Abstract
Gram-negative bacilli can spread from the environment and through food products. This study aimed to characterize ESBL production and virulence genes from multidrug-resistant Gram-negative bacilli isolated from specimen collected from the environment, kitchen, and food products. A total of 130 samples were collected at local markets in seven different communities in Benin (Abomey-Calavi, Ouidah, Bohicon, Abomey, Parakou, Djougou, and Grand-Popo). Samples were cultured on McConkey and ChromID™ ESBL agar plates. The isolates were identified by the API 20E gallery. An antibiotic susceptibility test was carried out, and the detection of ESBL production and virulence-associated genes was carried out by Polymerase Chain Reaction (PCR). The data collected was coded and analyzed using GraphPad prism 7 software and Excel. The software R was used to calculate the correlation coefficient between the results of the detection of ESBL+ on agar and by the effect of the double synergy. The results showed that sixty-three (63) bacterial strains were isolated from the 130 samples, of which the dominant species was Chryseomonas luteola (10/63). The kitchen samples were the most contaminated with 36.50%. More than 40% of the isolates were resistant to at least three different classes of antibiotics. Also, blaSHV gene was detected in 33.33% (21/63) of the isolates and in all isolates of Pseudomonas aeruginosa (5/5%). 11.11% (7/63) of isolates were virulent with dominance of the fimH gene, especially with Escherichia coli (83.33%). The kitchen samples showed a high prevalence of ESBL-producing strains with fimH gene. This raises the problem of non-compliance with hygiene rules in community cooking and food handling.
1. Introduction
Antimicrobial resistance has become a major threat to global public health in the 21st century [1]. It is estimated that, by 2050, 10 million deaths per year and up to $100 trillion of global economic loss will occur if the problem of antimicrobial resistance is not immediately resolved [2]. In recent years, in the Enterobacteriaceae family in particular, there has been increasing evidence of a high prevalence of multiresistant Gram-negative bacteria. The use of antibiotics in human medicine, veterinary medicine, and agriculture has been the main selective pressure for the emergence of drug-resistant bacteria [3].
The emergence and rapid spread of extended spectrum β-lactamase- (ESBL-) producing bacteria poses a threat to the population, not only in developing countries, but also in developed countries, as ESBLs may degrade not only penicillin, but also other classes of β-lactams. In addition, most ESBL-producing bacteria are multiresistant [4]. The increased presence of Enterobacteriaceae producing ESBL in non-clinical environments such as food, animal husbandry, and agriculture and in different aquatic environments has been shown in several studies [5–7]. In addition, multiresistant enterobacteria have been isolated from healthy individuals [8], suggesting that the community may serve as a reservoir. It is known that the intestinal tract is an excellent reservoir for these bacteria and that colonized people may be infected later. In fact, the presence of Escherichia coli producing CTX-M has been reported in healthy children [9], which shows the potential risk of spreading β-lactamase-mediated resistance.
The dissemination of β-lactamase-encoding genes in different geographical regions may partly be due to the fact that many resistance genes are carried on self-transmissible or mobile plasmids capable of spreading horizontally between and within species [3]. During gene transfer, resistance mechanism to other classes of antibiotics can easily be combined [10]. There are different types of β-lactamase enzymes present in bacteria inhabiting diverse environments and exposed to different selection pressures [11]. The virulence factors of Enterobacteria have an important role in the development of infections [12]. The molecular characteristics and functions of these virulence factors have been determined [13]. The most likely theory is that strains of pathogenic enterobacteria evolved primarily from non-pathogenic strains by acquiring virulence genes (by horizontal transfer of plasmid, bacteriophage, transposon, and pathogenicity located at chromosomal loci), which provides increased adaptive capacity to new niches and allows pathogens to increase their ability to cause wide range of infections [14, 15]. Moreover, evolution of virulence and resistance occurred at different time points. Virulence has evolved over millions of years, but resistance is a new phenomenon that has occurred over the past few decades (after introduction of antibiotics). As aquatic bacterial genetic reactors, aquatic environments promote the transmission of resistance genes virulence, and virulence-related characteristics among bacterial strains [16].
In Benin, several studies have reported the increasing evolution of the prevalence of broad-spectrum β-lactamase-producing enterobacteria in clinical infections [17–19]. But few studies have reported broad-spectrum β-lactamase-producing bacteria isolated simultaneously from external environment, kitchen environment, and food products. The current study is aimed at providing scientific knowledge regarding the spread of broad-spectrum β-lactamase-producing enterobacteria in different environments in Benin, and also at characterizing the resistance genes and determining their virulence factors. Such data will be used to better understand clinically observed antibiotic resistance. The study will also serve as a basis for recommendations to combat antibiotic resistance.
2. Material and Methods
2.1. Zone and Period of Study
The study was carried out mainly in the South of Benin, and in some towns in Northern Benin.2. In Southern Benin, the average annual temperature is 28°C and the humidity varies between 69 and 97% [19]. The phytogeographic districts covered by this study are Coastal, Pobè, Ouémé valley, Plateau, Zou, Borgou, and Donga. The study was done in December 2020. The samples were collected from community kitchen environment (cloth, sink, sponge, soap, and bench), external environments (sediment/mud, sewage, feces of animal's cattle, pig, and chicken), and foods products (crabs, fresh shrimps, dried fishes, fermented fishes, tomatoes, and leafy vegetable) (Figure 1).
