An investigation of the impact of triclosan adaptation on Proteus mirabilis clinical isolates from an Egyptian university hospital

Abstract

Antibiotic resistance is a main threat to the public health. It is established that the overuse and misuse of antibiotics are highly contributing to antibiotic resistance. However, the impact of nonantibiotic antimicrobial agents like biocides on antibiotic resistance is currently investigated and studied. Triclosan (TCS) is a broad-spectrum antibacterial agent widely used as antiseptic and disinfectant. In this study, we aimed to evaluate the effect of exposure of Proteus mirabilis clinical isolates to sublethal concentrations of TCS on their antibiotic susceptibility, membrane characteristics, efflux activity, morphology, and lipid profile. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of TCS were determined for 31 P. mirabilis clinical isolates. The tested isolates were adapted to increasing sublethal concentrations of TCS. The MICs of 16 antibiotics were determined before and after adaptation. Membrane characteristics, efflux activity, ultrastructure, and lipid profile of the tested isolates were examined before and after adaptation. Most adapted P. mirabilis isolates showed increased antibiotic resistance, lower membrane integrity, lower outer and inner membrane permeability, and higher membrane depolarization. Nonsignificant change in membrane potential and lipid profile was found in adapted cells. Various morphological changes and enhanced efflux activity was noticed after adaptation. The findings of the current study suggest that the extensive usage of TCS at sublethal concentrations could contribute to the emergence of antibiotic resistance in P. mirabilis clinical isolates. TCS could induce changes in the bacterial membrane properties and increase the efflux activity and in turn decrease its susceptibility to antibiotics which would represent a public health risk.

Introduction

Antibiotic resistance is a global public health issue which is defined as the ability of bacteria to withstand and survive an antibiotic concentration that typically inhibits the growth of the majority of other bacteria [4]. Antibiotic resistance is spreading worldwide due to many factors. One of these factors is the extensive use of antibiotics in medicine for treating different bacterial infections in humans and animals [38]. Another factor includes the improper utilization of biocides (disinfectants, antiseptics, and preservatives) in both households and hospitals. Triclosan (TCS) is widely used as disinfectant and for personal hygiene purposes [37]. TCS is found in a broad range of consumer products like hand soap, toothpaste, deodorant, hand lotion, hand cream, surgical scrubs, shower gel, and mouthwash. The growing use of TCS has led to many concerns about its potential to assist in the spreading of antibiotic resistance [18, 29, 30, 33]. The impact of the exposure to TCS on antibiotic resistance in certain bacterial species has been reported, but up to our knowledge, this is the first time to study the impact of TCS exposure on Proteus mirabilis clinical isolates in Egypt. P. mirabilis bacteria are Gram-negative rods which are well-known bacterial species in microbiology laboratories by its swarming motility across the agar surfaces. In addition, it can produce urease enzyme which hydrolyzes urea into ammonia and carbon dioxide. Swarming motility and urease production are the two hallmarks for identification of this microorganism [31]. P. mirabilis is a common cause of urinary tract infections (UTI) in Egypt [11, 16]. The antibiotic resistance in P. mirabilis is increasing, and the emergence and spread of multidrug-resistant P. mirabilis isolates are being more and more frequently reported [14]. In the current study, we are trying to investigate one of the possible aspects of the reasons of the spread of antibiotic resistance among P. mirabilis clinical isolates in Egypt. This was accomplished by studying the impact of the exposure of P. mirabilis isolates to sublethal concentrations of TCS on cell membrane permeability and integrity, membrane depolarization and potential, efflux pump activity, cell morphology, and lipid profile.

Materials and methods

Bacterial isolates

A total of 31 P. mirabilis isolates were collected from the departments of Tanta University Hospital. Then the bacterial isolates were examined microscopically and were identified using standard biochemical tests [21]. Proteus mirabilis (ATCC 35659) was used as a reference strain.

