Abstract
The tedizolid MIC of 27 clinical isolates of linezolid-resistant staphylococci and enterococci was determined. Tedizolid MICs were ≥1 μg/mL and were 4- to 32-fold lower than those of linezolid. Linezolid resistance mechanisms included G2576T 23S rRNA gene and rplC and rplD mutations.
Keywords: Linezolid resistance, Tedizolid resistance, Vancomycin resistant, Multidrug resistant, Antimicrobial resistance
Oxazolidinones are synthetic antibacterial agents that prevent the formation of the N-formylmethionyl-tRNA–ribosome–mRNA ternary complex (Swaney et al., 1998). Linezolid was the first oxazolidinone approved by the US Food and Drug Administration (FDA). Linezolid-resistant clinical isolates have been reported; such isolates most commonly have mutations in domain V of the 23S rRNA gene and/or rplC and/or rplD (encoding ribosomal proteins L3 and L4, respectively) (Mendes et al., 2014). Staphylococcus aureus, Enterococcus faecium, and Staphylococcus epidermidis have multiple copies of the 23S rRNA gene, of which 1 or more may be mutated, conferring resistance in a gene dosage-dependent manner (Liakopoulos et al., 2009; Marshall et al., 2002; Wilson et al., 2003). In staphylococci, the plasmid-borne methyltransferase cfr can also confer resistance to linezolid (Locke et al., 2012).
Tedizolid is the second oxazolidinone approved by the FDA. In vitro, tedizolid is more active against staphylococci and enterococci than is linezolid (Livermore et al., 2009). Herein, we determined the MIC of tedizolid against clinical isolates of linezolid-resistant enterococci and staphylococci and characterized the mechanism of oxazolidinone resistance in these isolates.
Twenty-seven clinical isolates of linezolid-resistant Gram-positive cocci (21 E. faecium, 5 S. aureus, and 1 S. epidermidis) were studied. The following were obtained through BEI Resources, National Institute of Allergy and Infectious Diseases, National Institutes of Health (NIH) as part of the Human Microbiome Project: NRS127, NRS271, and NRS119. IDRL-9978 to IDRL-9989 were gifts from Dr Patricia Ferrieri from the University of Minnesota. The remainder of the isolates were from Mayo Clinic.
MIC values of linezolid, tedizolid, vancomycin, and penicillin and, for the staphylococcal isolates, oxacillin, were determined by broth microdilution following the Clinical and Laboratory Standards Institute (CLSI) guidelines (CLSI, 2014). CLSI breakpoints were used, except for tedizolid, for which FDA breakpoints were applied.
Linezolid resistance mechanisms were assessed by amplifying and sequencing the 23S rRNA gene and, for staphylococci, rplC and/or rplD. In addition, cfr was assessed by PCR. Primers used are shown in Table 1. DNA was extracted using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA). PCR was performed using Platinum PCR SuperMix (Life Technologies, Austin, TX, USA). cfr-positive strains (32289 and 56351), provided by Cubist-Merck Pharmaceuticals, were used as positive controls for cfr PCR. Dye terminator Sanger sequencing was performed, and sequences were analyzed using Sequencher 5.0 (Gene Codes Corporation, Ann Arbor, MI, USA). E. faecium 23S rRNA sequences were compared to GenBank AF432914.1 (Herrero et al., 2002). S. aureus and S. epidermidis 23S rRNA rplD, and rplC gene sequences were compared to NCTC 8325 (NC_007795.1) and ATCC 12228 (NC_004461), respectively.
Table 1.
Primers used and sources.
