The Operon Encoding Hydrolytic Dehalogenation of 4-Chlorobenzoate Is Transcriptionally Regulated by the TetR-Type Repressor FcbR and Its Ligand 4-Chlorobenzoyl Coenzyme A

The bacterial hydrolytic dehalogenation of 4CBA is a special CoA-activation-type catabolic pathway that plays an important role in the biodegradation of polychlorinated biphenyls and some herbicides. With genetic and biochemical approaches, the present study identified the transcriptional repressor and its cognate effector of a 4CBA hydrolytic dehalogenation operon.

ABSTRACT

The bacterial hydrolytic dehalogenation of 4-chlorobenzoate (4CBA) is a coenzyme A (CoA)-activation-type catabolic pathway that is usually a common part of the microbial mineralization of chlorinated aromatic compounds. Previous studies have shown that the transport and dehalogenation genes for 4CBA are typically clustered as an fcbBAT1T2T3C operon and inducibly expressed in response to 4CBA. However, the associated molecular mechanism remains unknown. In this study, a gene (fcbR) adjacent to the fcb operon was predicted to encode a TetR-type transcriptional regulator in Comamonas sediminis strain CD-2. The fcbR knockout strain exhibited constitutive expression of the fcb cluster. In the host Escherichia coli, the expression of the P_fcb-fused green fluorescent protein (gfp) reporter was repressed by the introduction of the fcbR gene, and genetic studies combining various catabolic genes suggest that the ligand for FcbR may be an intermediate metabolite. Purified FcbR could bind to the P_fcb DNA probe in vitro, and the metabolite 4-chlorobenzyl-CoA (4CBA-CoA) prevented FcbR binding to the P_fcb DNA probe. Isothermal titration calorimetry (ITC) measurements showed that 4CBA-CoA could bind to FcbR at a 1:1 molar ratio. DNase I footprinting showed that FcbR protected a 42-bp DNA motif (5′-GGAAATCAATAGGTCCATAGAAAATCTATTGACTAATCGAAT-3′) that consists of two sequence repeats containing four pseudopalindromic sequences (5′-TCNATNGA-3′). This binding motif overlaps with the −35 box of P_fcb and was proposed to prevent the binding of RNA polymerase. This study characterizes a transcriptional repressor of the fcb operon, together with its ligand, thus identifying halogenated benzoyl-CoA as belonging to the class of ligands of transcriptional regulators.

IMPORTANCE The bacterial hydrolytic dehalogenation of 4CBA is a special CoA-activation-type catabolic pathway that plays an important role in the biodegradation of polychlorinated biphenyls and some herbicides. With genetic and biochemical approaches, the present study identified the transcriptional repressor and its cognate effector of a 4CBA hydrolytic dehalogenation operon. This work extends halogenated benzoyl-CoA as a new member of CoA-derived effector compounds that mediate allosteric regulation of transcriptional regulators.

INTRODUCTION

The model halogenated benzoic acid molecule 4-chlorobenzoate (4CBA) is a significant intermediate catabolite during the biodegradation of many halogenated compounds, such as polychlorinated biphenyls (1, 2) and some herbicides (3). 4CBA is frequently introduced into the environment via its use in the synthesis of industrial chemicals, including dye stuffs, pigments, and pharmaceuticals (4). Microbes are major consumers of 4CBA in the environment. Due to the limited bioavailability of the halogen group, dehalogenation is a key step in the microbial mineralization of 4CBA, and the type of hydrolytic dehalogenation that 4CBA undergoes is considered to be unique due to its characteristic of coenzyme A (CoA) activation (5–7). Several bacterial species with the capacity for hydrolytic dehalogenation of 4CBA have been isolated in recent decades, including Pseudomonas sp. strain CBS3 (8, 9), Comamonas sp. strain DJ-12 (10, 11), Arthrobacter sp. strain SU (12), and Arthrobacter sp. strain TM1 (13). The hydrolytic dehalogenation of 4CBA has been well studied in these strains. The catabolic pathway consists of the following three steps (Fig. 1A): (i) 4-chlorobenzoate-CoA ligase initially adenylates the carboxyl group with ATP and thioesterificates 4CBA-AMP with CoA to form a thioester; (ii) 4-chlorobenzyl-CoA (4CBA-CoA) dehalogenase then catalyzes the hydrolysis of 4CBA-CoA to 4-hydroxybenzyl-CoA (4HBA-CoA) via a nucleophilic aromatic substitution, and the 4-chlorine atom is replaced by the hydroxyl group derived from H₂O; and (iii) 4HBA-CoA thioesterase hydrolyzes 4HBA-CoA to 4-hydroxybenzoate (4HBA) via CoA removal. Despite differences in organization, corresponding genes for the hydrolytic dehalogenation of 4CBA have been observed to be present in these strains as a cluster, which is named the fcb gene cluster (Fig. 1B). In addition to catabolic genes (fcbA, fcbB, and fcbC), transporter genes (fcbT1T2T3) are also present in this cluster (Fig. 1B). Functional identification indicated that fcbT1T2T3, which encodes a tripartite ATP-independent periplasmic transporter in strain DJ-12, is responsible for the uptake of 4CBA (11). It has also been demonstrated that fcb operon expression is induced by 4CBA, 4-bromobenzoate (4BBA), and 4-iodobenzoate (4IBA) (11). However, the associated mechanism has not been elucidated to date.

FIG 1.

Organization and transcriptional analysis of the fcb cluster in strain CD-2. (A) Steps of the 4CBA dehalogenation pathway. (B) Schematic diagram of the fcb cluster. The P_fcb promoter is indicated by an arrow. The five amplification fragments (F1 to F5) for transcriptional unit evaluation are shown under the fcb cluster as lines. The fcb clusters in Comamonas sp. strain DJ12, Acidovorax sp. strain T1, Alcaligenes sp. strain AL3007, an uncultured bacterial clone, a consortium cosmid clone, Pseudomonas sp. strain CBS3, Arthrobacter globiformis strain KZT1, and Arthrobacter sp. strain TM1 are also presented, for which the GenBank accession numbers are AF0517717, MF189566, AF537222, KY207245, DQ826744, EF569604, AF304300, and AF042490, respectively. The identities of amino acids compared with those for strain CD-2 are shown for each gene. (C) TSS determination of the fcb cluster by 5′-RACE. The TSS C is indicated by an arrow. (D) TSS determination of fcbR by 5′-RACE. The TSS A is indicated by an arrow. (E) DNA elements and the location of the FcbR-binding site in the P_fcb promoter of the fcb gene cluster. The −35 box TTGACT and the −10 box TATAGT are indicated by lines, and the TSS is indicated with an arrow. The FcbR-binding site is indicated by a bold orange line above the sequence. (F) DNA elements in the P_fcbR promoter of the fcbR regulator gene itself. The −35 box GCGCCA and the −10 box TAGAAT are indicated by lines, and the TSS is indicated with an arrow. The proposed FcbR-binding site is indicated by a bold orange line above the sequence. (G) Transcription unit determination of the fcb cluster. Five fragments (F1 to F5), as shown in panel B, were PCR amplified and resolved by electrophoresis. Samples using total RNA, cDNA, and genomic DNA (gDNA) as the templates are indicated. Total RNA was extracted from strain CD-2 cells grown in MSM with 0.5 mM 4CBA as the carbon source, and cDNA was synthesized using random primers from the extracted total RNA.