Figure 1.
Location map of collection's areas.
2.2. Collection of Samples
Sampling was done randomly, depending on sample availability. Thirty (30) samples from the community kitchen environment were collected by swabbing. Thirty (30) sediments/mud, nine (9) animal feces, and forty-two (42) food products were collected in sterile stomach bags. Nineteen (19) sewage samples were collected in sterile one-liter bottles. A total of 130 samples were collected from the local markets of Dantokpa, Grand-Popo, Abomey-Calavi, the University of Abomey-Calavi, Bohicon, Abomey, Parakou, and Djougou (Table 1).
Table 1.
Distribution of samples according to their nature and origin.
| Sample origin | Type of sample | Location | Positive samples |
|---|---|---|---|
| Community kitchens | Cloth | Abomey-Calavi | 6 |
| Sink | Abomey-Calavi | 12 | |
| Bench | Abomey-Calavi | 3 | |
| Sponge | Abomey-Calavi | 6 | |
| Soap | Abomey-Calavi | 3 | |
|
| |||
| Sediments/muds | Sediment of waste water (from Kpahou's farm) | Ouidah | 3 |
| Gutter sediment | Abomey-Calavi street | 6 | |
| Lake sediment | Abomey-Calavi market | 6 | |
| Mud | Grand-Popo market | 3 | |
| Sediment of little beach | Grand-Popo | 6 | |
| Sinangourou bridge waste water's sediment | Sinangourou, Parakou | 1 | |
| Sewage sediment from the Sabari drainage canal | Sabari, Djougou | 2 | |
| Drainage canal crossing Abomey | Goho, Abomey | 1 | |
| Drainage canal crossing Bohicon | Bohicon | 1 | |
| Drainage canal crossing Tindji | Tindji | 1 | |
|
| |||
| Sewage | Water from River | Grand-Popo | 3 |
| Sewage from market | Abomey-Calavi | 3 | |
| Sewage from market | Dantokpa (Cotonou) | 3 | |
| Sewage from market | Grand-Popo | 3 | |
| Sewage from University of Abomey-Calavi | Abomey-Calavi | 3 | |
| Sinangourou bridge's waste water | Parakou, Sinangourou | 1 | |
| Waste water drainage system crossing Djougou | Sabari, Djougou | 2 | |
|
| |||
| Feces of animals | Feces of cattle from market | Grand-Popo | 3 |
| Feces of pig from market | Grand-Popo | 3 | |
| Feces of chicken from market | Grand-Popo | 3 | |
|
| |||
| Foods | Crabs from market | Grand-Popo | 3 |
| Leafy vegetable from market | Grand-Popo | 3 | |
| Fresh shrimp from market | Grand-Popo | 3 | |
| Dried fishes from market | Grand-Popo | 3 | |
| Fresh tomatoes from market | Grand-Popo | 3 | |
| Fresh shrimp from market | Dantokpa (Cotonou) | 3 | |
| Dried fishes from market | Dantokpa (Cotonou) | 3 | |
| Fermented fishes from market | Dantokpa (Cotonou) | 3 | |
| Fresh tomatoes from market | Dantokpa (Cotonou) | 3 | |
| Fresh tomatoes from market | Djougou | 4 | |
| Dried fishes from market | Abomey | 3 | |
| Leafy vegetable from market | Parakou | 4 | |
| Soja cheese | Bohicon | 5 | |
|
| |||
| Total | 130 | ||
2.3. Bacteriological Analysis
2.3.1. Seeding
Sewage Samples. After homogenization, 1 ml of each sample was taken and added to 9 ml of sterile distilled water contained in a screw tube for the preparation of 10−1 dilution. Successive decimal dilutions were made up to 10−3and 100 μl of each dilution was then inoculated on McConkey and ChromID™ ESBL solid media (Biomerieux, France).
Solid Samples. Previously, all food samples were ground in a sterile mortar. 9 ml of sterile distilled water was added to 1 g of each solid sample (sediment/sludge, animal feces, and crushed food item) contained in a screw tube (stock solution). After homogenization through a vortex, 1 ml of the stock solution (10−1 dilution) was added again to 9 ml of distilled water (10−2 dilution). Successive decimal dilutions were made up to 10−4. The last three dilutions (10−2, 10−3, and 10−4) were then seeded on McConkey solid media and ChromID™ ESBL (Biomerieux, France).
Community Kitchen Samples. Each community kitchen sample swab was cultured on McConkey and ChromID™ ESBL solid media by streaking with sterile loop (Biomerieux, France).
2.4. Incubation
All previously prepared McConkey and ChromID™ ESBL agars (Biomerieux, France) were incubated at 37°C for 24 h.
2.5. Biochemical Identification
After 24 h incubation, Gram staining was performed on all characteristic colonies on McConkey. Each selected characteristic colony (Gram-negative bacillus) was removed and seeded on Mueller-Hinton solid medium (MH). The MH agar plates were then incubated at 37°C for 24 h. Gram controls, oxidase test, and the identification by the gallery API20E tests were made after.