Chemicals

The chemicals used in the present study were bis-(1,3-dibutylbarbituric acid) trimethine oxonol [DiBAC4(3)] (Invitrogen) and 1-N-phenylnaphthylamine (NPN) (Himedia). All the other chemicals utilized (including TCS, the tested antibiotics, O-nitrophenyl-β-galactopyranoside, and ethidium bromide) were of analytical grade, and they were purchased from Sigma-Aldrich.

Determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of TCS

The MIC of TCS for each tested bacterial isolate was determined by broth microdilution method using Mueller-Hinton broth (MHB, Oxoid) as stated by CLSI guidelines (2017). Each microtitration plate contained an uninoculated well (negative control) and growth control well (positive control). The lowest antibiotic concentration which completely inhibited the bacterial growth (MIC) was revealed by absence of turbidity in the wells compared to the positive and negative control. After determination of MICs, the wells that showed growth inhibition were subcultured on Mueller-Hinton agar (MHA, Oxoid) for MBC determination. The MBC was determined as the lowest concentration of TCS required for killing bacteria after incubation at 37°C for 24 h. The bacterial isolates were considered to be tolerant to TCS if the MIC> 7.5 μg ml⁻¹ as reported by Curiao et al. [8].

Adaptation of bacterial isolates to TCS

It was carried out by daily exposing of the tested isolates to increasing sublethal concentrations of TCS as described by Soumet et al. [34] and Elbanna et al. [10] starting with a concentration of half of the MBC of TCS. When the growth was observed, a 10-fold diluted culture was then transferred to a fresh MHB supplemented with a higher concentration of TCS. This procedure was continued until no growth was detected after incubation for 24 h at 37°C. Then the suspension from the last tube, showing bacterial growth, was spread using a loop on MHA and incubated for 24 h at 37°C for conformation of the growth and storage.

Determination of antibiotic MICs

The susceptibility of P. mirabilis isolates to 16 antibiotics was tested before and after adaptation to TCS on MHA using agar dilution method according to the guidelines of the CLSI [6]. The tested antibiotics were ampicillin/sulbactam; ampicillin; cefazoline; cefaclor; cefotaxime; cefepime; azithromycin; erythromycin; amikacin; gentamicin; tetracycline; chloramphenicol; ciprofloxacin; lomefloxacin; imipenem; sulfamethoxazole/trimethoprim.

Integrity of cell membranes

The integrity of cell membranes of the tested isolates, before and after adaptation, was investigated by determination of the release of materials absorbing at 260 nm [19]. Bacterial cells were grown in nutrient broth in order to obtain a culture with an OD₆₃₀ of 0.4. The tested isolates were harvested by centrifugation, and the pellets were resuspended in 0.5 % NaCl solution. Then, the final cell suspension was adjusted to 0.7 at an absorbance of 420 nm. The release of materials absorbing at 260 nm was monitored over time using 1800 UV-Vis spectrophotometer (SHIMADZU, Japan).

Cell membrane permeability

Inner cell membrane permeability was examined by detection of the release of β-galactosidase enzyme from the cytoplasm of the tested isolates and measuring its activity using O-nitrophenyl-β-galactopyranoside (ONPG) as a substrate for the β-galactosidase enzyme [32]. Cultures of bacterial isolates in nutrient broth containing 2% lactose were harvested by centrifugation, washed twice, and resuspended in 0.5% NaCl solution. Then 1.6 ml of the bacterial suspension was mixed with 150 μl of 34 mM ONPG solution. The o-nitrophenol (ONP) produced over time was monitored by determining the increase in the absorbance at 420 nm using ELISA reader (Sunrise Tecan, Austria). Outer membrane permeability of the tested isolates was tested before and after TCS adaptation as described by Halder et al. [15]. Briefly, 5mM of NPN stock solution in ethanol was diluted using potassium phosphate buffer (PBS) (pH 7.5) to a concentration of 20 μM. The fluorescence of the tested samples was measured (excitation and emission wavelength of 340 and 420 nm, respectively) using the fluorescence spectrophotometer (SHIMADZU, Japan).

