Morpho-biochemical and molecular characterization of two new strains of Aspergillus fumigatus nHF-01 and A. fumigatus PPR-01 producing broad-spectrum antimicrobial compounds

Abstract

The main objective of the study is to characterize two new strains of Aspergillus fumigatus through morphometric, biochemical, molecular methods, and to evaluate their antimicrobial potentiality. The micro-morphotaxonomy, growth, and metabolic behavior of the strains, nHF-01 and PPR-01, were studied in different growth conditions and compared with standard strain. The molecular characterization was done by sequencing the ncrDNA ITS1-5.8S-ITS2 and D1–D2 domains of the nc 28S rDNA region and compared with a secondary structure-based phylogenetic tree. The secretory antimicrobials and pigments were characterized by TLC, UV-Vis, and FT-IR spectroscopy. Both the strains showed distinct growth patterns in different nutritional media and could assimilate a wide range of carbohydrates with distinctive biochemical properties. The molecular characterization revealed the strains, nHF-01 and PPR-01, as Aspergillus fumigatus (GenBank Accession No. MN190286 and MN190284, respectively). It was observed that the strain nHF-01 produces red to brownish pigments having mild antimicrobial activity while the strain PPR-01 does not represent such transformations. The extractable compounds had a significant antimicrobial potentiality against the human pathogenic bacteria. From this analysis, it can be concluded that the nHF-01 and PPR-01 strains are distinct from other A. fumigatus by their unique characters. Large-scale production and detailed molecular elucidation of the antimicrobial compounds may lead to the discovery of new antimicrobial compounds from these strains.

Supplementary Information

The online version contains supplementary material available at 10.1007/s42770-021-00439-w.

Introduction

Aspergillus spp. are cosmopolitan conidial aerobic microfungi, belonging to phylum Ascomycota, family Trichocomaceae [1]. The species of the genus, Aspergillus is morphologically, metabolically, and phylogenetically diverse. To date, only about 5–13% of the overall worldwide fungal species have been identified and characterized [2]. In nature, each species has its beauty in its genetic and metabolic robustness to cope up with the ever-changing environment and competition in its niche. Thus, the taxonomic and metabolic characterization of the isolate leads to identify the new strain with bioactive compound production potentials. Due to thallophytic uniseriate cells representing the most unique species structure, growth conditions greatly influence the micromorphological parameter and thus provide a valuable tool for their taxonomic characterization. Therefore, the micro-morpho-taxonomy study in different nutrients and cultural conditions contribute to the taxonomic identity of a species [3]. It was reported that under different cultural conditions each of the isolates may produce different shapes in the arrangement of hyphae, vesicle, and spores as observed under the light and scanning electron microscope [4]. Besides these, the biochemical characterization also helps to establish the unique fungal metabolic profiles of an individual isolate. Apart from morpho-biochemical parameters, the genomic uniqueness also helps to represent new strain. For the last few decades, the nucleotide composition and alignment of the ncrDNA ITS1-5.8S-ITS2 (ITS barcode) and D1–D2 domains of nc 28S rDNA provide a unique barcode for the determination and identification of the isolates up to the species level [5]. Thus, all these experimental observations have a great impact on assigning a new species.

From the perspectives of basic science to applied biomedical arenas, it is very important to isolate and characterize the species of Aspergillus. They are known to produce different unique metabolites like antimicrobial agents (6-hydroxymellein,3,4,-dihydro-6,8-dihydroxy-3-methylisochromen-1-one) [6]; immunosuppressive drugs (ceftaroline (2010), tedizolid (2014), dalbavancin (2014), ceftolozane/T ceftolozane/tazobactam (2015) [7]; hematoporphyrin) [8]; and antifungal agents (fumifungin, fumitremorgin C, gliotoxin, asperlin, ophiobolin O, and phenylahistin) [9, 10]. Keeping the above novelties in view, the present study was undertaken to characterize two such new strains, nHF-01 and PPR-01 with antimicrobial production ability by evaluating their morpho-biochemical characters, metabolites production ability, and the sequence of ncrDNA ITS1-5.8S-ITS2 and D1–D2 domains of nc 28S rDNA.

Materials and methods

Isolation and morpho-taxonomic characterization of the isolates

The microfungi were isolated randomly from different spoiled foods sources of household usage like ripened fruits; vegetables; cereals and pulses; and processed foodstuffs like bread, papad, and sauce on malt extract agar (MEA, containing sprouted malt grains extract 2%, and agar powder 2%, w/v, pH 6.5) medium and grown at 28 °C. The pure culture of the isolates was developed by repeated culture on different fungal specific culture media and checking the homogeneity of colony appearance; the pure isolates were named accordingly. The colonies and the culture aliquot were tested for antibacterial activity by the spot-on-lawn method against some target food spoilage and toxicogenic bacteria [11]. The potential antibacterial strains were used for further study. The stock culture of the isolates was maintained in MEA slants with mineral oil at − 10 °C for future use.