In our previous study, a 4CBA-degrading strain, Comamonas sediminis CD-2, was isolated from the polluted soil of a chemical factory (14) and genomic analysis revealed that its hydrolytic dehalogenation genes share very high identity with those present in Comamonas sp. strain DJ-12 (10, 11). Here, open reading frame (ORF) analysis indicated that a TetR-family transcriptional regulator-encoding gene (fcbR) is located downstream of the fcb cluster, and we hypothesized that this gene regulates the transcription of the total fcb cluster. TetR-type transcriptional regulators typically act as repressors to regulate genes involved in antibiotic resistance, quorum sensing, metabolism, and many other physiological processes, and their ligands are extraordinarily diverse (15). Therefore, TetR-type transcriptional regulators are considered to have great application potential in the engineering of biosensors and synthetic biology elements, and the identification of the exact ligands of TetR-type transcriptional regulators is valuable. Therefore, in this study, genetic and biochemical approaches were used for the functional characterization of fcbR.

RESULTS

Transcriptional analysis of the fcb gene cluster.

The transcription start site (TSS) of the fcb cluster was detected by 5′-rapid amplification of cDNA ends (5′-RACE). As shown in Fig. 1C, a C residue 27 base pairs (bp) upstream of the fcbB translational start codon was identified as the TSS. The putative −35 (TTGACT) and −10 (TATAGT) boxes were separated by 17 bp, sharing high similarity to the characteristics of the σ⁷⁰-type promoter in Escherichia coli. To test whether the entire fcb gene cluster is transcribed as a single transcriptional unit, we analyzed the intergenic regions of two adjacent open reading frames (ORFs) by reverse transcription PCR (RT-PCR). The five intergenic regions in the fcb cluster were all successfully amplified when cDNA was employed as the template that was reverse transcribed from total RNA in 4CBA-cultured cells of strain CD-2 (Fig. 1G), indicating that the fcbB, fcbA, fcbT1, fcbT2, fcbT3, and fcbC genes comprise an operon and are cotranscribed as a single unit. In addition, the TSS of fcbR was identified as an A residue located 29 bp upstream of the translational start codon (Fig. 1F).

The effect of 4CBA on the transcription of the fcb operon was confirmed by reverse transcription quantitative PCR (RT-qPCR). By comparing the relative transcribed mRNA levels of all seven genes (fcbB, fcbA, fcbT1, fcbT2, fcbT3, fcbC, and fcbR) in strain CD-2 grown in the presence or absence of 4CBA, the RT-qPCR results showed that 4CBA significantly increased the transcription of all of these genes in the fcb operon (325.4 ± 41.5-, 456.1 ± 153.9-, 296.7 ± 128.6-, 330.4 ± 49.1-, 302.5 ± 34.5-, 311.8 ± 56.7-, and 12.4 ± 4.2- fold for fcbB, fcbA, fcbT1, fcbT2, fcbT3, fcbC, and fcbR, respectively) (Fig. 2C and D). Therefore, the fcb gene cluster is an inducible operon in strain CD-2. These results were consistent with the findings of a study that used a promoter-fused lacZ reporter in Comamonas sp. strain DJ-12 (11).

FIG 2.

Effects of fcbR on the dehalogenation of 4CBA, cell growth using 4CBA as the sole carbon source, and gene expression of the fcb operon. (A) 4CBA dehalogenation by the wild-type strain CD-2 (WT, blue), the fcbR knockout mutant (MT, orange), the fcbR-complemented strain (MTC, gray), and absent of bacterial cells (NCK, black). (B) Cell growth of strains WT, MT, and MTC on 4CBA. (C) Relative transcriptional expression analysis of fcbB, fcbA, fcbT1, fcbT2, fcbT3, and fcbC in the WT (blue), MT (orange), and MTC (gray) strains in the presence of 0.5 mM succinate or 0.5 mM 4CBA. (D) Relative transcriptional expression analysis of fcbR in the WT (blue) and MTC (gray) strains in the presence of 0.5 mM succinate or 0.5 mM 4CBA. Data shown are means ± standard deviation (SD) of three replicates. Asterisks indicate P values assessed by Student’s t test: ***, P < 0.001; NS, nonsignificant.

fcbR is essential for the inducible expression of the fcb operon.

To functionally characterize fcbR, a PCR-amplified fragment was used to construct an fcbR null mutant strain (CD-fcbRMT) in which the gene was replaced by genetic markers for resistance to gentamicin. The CD-fcbRMT strain consumed 50% 4CBA within approximately 17 h, while the wild-type strain (CD-2) and the fcbR-complemented strain (CD-fcbRMTC) consumed 50% 4CBA within approximately 27 h (Fig. 2A). The substrate consumption rate of the mutant CD-fcbRMT was significantly higher than that of the wild-type strain CD-2 and the fcbR-complemented strain CD-fcbRMTC (Fig. 2A). Cell growth for the mutant strain on 4CBA was also more rapid than that of the wild-type and complemented strains, as shown in Fig. 2B. The mutant strain grew to stationary phase at approximately 40 h, while the wild-type and complemented strains grew to stationary phase at approximately 56 h. RT-qPCR assays were then performed to evaluate the relative transcription level of the fcb cluster. Transcription of the fcb operon in the fcbR null mutant strain was constitutive, and the addition of 4CBA no longer affected the level of fcb gene cluster expression when fcbR was knocked out (Fig. 2C). In the fcbR-complemented strain CD-fcbRMTC, the transcription level of the fcb cluster became inducible again, which was similar to the results obtained for the wild-type strain CD-2 (Fig. 2C). These results showed that fcbR is essential for the inducible transcription of the fcb operon in the presence of 4CBA and that FcbR plays a crucial role in repressing fcb gene cluster expression.

FcbR represses P_fcb reporter gene fusion in E. coli.

To further assess the function of fcbR in the transcription of the fcb operon, an inducible expression system using the reporter gene gfp was constructed in the host E. coli. When the fcb operon promoter (P_fcb) was fused to gfp, it was expressed in E. coli cells (Fig. 3A, colony a), and the fluorescence intensity was approximately 10-fold higher than that observed in the control cells (Fig. 3B). As expected, the subsequent introduction of fcbR repressed gfp expression (Fig. 3A, colony b), as the fluorescence intensity in these cells was not significantly different from that observed in the control cells (Fig. 3B). These results indicated that FcbR is a repressor of the fcb operon. However, this repression could not be relieved when cells of colony b were cultured in medium containing 4FBA, 4CBA, 4BBA, 4IBA, or 4-hydrobenzoate (4HBA) (Fig. 3A, colonies c to g). Two possible explanations for this phenomenon are that the initial substrate could not be transported into E. coli cells or that an intermediate metabolite may be the direct ligand of FcbR.

FIG 3.