Membrane potential

Measurement of zeta potential of the membranes of the tested isolates, suspended in 0.5-mM PBS (pH 7.4), was performed before and after adaptation as described by Halder et al. [15]. Zetasizer Nano ZS 90 (Malvern, UK), with helium-neon laser (633 nm) as a source of light, was used, and the detection was carried out at 90-degree scattering angle.

Membrane depolarization

Membrane depolarization was measured using DiBAC4(3) (Molecular Probes) as described by Seong and Lee [32]. The tested isolates before and after adaptation were harvested by centrifugation and resuspended in PBS, and then the cells were stained with 5-μg/ml DiBAC4(3). A FACSVerse flow cytometer (BD Biosciences, USA) was utilized to analyze staining of cells.

Efflux pump activity

The fluorometric cartwheel method was utilized for testing the efflux of ethidium bromide (EtBr) in the tested isolates before and after adaptation to TCS as reported by Suresh et al. [35]. Tryptic soy agar supplemented with concentrations of EtBr ranging from zero to 2.5 mg l^-1 were prepared and protected from light. Afterward, the EtBr-agar plates were divided into sectors by radial lines. Then, cultures were swabbed onto the plates starting from the plate center toward the edges and incubated at 37°C for 16–18 h. The plates were visualized using 1800 UV-Vis transilluminator (SHIMADZU, Japan) and photographed. The lowest concentration of EtBr that produced fluorescence of the bacterial isolates was recorded, using the reference strain as negative control.

Real-time PCR (RT-PCR)

The expression of four efflux pump genes (acrB, mdfA, norE, and yihV) were examined before and after TCS adaptation using RT-PCR, and gapA gene was used as housekeeping gene as reported by Huguet et al. [17] and Abdelaziz et al. [1] using Rotor-Gene Q 5plex (Qiagen). The total RNA was extracted from the tested isolates using the PureLink® RNA Mini Kit (Thermo Scientific). Concentrations and the purity of RNA were estimated using NanoDrop ND1000 UV-Vis spectrophotometer (Thermo Scientific). Afterward, RNA was retrotranscribed into cDNA by power cDNA synthesis kit (iNtRON Biotechnology). Amplification of the tested genes was accomplished using specific primers (Table 1) using Power SYBR® Green Master Mix (Thermo Scientific). Negative control of RNA sample amplified without reverse transcription was utilized. The relative gene expression was measured by the 2^−ΔΔCt method as suggested by Livak and Schmittgen [20]. The expression of the isolates not exposed to biocides was set to 1 (these isolates were utilized as calibrators or control samples). An increase of 2-fold or more in the gene expression in comparison with that of the control samples was supposed to be an indication of overexpression [12]. All the experiments were carried out in triplicate, and the results were displayed as mean ± SD values.

Table 1.

Primers used in RT-PCR

Genes	Primers (5′ to 3′)	Reference
acrB	F: 5′-GAAGAGCACGCACCACTACAC R: 5′-GCAGACGCACGAACAGATAGG	Huguet et al. [17]
mdfA	F: 5′-TTTATGCTTTCGGTATTGG R: 5′-GAGATTAAACAGTCCGTTGC
norE	F: 5′-TCGCAGGACATCAGATTG R: 5′-CAGACACCCACCATAAGC
yihV	F: 5'- GGCTATCATCCTCGTCTTCC R: 5'- GCGTCATCCACCAGTAACC
gapA	F: 5'-GGACGAAGTTGGTGTTGAC R: 5'-TTCTGAGTAGCGGTAGTAGC