| Gene | Primer sequence |
|---|---|
| 23S rRNA gene (Prystowsky et al., 2001) | |
| 23S-2049F | GACGGAAAGACCCCATGG |
| 23S-2767R | ACACTTAGATGCTTT |
| cfr (Toh et al, 2007) | |
| cfr_toh_330_F | ATGAATTTTAATAATAAAACAAAG |
| cfr_toh_330_R | TACACCCAAAATTACATCCG |
| S. epidermidis rplC and rplD | |
| Se_rplC_rplD_F (Locke et al., 2009b) | ATGGGCTTAAACTTACCATCAGG |
| Se_rplC_rplD_Ra | TGCACGAGTATCTACATCGAAAG |
| S. aureus rplC and rplD | |
| Sa_rplC_rplD_F (Locke et al., 2009b | ATGGGCTTAAACTTACCATCTGG |
| Sa_rplC_rplD_Ra | TGTTAACACGAGTATCAACGTCG |
| 23S rRNA individual copies (Locke et al, 2009a) | |
| rRNA_1F | GCGGTGTTTGAGAGATTATTTA |
| rRNA_1R | GCTTCATGATATACGCTTCCTTT |
| rRNA_2F | CTGAATGACAATATGTCAACGTTAATTCC |
| rRNA_2R | GATACCGTCTTACTGCTCTTCTC |
| rRNA_3F | AGGCCGGCAATATGTAAG |
| rRNA_3R | GTCGTCAAACGGCACTAATA |
| rRNA_4F | TGTGGACGGTGCATCTGTAG |
| rRNA_4R | ATCACCCGCTCCATAGATAAT |
| rRNA_5F | GCCGATAGCrCTACCACTG |
| rRNA_5R | AGGTGCGATGGCAAAACA |
| rRNA_6F | GCGGTCGCCTCCTAAAAG |
| rRNA_6R | GGAATTAACGTTGACATATTGTCATTCAG |
Personal communication, Jeffrey Locke, Trius Therapeutics, a subsidiary of Cubist, San Diego, CA, USA.
S. aureus IDRL-10060 and S. aureus NRS119 were subjected to amplification of individual copies of the 23S rRNA gene using primers shown in Table 1. Each amplified 23S rRNA gene was digested with NheI (New England BioLabs, Ipswich, MA, USA) and visualized by 2% agarose electrophoresis stained with SYBR Safe DNA Gel Stain (Life Technologies). Digested products were compared to an in silico digestion of S. aureus NCTC 8325 (NC_007795) using ApE-A plasmid editor (M. Wayne Davis, personal communication). Since this strain has 5 23S rRNA copies, the sixth copy was amplified and sequenced from S. aureus ATCC 29213 using primers shown in Table 1.
Table 2 shows the in vitro activity of tedizolid against the linezolid-resistant isolates. S. aureus NRS127 had a tedizolid MIC of 1 μg/mL (intermediate); the other 4 S. aureus isolates had MICs of ≥2 μ/mL (resistant). There are no tedizolid breakpoints for S. epidermidis, but applying the S. aureus breakpoint, the S. epidermidis isolate studied would be considered tedizolid resistant. Similarly, although there are no tedizolid breakpoints for E. faecium, applying the E. faecalis susceptible breakpoint of ≤0.5 μg/mL, all E. faecium isolates studied would be considered tedizolid nonsusceptible. S. aureus linezolid MICs were 3–4 doubling dilutions higher than those of tedizolid; however, resistance breakpoints for S. aureus are 2 doubling dilutions higher from those of tedizolid. Overall, linezolid MICs were 2–5 doubling dilutions higher than those of tedizolid.
Table 2.
Antimicrobial susceptibility of 27 linezolid-resistant isolates and oxazolidinone resistance mechanisms.
| Strain | Source | Species | MIC (in μg/mL) |
23S rRNA C2576T | cfr | L3 mutations | L4 mutations | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Linezolid | Tedizolid | Vancomycin | Penicillin | Oxacillin | |||||||
| IDRL-6384 | Mayo Clinic | E. faecium | 32 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRI-6237 | Mayo Clinic | E. faecium | 32 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-7570 | Mayo Clinic | E. faecium | 8 | 1 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-9182 | Mayo Clinic | E. faecium | 32 | 1 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6478 | Mayo Clinic | E. faecium | 64 | 4 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6479 | Mayo Clinic | E. faecium | 16 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6459 | Mayo Clinic | E. faecium | 32 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-9978 | University of Minnesota | E. faecium | 32 | 1 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-9982 | University of Minnesota | E. faecium | 16 | 1 | 1 | >128 | ND | + | − | ND | ND |
| IDRL-9981 | University of Minnesota | E. faecium | 16 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-9983 | University of Minnesota | E. faecium | 16 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-9985 | University of Minnesota | E. faecium | 32 | 4 | 1 | >128 | ND | + | − | ND | ND |
| IDRL-9986 | University of Minnesota | E. faecium | 8 | 2 | 1 | >128 | ND | + | − | ND | ND |
| IDRL-9988 | University of Minnesota | E. faecium | 32 | 2 | >128 | 128 | ND | + | − | ND | ND |
| IDRL-9989 | University of Minnesota | E. faecium | 32 | 1 | >128 | 128 | ND | + | − | ND | ND |
| IDRL-6385 | Mayo Clinic | E. faecium | 32 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6386 | Mayo Clinic | E. faecium | 32 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6387 | Mayo Clinic | E. faecium | 32 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6388 | Mayo Clinic | E. faecium | 32 | 1 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6389 | Mayo Clinic | E. faecium | 32 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-6390 | Mayo Clinic | E. faecium | 64 | 2 | >128 | >128 | ND | + | − | ND | ND |
| IDRL-10042 | Mayo Clinic | S. epidermidis | 32 | 2 | 2 | 4 | 32 | − | − | L101V H146Q V154L A157R |
71G72 N158S |
| IDRL-10060 | Mayo Clinic | S. aureus | 64 | 4 | 1 | 64 | 64 | + | − | ||
| IDRL-9925 | Mayo Clinic | S. aureus | 16 | 2 | 2 | 8 | 64 | − | − | G152D | |
| NRS127 | BEI Resources | S. aureus | 8 | 1 | 2 | 16 | 32 | − | − | ΔS145 | |
| NRS271 | BEI Resources | S. aureus | 32 | 4 | 1 | 16 | 64 | + | − | Q3K | |
| NRS119 | BEI Resources | S. aureus | 64 | 8 | 2 | 64 | >128 | + | − | ||
ND = not done.