FcbR represses the expression of the P_fcb-gfp fusion in host E. coli cells. (A) GFP expression phenotype of E. coli DH5α colonies harboring different plasmids. (B) Quantitative measurement of GFP expression in E. coli DH5α colonies harboring different plasmids. pSRGFP-18, a pUC18-based gfp reporter plasmid containing two multiple cloning sites (60); pSR-R, pSRGFP-18 harboring fcbR; pSR-P, pSRGFP-18 harboring P_fcb upstream of gfp; pSR-PR, pSRGFP-18 harboring P_fcb upstream of gfp and the transcriptional regulator gene fcbR; pBAC, a BAC plasmid (61); pBAC-fcbT, pBAC harboring fcbT1T2T3; pBAC-fcbAT, pBAC harboring fcbAT1T2T3; pBAC-fcbBAT, pBAC harboring fcbBAT1T2T3; and pBAC-hbaA, pBAC harboring the predicted 4-hydroxybenzoate-CoA ligase gene hbaA. BLANK, cells cultured in LB; 4FBA, cells cultured in 0.5 mM 4FBA; 4CBA, cells cultured in 0.5 mM 4CBA; 4BBA, cells cultured in 0.5 mM 4BBA; 4IBA, cells cultured in 0.5 mM 4IBA; 4HBA, cells cultured in 0.5 mM 4HBA.

These two possibilities were subsequently evaluated by further introducing different parts of the fcb cluster into host cells on a second plasmid (Fig. S1 in the supplemental material). Because 4CBA is transported into cells by the tripartite ATP-independent periplasmic transporter FcbT1T2T3 in Comamonas (11), the fcbT1T2T3 genes were first introduced with the plasmid pBAC-fcbT, but colonies still exhibited a nonfluorescent phenotype in the presence of the initial substrate (Fig. 3A, colonies h to k). Notably, when fcbAT1T2T3 or fcbBAT1T2T3 was introduced into the system, gfp was again expressed in the presence of 4CBA (Fig. 3A, colonies m and q), and the fluorescence intensity of the corresponding cells was approximately 26- and 12-fold higher than that of the control cells, respectively (Fig. 3B). 4BBA (Fig. 3A, colonies n and r) and 4IBA (Fig. 3A, colonies o and s) were observed to have effects similar to that of 4CBA. FcbA catalyzes 4CBA to 4CBA-CoA, and FcbB catalyzes 4CBA-CoA to 4HBA-CoA. The above results demonstrated that the direct ligand of FcbR is not 4CBA but rather the intermediate metabolite 4CBA-CoA or both 4CBA-CoA and 4HBA-CoA. However, when the predicted 4-hydrobenzoyl-CoA ligase-encoding gene hbaA from strain CD-2 was introduced into the system, which shares 47.1% identity with oxygen-insensitive HbaA of Rhodopseudomonas palustris (16) and is theoretically able to transform 4HBA to 4HBA-CoA, the expression of gfp remained repressed, even in the presence of 4HBA (Fig. 3A, colony t), suggesting that 4HBA-CoA is not a ligand of FcbR.

4CBA-CoA prevents FcbR binding to the fcb operon promoter in vitro.

FcbR was overexpressed in E. coli Rosetta (strain DE3) from the expression vector pETstFcbR and was detected by SDS-PAGE (Fig. S2), and gel filtration results showed that FcbR primarily existed as a dimer (Fig. S3). Purified FcbR was then used for electrophoretic mobility shift assay (EMSA) to evaluate its binding ability to fcb promoter DNA. As shown in Fig. 4A, increasing amounts of purified FcbR shifted the migration of the DNA probe, and a P_fcb-FcbR DNA-protein complex was formed. In contrast, no DNA-protein complex was observed for the nonspecific control DNA (comprising an internal fcbA sequence). These results indicated that FcbR can specifically bind to the fcb promoter region. Furthermore, the potential ligands of FcbR were also tested, and 4CBA-CoA was observed to prevent FcbR binding to the DNA probe, while the other compounds had no effect on FcbR (Fig. 4A). The effect of 4CBA-CoA on FcbR was evaluated in detail, as shown in Fig. 4B. Increasing quantities of 4CBA-CoA decreased the formation of the FcbR-DNA complex. Additionally, EMSA analysis showed that FcbR could bind to the DNA probe of its own promoter (P_fcbR), albeit with low binding affinity (Fig. 4C), implying that FcbR also control its own transcription.

FIG 4.

EMSA of FcbR and the P_fcb or P_fcbR probe and effects of 4CBA-CoA on their binding. (A) FcbR binds to the promoter DNA probe of the fcb operon and the effect of diverse molecules on FcbR-specific binding. Each lane contains 60 ng of DNA probe. The first 5 lanes show samples incubated with increasing amounts of FcbR (0 to 3.32 μM), and the next 6 lanes show samples incubated with 3.32 μM FcbR and different small molecules (5 mM), including 4CBA, 4CBA-CoA, 4HBA-CoA, 4HBA, CoA, and BA-CoA. (B) Effects of increasing 4CBA-CoA (0 to 32 μM) on the binding between 3.32 μM FcbR and the P_fcb DNA probe. S0 indicates the 198-bp negative-control DNA fragment that was amplified from the fcbA gene; S1 indicates the 241-bp P_fcb DNA probe; S2 indicates the complex of FcbR and the P_fcb DNA probe. (C) FcbR binds to the DNA probe of its own promoter. Each lane contains 60 ng of DNA probe and samples were incubated with increasing amounts of FcbR (0 to 5.81 μM). SR1 indicates the 249-bp P_fcbR DNA probe; SR2 indicates the complex of FcbR and the P_fcbR DNA probe. (D) ITC measurement of 4CBA-CoA binding to FcbR. The ITC raw data are shown on the top, and the fitted curve is shown on the bottom. A 500 μM 4CBA-CoA solution was titrated into the reaction cell containing 32 μM FcbR. The first drop was one-fourth of the volume of the subsequent drops, and it was not used in the curve fit.

Isothermal calorimetry (ITC) assays were subsequently performed to validate the interaction between FcbR and the ligand 4CBA-CoA. A typical thermogram was generated when 0.5 mM 4CBA-CoA was titrated into 32 μM purified FcbR solution (Fig. 4D). The number of binding sites (N) and the equilibrium dissociation constant (K_D) were calculated as 1.06 ± 0.0372 sites and 6.37 ± 0.424 μM, respectively, indicating that one molecule 4CBA-CoA bound to one FcbR protein. ITC measurements of the molecules 4CBA, 4HBA-CoA, and 4HBA showed no binding to FcbR (Fig. S4), which was consistent with the results obtained for the GFP reporter analysis in E. coli and by EMSA.

A 42-bp motif containing four pseudopalindromic sequences of 5′-TCNATNGA-3′ comprises the FcbR dimer binding box.

A DNase I footprinting experiment was performed to identify the FcbR-binding site in the fcb operon promoter. As shown in Fig. 5A, the results indicated that FcbR protected the 42-bp DNA motif 5′-GGAAATCAATAGGTCCATAGAAAATCTATTGACTAATCGAAT-3′, which is located from −23 to −64 bp relative to the TSS of the fcb promoter (Fig. 1E). This binding region encompasses the −35 box (Fig. 1E), which is a predicted binding site of the sigma 70 factor. In other FcbR ortholog-positive 4CBA-metabolizing strains (Fig. 1B), the 42-bp binding motif could also be detected in the P_fcb regions for those strains, and a sequence alignment indicated the DNA motif was conserved (Fig. 5B). The consensus sequence was visualized by WebLogo (17), and further sequence analysis showed the motif consisted of two sequence repeats (repeat 1 and repeat 2) containing four repeats of the palindromic sequence 5′-TCNATNGA-3′ (PS1 to PS4, Fig. 5C). In addition, only repeat 1 was observed in the proposed FcbR-binding site in P_fcbR (Fig. 1F, Fig. 5B), which might be why FcbR exhibited low affinity to the P_fcbR probe in the EMSA analysis (Fig. 4C).