2.6. Susceptibility of Strains to Antibiotics
An antibiogram was performed for each bacterial sample isolated by method of disk diffusion using Mueller-Hinton agar II medium in accordance with the recommendations of the Antibiogram Committee of the French Society of Microbiology [20]. The antibiotics tested against the isolates were amoxicillin (AMX) (25 μg), gentamicin (GEN) (10 μg), ceftriaxone (CRO) (30 μg), cefotaxime (CTX) (30 μg), ertapenem (ETP) (10 μg), imipenem (IPM) (10 μg), ciprofloxacin (CIP) (5 μg), amoxicillin + clavulanic acid (AMC) (30 μg), and aztreonam (ATM) (30 μg). They were acquired from Sigma Aldrich.
The reference strain (E. coli ATCC 25923) and the strains to be tested were previously subcultured on the MH agar and incubated for 24 h at 37°C in order to provide young colonies. For each strain inoculum correspondent standard McFarland 0.5 was prepared. Using a sterile swab, the inoculum obtained was cultured by swabbing on dried MH II medium. The spreading was rotated three times in order to obtain a homogeneous distribution of the inoculum. The pre-impregnated antibiotic discs were then gently deposited on the surface of the agar with a disc dispenser. The agar plates were incubated for 24 h at 37°C.
A double disc diffusion method was used for the phenotypic confirmation of ESBL production according to the guidelines described by the Clinical Laboratory Standards Institute [21]. Klebsiella pneumonia (ATCC 700603) was used as the standard strain.
2.7. Molecular Detection of Virulence-Associated and ESBL Genes
The DNA of all isolates was extracted using the Qiagen red extraction kit. The isolates were tested for different virulent genes using standard PCR with six sets of specific primer pairs (Table 2). The reaction mixture consisted of 9.5 μL of water without DNA, 12.5 μL of the 2XPCR Master Mix reagent, 0.5 μL of each primer pair, and 2 μL of bacterial DNA.
Table 2.
Primers of virulence genes and desired ESBL genes in the genome of isolates.
| Genes | Primer | Sequence (5'-3') | Amplicon size (bp) | Reference (s) |
|---|---|---|---|---|
| Virulence | ||||
| PapC | F | GACGGCTGTACTGCAGGGTGGCG | 328 | [3] |
| R | ATATCCTTTCTGCAGGGATGCAATA | |||
| fimH | F | TACTGCTGATGGGCTGGTC | 640 | |
| R | GCCGGAGAGGTAATACCCC | |||
| iss | F | GGCAATGCTTATTACAGGATGTGC | 260 | |
| R | GAGCAATATACCCGGGCTTCC | |||
| Biofilm | F | GATTCAATTTTGGCGATTCCTGC | 225 | |
| R | TAATGAAGTCATTCAGACTCATCC | |||
| Stx1 | F | CGCTGAATGTCATTCGCTCTGC | 302 | |
| R | CGTGGTATAGCTACTGTCACC | |||
| Stx2 | F | CCTCGGTATCCTATTCCCGG | 516 | |
| R | CTGCTGTGACAGTGACAAAACGC | |||
|
| ||||
| ESBL | ||||
| blaCTX-M1 | F | GGTTAAAAAATCACTGCGTC | 863 | [4] |
| R | TTGGTGACGATTTTAGCCGC | |||
| blaCTX-M2 | F | ATGATGACTCAGAGCATTCG | 865 | |
| R | TGGGTTACGATTTTCGCCGC | |||
| blaCTX-M9 | F | ATGGTGACAAAGAGAGTGCA | 869 | |
| R | CCCTTCGGCGATGATTCTC | |||
| blaCTX-M15 | F | CACACGTGGAATTTAGGGACT | 995 | |
| R | GCCGTCTAAGGCGATAAACA | |||
| blaTEM | F | ATGAGTATTCAACATTTCCGC | 856 | |
| R | CAATGCTTAATCAGTGAGG | |||
| blaSHV | F | AAGATCCACTATCGCCAGCAG | 230 | |
| R | ATTCAGTTCCGTTTCCCAGCGG | |||
The virulence genes that were targeted for amplification by PCR were iss, fimH, Stx-1, Stx-2, biofilm, and PapC, whereas the ESBL genes targeted for amplification were blaTEM, blaSHV, blaCTX-M1, blaCTX-M2, blaCTX-M9, and blaCTX-M15.
The amplification of blaTEM, blaSHV, blaCTX-M1, blaCTX-M2, blaCTX-M9, and blaCTX-M15 genes was carried out using the method described in [22, 23]. The amplification of fimH and iss genes was performed using the method described in [24]. Regarding PapC gene, its amplification was also carried out using the method previously described in [25]. The amplification conditions of the other genes (Stx-1, Stx-2, and Biofilm) involved initial denaturation at 94°C for 30 sec, followed by 30 cycles at 94°C for 30 secs of denaturation at 68°C for 1 min of hybridization, at 68°C elongation for 1 min. Final extension was carried out at 68°C for 5 min and maintained at 4°C. Amplification products were separated by 2% agarose gel electrophoresis with 5 μg/ml red gel and a 100 bp DNA ladder as a molecular weight marker. The migration was carried out at a scale of 90 V/cm for 20 min. Amplification bands were visualized and photographed under ultraviolet light (UV).
2.8. Statistical Analyses
The data collected was coded and analyzed using GraphPad prism 7 software. Phenotypic identification methods were performed independently in triplicate. The software R was used to calculate the correlation coefficient between the results of the detection of ESBL + on agar and by the effect of the double synergy.