The morpho-taxonomic identification was done according to the standard protocol [12, 13]. The isolates nHF-01 and PPR-01 were grown in MEA, potato dextrose agar (PDA, containing potato infusion 20%, dextrose 2%, and agar powder 2%, w/v, pH 6.5), and corn meal agar (CMA, containing corn meal infusion 50 gm/L, agar powder 15 gm/L, w/v, pH 6.5) plates for 10 days at 28 °C in dark condition. The appearance of the colony (such as texture, margin, color, sporulation, and pigmentation) and growth patterns were monitored in every 24 h interval for 10 days and used as taxonomic keys for identification up to the species level. The micro-morphometric analysis, such as septation, branching pattern, conidial structure, and ornamentation, was studied using the cover-slip technique [14] under a light microscope at × 400 and × 1000 magnification (Magnus, Model Mag Star EM-200, Olympus Opto System India Pvt. Ltd, India) equipped with Olympus camera (DX-500, 5MP) and scanning electron microscope (SEM JE100, Jeol, Oxford). The morphometric parameters were compared with a standard strain A. fumigatus MCC 1046, procured from Microbial Culture Collection at National Centre for Cell Science (http://www.nccs.res.in/), Pune, Maharashtra, India.

Biochemical tests

• i.Carbohydrate assimilation tests

  The carbohydrate assimilation test was used to determine the selective utilization capacity of a specific carbohydrate by the fungal strain following the protocol of Kitancharoen and Hatai [15]. This assay was done by using HiCarbo^TM Kit cassettes with different pH indicators (HiMedia, Mumbai, India) comprising 31 different carbohydrates of simple sugar, sugar alcohol, disaccharides, etc. Fifty microliters of fresh active spore suspension (~ 10⁴ CFU/mL) of the isolates, nHF-01 and PPR-01, were added to each of the reaction well and observed for visual color change in each 24 h intervals for 10 days according to manufacturer’s guidelines. A change in color (according to the manufacturer’s guideline) of the medium indicates a positive response. The well without any sugar was used as a negative control.

• ii.Other biochemical tests

  The hydrolytic properties of different substrates and non-carbohydrate nutrients assimilation were done in modified Czapek Dox medium [CZA, containing sodium nitrate 2.00 g/L; di-potassium phosphate 1.00 g/L; magnesium sulfate 0.50 g/L; potassium chloride 0.50 g/L; ferrous sulfate 0.01 g/L; (w/v); final pH (at 25 °C) 7.3 ± 0.2] with suitable amendments of substrates following the protocol of Kitancharoen and Hatai [15].

Molecular characterization of the strains

The fungal samples were collected by scraping the mycelia and spores from 3- to 4-day-old PDA plates. The genomic DNA was extracted by crushing with acid-washed glass beads (Sigma-Aldrich, USA) in a micropastle with addition of a 200-μL modified extraction buffer-A [containing hexadecyltrimethylammonium bromide (CTAB) 2% (w/v), 100 mM Tris (pH 8.0) buffer 10% (v/v), 20 mM EDTA 1% (v/v), 1.4 M NaCl 8.2% (w/v), polyvinyl pyrrolidone (PVP) 4% (w/v), ascorbic acid 0.1% (w/v), 10 mM β-mercaptoethanol (BME) 0.07% (v/v), sodium dodecyl sulfate 1% (SDS, w/v), and the final volume was adjusted to 100 mL by distilled water] [16]. A 100 μL (100 mg/mL, w/v) lysozyme was added to it, incubated for 60 min at 65 °C. Then, 1 μL of proteinase K (20 mg/mL, w/v) was added and kept for 60 min, at 37 °C. An equal amount of phenol, chloroform was added to the mixture and the aqueous phase was collected after centrifugation at 16,128×g for 15 min at 4 °C. The 0.6 volumes of chilled isopropanol were added to the aqueous phase, mixed by gentle inversion, and placed at − 20 °C for 15 min, and centrifuged at 16,128×g for 15 min at 4 °C. The pellet was washed with chilled ethanol, then air-dried, and later dissolved in × 1 TAE (50 μL) buffer. The purity was checked in 1% (w/v) agarose gel following the protocol of Sambrook and Russel [17]. The PCR and sequence of the ITS region of the 28S rDNA were done by using universal primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′), and D1–D2 domains by using NL1 (5′-GCATATCAATAAGCGGAGGAAAAG-3′) and NL4 (5′-GGTCCGTGTTTCAAGACGG-3′) primers according to Kumar and Shukla [18]. The PCR program was 3 min denaturation at 95 °C, 30 s at 95 °C, 45-s annealing at 60.5 °C, and 2 min chain extension at 72 °C for 35 cycles followed by a post-run of 10 min at 72 °C. The PCR product was then purified and sequenced with sequencing primer ncrDNA ITS1-5.8S-ITS2 and D1–D2 domains. The extracted trimmed sequences were edited using the Bioedit Sequence Alignment Editor v7.0.5 software. Both ITS and LSU full sequences were combined using Geneious Prime software version 2019.2., BLAST searched from the NCBI database. The combined unrooted structural phylogenetic tree was constructed by the Kimura 2 method using the MEGA7 software with the bootstrap test of 1000 interactions [19].