All the enterococci and S. aureus IDRL-10060, NRS271, and NRS119 harbored the 23S rRNA G2576T mutation. It has been shown that, in NRS271, 5 of the 6 23S rRNA copies have the G2576T point mutation (Wilson et al., 2003). The G2576T mutation was present in all 6 23S rRNA gene copies of S. aureus NRS119 and in 5 of 6 copies of the 23S rRNA gene in S. aureus IRDL-10060. It has been shown that the level of linezolid resistance correlates with the number of mutated 23S rRNA copies (Besier et al., 2008; Marshall et al., 2002); our isolates, which had G2576T mutations in 5 or 6 alleles, exhibited high linezolid MIC values.
The S. epidermidis isolate had mutations in the L3 protein and a 71G72 insertion and a N158S mutation in the L4 protein. The L3 L101V mutation has been reported in clinical isolates and is considered less important than other L3 mutations because both amino acids are hydrophobic (Pournaras et al., 2013). L3 mutations H146Q, V154L, and A157R have been previously reported (Locke et al, 2009b); V154L and A157R result in small nucleophilic amino acid exchanges for hydrophobic or basic amino acids near the oxazolidinone binding site, likely reducing oxazolidinone affinity by perturbing interactions between L3 and 23S rRNA (Kosowska-Shick et al., 2010; Locke et al., 2009b). The insertion of 71G72 in L4 impacts a highly conserved region (63KPWRQKGTGRAR74) (Kosowska-Shick et al., 2010; Wong et al.. 2010). The N158S L4 mutation has been previously described in linezolid-resistant and linezolid-susceptible isolates, suggesting that it may not affect linezolid susceptibility (Kosowska-Shick et al., 2010).
S. aureus IDRL-9925 had a L3 G152D mutation, previously reported in clinical isolates of S. aureus (Endimiani et al., 2011), and located in a central extension of L3 approaching the peptidyl transferase center and probably reducing oxazolidinone affinity by perturbing 23S rRNA bases (Locke et al., 2009b).
S. aureus NRS127 had a deletion of serine 145 of L3, and S. aureus NRS271 harbored a previously unreported Q3K mutation in the L3 protein, which is unlikely to confer linezolid resistance; this isolate also had a G2576T 23S rRNA gene mutation, likely explaining its resistance to linezolid (Besier et al., 2008; Endimiani et al., 2011; Gu et al., 2013; Livermore et al., 2009; Locke et al., 2009b).
In summary, although tedizolid is more active in vitro than is linezolid against enterococcal and staphylococcal isolates with 23S rRNA, rplC, and/or rplD gene mutations, its MICs arc nevertheless elevated, and where interpretive guidelines exist, linezolid-resistant isolates are not susceptible to tedizolid.
Acknowledgments
The authors thank Cubist-Merck Pharmaceuticals and the NIH (grant R25 GM075148 at Mayo Clinic) for supporting the studies performed herein.