3. Results
3.1. Culture on McConkey Agar
Of the 130 samples analyzed, we were able to isolate 63 bacterial strains, all Gram-negative bacilli. The kitchen environment samples contained 36.50% (23/63) of the isolated bacterial strains, followed by external environmental samples (33.33%) (21/63) whereas the samples from food products were 30.15% (19/63).
3.2. Culture on ChromID™ ESBL Agar
Samples were cultured on both McConkey Agar and ChromID™ ESBL Agar. The latter provided us with preliminary data on strains that produce β-lactamase. Of the 130 samples analyzed, 21 β-lactamase-producing strains were isolated. Furthermore, 47.61% β-lactamase-producing strains were isolated from community kitchen samples, 42.85% from external environmental samples, and 9.52% from food products.
3.3. Identification of Isolates
After isolation, a total of 63 strains were identified and there were about 21 bacterial species. As shown in Figure 2, there is a dominance of Chryseomonas luteola (10/63), followed by Pseudomonas oryzihabitans (6/63), Enterobacter cloacae (6/63), and E. coli (6/63).
Figure 2.
Distribution of isolated bacterial species.
3.4. Antimicrobial Susceptibility
Table 3 shows the details of the antibiotic resistance profile of the identified strains. Of the 63 isolates, 59 (93.65%) were resistant to Amoxicillin and 54 (85.71%) to Cefotaxime, with relatively low resistance to Imipenem (16) (25.39%), Gentamicin (9) (14.28%), and Ciprofloxacin (5) (7.93%). The multidrug resistance analysis of the strains showed that there were 27.57% isolates that were resistant to at least 5 antibiotics, 19.95% isolates resistant to 4 antibiotics, and 16.81% isolates resistant to 3 antibiotics. We noted that there are two isolates, P. aeruginosa and P. fluorescens, that were resistant to all 9 antibiotics tested.
Table 3.
Antimicrobial susceptibility profiles of isolates.
| Antibiotics | % of resistance |
|---|---|
| Ceftriaxone (CRO) | 52.38 |
| Cefotaxime (CTX) | 85.71 |
| Amoxicillin (AMX) | 93.65 |
| Gentamicin (GEN) | 14.28 |
| Ciprofloxacin (CIP) | 7.93 |
| Imipenem (IPM) | 25.39 |
| Ertapenem (ETP) | 61.90 |
| Amoxicillin + clavulanic acid (AMC) | 57.14 |
| Aztreonam (ATM) | 44.44 |
3.5. PCR Detection of Virulence-Associated Genes of Isolates
Six genes (iss, fimH, stx1, stx2, biofilm, and PapC) of virulence were investigated in the genome of the 63 identified isolates. Only the fimH gene was detected as indicated in Table 4. Figure 3(a) shows the agarose gel of fimH after PCR.
Table 4.
Distribution of virulence-associated genes in different isolates.
| Isolates | No. | No. (%) of virulence-associated genes | |||||
|---|---|---|---|---|---|---|---|
| Iss | fimH | Biofilm | PapC | stx1 | stx2 | ||
| Acinetobacter baumanii | 4 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pseudomonas horyzihabitans | 6 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pseudomonas aeruginosa | 5 | 0 | 1 (20) | 0 | 0 | 0 | 0 |
| Pseudomonas fluorescens | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Klebsiella pneumonia | 4 | 0 | 0 | 0 | 0 | 0 | 0 |
| Klebsiella terrigena | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Klebsiella ornithynolitica | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Serratia marcescens | 2 | 0 | 0 | 0 | 0 | 0 | 0 |
| Serratia liquefasciens | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Chryseomoas luteola | 10 | 0 | 0 | 0 | 0 | 0 | 0 |
| Enterobacter aerogenes | 3 | 0 | 1 (33.33) | 0 | 0 | 0 | 0 |
| Enterobacter cloacae | 6 | 0 | 0 | 0 | 0 | 0 | 0 |
| Stenotrophomonas maltophilia | 2 | 0 | 0 | 0 | 0 | 0 | 0 |
| Escherichia coli | 6 | 0 | 5 (83.33) | 0 | 0 | 0 | 0 |
| Shigella spp | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pantoea spp | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Burkholderia cepacian | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Klebsiella Spp | 4 | 0 | 0 | 0 | 0 | 0 | 0 |
| Citrobacter freundii | 2 | 0 | 0 | 0 | 0 | 0 | 0 |
| Citrobacter diversus | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Enterobacter gergoviae | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Total | 63 | 0 | 7 (11.11) | 0 | 0 | 0 | 0 |
Figure 3.
(a) Agarose gel of fimH gene (640 bp) after PCR. (b) Agarose gel of blaSHV gene (230 bp) after PCR.
3.6. PCR Detection of ESBL Genes of Isolates
Of six ESBL genes (blaTEM, blaSHV, blaCTX-M1, blaCTX-M2, blaCTX-M9, and blaCTX-M15), only the BlaSHV gene was found in the genome of 21 isolates. These isolates comprised Pseudomonas aeruginosa (100%) (5/5), followed by Pseudomonas fluorescens (100%) (1/1) and K. pneumoniae (75%) (3/4). All the strains isolated on ChromID™ ESBL agar and whose double synergy was observed during antibiotic susceptibility tests were also positive for the detection of the blaSHV gene (r = 1, P < 0.001). Figure 3 shows the agarose gel of blaSHV after PCR (Table 5).
Table 5.