Partial characterization of the secretory pigments and secondary metabolites, and their antibacterial assessment

After 5–6 days of active growth in PDA media at 28 °C in dark condition, the released pigments were extracted from the solid plate culture with a gradient of solvents starting with non-polar to polar solvents, like n-hexane, diethyl ether, DCM, ethyl acetate, acetone, and methanol. TLC analysis of the concentrated crude pigments was done on silica gel TLC60 F₂₅₄ plates (Merck, Germany) in a solvent system of n-hexane and ethyl acetate (7:13, v/v). The spots were visualized under 254 nm and Rf values were recorded. The FT-IR analysis of the pigments was done by FT-IR spectrophotometer (Shimadzu IR Affinity-1S, Japan). A 2 mg (w/v) of the extracted pigments was dissolved in respective solvents, viz. n-hexane, diethyl ether, DCM, and ethyl acetate, and analyzed in the wavenumber range of 500–4000 cm⁻¹ using 466 scans at the resolution of 16 cm⁻¹. The UV-Visible spectrum of different solvent fractions was also carried out in a UV-Vis spectrophotometer (UV-Vis 1800, Shimadzu, Japan) using DCM as solvent system. The pigments (2 mg/mL, w/v) were tested for antibacterial activity by the spot-on-lawn method [20] against some pathogenic bacteria like Bacillus cereus MTCC 1272; Escherichia coli MTCC 723; Salmonella enterica serovar Typhimurium MTCC 98; Staphylococcus aureus MTCC 96; Staphylococcus epidermidis MTCC 3086; Streptococcus mutans MTCC 890 procured from Microbial Type Culture Collection and Gene Bank (MTCC), CSIR-Institute of Microbial Technology, Chandigarh—160036, India, and Enterococcus faecalis MCC 2041T procured from National Centre for Microbial Resource (NCMR), Pune, Maharashtra, India, and yeasts such as Candida albicans MTCC 183 and C. glabrata MCC 1445.

The antimicrobial secondary metabolites of the strains nHF-01 and PPR-01 were extracted from the 50 mL MEB grown at 28 °C for 10 days. The cell-free supernatant was harvested by centrifugation at 7168×g for 10 min at 30 °C. The different solvent fractions were extracted by using 1:1 (v/v) organic solvents such as n-hexane (PolarityIndex (PI) 0.1), diethyl ether (PI 2.8), DCM (PI 3.1), and ethyl acetate (PI 4.4) in a separating funnel. The solvent fractions were concentrated by rotary-vacuum evaporator (Rota-Vap, Superfit, Model: PBV-70, Mumbai, India), and the constituting compounds in the crude antimicrobial extract were analyzed on Silica gel F₂₅₄ TLC plates (Merck, Germany) with n-hexane and ethyl acetate (9:10, v/v) of solvent system and observed under 254 nm, and the Rf values were recorded. The separated TL chromatogram was checked for a potent antibacterial fraction by scrapping the TLC spots, eluting with the same TLC solvents, and assaying antibacterial activity (15 mg/mL, w/v) against pathogenic bacteria, as mentioned earlier. The plates were incubated at 37 °C and observed for the zone of growth inhibition; the diameter of growth inhibition was recorded.

Results and discussion

Isolation and micromorphotaxonomic identification of the strains

Among the 17 nos. of fungal isolates having different mycelial color, texture, and visible growth pattern on the MEA plates, the isolates nHF-01 and PPR-01 showed a good amount of antibacterial activity, and thus these two strains were selected and used for further study. The morphometric study is an important key to characterize microfungi. The taxonomic identity of the strains possessed some unique morpho-taxonomic characters as shown in Table 1. Figure 1 illustrates the micromorphological characters of the strains. Conidial heads were green/blue-green color–borne on long, narrow conidiophores with globose spinulose conidia arranged in chains in compact columns. The magnified SEM images revealed the spiny conidiospores (Fig. 1c, d, h, and i). A contrasting growth behavior in three defined media was observed among the strains as shown in Fig. 2. The strain nHF-01 produced coloration in the PDA medium (Fig. 2a, days 5D-10D) while other media were not colored. No coloration in any media was observed for the strain PPR-01. This indicates the strain nHF-01 produces secretory pigments. The average colony growth was also variable among the strains in different media. The strain nHF-01 is a comparatively slow grower than the strain PPR-01 with an average colony diameter of 12 mm/day and 14 mm/day, respectively, at 28 °C. Among the media variants, the culture medium CMA supports less proliferating colony growth than the PDA and MEA media (Fig. 2b, d). The detailed taxonomic descriptions and their key to identification have been arranged according to Raper and Thom [12] as mentioned below.

Table 1.

Colony behavior and micromorphologies of the fungal strains in different media at 28 °C after 10 days