FIG 5.

The FcbR-binding site in P_fcb and ITC measurement of FcbR binding to its own DNA-binding site. (A) DNase I footprinting analysis of FcbR and P_fcb. 6-Carboxyfluorescein-labeled DNA probe (500 ng) was incubated with 0 or 5 μg FcbR (red and blue lines, respectively). The FcbR-protected region is indicated in a box, and the protected sequence is shown at the bottom. (B) Sequence alignment of FcbR-binding sites. The 42-bp FcbR-binding motif among strains CD-2, DJ12, T1, AL3007, an uncultured clone, a cosmid clone, and strain CBS-3 were selected for sequence alignment. The proposed FcbR-binding site in P_fcbR was also aligned and is shown under the figure; sequence exhibiting high similarity to repeat 1 is indicated by a black box. (C) The Logo of the FcbR-binding motif in seven samples was generated using WebLogo 2.8.2. Two sequence repeats in the motif are indicated by lines, and four palindromic sequences (PS1, PS2, PS3, and PS4) are indicated by arrow-headed lines. (D) ITC measurement of FcbR binding to the binding site-containing DNA probe. The 42-bp FcbR binding site-containing DNA (40 μM) was titrated into a reaction cell containing 23 μM FcbR. The first drop was one-fourth of the volume of the subsequent points, and it was not used in the curve fit.

ITC measurement was performed to validate the binding capacity of FcbR to the 42-bp motif. A single-binding-site-model fitted ITC thermogram was obtained, and the FcbR dimer was observed to exhibit an N = 0.262 ± 0.0240 sites and K_D = 1.36 ± 0.629 μM when the DNA probe was titrated into a purified FcbR solution (Fig. 5D). Therefore, the FcbR dimer bound to the 42-bp DNA motif with a 2:1 stoichiometry.

DISCUSSION

In the present study, FcbR, a TetR-type transcriptional repressor, was shown to regulate transcription of the fcbBAT1T2T3C operon, which is responsible for 4CBA dehalogenation. A proposed transcriptional model is shown in Fig. 6. In the absence of 4CBA, FcbR is bound to the −35 region in the fcb promoter to repress the transcription of the fcb operon (Fig. 6I). When 4CBA is present, trace amounts of 4CBA are transported into the cell and transformed to 4CBA-CoA by the 4CBA transporter FcbT and 4CBA-CoA ligase FcbA (both expressed at background levels), respectively. 4CBA-CoA is the inducer molecule of FcbR, and the binding of 4CBA-CoA to FcbR induces its release from the promoter region (Fig. 6II). Subsequently, the fcbBAT1T2T3C operon is highly transcribed to express more transporter and dehalogenation enzymes to transport and metabolize 4CBA (Fig. 6III). The genes encoding fcbR were shown to be conserved in Betaproteobacteria and Gammaproteobacteria strains that can perform 4CBA dehalogenation, including Comamonas sp. strain DJ12, Acidovorax sp. strain T1, Alcaligenes sp. strain AL3007, an uncultured bacterial clone, a consortium cosmid clone, and Pseudomonas sp. strain CBS3 (Fig. 1B). Additionally, the binding motif of FcbR was also conserved within the P_fcb sequences of these strains (Fig. 5B and C). It suggests that the transcriptional regulation mechanism of 4CBA dehalogenation in these strains is conserved. However, no FcbR-like gene was found in the fcb cluster from Actinobacteria, such as Arthrobacter globiformis KZT1 and Arthrobacter sp. strain TM1 (Fig. 1B). Moreover, the promoter sequences of the fcb cluster in strains KZT1 and TM1 exhibited low similarity to those of the Betaproteobacteria and Gammaproteobacteria strains (data not shown). Whether a different transcriptional regulation model exists in Arthrobacter strains remains to be further studied.

FIG 6.

Proposed transcriptional regulation model for FcbR. (I) FcbR represses the transcription of the fcb cluster in the absence of 4CBA in the medium. (II) 4CBA is transported into cells and converted to the ligand 4CBA-CoA by basal expression of FcbT and FcbA, respectively. (III) 4CBA-CoA binds to FcbR and releases FcbR from the promoter region of the fcb operon. The fcb gene cluster is then highly transcribed to produce more 4CBA transporters and dehalogenation enzymes.

Dehalogenation is a key step in the microbial degradation of halogenated compounds (18). To date, only a few transcriptional regulators for microbial dehalogenation have been reported: (i) the LysR-type transcriptional regulator (LTTR) HadR and TcpR for the oxidative dehalogenation of 2,4,6-trichlorophenol (19, 20); (ii) the LTTR PcpR for the oxidative dehalogenation of pentachlorophenol (21, 22); (iii) the CRP/FNR-type transcriptional regulator CprK for the anaerobic dehalorespiration of 3-chloro-4-hydroxyphenylacetic acid (23, 24); (iv) the LTTR LinR for the reductive dehalogenation of 2,5-dichlorohydroquinone (25); and (v) the MarR-type regulator Rdh2R for reductive dehalogenation of trichlorobenzene (26). To the best of our knowledge, identification of FcbR is the first report of a transcriptional regulator for hydrolytic dehalogenation.

CoA thioesterification is a strategy used for acyl group carrying and carbonyl group activation in diverse biochemical reactions, such as the biosynthesis and degradation of lipids, secondary metabolic pathways, and the biosynthesis of amino acids, cholesterol, and the neurotransmitter acetylcholine (27–31). Although extensive research has described the roles of CoA and its derivatives in cellular metabolism, the significance of CoA derivatives as key regulators and signaling molecules beyond their normal roles has gradually emerged, as exemplified by the allosteric regulation of specific transcriptional regulators. An increasing number of CoA derivatives have been shown to function as ligands of transcriptional regulators, including fatty alkyl-CoA for FadR, which regulates fatty acid synthesis and degradation (32–34); phenylacetyl-CoA for PaaX/PaaR, which negatively regulates phenylacetic acid degradation (35–37); 3-methylbenzoyl-CoA for MbdR, which regulates the anaerobic degradation of 3-methylbenzoate (38); feruloyl-CoA for FerR/FerC, which regulates the degradation of ferulic acid (39, 40); p-coumaroyl-CoA for HcaR/CouR, which regulates p-coumarate degradation (41, 42); benzoyl-CoA for BzdR/BoxR/GenR, which regulates benzoate degradation (43–45); 2-ketocyclohexane-1-carboxyl–CoA for BadR, which regulates the anaerobic degradation of benzoate (46, 47); 3aα-H-4α(3′-propanoate)-7aβ-methyl-hexahydro-1,5-indanedione-CoA for KstR2, 3-oxocholest-4-en-26-oyl-CoA for KstR and CoA, or short-chain acyl-CoA for PrpR, all of which regulate cholesterol catabolism (48–50); and isovaleryl-CoA for AibR, which regulates alternative de novo isovaleryl coenzyme A biosynthesis (51). Because these CoA derivatives are all intermediate metabolites belonging to specific metabolic pathways, their identification has expanded our knowledge of indirect metabolic sensing by transcriptional regulators (52). However, reported ligands of CoA derivatives have not been found to contain halogen groups, and the results of the present study indicated that a halogenated aryl-CoA could be recognized by a transcriptional regulator. Furthermore, the observation that 4HBA-CoA and CoA could not be recognized by FcbR (Fig. 4A and Fig. S4) indicated that the halogen group in 4CBA-CoA plays a significant role in the recognition between the transcriptional regulator FcbR and its ligand molecule. Because the halogen group in 4CBA-CoA is a nonpolar and hydrophobic group, it is expected to aid in elucidating the mechanism by which FcbR recognizes the halogen group of 4CBA-CoA. The C terminus of most TetR-type transcriptional regulators forms a ligand-binding domain (15), and the multiple sequence alignment of the C termini of CoA-derivative-recognized transcriptional regulators showed no significant conserved domain or residues (Fig. S5A). Further phylogenetic analysis (Fig. S5B) indicated the C-terminal sequence of FcbR is most closely related to KstR2 from Mycobacterium tuberculosis strain H37Rv, which recognizes 3aα-H-4α(3′-propanoate)-7aβ-methyl-hexahydro-1,5-indanedione-CoA as a ligand (48). Additionally, the C-terminal amino acids of these transcriptional regulators have no clear evolutionary relationship with ligand recognition, indicating the ligand-binding domains may occur independently.