Distribution of ESBL genes in different isolates.
| Isolates | ESBL genes (%) | ||||||
|---|---|---|---|---|---|---|---|
| No | BlaTEM | BlaSHV | BlaCTX-M1 | BlaCTX-M2 | BlaCTX-M9 | BlaCTX-M15 | |
| Acinetobacter baumanii | 4 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pseudomonas horyzihabitans | 6 | 0 | 0 | 0 | 0 | 0 | 0 |
| Pseudomonas aeruginosa | 5 | 0 | 5 (100) | 0 | 0 | 0 | 0 |
| Pseudomonas fluorescens | 1 | 0 | 1 (100) | 0 | 0 | 0 | 0 |
| Klebsiella pneumonia | 4 | 0 | 3 (75) | 0 | 0 | 0 | 0 |
| Klebsiella terrigena | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Klebsiella ornithynolitica | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Serratia marcescens | 2 | 0 | 1 (50) | 0 | 0 | 0 | 0 |
| Serratia liquefasciens | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Chryseomoas luteola | 10 | 0 | 0 | 0 | 0 | 0 | 0 |
| Enterobacter aerogenes | 3 | 0 | 3 (100) | 0 | 0 | 0 | 0 |
| Enterobacter cloacae | 6 | 0 | 3 (50) | 0 | 0 | 0 | 0 |
| Stenotrophomonas maltophilia | 2 | 0 | 1 (50) | 0 | 0 | 0 | 0 |
| Escherichia coli | 6 | 0 | 2 (33.33) | 0 | 0 | 0 | 0 |
| Shigella spp | 1 | 0 | 1 (100) | 0 | 0 | 0 | 0 |
| Pantoea spp | 1 | 0 | 1 (100) | 0 | 0 | 0 | 0 |
| Burkholderia cepacian | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Klebsiella Spp | 4 | 0 | 0 | 0 | 0 | 0 | 0 |
| Citrobacter freundii | 2 | 0 | 0 | 0 | 0 | 0 | 0 |
| Citrobacter diversus | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Enterobacter gergoviae | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Total | 63 | 0 | 21 (33.33) | 0 | 0 | 0 | 0 |
4. Discussion
4.1. Prevalence of Pathogens in the Samples
Of the 130 samples analyzed, we were able to isolate 63 bacterial strains, all Gram-negative bacilli. The kitchen environment samples contained 36.50% (23/63) of the isolated bacterial strains, followed by external environmental samples (33.33%) (21/63), whereas the samples from food products were 30.15% (19/63). In addition, 47.61% of the bacteria isolated from cooking samples are ESBL producers. These results show that there is a high risk of contamination of food products in these kitchen environments if the appropriate practice of hygiene is not maintained. A report from a study on ESBL-producing Enterobacteriaceae isolated from food prepared in the kitchen of a hospital center [26] showed that 8.04% of foods from the hospital kitchen were contaminated with ESBL-producing strains. This low prevalence reflects the minimum respect of hygiene rules in the kitchen of the hospital. Thus, the risk of contamination was lower in this environment, but this should not be extrapolated to the community kitchen environment, where safety standards are probably less rigorously respected [27].
Of 48 external environmental samples (wastewater and sediment), 42.85%% of the strains produced ESBL. This proportion is relatively lower than that obtained by [28], where 52.69% of the ESBL-producing Enterobacteriaceae were reported. However, these results are relatively high than those obtained by [29], where 15.47% of the ESBL-producing bacteria were noted. These different results show that there is a real problem of environmental contamination in Benin. Several studies have been conducted on the isolation of ESBL-producing E. coli from rivers. The human and animal ESBL-producing E. coli in various river waters may be related to the nature of their watersheds, the intensity of antibiotic use, and the relative degree of fecal contamination by humans and animals. Clonal groups similar to those found in human infections have also been isolated from contaminated rivers adjacent to large cities [30, 31].
The prevalence of ESBL-producing bacteria was 13.75% from fecal animal samples. Also, this same proportion was obtained in piglet feces in India [32]. These results reflect the risk of contamination of slaughter meat and food products of animal origin. Of the 43 food samples, there is a prevalence of 9.52% of ESBL-producing bacterial strains. This result is relatively small compared to the 20.75% of Gram-negative Bacillus (GNB) ESBL producers obtained by [33] from hospital samples in Benin.
4.2. Antimicrobial Resistance
In this study, 63 bacterial strains from 21 species were isolated. The most identified bacterial species is C. luteola (10/63). Antibiotic susceptibility analysis showed high resistance of bacterial isolates to penicillin, cephalosporins, and aztreonam. This high resistance of the isolates coincides with the results obtained by [28] that was conducted on environmental samples and food in Spain. In addition, it was noted that the isolates showed significant resistance to β-lactamase inhibitors such as amoxicillin + clavulanic acid (70.39%). These results coincide with those from [34], where resistance of strains to beta-lactamase inhibitors is noted. This suggests that there is an increasing need to encourage the use of alternative beta-lactamase inhibitors. For the multidrug resistance analysis of bacterial isolates, 10 (16.81%) of the isolates were resistant to at least three different families of antibiotics. These results further emphasize the problem of multidrug-resistant bacteria in the environment which may threaten both human and animal health. The resistance of a high proportion of bacterial strains to carbapenems (Imipenem (IPM): 25.39%; Ertapenem (ETP): 61.90%) is a serious public health problem, as these antibiotics are the most effective of the beta-lactams against Gram-positive and Gram-negative bacteria, with a broad spectrum of activity [35].