Sl. no.		Observed characters
		A. fumigatus nHF-01				A. fumigatus PPR-01
		PDA	CMA	MEA	CDA	PDA	CMA	MEA	CDA
A	Colony parameters					Colony parameters
1.	Growth (mm)	85–88	80–85	50–52	53–55	95–97	85–90	75–80	55–60
2.	Growth: (i) at 37 °C (ii) at 48 °C (iii) at 55 °C	+	+	+	+	+	+	+	+
3.		+	+	+	+	+	+	+	+
4.		__	__	__	__	__	__	__	__
5.	Elevation	Raised	Crateriform	Flat	Raised	Crateriform	Crateriform	Crateriform	Crateriform
6.	Margin	Filamentous	Filiform	Filamentous	Lobate	Filiform	Filiform	Filiform	Filiform
7.	Surface	Wrinkled	Rough	Smooth	Rough	Rough	Smooth	Smooth	Rough
8.	Surface texture	Velvety thick	Radiate	Radiate	Floccose	Velvety	Radiate	Radiate	Velvety thick
9.	Dorsal surface	White margin and incipient red at the center	White	White	Colorless	White at margin and green at the center	White at margin and green at the center	Green	White
10.	Reverse color	White in margin and red at the center	White	Transform into reddish	Transfom into green to reddish	Green	Green	Green	Green
11.	Zonation	Two color zone at center and periphery	Radially furrowed on upper surface	Slightly colored zone at periphery	Irregularly furrowed	Two color zone	Two color zone	Two color zone	Wrinkled and radially furrowed
12.	Sporulation	Heavy and dispersed	Poor	Heavy and non dispersed	Poor	Heavy	Poor	Heavy	Heavy
13.	Opacity	Opaque	Transparent	Translucent	Transparent	Opaque	Opaque	Opaque	Transparent
B	Micromorphologies (in PDA medium)					Micromorphologies (in PDA medium)
1.	Vegetative mycelia	Hyphal cell length 250–350 μm.				The mycelium is a heterotrichous nature. The septate aerial hyphae were gradually imperceptible into the flask-shaped vesicles.
2.	Conidial heads	Columnar, compact, 70 μm in diameter				Columnar, compact, 66 μm in diameter
3.	Conidiophores	Short, smooth, up to 300 μm in length and 2–6 μm in diameter, greenish in color; upper part: arising directly from submerged septate hyphae and aseptate aerial hyphae gradually imperceptible into the flask-shaped vesicles				Long, smooth, 300 μm in length and 2–3 μm in diameter, green in color.
4.	Vesicles	up to 8.28 μm in length and 6.9 μm in breadth, usually fertile on the upper half only				8.28 μm in length and 5.9 μm in diameter. The upper half was predominantly fertile.
5.	Sterigmata	One series, usually 5.52 × 2.76 μm in diameter, closely packed with axes roughly parallel to the axis of the conidiophores.				Uniseriate and 6.2 × 2.36 μm in diameter, compactly arranged to the axis of the conidiophores.
6.	Conidia	Dark green in mass, echinolate, globose (after Q-value), mostly 1.5–3 μm in diameter				Dark green to bluish in mass, echinolate or spinose, globose (after Q-value), mostly 2–4 μm in diameter

Here, PDA, potato dextrose agar; CMA, corn meal agar; MEA, malt extract agar

Fig. 1.

Developmental stages of the strain nHF-01 (a-e), and PPR-01 (f-j). a, f 2–4 days old mature hyphae (inset: plate culture); c, d, h, i the SEM photomicrographs of conidial heads and spinose spore of, nHF-01 (c, d) and PPR-01 (h, i); b and g mature reproductive organ of nHF-01 and PPR-01, respectively. Pictorial illustrations of different parts of nHF-01 (e) and PPR-01 (j); (i) pre-mature hyphae, (ii) pre-mature vesicle and conidiophores, (iii) matured reproductive organ, (iv) sterigmata, and (v) single spinose spore. Bar = 10 μm

Fig. 2.

Colony growth behavior and growth rate of A. fumigatus nHF-01 and A. fumigatus PPR-01 in three different culture media at 28 °C in different days of incubation. a Growth behavior of nHF-01; b colony growth rate of nHF-01; c growth behavior of PPR-01; d colony growth rate of PPR-01. Here, figure panels a and c are the pictures of colony growth on culture plates in both sides (dorsal and ventral sides) in different days of incubation; the code “1D–10D” indicates days of incubation from 1 to 10 days; in figure panels b and d, the rectangle marker indicates the culture medium PDA, triangle marker indicates the culture medium CMA, and circle marker indicates the culture medium MEA

Key to the groups—based primarily upon color

1 Conidial head definitely green, blue-green, or yellow-green shades in young fruiting colonies. ........................................................ 2

1* Conidial heads lacking green colors (Greenish in exceptional cases). Shading toward colorless through light flesh colors. ...........................................................A. terreus group

2 Conidial heads in green and blue-green shades. ................................................................................... 3

2* Conidial heads in yellow-green shades. ........................................................................ A. flavus group

3 Conidial stalks and heads were coarse-heads clavate. .................................................. A. clavatus group

3* Conidial heads not clavate. ......................................... 4

4 Colonies mostly showing yellow perithecia and more or less yellow and red hyphae. ............ A. glaucus group

4* Colonies lacking yellow perithecia and more or less yellow and red hyphae. ......................................................... 5

5 Colonies producing columnar spore masses. ................ 6

5* Colonies producing radiate, globose, or hemispherical heads, and flesh-colored shades. ... A. versicolor group

6 Grown rapidly and spreading colonies. ........................ 7

6* Grown slowly and restrictedly growing colonies. .................................................... A. restrictus series

7 Conidial columns long, narrow. ........ A. fumigatus group

7* Conidial columns short and broad; perithecia usually present, ascospores red. ............................. A. nidulans group

Key to the groups—based primarily upon morphology

1 Species producing perithecia and purple-red ascospores. ............................................ A. nidulans group

1* Species not producing perithecia and ascospores. ............................................................................... 2

2 Conidial heads cylindrical-clavate; vesicles definitely clavate. ....................................A. clavatus group

2* Conidial heads not cylindrical-clavate. ....................... 3

3 Colonies showing green or greenish color at some stages of development. ...................................... 43* Colonies lacking green color; conidiophore walls rough, yellow; head yellow to ochre. ... A. ochraceous group