Examination using electron microscope

The tested isolates were examined using scanning electron microscope (SEM, Akashi Seisakusho, Japan) and transmission electron microscope (TEM, Jeol-1200 ECII, Japan). The procedures were performed as described by McDowell and Trump [24] in the Electron Microscope Unit, Mansoura University, Egypt. Briefly, the tested samples were centrifuged, and the cell pellets were first prefixed using 2.5% glutaraldehyde dissolved in 0.05-M cacodylate buffer. Then, the cells were post fixed using 1% osmium tetroxide dissolved in Ryter-Kellenberger buffer. Specimens were then mounted on aluminum stabs and sputter-coated with gold for examination by SEM. The samples were prepared for examination by TEM by fixation and dehydration and then infiltration using Epon 812 resin and embedded in appropriate capsules. Samples were then polymerized at 70°C in the oven. Thin grids were prepared using ultramicrotome, and they were stained with 7.5% (w/v) uranyl acetate and lead citrate and examined using TEM.

Lipid profile

Total lipids were extracted as described by Gidden et al. [13]. Briefly, bacterial cells were centrifuged and the pellet was washed with ice-cold (75%) ethanol. Then, it was mixed with 30 ml of a mixture of dichloromethane, ethanol, and water with a ratio of 1:1:1 (v:v:v). The mixture was then shaken for 1 min and left overnight. A biphasic system with a bottom organic layer (containing the lipids) was developed. The organic layer was carefully transferred using a pipette to another bottle and the solvent was evaporated under nitrogen until nearly 1 ml remained. Lipid profiles of the tested isolates, before and after adaptation, were detected. One microliter of the extracted lipids was mixed with 1 l of 1 M of 2,5dihydroxybenzoic acid (DHB) (in 90% methanol with 0.1% formic acid) and then spotted onto a MALDI target. Mass spectra (Bruker Daltonik, Germany) were obtained using Ultraflex II MALDI-TOF/TOF mass spectrometer in the Faculty of Medicine, Alexandria University, Egypt.

Statistical analysis

Independent repeating of the experiments at least three times was done in order to achieve the reproducibility. Data was expressed in the form of mean and standard deviation. One-way ANOVA was utilized for detection of the measurable differences between the tested isolates (p < 0.05) using IBM SPSS (17.0, IBM, USA).

Results

In the current study, it was found that 18% of the tested isolates were tolerant to TCS before adaptation. However, this percentage has increased to 30% after adaptation.

Antimicrobial susceptibility testing

A significant increase (p < 0.05) in the bacterial resistance to the tested antimicrobials has occurred after adaptation except for imipenem as shown in Table 2.

Table 2.

Prevalence of antimicrobial resistance in P. mirabilis isolates before and after adaptation to TCS

Antibiotic	No. of resistant isolates before TCS adaptation (%)	No. of resistant isolates after TCS adaptation (%)
Ampicillin/sulbactam	19 (61.3%)	29 (93.5%)
Ampicillin	20 (64.5%)	31 (100%)
Cefazoline	18 (58%)	31 (100%)
Cefaclor	17 (54.8%)	28 (90.3%)
Cefotaxime	13 (41.9%)	21 (67.7%)
Cefepime	9 (29%)	21 (67.7%)
Erythromycin	18 (58%)	30 (96.8%)
Azithromycin	17 (54.8%)	27 (87%)
Amikacin	12 (38.7%)	20 (64.5%)
Gentamicin	15 (48.4%)	25 (80.6%)
Tetracycline	13 (41.9%)	28 (90.3%)
Chloramphenicol	8 (25.8%)	17 (54.8%)
Ciprofloxacin	9 (29%)	16 (51.6%)
Lomefloxacin	8 (25.8%)	15 (48.4%)
Sulfamethoxazole/trimethoprim	6 (19.4%)	15 (48.4%)
Imipenem	2 (6.5%)	2 (6.5%)

Integrity of cell membranes

Monitoring the release of the material absorbing at 260 nm from the tested isolates was carried out before and after adaptation to TCS as shown in Fig. 1. A significant decrease (p˂ 0.05) in the membrane integrity was detected in 19.4% of the adapted cells.