MATERIALS AND METHODS

Chemicals, bacterial strains, plasmids, and growth conditions.

4CBA (>99% purity), 4-fluorobenzoic acid (4FBA) (>98% purity), 4BBA (>99% purity), 4IBA (>99% purity), and 4HBA (>99% purity) were purchased from Adamas-beta (Shanghai, China) and prepared as 0.1 M stock solutions in methanol and sterilized by membrane filtration (0.22 μm). CoA lithium salt (99% purity) was purchased from Aladdin (Shanghai, China). Benzoyl-CoA lithium salt (BA-CoA, >90% purity) was purchased from Sigma-Aldrich (Shanghai, China). Other reagents, including LiOH, HCl, tetrahydrofuran, triethylamine, ethylacetate, isopropyl 1-thio-β-d-galactopyranoside (IPTG), and d-desthiobiotin, were all purchased from J&K Scientific, Ltd. (Shanghai, China). 4CBA-CoA (97% purity) was synthesized according to Mieyal et al. (53), while 4HBA-CoA (90% purity) was synthesized according to Merkel et al. (54) and Liang et al. (55), with both prepared as 20 mM stock solutions in ddH₂O. For 4CBA-CoA preparation, 200 mg CoA lithium salt was dissolved in 4 ml ddH₂O (pH 8.0). A 5-fold molar excess of 4CBA was added to the rapidly stirring solution under N₂ at 25°C, and the pH of the reaction solution was maintained at approximately 8.0 by the addition of 0.2 M LiOH. After 30 min of stirring, the pH of the solution was adjusted to 4.0 with 1 M HCl. Following an additional stirring of 30 min, the precipitated benzoic acid derivative was removed by centrifugation (12,000 × g, 10 min). The supernatant was chromatographed on a Sephadex G-25 column to purify the product. The product-containing fractions were pooled and evaporated to dry on a rotary evaporator. For 4HBA-CoA preparation, 50 μl ethyl chloroformate and 68 μl triethylamine were added into a stirred solution of 0.5 mM 4HBA in 20 ml of dry tetrahydrofuran at 25°C under N₂. A white precipitate that formed over a period of 1 h was removed by filtration. The resulting clear solution was subsequently added dropwise to 10 ml ddH₂O in which was dissolved 36 mg CoA lithium salt solution under the protection of N₂ (over a 60-min period). The pH of the solution was maintained at approximately 8.0 by the addition of 0.2 M LiOH. After stirring for an additional 1 h under N₂, the solution was adjusted to pH 4.0 with 1 M HCl. Unconsumed acid was removed by three extractions with ethyl acetate. The product was purified using a Sephadex G-25 column as described above. Quality checking of prepared 4CBA-CoA and 4HBA-CoA were performed by HPLC and mass spectrum analyses (Fig. S6 and S7).

The bacterial strains and plasmids used in this study are listed in Table 1, and all oligonucleotide primers are listed in Table 2. Escherichia coli strains were cultured in Luria-Bertani (LB) medium (NaCl, 5.0 g liter⁻¹; yeast extract, 5.0 g liter⁻¹; and tryptone, 10.0 g liter⁻¹ [pH 7.0]) or acidic LB medium (pH 5.5) at 37°C. Comamonas sediminis CD-2 was grown aerobically in LB medium or mineral salt medium (MSM) (NaCl, 1.0 g liter⁻¹; NH₄NO₃, 1.0 g liter⁻¹; K₂HPO₄, 1.5 g liter⁻¹; KH₂PO₄, 0.5 g liter⁻¹; and MgSO₄·7H₂O, 0.2 g liter⁻¹ [pH 7.0]) at 30°C. Antibiotics were added as follows: ampicillin (Ap), 100 mg liter⁻¹; gentamicin (Gm), 50 mg liter⁻¹; kanamycin (Km), 50 mg liter⁻¹; and chloramphenicol (Cm), 30 mg liter⁻¹.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Characteristics	Source
Strains
Escherichia coli
DH5α	F− recA1 endA1 thi-1 supE44 relA1 deoR Δ(lacZYA-argF)U169 Φ80dlacZΔM15	Invitrogen
Rosetta (DE3)	F− ompT hsdS(rB¯ mB¯) gal dcm lacY1 (DE3)/pRARE (Cmr)	Invitrogen
Comamonas sediminis
CD-2	p-chlorobenzoate degradation strain containing fcbBAT1T2T3CR operon	(14)
CD-fcbRMT	fcbR-disrupted mutant from strain CD-2; Gmr	This study
CD-fcbRMTC	Mutant CD-fcbRMT harboring pB2fcbR; Gmr, Kmr	This study
Plasmids
pMD19-T	TA clone vector, Apr	Invitrogen
pMfcbPT	pMD19-T containing fcbB promoter, Apr	This study
pBBR1MCS-2	Broad-host-range cloning vector, Kmr	(62)
pBBR1MCS-5	Broad-host-range cloning vector, Gmr	(62)
pB2fcbR	pBBR1MCS-2 harboring fcbR, Kmr	This study
pSRGFP-18	Transcription factor screening vector, Apr	(60)
pSR-P	pSRGFP-18 harboring promoter of fcbB in front of gfp, Apr	This study
pSR-R	pSRGFP-18 harboring fcbR, Apr	This study
pSR-PR	pSRGFP-18 harboring promoter of fcbB and fcbR	This study
pCUGIBAC1	Melon bacterial artificial chromosome (BAC) library construction vector; Apr, Cmr	(61)
pBAC	One copy no. BAC library, Cmr	This study
pBAC-fcbT	pBAC harboring fcbT1T2T3, Cmr	This study
pBAC-fcbAT	pBAC harboring fcbAT1T2T3, Cmr	This study
pBAC-fcbBAT	pBAC harboring fcbBAT1T2T3, Cmr	This study
pBAC-hbaA	pBAC harboring hbaA, Cmr	This study
pET-29a(+)	Expression vector, Kmr	Invitrogen
pETstFcbR	pET-29a(+) harboring Strep-tag II-labeled fcbR, Kmr	This study

TABLE 2.