4.3. ESBL and Virulence-Associated Genes Detection
Phenotypic detection of bacterial ESBL-producing strains was carried out by the double synergy technique. Only 21/63 of isolates were ESBL-producing; a correlation (r = 1) was noted between the two phenotypic detection techniques of ESBL-producing isolates. This involves the culture of samples on ChromID™ ESBL agar and the search for the double synergistic effect during the antibiotic susceptibility test. The presence of the blaSHV gene in the genome of 33.33% of isolates confirms this correlation. P. aeruginosa (100%) was the most predominant among these strains with ESBL genes. However, among the ESBL genes sought, only the blaSHV gene was found in the ESBL-positive isolates. The blaSHV carrying organisms have also been detected in a variety of environmental and food samples [36]. Despite the high cefotaxime resistance observed, the bacterial strains were negative to blaCTX-M, suggesting that other genes may be involved in the resistance mechanism.
The search for virulence genes also showed the presence of a single virulence gene in the isolates; the fimH gene, also known as the fimbriae adhesion gene type 1 (fimH), recorded the prevalence of 11.11% in this study. E. coli (83.33%) was the most predominant bacterial among this group. It is believed that fimH contributes to the protection of E. coli from heterophilous hosts [37]. Its role in the virulence of Avian Pathogenic E. coli strains remains controversial and is the subject of conflicting reports [38]. Other studies found higher occurrences of the fimH gene, particularly those from [39], which found a prevalence of 98.1% among 524 Avian Pathogenic E. coli isolates.∗
5. Conclusion
This study allowed us to characterize the multidrug resistance, virulence, and ESBL production of bacterial strains isolated from the external environment, food products, and community kitchen samples. Only 33.33% of the isolates were ESBL-positive and 11.11% harboured the virulence fimH gene. Only the blaSHV gene was present in the genome of isolated strains. The community kitchen samples showed a high prevalence of ESBL-producing bacteria and fimH gene. This raises the problem of non-compliance with hygiene rules in community kitchen.
6. Limitations
This study presents some limitations. We did not identify exact blaSHV alleles due to PCR limitation. Secondly, we could not confirm carbapenem resistance genotypically. In addition, we could not detect other β-lactamase genes and virulence factors that may be present. Future studies including whole genome sequencing could help to address these limitations.
Acknowledgments
The authors are grateful to Dr Kaisa HAUKKA (Department of Microbiology, University of Helsinki) who reviewed this manuscript. They also thank the Minister of the Living Environment and Sustainable Development in Benin, his Excellency his Excellency M. José TONATO and all his staff. They are also grateful to the Cordinator of The Regional Disease Surveillance Systems Enhancement (REDISSE) Project in West Africa, Madam Fidélia SESSOU HINSON and her staff in Benin for the support.
Data Availability
All data generated or analyzed during this study are included in this published article.
Disclosure
The kitchen samples were collected after gaining the informed consent of the head of the household.
Conflicts of Interest
The authors declare that they have no conflicts of interest.
Authors' Contributions
Victorien Dougnon, Vincentia Marie Camille Houssou, Jerrold Agbankpe, Birikissou Bouraima, Esther Deguenon, Eugénie Anago, Martin Pépin Aïna, and Lamine Baba-Moussa wrote the protocol. Victorien Dougnon, Vincentia Marie Camille Houssou, Chimène Nanoukon, Jibril Mohammed, Birikissou Bouraima, Esther Deguenon, Martin Pépin Aïna, Kafayath Fabiyi, Marie Hidjo, Hornel Koudokpon, and Fidélia Djegui processed the samples. Victorien Dougnon and Jerrold Agbankpe did the statistical analyses. Victorien Dougnon, Vincentia Marie Camille Houssou, Jerrold Agbankpe, Chimène Nanoukon and Jibril Mohammed wrote the draft of the manuscript. Victorien Dougnon, Jerrold Agbankpe, and Lamine Baba-Moussa reviewed the manuscript. All authors read and approved the final version of the manuscript.
References
- 1.World Health Organization. Antimicrobial Resistance: Global Report on Surveillance. Geneva, Switzerland: World Health Organization; 2019. http://www.who.int/drugresistance/documents/surveillancereport/en/ [Google Scholar]
- 2.O’Neill J. Tackling drug-resistant infections globally: final report and recommendations. 2019. http://amr-review.org/sites/default/files/160518_Final%20paper_with%20cover.pdf.