References
- Besier S, Ludwig A, Zander J, Brade V, Wichelhaus TA. Linezolid resistance in Staphylococcus aureus: gene dosage effect, stability, fitness costs, and cross-resistances. Antimicrob Agents Chemother 2008;52:1570–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clinical and laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing twenty-fourth informational supplement M100-S24; 2014. [Google Scholar]
- Endimiani A, Blackford M, Dasenbrook EC, Reed MD, Bajaksouszian S, Hujer AM, et al. Emergence of linezolid-resistant Staphylococcus aureus after prolonged treatment of cystic fibrosis patients in Cleveland, Ohio. Antimicrob Agents Chemother 2011;55:1684–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu B, Kelesidis T, Tsiodras S, Hindler J, Humphries RM. The emerging problem of linezolid-resistant Staphylococcus. J Antimicrob Chemother 2013;68:4–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Herrero IA, Issa NC, Patel R. Nosocomial spread of linezolid-resistant, vancomycin-resistant Enterococcus faecium. N Engl J Med 2002;346:867–9. [DOI] [PubMed] [Google Scholar]
- Kosowska-Shick K, Julian KG, McGhee PL, Appelbaum PC, Whitener CJ. Molecular and epidemiologic characteristics of linezolid-resistant coagulase-negative staphylococci at a tertiary care hospital. Diagn Microbiol Infect Dis 2010;68:34–9. [DOI] [PubMed] [Google Scholar]
- Liakopoulos A, Neocleous C, Klapsa D, Kanellopoulou M, Spiliopoulou I, Mathiopoulos KD, et al. A T2504 mutation in the 23S rRNA gene responsible for high-level resistance to linezolid of Staphylococcus epidermidis.. J Antimicrob Chemother 2009;64:206–7. [DOI] [PubMed] [Google Scholar]
- Livermore DM, Mushtaq S, Warner M, Woodford N. Activity of oxazolidinone TR-700 against linezolid-susceptible and -resistant staphylococci and enterococci. J Antimicrob Chemother 2009;63:713–5. [DOI] [PubMed] [Google Scholar]
- Locke JB, Hilgers M, Shaw KJ. Mutations in ribosomal protein L3 are associated with oxazolidinone resistance in staphylococci of clinical origin. Antimicrob Agents Chemother 2009a;53:5275–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Locke JB, Hilgers M, Shaw KJ. Novel ribosomal mutations in Staphylococcus aureus strains identified through selection with the oxazolidinones linezolid and torezolid (TR-700). Antimicrob Agents Chemother 2009b;53:5265–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Locke JB, Rahawi S, Lamarre J, Mankin AS, Shaw KJ. Genetic environment and stability of cfr in methicillin-resistant Staphylococcus aureus CM05. Antimicrob Agents Chemother 2012;56:332–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marshall SH, Donskey CJ, Hutton-Thomas R, Salata RA, Rice LB. Gene dosage and linezolid resistance in Enterococcus faecium and Enterococcus faecalis. Antimicrob Agents Chemother 2002;46:3334–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mendes RE, Deshpande LM, Jones RN. Linezolid update: stable in vitro activity following more than a decade of clinical use and summary of associated resistance mechanisms. Drug Resist Updat 2014;17:1–12. [DOI] [PubMed] [Google Scholar]
- Pournaras S, Ntokou E, Zarkotou O, Ranellou K, Themeli-Digalaki K, Stathopoulos C, et al. Linezolid dependence in Staphylococcus epidermidis bloodstream isolates. Emerg Infect Dis 2013;19:129–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Prystowsky J, Siddiqui F, Chosay J, Shinabarger DL, Millichap J, Peterson LR, et al. Resistance to linezolid: characterization of mutations in rRNA and comparison of their occurrences in vancomycin-resistant enterococci. Antimicrob Agents Chemother 2001; 45:2154–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Swaney SM, Aoki H, Ganoza MC, Shinabarger DL. The oxazolidinone linezolid inhibits initiation of protein synthesis in bacteria. Antimicrob Agents Chemother 1998;42:3251–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Toh SM, Xiong L, Arias CA, Villegas MV, Lolans K, Quinn J, et al. Acquisition of a natural resistance gene lenders a clinical strain of methicillin-resistant Staphylococcus aureus resistant to the synthetic antibiotic linezolid. Mol Microbiol 2007;64:1506–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson P, Andrews JA, Charlesworth R, Walesby R, Singer M, Farrell DJ, et al. Linezolid resistance in clinical isolates of Staphylococcus aureus. J Antimicrob Chemother 2003;51:186–8. [DOI] [PubMed] [Google Scholar]
- Wong A, Reddy SP, Smyth DS, Aguero-Rosenfeld ME, Sakoulas G, Robinson DA. Polyphyletic emergence of linezolid-resistant staphylococci in the United States. Antimicrob Agents Chemother 2010;54:742–8. [DOI] [PMC free article] [PubMed] [Google Scholar]