Oligonucleotides used in this study

Primers	Sequence (5′ to 3′)a	Purpose
TSS-A	AACACCGGCCTCTTCACACGAAT	5′-RACE of the fcbBAT1T2T3C cluster
TSS-B	CACCAGAGGGCAGCGACTCGGAA
TSS-C	CACGTTGTCGTCTTCCTCGGCTC
TSS-R-A	AGGTGTCGCTTGATCATTTCG	5′-RACE of fcbR
TSS-R-B	CGATTGTCGAATTTCAGTCGA
TSS-R-C	AACCCTCGATCGCGTAGACAC
Tu-BA-F	AGAACGTGATCTCGTCTGTGA	Transcription unit detection (fcbB-fcbA)
Tu-BA-R	CGTCTGTAGCTCTGCGTGCGT
Tu-AT1-F	GACGCCTTCTGCCGCTCCAGTG	Transcription unit detection (fcbA-fcbT1)
Tu-AT1-R	ACGCCCTTGCCGGTAGAGTTGA
Tu-T1T2-F	GTACGTCGTGCATACGACGAAG	Transcription unit detection (fcbT1-fcbT2)
Tu-T1T2-R	CACATCAGCACAGATGACGAGC
Tu-T2T3-F	ACAATCGAGTTTCTGCTGCGTA	Transcription unit detection (fcbT2-fcbT3)
Tu-T2T3-R	CAGGCGCCCACCACATTGATG
Tu-T3C-F	CTGATTCTGATTTTCTTCTGGC	Transcription unit detection (fcbT3-fcbC)
Tu-T3C-R	TTCCGACGATGCCTCGCTCAG
DeR-1F	GCTGCCCGATGTGTTCGTGGGAC	Gene knockout of fcbR (upper homologous arm amplification)
DeR-1R	TCATTTCAGAGCCTGGTGACACTCGGAATCCT
DeR-2F	GTGTCACCAGGCTCTGAAATGAGCTGTTGACAATTAATCATCGGCTC	Gene knockout of fcbR (gentamicin resistance gene amplification)
DeR-2F1	TTGACAATTAATCATCGGCTCGTATAATGTGTGGAGGTATTCACACAGGA
DeR-2F2	TGTGGAGGTATTCACACAGGAAACAGCTATGTTACGCAGCAGCAACGATG
DeR-2R	AGAATTCGAACTTAGGTGGCGGTACTTGGGTC
DeR-3F	CCGCCACCTAAGTTCGAATTCTAGCTTGAGCG	Gene knockout of fcbR (downstream homologous arm amplification)
DeR-3R	TCTGAGTACACGTCCTTCTCAA
GcR-F	TACAGGTACCTCCGCTCAAGCTAGAATTCGA (KpnI)	Genetic complementation of fcbR
GcR-R	GATATCTAGAGCTTCGCGCCATTCCCATACCTGAG (XbaI)
q16S-F	AGTCCACGCCCTAAACGAT	RT-qPCR of 16S rRNA gene
q16S-R	AAACCACATCATCCACCGCTTG
qB-F	CCTGGCACAGCATCGGCATT	RT-qPCR of fcbB
qB-R	AGACGCGATTGACGATGCCCCA
qA-F	CCGCTGAACTTGCCGAGCTGA	RT-qPCR of fcbA
qA-R	GTCGCAAGGCTCCCCATCTCGT
qT1-F	CATCAACTATGTGGGTGGTCCTCGT	RT-qPCR of fcbT1
qT1-R	AACTTGCATCAGCTTCAGAGCGTCA
qT2-F	TTGACATCCTCTGTGCACGTCCT	RT-qPCR of fcbT2
qT2-R	GTCGCATACGCAGCAGAAACTCG
qT3-F	CTCCCTCACGCCGATTCCTC	RT-qPCR of fcbT3
qT3-R	AAAAGAAGGTTCCAGCGACGAC
qC-F	TCATCTCCTGCGGCGTCCC	RT-qPCR of fcbC
qC-R	CTTACCCCACTCCCGGACCTC
qR-F	CGCTTGAAGTAAGACCCGAGT	RT-qPCR of fcbR
qR-R	GAAGTCTCCGCGTCTAGTCCCT
fcbPT-F	GAATCTCGAGCACGAGGGAAATCAATAGGTCCA (XhoI)	Promoter (PfcbB) insertion into pSRGFP-18
fcbPT-R	TCCTACTAGTCACGTTGTCGTCTTCCTCGGCTCG (SpeI)
fcbR-F	GTGAGGTACCTCCGCTCAAGCTAGAATTCGA (KpnI)	fcbR insertion into pSRGFP-18 and pSR-P
fcbR-R	CCAATCTAGAGCTTCGCGCCATTCCCATACCTGAG (XbaI)
Gi-pBAC-1F	TTCGTGGGACGTTAAGAGTATTCTATAGTGTCACCT	Gibson assembly (pBAC forward primer 1)
Gi-pBAC-2F	GCGAAACACGCTTGAGAGTATTCTATAGTGTCACCTAA	Gibson assembly (pBAC forward primer 2)
Gi-pBAC-R	ATGATTAATTGTCAACAGCTCATTTCAGAGGCATGCCTGCAGGTCGACTCTAGAG	Gibson assembly (pBAC reverse primer)
Gi-Ptac-F	CTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAGGTATTCA	Gibson assembly (Ptac introduction)
Gi-fcbT1-F	GTATAATGTGTGGAGGTATTCACACAGGAAACAGCTATGCGTATTCATCGTCGCCAGT	Gibson assembly (fcbT1 forward primer)
Gi-fcbA-F	GTATAATGTGTGGAGGTATTCACACAGGAAACAGCTATGCAGACAGTCAATGAGTTGC	Gibson assembly (fcbA forward primer)
Gi-fcbB-F	GTATAATGTGTGGAGGTATTCACACAGGAAACAGCTATGTACGAAGCCATCGGTCACC	Gibson assembly (fcbB forward primer)
Gi-fcbT3-R	CACTATAGAATACTCTTAACGTCCCACGAACACATC	Gibson assembly (fcbT3 reverse primer)
Gi-hbaA-F	ACACAGGAAACAGCTATGATTGACTTCAGTCAACCCTT	Gibson assembly (hbaA forward primer)
Gi-hbaA-R	CACTATAGAATACTCTCAAGCGTGTTTCGCCTCCTTCT	Gibson assembly (hbaA reverse primer)
Gi-pET29-F	ATTCGAGCTCCGTCGACAAGC	FcbR heterologous expression (Gibson assembly, pET29a)
Gi-pET29-R	ATGTATATCTCCTTCTTAAAGT
Gi-fcbR-F1	AGCCACCCGCAGTTCGAAAAGGATGACGACGACAAGATGAGCAACCCTCAACGCTCGAC	FcbR heterologous expression (Gibson assembly, Strep-tag II-labeled fcbR)
Gi-fcbR-F2	TTTGTTTAACTTTAAGAAGGAGATATACATATGTGGAGCCACCCGCAGTTCGAAAAGGA
Gi-fcbR-R	CGGCCGCAAGCTTGTCGACGGAGCTCGAATCTAACGCTCTTCCCCGGCGGCGACT
EMSA-CK-F	AAACTGGATTCGTTGCGCCACA	EMSA control probe
EMSA-CK-R	AACGATCCGCACTTCCGAGA
EMSA-fcb-F	CACGAGGGAAATCAATAGGTCCA	EMSA probe of fcbB promoter
EMSA-fcb-R	CACGTTGTCGTCTTCCTCGGCTCG	EMSA probe of fcbR promoter
EMSA-fcbR-F	AAATCAACAAAGCCGGGAA
EMSA-fcbR-R	GAGCATCGGCTATGTCCTTA
FAM-M13F	FAM-CCCAGTCACGACGTTGTAAAACG	DNase I footprinting
M13R	AGCGGATAACAATTTCACACAGGA

^aRestriction enzyme cutting sites are underlined and specified after the sequence.