Fig. 1.

Release of 260-nm absorbing material from representative P. mirabilis isolate before and after TCS adaptation

Cell membrane permeability

When the inner membrane of the bacterial isolates is permeable, ONPG can enter the cytoplasm, and it is degraded by β-galactosidase enzyme. This test was carried out in 96-well plate and ONPG was added to each well. The production of ONP was detected via monitoring the gradual increase in the absorbance at OD₄₂₀ with time as presented in Fig. 2. It was observed that there was a significant decrease in the inner membrane permeability in the adapted isolates relative to their original counterparts. The change in the outer membrane permeability in the adapted isolates was detected by monitoring the increase in the fluorescence of NPN using a spectrofluorophotometer every 1 h until no more increase in the emission intensity was detected. A significant decrease in the fluorescence of NPN was noticed in the adapted isolates as represented in Fig. 3.

Fig. 2.

Representative example of the change of the inner membrane permeability of P. mirabilis isolate before and after TCS adaptation

Fig. 3.

Representative example of the change of the outer membrane permeability of P. mirabilis isolate before and after TCS adaptation

Estimation of zeta potential

In the current study, zeta potential of tested isolates was measured before and after TCS adaptation. We found that there was nonsignificant change in the membrane potential of the tested isolates after adaptation.

Membrane depolarization

The change in the membrane potential of the tested isolates before and after adaptation was investigated by flow cytometry using DiBAC4(3) as a fluorescent probe. We observed that 58% of the isolates showed a significant increase in the fluorescent gap after its adaptation to TCS (p˂ 0.05). An example is shown in Fig. 4 where the fluorescent gap has increased from 20.7% before adaptation to 96.2% after adaptation to TCS.

Fig. 4.

Representative example of effect of TCS adaptation on membrane depolarization of P. mirabilis isolate before adaptation (dot plot (a) and histogram (b)) and after adaptation (dot plot (c) and histogram (d))

Detection of efflux activity

The EtBr-agar cartwheel method was used in the current study for detection of the efflux activity in the tested isolates before and after adaptation to TCS. The principle of this test depends on the ability of EtBr to traverse the cell wall of Gram-negative bacteria, and when it is concentrated inside the cell, it can fluoresce by UV light. Efflux pumps of bacteria can recognize this substrate, and they have the ability to extrude it to the external medium [22]. The minimum concentration of EtBr which produced fluorescence in each tested isolate was recorded before and after adaptation. Noteworthy, we found that 32.3% of P. mirabilis isolates showed an increase in the efflux activity after adaptation to TCS.

RT-PCR

For further comprehension of the influence of adaptation to TCS on efflux systems, we investigated the expression of four efflux pump genes in the adapted isolates relative to the corresponding non-adapted ones as shown in Table 3. Ten P. mirabilis isolates were examined by this test (which showed the highest increase in the fluorometric efflux with EtBr as detected by cartwheel method after adaptation) before and after repeated exposure to sublethal concentrations of TCS.

Table 3.

Relative gene expression (mean± SD) for the tested P. mirabilis isolates after adaptation to TCS

Isolate code	Relative gene expression*
	acrB	mdfA	norE	yihV
P1	3.1±0.8	8.2±1.1	1.1±0.3	15.3±0.2
P2	5.2±0.1	0.3±0.1	14.3±0.3	0.2±0.8
P3	1.8±0.2	1.5±0.1	16.1±0.1	2.8±0.2
P4	0.5±0.6	18.0±0.6	2.1±0.9	0.9±0.2
P5	12.1±0.1	1.1±0.2	9.0±0.6	1.3±0.2
P6	7.3±0.2	1.2±0.1	0.2±0.0	10±0.2
P7	2.9±0.3	18.0±2.0	1.7±0.2	11.1±0.0
P8	0.4±0.1	0.2±0.1	14±0.3	6.3±0.2
P9	0.4±0.2	10±0.2	2.9±0.1	16±0.7
P10	5.0±0.3	13.8±0.1	12.4±0.1	0.2±0.1

*The bold values point to changes in gene expression> 2-fold (relative gene expression calculated using 2^−ΔΔCT method)

Examination of the bacterial morphology before and after adaptation to TCS

In an attempt to reveal the reasons why bacterial adaptation to TCS decreased its susceptibility to the tested antimicrobials, we examined the morphological and ultrastructural changes that occurred in P. mirabilis isolates after adaptation to TCS using SEM and TEM.