4 Conidiophore walls rough or pitted, colonies green or yellow-green to yellowish. ............ A. flavus-oryzae group

4* Conidiophore wall smooth. ........................................ 5

5 Sterigmata in one series. ................................................. 6

5* Sterigmata in two series; the conidial area in blue-greens. ..................................................................... A. sydowi

6 Conidia elliptical to pyriform; sterigmata usually coarse. ............................................. A. glaucus group

6* Conidia spinulose, 2.5 to 4 μ, globose; chains in compact columns. ..................... A. fumigatus group

Key to the Aspergillus fumigatus series

1 Cultures strictly conidial, varying from velvety to floccose. ................................. A. fumigatus series

1* Cultures producing perithecia and ascospores, conidial development generally limited. ...... A. fischeri series

The infrageneric classification of the genus Aspergillus, a name introduced by Micheli (1729), with subsequent validating the genus by Haller (1768) and Fries (1832), is traditionally based on morphological characters. Aspergillus is a genus of Hyphomycetes characterized by the formation of conidiophores with large, heavy-walled stipes, and swollen apices/vesicles. The taxonomic identity keys based on the color and morphology identified these strains as Aspergillus fumigatus [12, 13]. Hence, the strains were named as A. fumigatus Fresen strain nHF-01 and A. fumigatus Fresen strain PPR-01.

The filamentous fungal genus Aspergillus is an important microfungus used in agriculture, medicine, and various industries like food fermentation, large-scale production of enzymes, organic acids, and bioactive compounds [21–24]. It is also the best known and most frequently recognized fungal genera on earth. It consists of over 8250 species and is classified into the nine main sections: Flavi, Fumigati, Nigri, Udagawae, Cricumdati, Versicolor, Usti, Terrei, and Emericella; among which the sections Fumigati, Flavi, and Nigri are the most important members of this genus [21–24]. A. fumigatus was first described by Johann Baptist Georg Wolfgang Fresenius in 1863 [25], and it has been named after him as A. fumigatus Fresen. The micromorphological characterization is one of the most fundamental and ground bases adopted by mycologists across the globe to identify the microfungi. However, molecular systematics have subsequently been adopted to ascertain the species or strain level. The taxonomy of this Aspergillus section Fumigati has recently been revised and includes the species A. fumigatus, A. lentulus, A. fumigatiaffinis, A. fumisynnematus, A. novofumigatus, and A. laciniosa [22, 23, 26]. A. fumigatus is generally regarded as a single homogeneous species, but strains may vary greatly in their cultural characteristics and to a lesser degree in their micromorphology. Typical A. fumigatus isolates produce dark blue-green colonies on Czapek Dox agar (CZA) and malt extract agar (MEA) plates, consisting of a dense felt of conidiophores intermingled with aerial hyphae. Microscopically, the conidial heads are columnar, compact, and often densely crowded, and conidiophores are short, smooth, up to 300 μm in length, usually more or less green in color, and arise directly from submerged hyphae or emerge as very short branches from aerial hyphae. Vesicles are subclavate, up to 20 to 30 μm in diameter, often similar in color with the conidiophores, and usually fertile on the upper half only. Phialides, which are directly borne on the vesicle, are also pigmented, are usually about 6 to 8 μm × 2 to 3 μm. Conidia mostly are green in mass, smooth to finely echinulate, globose to subglobose, and mostly 2.5 to 3.0 μm in diameter with extremes ranging from 2.0 to 3.5 μm [22]. The strains of A. lentulus, a very close relative to A. fumigatus, can be distinguished by their ability to grow at high temperatures. While the isolates of A. lentulus are unable to grow at temperatures 48 °C, A. fumigatus thrives at and above 48 °C [27]. Both these species also differ significantly in their secondary metabolite profiles [28]. Thus, based on these parameters, the present strains appear morpho-taxonomically unique in comparison with other strains and may be considered as a new strain of A. fumigatus.

The biochemical properties of the strains were shown in Table 2. The A. fumigatus nHF-01 could assimilate a wide variant of sugars with slow utilization of reducing disaccharides, while a fast utilization by the PPR-01 was observed. Both strains were unable to utilize the sugar alcohols. This difference established that both strains had unique sugar utilization pathways for catabolic utilization common in all other microfungi such as Aspergillus spp., Penicillium spp., and Thermomyces spp. Maheshwari and Balasubramanyam also observed similar parameters in Thermomyces sp. [29]. Therefore, these carbohydrates fermentation profiles indicate the unique biochemical nature of the A. fumigatus nHF-01 and A. fumigatus PPR-01. Aspergillus is a cosmopolitan filamentous fungus, having a saprophytic lifestyle and playing an important role in the aerobic decomposition of organic materials and in recycling environmental carbon and nitrogen under natural conditions. It can utilize a wide spectrum of organic compounds and complex substrates, especially concerning carbon [30]. This reflects the pronounced nutritional flexibility of the strains of A. fumigatus [31]. The whole-genome data analysis (http:// www.tigr.org/;http://www.sanger.ac.uk/) revealed that they have ample numbers of substrate perception, degradation, uptake, and catabolism of organic substrates [32–36]. They also have a wide array of hydrolytic enzymes producing the capacity to degrade polymeric and oligomeric substrates, among which arabinan, cellulose, pectin, and xylan are the most common ones [37]. The KEGG pathway database (http://www.genome.ad.jp/kegg/pathway.html# carbohydrate) also revealed that it contained 275 transporters of the major facilitator superfamily, to which sugar transporters belong (see http://www. membranetransport.org/). The preferred source of carbon and energy is glucose, and along with other hexoses, they are metabolized via glycolysis and the pentose phosphate pathway. On the other hand, non-carbohydrate compounds such as acetate, fatty acids, ethanol, or amino acids are metabolized by gluconeogenesis [38].