Transcription start site detection of the fcb cluster.

The transcription start site (TSS) of the fcbBAT1T2T3C cluster and fcbR were detected by 5′-rapid amplification of cDNA ends (5′-Full RACE kit, TaKaRa, Dalian, China). Total RNA was extracted from Comamonas sediminis CD-2 cells grown in MSM containing 0.5 mM 4CBA using a MiniBEST universal RNA extraction kit (TaKaRa, Dalian, China). First-strand cDNA was synthesized with the primer TSS-A or TSS-R-A and then poly A tailed by terminal deoxynucleotidyl transferase (TdT) with dATP. The poly A-tailed cDNA was subsequently used as a template for PCR. After amplification using the abridged anchor primer (APP) and TSS-B (TSS-R-B for fcbR), the resulting product was further amplified with the primers APP and TSS-C (TSS-R-C for fcbR) to generate the final PCR fragment, and TA clones of the final PCR products were sequenced. To test whether the fcbBAT1T2T3C cluster was in one transcriptional unit, sequences between two adjacent ORFs were detected by PCR using cDNA as a template.

pSRGFP-18- and pCUGIBAC1-based plasmid construction.

pSRGFP-18-based plasmids were constructed using restriction endonucleases and T4 DNA ligase. The promoter of the fcb cluster was amplified with the primer pair fcbPT-F and fcbPT-R, and then cloned into the XhoI and SpeI sites of pSRGFP-18 to generate pSR-P. The fcbR gene was PCR amplified using the primer pair fcbR-F and fcbR-R, and the resulting PCR product was cloned into the KpnI and XbaI sites of pSRGFP-18 and pSR-P to obtain pSR-R and pSR-PR, respectively.

pCUGIBAC1-based plasmids were constructed by Gibson assembly (56). The Gibson assembly fragment of pCUGIBAC1 was amplified using the primer pair Gi-pBAC-F and Gi-pBAC-R. Then, fcbT1T2T3, fcbAT1T2T3, and fcbBAT1T2T3 were PCR amplified with the primer pairs Gi-fcbT1-F/Gi-fcbT3-R, Gi-fcbA-F/Gi-fcbT3-R, and Gi-fcbB-F/Gi-fcbT3-R, respectively. The constitutively expressed promoter P_tac was introduced into the above three fragments by PCR amplification using Gi-Ptac-F and Gi-fcbT3-R as primers. The resulting PCR products were assembled with the pCUGIBAC1 Gibson assembly fragment, and the corresponding plasmids pBAC-fcbT, pBAC-fcbAT, and pBAC-fcbBAT were obtained. To construct pBAC-hbaA, the hbaA gene from strain CD-2 was PCR amplified with the primers Gi-hbaA-F and Gi-hbaA-R, and then P_tac was introduced by PCR amplification with the primers Gi-Ptac-F and Gi-hbaA-R. Finally, the resulting PCR product was assembled with the Gibson assembly fragment of pCUGIBAC1.

Measurement of green fluorescent protein expression.

The fluorescence of the plated colonies was assessed using the genetically modified organism (GMO) detection mirror (Nightsea, GFP-1, Lexington, USA). To quantify gfp expression, the optical density at 600 nm (OD₆₀₀) of the cells was adjusted to about 0.5, and the cells were then analyzed using a microplate reader (SpectraMax i3x, Molecular Devices, USA) with an excitation wavelength of 485 nm and emission wavelength of 535 nm. The bandwidths for excitation and emission were 9 and 15 nm, respectively.

Gene knockout and genetic complementation.

The fcbR gene was knocked out by a double-crossover event. The upstream and downstream homologous arms were amplified using the primer pairs DeR-1F/DeR-1R and DeR-3F/DeR-3R, respectively. The gentamicin resistance gene was amplified from plasmid pBBR1MCS-5 using primers DeR-2F2 and DeR-2R, and the promoter P_tac was introduced by two additional PCR amplifications using DeR-2F1 and DeR-2F as the forward primer. These three DNA fragments were then joined by overlap extension PCR to generate the homologous recombination fragment DeR. Finally, the DeR fragment was electroporated into cells of strain CD-2. Electroporation was performed in a 0.2-cm-gap cuvette (Bio-Rad) using a Gene Pulser II system (Bio-Rad) set at 2.5 kV, 25 μF, and 200 Ω. After resuscitation in LB medium at 30°C for 6 h, the cells were centrifuged at 6,000 rpm for 3 min and spread onto selective plates. The positive knockout strain, designated CD-fcbRMT, was assessed by PCR amplification and sequencing using primers DeR-1F and DeR-3R. To obtain the fcbR-complemented strain CD-fcbRMTC, fcbR was first amplified with the primer pair GcR-F and GcR-R. Next, the resulting PCR product was cloned into the KpnI and XbaI sites of the broad-host-range plasmid pBBR1MCS-2 to generate pB2fcbR, which was subsequently electroporated into the ΔfcbR mutant CD-fcbRMT strain.

Bacterial growth on 4CBA and degradation assay.

The tested strains were cultured in LB broth at 30°C to OD₆₀₀ = 0.6, after which cells were harvested by centrifugation and washed twice with MSM medium. The washed cells were then incubated at 30°C in MSM medium containing 0.5 mM 4CBA, with an initial cell density of OD₆₀₀ = 0.03. Bacterial growth and the concentration of 4CBA were detected every 4 h by plate counting and high-pressure liquid chromatography (HPLC) detection, respectively. For HPLC detection, 0.5 ml of sample was mixed with 1 ml of methanol and filtered through a 0.22-μm membrane filter. Then, 20 μl of this mixture was detected using an UltiMate 3000 instrument (Thermo Fisher Scientific, USA) equipped with a UV detector set at a wavelength of 230 nm and a Kromasil 100-5C₁₈ reverse phase column (4.6 × 250 mm × 5 μm) using a mobile phase of 80% (vol/vol) methanol at a flow rate of 1 ml min⁻¹. The concentration of 4CBA was calculated using a standard curve of 4CBA.

Reverse-transcription quantitative PCR.