- 3.De Oliveira D. V., Van Der Sand S. T. Phenotypic tests for the detection of β-lactamase-producing enterobacteriaceae isolated from different environments. Current Microbiology. 2016;73(1):132–138. doi: 10.1007/s00284-016-1036-6. [DOI] [PubMed] [Google Scholar]
- 4.Yamasaki S., Le T. D., Vien M. Q., Van Dang C., Yamamoto Y. Prevalence of extended-spectrum β-lactamase-producing Escherichia coli and residual antimicrobials in the environment in Vietnam. Animal Health Research Reviews. 2018;18(2):128–135. doi: 10.1017/s1466252317000160. [DOI] [PubMed] [Google Scholar]
- 5.Benjamin L., Atwill E. R., Jay-Russell M., et al. Occurrence of generic Escherichia coli, E. coli O157 and Salmonella spp. in water and sediment from leafy green produce farms and streams on the Central California Coast. International Journal of Food Microbiology. 2013;165(1):65–76. doi: 10.1016/j.ijfoodmicro.2013.04.003. [DOI] [PubMed] [Google Scholar]
- 6.Ojer-Usoz E., González D., Vitas A. I., et al. Prevalence of extended-spectrum β-lactamase-producing enterobacteriaceae in meat products sold in Navarra, Spain. Meat Science. 2013;93(2):316–321. doi: 10.1016/j.meatsci.2012.09.009. [DOI] [PubMed] [Google Scholar]
- 7.Kürekci C., Aydin M., Yipel M., Katouli M., Gündoğdu A. Characterization of extended spectrum β-lactamase (ESBL)-producing Escherichia coli in Asi (Orontes) River in Turkey. Journal of Water and Health. 2017;15(5):788–798. doi: 10.2166/wh.2017.257. [DOI] [PubMed] [Google Scholar]
- 8.Ruppé E., Armand-Lefèvre L., Estellat C., et al. High rate of acquisition but short duration of carriage of multidrug-resistant enterobacteriaceae after travel to the tropics. Clinical Infectious Diseases. 2015;61(4):593–600. doi: 10.1093/cid/civ333. [DOI] [PubMed] [Google Scholar]
- 9.Fernández-Reyes M., Vicente D., Gomariz M., et al. High Rate of fecal carriage of extended-spectrum-β-lactamase-producing Escherichia coli in healthy children in Gipuzkoa, Northern Spain. Antimicrobial Agents and Chemotherapy. 2014;58(3):1822–1824. doi: 10.1128/aac.01503-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Al-Mayahie S. M. G. Phenotypic and genotypic comparison of ESBL production by vaginal Escherichia coli isolates from pregnant and non-pregnant women. Annals of Clinical Microbiology and Antimicrobials. 2013;12:1–7. doi: 10.1186/1476-0711-12-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Bush K., Fisher J. F. Epidemiological expansion, structural studies, and clinical challenges of new β-lactamases from gram-negative bacteria. Annual Review of Microbiology. 2011;65(1):455–478. doi: 10.1146/annurev-micro-090110-102911. [DOI] [PubMed] [Google Scholar]
- 12.Hojati Z., Zamanzad B., Hashemzadeh M., Molaie R., Gholipour A. The fimH gene in uropathogenic Escherichia coli strains isolated from patients with urinary tract infection. Jundishapur Journal of Microbiology. 2015;8:1–4. doi: 10.5812/jjm.17520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Dehbanipour R., Rastaghi S., Sedighi M., Maleki N., Faghri J. High prevalence of multidrug-resistance uropathogenic Escherichia coli strains, Isfahan, Iran. Journal of Natural Science, Biology, and Medicine. 2016;7(1):22–26. doi: 10.4103/0976-9668.175020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jalali H. R., Pourbakhsh A., Fallah F., Eslami G. Genotyping of virulence factors of uropathogenic Escherichia coli by PCR. Novelty in Biomedicine. 2015;3(4):177–181. doi: 10.22037/nbm.v3i4.8036. [DOI] [Google Scholar]
- 15.Ghazvini H., Taheri K., Edalati E., Sedighi M., Mirkalantari S. Virulence factors and antimicrobial resistance in uropathogenic Escherichia coli strains isolated from cystitis and pyelonephritis. Turkish Journal of Medical Sciences. 2019;49:361–367. doi: 10.3906/sag-1805-100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Singhal N., Kumar M., Virdi J. S. Molecular analysis of β-lactamase genes to understand their differential expression in strains of Yersinia enterocolitica biotype 1A. Scientific Reports. 2014;4:p. 5270. doi: 10.1038/srep05270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Anago E., Ayi-Fanou L., Akpovi C. D., et al. Antibiotic resistance and genotype of beta-lactamase producing Escherichia coli in nosocomial infections in Cotonou, Benin. Annals of Clinical Microbiology and Antimicrobials. 2015;14:p. 5. doi: 10.1186/s12941-014-0061-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Affolabi D., Sogbo F., Laleye G., et al. Rapid detection of extended spectrum-β-lactamase-producing enterobacteriaceae in blood cultures using the ESBL NDP test in Cotonou, Benin. Journal of Medical Microbiology. 2017;66:884–887. doi: 10.1099/jmm.0.000509. [DOI] [PubMed] [Google Scholar]
- 19.Dougnon T. V., Déguénon E., Fah L., et al. Traditional treatment of human and animal salmonelloses in Southern Benin: knowledge of farmers and traditherapists. Veterinary World. 2017;10(6):580–592. doi: 10.14202/vetworld.2017.580-592. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.2018. Antibiogram Commitee of the French Society of Microbiology, 2018 Recommendations, 2018.