Table 2.

Biochemical properties of the strains

S. no.	Carbohydrates assimilation		Aspergillus sp. nHF-01		Aspergillus sp. PPR-01
	Sugar types	Sugar names	After 5 days	After 10 days	After 5 days	After 10 days
Monosaccharides
1	Aldohexose	Dextrose	+++	+++	+++	+++
2		Galactose	+++	+++	+++	+++
3		Mannose	+++	+++	+++	+++
4		D-Arabinose	-	-	-	-
5		L-Arabinose	-	-	+++	+++
6	Ketohexose	Fructose	+++	-	+++	+++
7		Sorbose	-	-	+	-
8	Aldopentose	Xylose	+++	+++	+++	+++
Disaccharides
9	Reducing	Lactose	++	-	+++	-
10		Maltose	+++	+++	+++	+++
11		Melibiose	-	+++	+++	+++
12	Non-reducing	Sucrose	+++	+++	+++	+++
13		Trehalose	-	+++	+++	+++
Trisaccharides
14	Reducing	Raffinose	+++	+++	+++	+++
15	Non-reducing	Melezitose	++	++	+++	+++
16	Oligosaccharides	Inulin	++	+++	+++	++
Sugar alcohol
17	Triose	Glycerol	-	-	+++	+++
18	Hexose	Dulcitol	-	-	+++	-
19		Inositol	-	-	+	-
20		Sorbitol	-	-	+	-
21		Mannitol	-	-	+	-
22		Rhamnose	+++	-	+++	-
23		Erythritol	-	-	+	-
24		Salicin	-	-	+++	+++
25	Pentose	Xylitol	-	-	-	-
26		α-Methyly-D-mannoside	-	-	-	-
27		Adonitol	-	-	+++	++
28		Arabitol	-	-	-	-
29	Sugar derivatives	Sodium gluconate	-	-	+++	-
30		α-Methyly-D-glucoside	-	-	+	-
Other biochemical tests
1.	Assimilation/utilization efficiency	Citrate	-	-	-	-
2.		Malonate	-	-	-	-
3.		Nitrate	++	++	++	++
4.	Hydrolytic efficiency	Casein	-	-	-	-
5.		Cellulase	+	+	+	+
6.		Esculine	-	-	-	-
7.		Fatty acid esterase	-	++	++	++
8.		Gelatin	-	++	-	+
9.		Urease	-	-	-	-
10.		β-galactosidase (Cellobiose)	++	++	+++	+++
11.		β-galactosidase (ONPG)	-	-	-	-

Summary:

1. Fast utilization: Xylose, fructose, dextrose, galactose, raffinose, sucrose, mannose, inulin, maltose, cellobiose and melezitose.

2. Slow utilization: Trehalose, melibiose.

3. No utilization: Sodium gluconate, salicin, dulcitol, inositol, sorbitol, mannitol, adonitol, arabitol, erythritol, alpha-methyl-D-glucoside, esculin, D-arabinose, citrate and sorbose

Molecular characterization of the fungal strains

The BLAST search of both the ITS and LSU sequences indicates that the isolated strains had 100% alignment similarities with A. fumigatus. The secondary structure-based unrooted neighbor-joining tree analysis of the ITS-D1/D2 region of LSU region sequences indicates that the strains, nHF-01 and PPR-01, had a close affinity towards A. fumigatus F37-04 (KX664390), which is an isolate from infected fish and A. fumigatus NRRL (EF669931), an environmental isolate, respectively, sharing the same clade (Fig. 3). Hence, the strains were assigned as A. fumigatus nHF-01 (GenBank Accession No. MN190286) and A. fumigatus PPR-01 (GenBank Accession No. MN190284). The ITS1 and ITS2 with 5.8S rRNA regions of the rRNA operon which yields a 550- to 600-bp amplicon are crucial markers for Aspergillus species discrimination at the subgenus or section level [39, 40]. Advantages of employing the ITS region for species identification include the universality of the primer sets, amenability of the regions to PCR amplification and sequencing, and the availability of a large and ever-expanding ITS sequence database in the publicly available GenBank database. In addition to the ITS-D1/D2 region sequencing, some studies also utilize the sequence information of five other genes, namely, beta-tubulin, calmodulin, the pre-rRNA processing protein Tsr1, the DNA-replication licensing factor Mcm7, and the second-largest subunit of RNA polymerase II (RPB2) [24]. Among these, the beta-tubulin gene was also used for molecular identification of the Aspergillus section Fumigati [24, 41]. Recently, the use the mass spectrometry identification (MSI) by MALDI-TOF has also been reported to confirm the species and section levels of this genus to differentiate the Aspergillusspecies into the sections Fumigati [42, 43]. But owing to its relatively expensive instrumentation leading to limited accessibility and the necessity of data analysis expertise, the developing laboratories have been unable to utilize this methodology. Due to its versatility and medical importance, the genome of A. fumigatus clinical isolate AF293 has been sequenced and it was first among the aspergilli members [44]. The complete genome of A. fumigatus revealed that the genome of A. fumigatus is estimated to consist of 28.7 Mb (http://www.tigr.org/). However, these data will certainly open up fresh perspectives by allowing comparative genomics to answer questions about the differences between pathogenic and nonpathogenic Aspergillus species.