Strain CD-2, the ΔfcbR mutant strain CD-fcbRMT, and the fcbR-complemented strain CD-fcbRMTC were cultured in LB medium with appropriate antibiotics to an optical density of OD₆₀₀ = 0.6. Next, the cells were harvested and washed twice with MSM medium. The washed cells were incubated in MSM medium (final cell density, OD₆₀₀ = 2.0) at 30°C for 3 h in the presence of 0.5 mM 4CBA. MSM medium with 0.5 mM succinate was used as the control. Total RNA was extracted as described above, and genomic DNA (gDNA) was digested with gDNA Eraser (TaKaRa, Dalian, China) at 42°C for 2 min. Reverse transcription was then conducted with 1 μg of gDNA-removed RNA using random primers. Then, cDNA was synthesized by incubating the sample at 37°C for 15 min, and the reaction was stopped by heating at 85°C for 5 s. Every sample was diluted 10-fold to serve as a template for qPCR. The qPCR analysis of fcbBAT1T2T3C expression was performed in an Applied Biosystems 7300 real-time PCR system (Applied Biosystems, USA) using a SYBR Premix Ex Taq RT-PCR kit (Tli RNaseH Plus) (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The transcription of the 16S rRNA gene was set as an internal standard, and relative expression was quantified according to the 2^-ΔΔCT threshold cycle (C_T) method using 3 replicates (57).

Heterologous expression and purification of Strep-tag II-labeled FcbR.

The open reading frame of the fcbR gene was amplified with the primers fcbRE-F1 and fcbRE-R, the product of which was then used as a template for PCR in which the Strep-tag II codon was introduced with the primer pair fcbRE-F2 and fcbRE-R. The resulting DNA product was cloned into pET-29a(+) to generate the expression plasmid pETstFcbR by Gibson assembly. E. coli Rosetta (DE3) cells harboring pETstFcbR were cultured in LB medium supplemented with 50 mg liter⁻¹ kanamycin and 30 mg liter⁻¹ chloramphenicol at 37°C to OD₆₀₀ = 0.6, and isopropyl 1-thio-β-d-galactopyranoside (IPTG) was then added to a final concentration of 0.15 mM to induce the expression of Strep-tag II-labeled FcbR. After 16 h of incubation at 16°C, the cells were harvested from 500-ml cultures by centrifugation. After being washed twice with WB buffer (20 mM Tris-HCl and 200 mM NaCl [pH 8.0]), the cells were resuspended in 40 ml of WB buffer and disrupted by sonication at 4°C. Then, cell debris was removed by centrifugation at 12,000 × g for 30 min at 4°C and filtered through a 0.22-μm membrane filter.

FcbR was purified at 4°C through three steps. First, a 30 to 50% ammonium sulfate precipitation was performed, and the resulting precipitate was resuspended in 20 ml WB buffer. Then, 5-cm³ Ni-NTA resin was incubated with the supernatant for 1 h, washed with 40 ml WB buffer three times, and eluted with 20 ml 100 mM imidazole containing WB buffer. Finally, the eluted solution was mixed with 5-cm³ of Strep-Tactin resin (IBA Lifesciences, Göttingen, Germany) for 30 min, washed with 40 ml of WB buffer three times, and FcbR was eluted in 5 ml of WB buffer containing 2.5 mM d-desthiobiotin. The eluted protein was concentrated using Millipore concentrators by centrifugation at 6,000 × g for 30 min at 4°C. The concentration of the purified FcbR was determined by the Bradford method with bovine serum albumin (BSA) as a standard, and the purity was detected by 12% SDS-PAGE.

Electrophoretic mobility shift assay.

A nonradioactive electrophoretic mobility shift assay (EMSA) was performed according to the method described by De la Cruz et al. (58). A 241-bp promoter DNA probe of the fcb operon and a 249-bp promoter DNA probe of the fcbR gene were PCR amplified using the primer pair EMSA-fcb-F/EMSA-fcb-R and EMSA-fcbR-F/EMSA-fcbR-R and purified with a DNA purification kit (Vazyme Biotech, Nanjing, China), respectively. A nonspecific DNA fragment (comprising an internal fcbA sequence) was PCR amplified using the primers EMSA-CK-F and EMSA-CK-R and used as the negative control. DNA probes were mixed with different concentrations of purified FcbR in EMSA buffer (100 mM Tris-HCl, 5% [vol/vol] glycerol, and 1 mM DTT [pH 8.0]). After incubating at 25°C for 10 min, the mixtures were separated by 5% (vol/vol) native polyacrylamide gel electrophoresis at 100 V for 1 h with 0.5× Tris-glycine-ethylenediaminetetraacetic acid buffer (12.5 mM Tris base, 125 mM glycine, and 1 mM EDTA [pH 8.0]). Gels were stained with ethidium bromide, and images were taken using a Tanon 1600 gel imaging system (Shanghai, China) under UV irradiation.

Isothermal titration calorimetry.

Isothermal titration calorimetry (ITC) experiments were performed using a MicroCal iTC₂₀₀ instrument (GE Healthcare, USA) at 30°C. FcbR, the oligonucleotide, and 4CBA-CoA were freshly prepared in WB buffer (20 mM Tris and 200 mM NaCl [pH 8.0]). The oligonucleotide used comprised the 42-bp binding site for FcbR to the fcb operon, which was determined by DNase I footprinting assay, and was obtained by incubating an oligonucleotide (5′-GGAAATCAATAGGTCCATAGAAAATCTATTGACTAATCGAAT-3′) and its complementary counterpart (5′-ATTCGATTAGTCAATAGATTTTCTATGGACCTATTGATTTCC-3′) at 95°C for 10 min before being slowly cooled to room temperature. Titration was performed with an initial 0.5 μl injection of 40 μM DNA oligonucleotide or 0.5 mM 4CBA-CoA in the syringe followed by 2.0 μl injections at 120 s intervals. A control experiment was performed by titrating buffer into the FcbR solution. The stirring speed was set at 600 rpm. The binding isotherms were fitted using Origin 7.0 in a single-site-binding model, and the stoichiometry value of binding (N) and the equilibrium dissociation constant (K_D) were calculated.

DNase I footprinting assay.

A DNase I footprinting assay was performed as described by Zianni et al. (59). The promoter region of the fcb operon was amplified with the primer pair EMSA-fcbR-F and EMSA-fcbR-R and cloned into the plasmid pMD19-T to generate pMfcbPT. The fluorescent FAM-labeled DNA probe was amplified from pMfcbPT using the primers FAM-M13F and M13R, purified with a DNA purification kit (Vazyme Biotech, Nanjing, China), and quantified with a NanoDrop 2000 (Thermo Fisher Scientific, USA). Approximately 500 ng of DNA probe was incubated with 5 μg FcbR at 25°C for 20 min, and then 0.015 units of DNase I (Promega) and 100 nmol CaCl₂ were added. After a further incubation at 25°C for 1 min, the reaction was stopped by adding DNase I stop solution (200 mM unbuffered sodium acetate, 30 mM EDTA, and 0.15% SDS). Samples were phenol extracted, ethanol precipitated, and dissolved in 15 μl of Milli-Q water before being mixed with HiDi formamide and GeneScan-LIZ500 size standards. Then, the sample was analyzed with an Applied Biosystems 3730 DNA analyzer.

Data availability.

The nucleotide sequence of fcbBAT1T2T3C-fcbR in strain CD-2 has been deposited in the GenBank database under the accession number MW021341.