- 21.Clinical and Laboratory Standards Institute (CLSI) Performance Standards for Antimicrobial Susceptibility Testing. 25th informational Supplement. Wayne, PA, USA: CLSI; 2015. [Google Scholar]
- 22.Ahmed A. M., Motoi Y., Sato M., et al. Zoo animals as reservoirs of gram-negative bacteria harboring integrons and antimicrobial resistance genes. Applied and Environmental Microbiology. 2007;73:6686–6690. doi: 10.1128/aem.01054-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Oliveira M., Dias F. R., Pomba C. Biofilm and fluoroquinolone resistance of canine Escherichia coli uropathogenic isolates. BMC Research Notes. 2014;7:p. 499. doi: 10.1186/1756-0500-7-499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Krizman M., Avgustin J. A., Zdovc I., et al. Antimicrobial resistance and molecular characterization of extended-spectrum β-lactamases and other Escherichia coli isolated from food of animal origin and human intestinal isolates. Journal of Food Protection. 2017;80(1):113–120. doi: 10.4315/0362-028x.jfp-16-214. [DOI] [PubMed] [Google Scholar]
- 25.Singhal N., Singh N. S., Maurya A. K., Virdi J. S. Virulence-associated traits and in vitro biofilm-forming ability of Escherichia coli isolated from a major river traversing Northern India. Environmental Science and Pollution Research. 2019;26:21304–21311. doi: 10.1007/s11356-019-05389-3. [DOI] [PubMed] [Google Scholar]
- 26.Stewardson A. J., Renzi G., Maury N., et al. Extended spectrum β-lactamase–producing enterobacteriaceae in hospital food: a risk assessment. Infection Control & Hospital Epidemiology. 2014;35(4):375–383. doi: 10.1086/675609. [DOI] [PubMed] [Google Scholar]
- 27.Redmond E. C., Griffith C. J. Consumer food handling in the home: a review of food safety studies. Journal of Food Protection. 2003;66:130–161. doi: 10.4315/0362-028x-66.1.130. [DOI] [PubMed] [Google Scholar]
- 28.Ojer-Usoz E., González D., Vitas A. I. Clonal diversity of ESBL-producing Escherichia coli isolated from environmental, human and food samples. International Journal of Environmental Research and Public Health. 2017;14(7):p. 676. doi: 10.3390/ijerph14070676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Hu Y. Y., Cai J. C., Zhou H. W., et al. Molecular typing of CTX-M-producing Escherichia coli isolates from environmental water, swine feces, specimens from healthy humans, and human patients. Applied and Environmental Microbiology. 2013;79:5988–5996. doi: 10.1128/aem.01740-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Colomer-Lluch M., Mora A., López C., et al. Detection of quinolone-resistant Escherichia coli isolates belonging to clonal groups O25b: H4-B2-ST131 and O25b: H4-D-ST69 in raw sewage and river water in Barcelona, Spain. Journal of Antimicrobial Chemotherapy. 2012;68:758–765. doi: 10.1093/jac/dks477. [DOI] [PubMed] [Google Scholar]
- 31.Zurfluh K., Hächler H., Nüesch-Inderbinen M., Stephan R. Characteristics of extended spectrum β-lactamase and carbapenemase producing enterobacteriaceae isolates from rivers and lakes in Switzerland. Applied and Environmental Microbiology. 2013;79:3021–3026. doi: 10.1128/aem.00054-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Nirupama K. R., Vinodh Kumar O. R., Pruthvishree B. S., et al. Molecular characterisation of blaOXA-48 carbapenemase-, extended-spectrum β-lactamase- and Shiga toxin-producing Escherichia coli isolated from farm piglets in India. Journal of Global Antimicrobial Resistance. 2018;13:201–205. doi: 10.1016/j.jgar.2018.01.007. [DOI] [PubMed] [Google Scholar]
- 33.Moussé W., Sina H., Mama-Sirou I. A., et al. Antibiotic resistance and production of extended spectrum β-lactamases by clinical gram-negative bacteria in Benin. Journal of Advances in Microbiology. 2019;18(2):1–13. doi: 10.9734/jamb/2019/v18i230158. [DOI] [Google Scholar]
- 34.González D., Gallagher E., Zúñiga T., Leiva J., Vitas A. I. Prevalence and characterization of β-lactamase-producing enterobacteriaceae in healthy human carriers. International Microbiology. 2019;23(2):171–177. doi: 10.1007/s10123-019-00087-z. [DOI] [PubMed] [Google Scholar]
- 35.Meletis G. Carbapenem resistance: overview of the problem and future perspectives. Therapeutic Advances in Infectious Disease. 2016;3:15–21. doi: 10.1177/2049936115621709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Singh A. S., Lekshmi M., Prakasan S., Nayak B. B., Kumar S. Multiple antibiotic-resistant, extended spectrum-β-lactamase (ESBL)-Producing enterobacteria in fresh seafood. Microorganisms. 2017;5:p. 53. doi: 10.3390/microorganisms5030053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Mellata M., Dho-Moulin M., Dozois C. M., et al. Role of virulence factors in resistance of avian pathogenic Escherichia coli to serum and inpathogenicity. Infection and Immunity. 2003;71:536–540. doi: 10.1128/iai.71.1.536-540.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Li G., Laturnus C., Ewers C., Wieler L. H. Identification of genes required foravian Escherichia coli septicemia by signature-tagged mutagenesis. Infection and Immunity. 2005;73(5):2818–2827. doi: 10.1128/iai.73.5.2818-2827.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Rodriguez-Siek K. E., Giddings C. W., Doetkott C., Johnson T. J., Fakhr M. K., Nolan L. K. Comparison of Escherichia coli isolates implicated in humanurinary tract infection andavian colibacillosis. Microbiology. 2005;151:2097–2110. doi: 10.1099/mic.0.27499-0. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this published article.