Fig. 3.

RNA structure-based unrooted phylogenetic tree by neighbor-joining method. The strains of present studies have been assigned with a filled triangle

Comparative biochemical and antimicrobial parameters of secretory pigments and secondary metabolites

The mycelia pigments offer protection of fungi to different harsh environmental factors, like light and desiccation show diverse biological activity in competing for the niche. Like other fungi, Aspergillus species produce a variety of pigments [45]. The melanin is one of the cell wall components that are responsible for their coloration. They are generally black or brown in color, although other colors exist. Melanins are a group of high molecular weight–related pigments that share some physical and chemical traits. They are among the most stable, insoluble, hydrophobic, and resistant pigments of formed by oxidative polymerization of phenolic compounds. Two pathways of melanin synthesis are found in fungi. Most fungal melanins are derived from the precursor molecule 1,8-dihydroxynaphthalene (DHN) and are known as DHN-melanins, produced by the polyketide pathway, a pathway with diverse roles in the production of secondary metabolites such as pigments, toxins, antibiotics, and signaling molecules [46]. Alternatively, some fungi produce melanin from L-3,4-dihydroxyphenylalanine (L-DOPA) [46]. A. fumigatus produces at least two types of melanin, namely pyomelanin and DHN-melanin. Pyomelanin, a product of L-tyrosine or L-phenylalanine catabolism, is a water-soluble, dark brown pigment, is synthesized extracellularly and can bind to the surface of hyphae and protects the fungus against reactive oxygen species (ROS), and acts as a defense compound in response to cell wall stress. While the DHN-melanin is responsible for the characteristic gray-greenish color of A. fumigatus conidia [47–49]. Thus, the chemical property of the secretory pigments has a strict relevance to its biosynthetic origin and its variations also indicate their adaptive and ecological significance. For example, among the black Aspergilli, the A. flavus, A. nidulans, and A. niger possess DOPA-melanin while A. niger and A. tubingensis contain the DHN-melanin [50, 51]. Among the present strains, A. fumigatus nHF-01 produced red to brownish pigment after the 5^th day of incubation which was extractable in both non-polar and mildly polar solvents while the strain A. fumigatus PPR-01 did not produce any pigments (Fig. 2a, c). The TLC of the pigments of nHF-01 showed the Rf values of 0.26, 0.58, 0.65, 0.95 of n-hexane fraction; 0.26, 0.58, 0.95 of diethyl ether fraction; 0.31, 0.65 of DCM fraction, and only one spot with Rf value of 0.31 in ethyl acetate fraction (Fig. 4a). However, the solvents acetone and methanol failed to extract the pigments, indicating their non-polar nature. The Rf value comparison with other fungal pigments show some similarity to β-carotene (Rf 0.95) [45, 46] and the UV-Visible spectra of all solvent extracts showed common peaks with λ_max values at 223–229 nm and 270–275 nm, which indicates nitrite and naphthacene pigment compounds, respectively (Fig. 4b). A similar spectrum was found in DHN-melanin, extracted from A. fumigatus (AFGRD105) [49].

Fig. 4.

The chromatographic and spectroscopic characterization and an antimicrobial assay of pigments and secondary metabolites of A. fumigatus nHF-01 and A. fumigatus PPR-01. a TLC chromatogram of the pigment fractions of A. fumigatus nHF-01; b, c UV-Vis and FT-IR spectra of the fractions, respectively; d, f antibacterial assay of secondary metabolites fractions of the strains against E. coli, respectively; and e, g TLC chromatogram of the crude DCM fractions of the strains. Here, the numbers in figure panel a indicate the different solvent fractions, “1” n-hexane, “2” diethyl ether, “3” DCM, “4” ethyl acetate, “5” acetone, and “6” methanol; the green lines in figure panels b and c indicate n-hexane fraction, the red line indicates diethyl ether fraction, the blue line indicates DCM fraction and the black line indicates ethyl acetate fraction; the numbers 1–4 in figure panels d and f indicate the solvent fractions from n-hexane, DCM, ethyl acetate, diethyl ether, respectively, and “5” indicates streptomycin (20 μg/mL) and “6” indicates DCM solvent, and the numbers in figure panels e and g indicate different Rf values