The SEM analysis of the bacterial morphology revealed considerable morphological modifications exhibited after adaptation to TCS in 87% of the tested isolates as shown in Fig. 5. These modifications ranged from deformed cells to overall cell surface wrinkling. In addition, we observed cell wall disruption represented in cracks and holes or even complete cell lysis. Moreover, the cells were longer and thinner than their original non-adapted counterparts. The TEM examination of the adapted isolates showed certain changes in 76% of the tested isolates. These changes were represented by appearance of electron-dense regions, and a spacing between the inner and the outer cell membrane was observed as presented in Fig. 6.

Fig. 5.

Scanning electron microscope image of representative P. mirabilis isolate a before and b after adaptation to TCS

Fig. 6.

Transmission electron microscope image of representative P. mirabilis isolate a before and b after TCS adaptation

Lipid profile

Lipid extracts of P. mirabilis isolates adapted to TCS were subjected to analysis of their lipid profile using Ultraflex II MALDITOF/TOF mass spectrometer. Mass spectra of a representative isolate before and after adaptation to TCS are shown in Fig. 7. There were non-observable changes in the lipid profiles of the tested isolates after TCS adaptation.

Fig. 7.

Lipid profile of representative P. mirabilis isolate a before and b after adaptation to TCS

Discussion

The aim of this study was to comprehend the impact of adaptation of P. mirabilis isolates to TCS. In order to achieve this objective, we investigated the changes occurred in antibiotic susceptibility, membrane characteristics, efflux pump gene expression, ultrastructure, and lipid profile after TCS adaptation. TCS is a common biocide used in hospitals, farms, and households for both personal hygiene and disinfection purposes [8]. In the current study, there was a significant increase of the antibiotic resistance in the TCS adapted isolates. This outcome agrees with many reports of other authors [2, 7, 9, 26]. The bacterial cell membrane is a target for various antibacterial agents. It was found that the interactions of bacterial membranes with biocides cause many fundamental changes in the membrane structure and function [5]. The release of the intracellular components absorbing at 260 nm is used as an indication of the membrane damage [5]. We examined the integrity of the cytoplasmic membrane before and after TCS adaptation, and we found that there a significant decrease (p˂ 0.05) in the membrane integrity in 19.4% of the adapted isolates. This can be explained as TCS is well known to perturb the structure of the bacterial membranes [27]. The bacterial inner membrane serves as a permeability barrier for most of the molecules; in addition, it acts as the location for the transport of molecules into the bacterial cell. It also has an essential role in energy conservation as it is the site where proton motive force is generated [32]. On the other hand, the bacterial outer membrane is an important organelle which acts as a selective permeability barrier via keeping toxic compounds to be out of the cell while allowing important nutrients to enter inside the cell [32]. In the current study, we explored the impact of adaptation to TCS on both inner and outer membrane permeability. A significant decrease in inner and outer membrane permeability was found after adaptation to TCS. The decrease in bacterial membrane permeability is considered as a potential mechanism for cross-resistance to many antibiotics via nonspecific rejection of hydrophobic chemicals. When the membrane permeability is decreased, the membrane sequesters the antimicrobial agent and stops it from passing into the bacterial cell, consequently preventing physiological disruption inside the cell. Zeta potential is an electrochemical property of the cell surface which is considered as an indication of the bacterial surface charge. Generally, the net surface charge of bacteria is negative, and it is balanced by the oppositely charged counter ions that are present in the surrounding medium [15]. It is known that zeta potential has an important role in the maintenance of many cellular functions because it operates many molecular devices, for instance, ion pumps that are embedded in the membrane [32]. Moreover, it can provide useful information concerning the cell surface characteristics [15]. There was nonsignificant change in the membrane potential of the tested isolates after TCS adaptation. For more comprehension of the impact of TCS adaptation on membrane characteristics, the membrane depolarization was examined using flow cytometry. DiBAC4(3) is a fluorescent probe that can enter the depolarized cells and binds to the membrane resulting in increased fluorescence and a red spectral shift [32]. It was observed that 58% of the isolates showed a significant increase in the fluorescent gap after TCS adaptation (p˂ 0.05).

It is well known that EtBr is a substrate for the efflux pumps; thus, in order to study the impact of TCS adaptation on the efflux pumps in P. mirabilis isolates, efflux of EtBr was detected using cartwheel method [25, 28]. Interestingly, 32.3% of P. mirabilis isolates exhibited an increase in the efflux activity after TCS adaptation. This was further investigated by RT-PCR to detect the impact of TCS adaptation on the expression of the efflux pump genes. Our investigation showed that the repeated exposure to sublethal concentrations of TCS increased the expression of the tested efflux pump genes (acrB, mdfA, norE, and yihV). These findings are consistent with Maseda et al. [23] and Fernández-Cuenca et al. [12].

One of the major ways by which microorganisms can cope with their environments is to alter their morphology, and many morphological adaptations have been reviewed and reported [39]. In our study, there were many morphological changes, including changes in size, shape, and roughness of the cell surfaces, occurred in the adapted isolates which agree with the results of the research conducted by several other researchers [3, 22, 36].

Lipid profile analysis provides an opportunity to follow the metabolic processes and the growth changes occurring in the adapted isolates [13]. In the current study, direct and rapid analysis of the simple lipid extracts from the P. mirabilis isolates was carried out using Ultraflex II MALDI-TOF/TOF mass spectrometer. Curiously, we did not find observable differences in the mass spectra of the lipid profiles after adaptation in comparison with the lipid profiles before adaptation. This finding needs further investigation in the future. To the best of our knowledge, there is no available data concerning the impact of TCS adaptation on lipid profiles of P. mirabilis isolates were found in the literature.

We have conclusively proven that the stepwise exposure of P. mirabilis clinical isolates to sublethal concentrations of TCS could lead to adaptive expression of different mechanisms that can influence membrane properties, efflux activity, and bacterial morphology which will affect the bacterial susceptibility to different antimicrobials. Much more research is required in order to determine the main molecular mechanisms which are responsible for the increase in antimicrobial resistance in the adapted P. mirabilis isolates. We suggest that the widespread and inadequate usage of TCS in hospitals in Egypt could be a potential factor that contributes in the observed high levels of resistance among members of Enterobacteriaceae family especially P. mirabilis. Thus, we highly recommend performing well-planned studies investigating the molecular changes occurring in different microorganisms before and after repeated exposure to TCS. Since preserving the efficacy of TCS is crucial to maintain good hygiene levels and reduce the need for using of antimicrobials, we recommend more training on the correct usage of biocides especially TCS in hospitals. For a biocide to be effective, good knowledge of the characteristics of the chemical biocide, training of the end users, and in addition good compliance are necessary. End users in hospitals should know that, when possible, physical processing (like heat sterilization) can provide much many advantages over the chemical disinfection, and they should use it when applicable

Author contribution

EE, FS, AA, and TE conceived the experiments and analyzed the results. EE conducted the experiments. All authors wrote and reviewed the manuscript.

Declarations

Ethics approval

Not applicable

Consent to participate

Not applicable

Consent for publication

Not applicable

Conflict of interest

The authors declare no competing interests.