The FT-IR spectroscopy analysis of nHF-01 pigments showed the marked differences in the transmittance values of all the solvent fractions. Some similarity in functional groups, such as amines (1020–1250 cm⁻¹, C-N), alkanes (2840–3000 cm⁻¹, C-H), esters (1735-1750 cm⁻¹, C=O), and alcohol (3363 cm⁻¹, O-H) in the spectrum were observed (Fig. 4c). This study also proves that the pigments of nHF-01 were nitrogenous molecules [48, 49]. FT-IR spectroscopy of pyomelanin pigment extracted from A. fumigatus cultures showed a broad absorption at 3420 cm⁻¹ due to associated or polymeric OH groups, the stretching vibrations for aliphatic CH bonding appear at 2952–2925 cm⁻¹, at 1586 cm⁻¹ for the symmetric carboxylate stretching vibrations (COO-) and the fingerprint regions between 1450 and 650 cm⁻¹ [52]. While DHN-melanin, extracted from A. fumigatus (AFGRD105), showed characteristic peaks at 3402 cm⁻¹, 2924 cm⁻¹, 2854 cm⁻¹, 2376 cm⁻¹, 1627 cm⁻¹, 1458 cm⁻¹, 1373 cm⁻¹, 1381 cm⁻¹, 1072 cm⁻¹, 1048 cm⁻¹, 678 cm⁻¹, 617 cm⁻¹, and 601 cm⁻¹[49]. Therefore, from this analysis, it appears that the secretory brown pigments of A. fumigatus nHF-01 have greater similarity with DHN-melanin than pyomelanin [49, 50] having brownish color. The extracted pigment of nHF-01 also displayed antimicrobial activity against the tested pathogenic bacteria with an average zone of growth inhibition of 6.0–8.0 mm (2 mg/mL, w/v) (Figure not shown here), and a 20–21-mm zone diameter against Candida albicans MTCC 183 and C. glabrata MCC 1445 at 18.5 mg/mL concentration (Figure not shown here). Raman and Ramasamy [49] also reported that DHN-melanin extracted from A. fumigatus (AFGRD105) possess the inhibitory property for all Gram-positive and Gram-negative bacteria like Bacillus spp., E. coli, Enterobacter spp., Klebsiella spp., Proteus spp., Pseudomonas spp., Staphylococcus spp., and Streptococcus spp. with a MIC value in the range of 0.125–32 μg/mL while it had MIC value of 512 μg/mL against the Aspergillus spp. This indicates that the biosynthesized pigments have greater antimicrobial potency than the synthetic melanin which had a MIC value of 4 μg/mL. Thus, the pigment profile also distinguishes that the strain nHF-01 is different from the strain PPR-01.

The antibacterial assay of secretory secondary metabolites of A. fumigatus nHF-01 and A. fumigatus PPR-01 from different solvents showed that the only DCM extractable compounds displayed antimicrobial activity. The TLC analysis of AMC of the DCM extract of nHF-01 showed three spots with Rf values 0.33 (C2), 0.53 (C3), and 0.63 (C4) while PPR-01 showed four spots with Rf values 0.18 (P2), 0.32 (P3), 0.38 (P4), and 0.61 (P5), respectively, (Fig. 4b, d). All the spots were UV active and showed a deep bluish color under 254-nm wavelengths. The crude DCM fraction showed a high growth inhibitory effect with an average inhibition zone diameter of 25–28 mm and 20–25 mm, respectively, against all the pathogenic bacteria at a concentration of 15 mg/mL (Fig. 4d). The MIC and MBC/MFC values of the fractions against the bacteria anf yeasts strains tested were in the range of 2.0–33 mg/mL (Fig. S1-S3; Table S1). This indicates that the antibacterial compounds produced by the strains had potent antibacterial efficacy and could be used as a potent antibacterial agent against such challenge bacterial pathogens. A large number of compounds produced by different species of Aspergillus sp. are ceftaroline, fidaxomicin, bedaquiline, etc., which are known to have the antibacterial property [53, 54] while fumifungin, synerazol, fumitremorgin C, gliotoxin, 18-oxotryprostatin, asperlin, etc. have antifungal activity [10]. However, antimicrobial compounds with both antibacterial and antifungal characteristics are very rare. In this context, the secretory secondary metabolites produced by A. fumigatus nHF-01 and PPR-01 had broad-spectrum antibacterial and antifungal property against human pathogenic bacteria and yeasts (personal communication). Thus, the secondary metabolites produced by these strains may add a new compound to this rare list. Also, the pigments may provide a defense function against free radicals, electromagnetic radiations, thermo-tolerance, metal ion sequestration, and mechanical-chemical cellular strength. Thus, the pigments of these strains may provide some endurance to these strains to survive under the variable environmental stresses.

Conclusion

From the above observations, it can be concluded that the new environmental isolates A. fumigatus nHF-01 (MN190286) and A. fumigatus PPR-01 (MN190284) showed very distinct morpho-biochemical and molecular characters with unique growth behavior in different nutritional conditions. They produce potent antimicrobial extracellular metabolites active against human pathogenic bacteria and fungi. The secretory pigment of A. fumigatus nHF-01 is a DHN-melanin–like nitrogenous compound having moderate antimicrobial activity against pathogenic bacteria. Thus, it can be concluded that the new environmental isolates A. fumigatus nHF-01 and A. fumigatus PPR-01 can be assigned as new strains producing broad-spectrum secretory antimicrobial compounds which could contribute to antimicrobial therapy for human uses.

Authors’ contributions

Vivekananda Mandal, Rajsekhar Adhikary, and Pulak Kumar Maity did the experimental work, analyzed the data, and wrote the draft manuscript of the article, and Dr Sukhendu Mandal and Dr Vivekananda Mandal designed the work plan and edited the manuscript.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest.