Skip to main content
eLife logoLink to eLife
. 2021 Jun 1;10:e67622. doi: 10.7554/eLife.67622

Distinct expression requirements and rescue strategies for BEST1 loss- and gain-of-function mutations

Qingqing Zhao 1,2,, Yang Kong 3,, Alec Kittredge 4, Yao Li 3, Yin Shen 5,, Yu Zhang 3,, Stephen H Tsang 6,, Tingting Yang 2,3,
Editors: Merritt Maduke7, Richard W Aldrich8
PMCID: PMC8169119  PMID: 34061021

Abstract

Genetic mutation of the human BEST1 gene, which encodes a Ca2+-activated Cl- channel (BEST1) predominantly expressed in retinal pigment epithelium (RPE), causes a spectrum of retinal degenerative disorders commonly known as bestrophinopathies. Previously, we showed that BEST1 plays an indispensable role in generating Ca2+-dependent Cl- currents in human RPE cells, and the deficiency of BEST1 function in patient-derived RPE is rescuable by gene augmentation (Li et al., 2017). Here, we report that BEST1 patient-derived loss-of-function and gain-of-function mutations require different mutant to wild-type (WT) molecule ratios for phenotypic manifestation, underlying their distinct epigenetic requirements in bestrophinopathy development, and suggesting that some of the previously classified autosomal dominant mutations actually behave in a dominant-negative manner. Importantly, the strong dominant effect of BEST1 gain-of-function mutations prohibits the restoration of BEST1-dependent Cl- currents in RPE cells by gene augmentation, in contrast to the efficient rescue of loss-of-function mutations via the same approach. Moreover, we demonstrate that gain-of-function mutations are rescuable by a combination of gene augmentation with CRISPR/Cas9-mediated knockdown of endogenous BEST1 expression, providing a universal treatment strategy for all bestrophinopathy patients regardless of their mutation types.

Research organism: Human

Introduction

Bestrophinopathies are a group of five retinal degeneration disorders caused by genetic mutations in the human BEST1 gene, namely Best vitelliform macular dystrophy (BVMD) (Marquardt et al., 1998; Petrukhin et al., 1998), autosomal recessive bestrophinopathy (ARB) (Burgess et al., 2008), adult-onset vitelliform dystrophy (AVMD) (Allikmets et al., 1999; Krämer et al., 2000), autosomal dominant vitreoretinochoroidopathy (ADVIRC) (Yardley et al., 2004), and retinitis pigmentosa (RP) (Davidson et al., 2009). Clinical phenotypes of bestrophinopathies include serous retinal detachment, lesions that resemble egg yolk, or vitelliform, and progressive vision loss that can potentially lead to blindness (Johnson et al., 2017). To date, over 250 distinct BEST1 mutations have been identified from bestrophinopathy patients, but their pathological mechanisms remain unclear. The majority of the BEST1 mutations are autosomal dominant, whereas the autosomal recessive ones are specifically linked to ARB (Johnson et al., 2017). As there is no effective treatment for bestrophinopathies yet, dissecting the molecular bases of different BEST1 mutations is critical for rational design of therapeutic strategies (Yang et al., 2015).

Functionally, bestrophin-1 (BEST1), the protein encoded by BEST1, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE) (Marmorstein et al., 2000). Bestrophinopathy patient-derived RPE cells exhibit abnormal Ca2+-dependent Cl- currents, underscoring the indispensable role of BEST1 as a CaCC in RPE (Li et al., 2017), although the contribution of other candidate CaCCs cannot be excluded. Structurally, while the human BEST1 structure has not been solved, high-resolution structures of three homologs from Klebsiella pneumoniae (KpBEST), chicken (cBEST1), and bovine (bBEST2) indicate that the channel is a highly conserved pentamer with a flower vase-shaped ion conducting pathway (Yang et al., 2014a; Kane Dickson et al., 2014; Owji et al., 2020).

A key question regarding the pathology of bestrophinopathies is how each BEST1 mutation specifically affects the channel activity, eventually resulting in retinal degeneration. The vast majority of the tested patient-derived mutations exhibited a loss-of-function phenotype, as the Cl- currents mediated by the mutant channels are significantly reduced compared to the wild-type (WT) BEST1 (Li et al., 2017; Hartzell et al., 2008; Johnson et al., 2014; Ji et al., 2019a; Ji et al., 2019b). We recently identified several gain-of-function mutations, which enhance the channel activity when transiently expressed in HEK293 cells but still cause bestrophinopathy (Ji et al., 2019a), suggesting the physiological importance of maintaining normal BEST1 functionality. However, although most loss-of-function and all gain-of-function mutations known so far are autosomal dominant, it remains elusive whether they have different capacities to influence the channel activity in the presence of WT BEST1, as one would expect in heterozygous carriers. In general, gain-of-function mutations often display a stronger dominant effect than loss-of-function mutations, but a side-by-side comparison between them has not been conducted for BEST1. This is essential for evaluating the pathogenicity of different BEST1 mutations, especially considering that allelic expression imbalance (AEI) at the BEST1 locus has been observed in human RPE (Llavona et al., 2017). Moreover, the strength of the mutations’ dominant effect is critical for gene augmentation therapy, as higher augmentation dosages may be necessary to suppress stronger mutations.

In this study, we quantitatively examined the functional influence of different classes of patient-derived mutations on the channel when the mutant and WT BEST1 were co-expressed at various ratios in HEK293 cells. Strikingly, all six autosomal dominant loss-of-function mutations behaved recessively at a 1:1 ratio with the WT BEST1 and required a superior 4:1 ratio to exhibit the mutant phenotype. It suggests that they act in a dominant-negative manner rather than the canonical dominant manner, which explains our previous results that gene augmentation is sufficient for the rescue of autosomal dominant loss-of-function mutations (Ji et al., 2019b). Consistent with this finding, the mutant BEST1 allele is transcribed at a higher level than the WT allele in patient-derived RPE cells. In sharp contrast, all three autosomal dominant gain-of-function mutations displayed a dominant behavior, even at an inferior 1:4 ratio with the WT BEST1. Due to their strong dominant effect, BEST1 gain-of-function mutations cannot be rescued by gene augmentation alone, but require CRISPR/Cas9-mediated silencing of the endogenous BEST1 in combination with gene augmentation for restoring Ca2+-dependent Cl- currents in RPE cells. Additionally, we confirmed the physiological role of BEST1 as the bona fide CaCC in RPE. Taken together, our results reveal the differences between loss- and gain-of-function mutations, and provide a therapeutic strategy for all BEST1 mutations.

Results

BEST1 loss-of-function mutations affect Cl- currents in a dosage-sensitive manner

To quantitatively evaluate the influence of BEST1 mutations on the channel activity under a condition mimicking the endogenous gene dosage, seven YFP-tagged BEST1 loss-of-function mutants, including six autosomal dominant (A10T, R218H, L234P, A243T, Q293K, and D302A) and one autosomal recessive (P274R), were individually mixed with CFP-tagged WT BEST1 at a 1:1 ratio and introduced into HEK293 cells for patch clamp recording. Surprisingly, in the presence of 1.2 μM free intracellular Ca2+ ([Ca2+]i), where BEST1 conducts peak current (Li et al., 2017), Cl- currents from cells co-expressing mutant and WT BEST1 were similar to those from cells expressing WT BEST1 alone (Figure 1a–h cyan, Figure 1—figure supplement 1a, Figure 1—figure supplement 2), regardless of whether the mutation is autosomal dominant or recessive. Therefore, these six loss-of-function mutations, although genetically defined as autosomal dominant, do not exhibit dominant behavior in vitro.

Figure 1. Functional influence of BEST1 loss-of-function mutants in HEK293 cells.

(a) Population steady-state current density-voltage relationships in HEK293 cells expressing BEST1 WT-CFP only (black), WT-CFP: WT-YFP = 1:1 (gray), or WT-CFP: WT-YFP = 1:4 (light gray), in the presence of 1.2 μM [Ca2+]i, n = 5–6 for each point. (b–h) Population steady-state current density-voltage relationships in HEK293 cells expressing BEST1 WT-CFP: mutant-YFP = 1:1 (cyan), WT-CFP: mutant-YFP = 1:4 (magenta), compared to mutant (red) or WT (black) only, in the presence of 1.2 μM [Ca2+]i, n = 5–6 for each point. The mutants are BEST1 A10T (b), R218H (c), L234P (d), A243T (e), Q293K (f), D302A (g), and P274R (h). All error bars in this figure represent s.e.m. See also Figure 1—figure supplements 1 and 2.

Figure 1.

Figure 1—figure supplement 1. Electrophysiological analysis of BEST1 loss-of-function mutations.

Figure 1—figure supplement 1.

(a) Bar chart showing population steady-state current densities at +100 mV for 1:1 co-expressed BEST1 WT-CFP and WT/mutant-YFP in HEK293 cells at 1.2 μM [Ca2+]i; n = 5–6 for each point. (b) Bar chart showing population steady-state current densities at +100 mV for 1:4 co-expressed BEST1 WT-CFP and WT/mutant-YFP in HEK293 cells at 1.2 μM [Ca2+]i; n = 5–6 for each point. *p<0.05 compared to WT only, using two-tailed unpaired Student’s t test. All error bars in this figure represent s.e.m.
Figure 1—figure supplement 2. Patient-derived BEST1 mutations in a homology model.

Figure 1—figure supplement 2.

Ribbon diagram of two oppositely facing (144°) protomers of a BEST1 pentamer is shown with the extracellular side on the top. (a) The side chains are shown and highlighted for residues at the neck (I76, F80, and F84, salmon) and aperture (I205, magenta). (b) The same diagram as a, rotated to the same degree as c. (c) The side chains are shown and highlighted for residues harboring loss-of-function (dominant: A10, R218, L234, A243, Q293, and D302, red; recessive: P274, blue) and gain-of-function (D203, I205, and Y236, magenta) mutations.

To test if a dominant-negative effect is at play, the mutants were individually co-transfected with WT BEST1 at a 4:1 ratio into HEK293 cells for patch clamp analysis. At 1.2 μM [Ca2+]i, Cl- currents from co-expression of an autosomal dominant mutant and WT BEST1 were significantly smaller than those from the WT only, and similar to those from the mutant only (Figure 1b–g magenta, Figure 1—figure supplement 1b). By contrast, currents from cells co-expressing the autosomal recessive P274R mutant and the WT BEST1 at a 4:1 ratio were still similar to those from cells expressing the WT BEST1 only (Figure 1h, Figure 1—figure supplement 1b). Therefore, the six previously recognized autosomal dominant mutations are actually dominant-negative in vitro, whereas the autosomal recessive P274R mutation indeed behaves recessively.

Imbalanced transcription of BEST1 alleles in human RPE

Our patch clamp results from transiently transfected HEK293 cells predict that the autosomal dominant mutant allele is expressed at a higher level than the WT allele in patients’ RPE, such that the dominant-negative effect can be manifested. To test this hypothesis, we extracted mRNA from patient-derived induced pluripotent stem cell (iPSC) differentiated RPE (iPSC-RPE), and measured the ratio of transcripts from the mutant and WT BEST1 alleles by reverse transcription polymerase chain reaction (RT-PCR) and TOPO cloning. Remarkably, the mutant genotype showed up three to four times more than the WT in all 12 BVMD patient-derived iPSC-RPE clones (two clones from each patient) (Table 1), indicating that the transcription level of the mutant allele is three- to fourfold higher than that of the WT allele in these patients’ RPE cells.

Table 1. Sequencing of BEST1 transcripts in retinal pigment epithelium (RPE) cells.

#1–6 are patient-derived iPSC-RPE cells carrying the same set of BEST1 mutations as those analyzed in transiently transfected HEK293 cells in Figure 1. #7 is native human RPE cells from a healthy donor bearing a single nucleotide polymorphism (SNP) in the BEST1 gene.

Donor # Mutation RPE type Mutant/WT from clone #1 Mutant/WT from clone #2
1 A10T iPSC-RPE 72/23 51/12
2 R218H iPSC-RPE 84/20 45/11
3 L234P iPSC-RPE 77/19 42/20
4 A243T iPSC-RPE 83/28 37/11
5 Q293K iPSC-RPE 76/19 46/10
6 D302A iPSC-RPE 78/18 35/14
7 rs767552540 Native 74/23 NA

To further validate if the two BEST1 alleles have imbalanced transcription in native RPE, we collected RPE cells from a post-mortem donor harboring heterozygosity of a single nucleotide polymorphism (SNP, rs767552540) in BEST1. Consistent with results from iPSC-RPE, transcripts from one allele outnumbered those from the other by approximately threefold in these native human RPE cells (Table 1).

Together, our results suggest that allelic imbalance of BEST1 transcription contributes to the dominant-negative effect of the autosomal dominant mutations. Importantly, this provides an explanation for the restoration of Ca2+-dependent Cl- currents by gene augmentation in iPSC-RPE cells bearing a BEST1 autosomal dominant loss-of-function mutation (Ji et al., 2019b): as long as the augmented WT BEST1 protein is expressed at a similar or higher level compared to the endogenous BEST1, the mutant to WT protein ratio is no longer in a dominant-negative scenario, such that the WT phenotype is exhibited as seen in 1:1 transiently transfected HEK293 cells (Figure 1b–g).

BEST1 gain-of-function mutations are bona fide dominant in vitro

We previously identified three BEST1 gain-of-function mutations, namely D203A, I205T, and Y236C, all of which are autosomal dominant (Figure 1—figure supplement 2Ji et al., 2019a). To test whether their behavior is dominant in vitro, each mutant was individually co-expressed with WT at 1:1 in HEK293 cells and subjected to patch clamp analysis. Without Ca2+, Cl- currents from cells co-expressing WT BEST1 and any of the mutants were significantly larger than those from cells expressing WT BEST1 only; at 1.2 μM [Ca2+]i, cells co-expressing D203A/WT and Y236C/WT displayed significantly bigger currents than WT only (Figure 2a–c left, Figure 2—figure supplement 1a); at both conditions, currents from cells co-expressing mutant/WT BEST1 resembled those from cells expressing the mutant only (Figure 2a–c, Figure 2—figure supplement 1a). These results indicate that these three gain-of-function mutations are indeed dominant, in contrast to the dominant-negative behavior of the six loss-of-function mutations.

Figure 2. Functional influence of BEST1 gain-of-function mutants in HEK293 cells.

(a–c) Left, population steady-state current density-voltage relationships in HEK293 cells co-expressing WT-CFP: mutant-YFP = 1:1 (cyan) compared to WT only (WT-CFP: WT-YFP = 1:1, gray), in the absence (open) or presence (solid) of 1.2 μM [Ca2+]i, n = 5–6 for each point. Right, population steady-state current density-voltage relationships in HEK293 cells co-expressing WT-CFP: mutant-YFP = 4:1 (blue) compared to mutant only (red), in the absence (open) or presence (solid) of 1.2 μM [Ca2+]i, n = 5–6 for each point. The mutants are BEST1 D203A (a), I205T (b), and Y236C (c). All error bars in this figure represent s.e.m. (d) WT or mutant BEST1-YFP-His was co-expressed with WT BEST1-CFP-Myc in HEK293 cells, and detected by immunoblotting directly in cell lysate (input) or after co-immunoprecipitation. See also Figure 2—figure supplements 1 and Figure 2—source data 1.

Figure 2—source data 1. The uncropped blots in Figure 2d and Figure 3—figure supplement 1.

Figure 2.

Figure 2—figure supplement 1. Electrophysiological analysis of BEST1 gain-of-function mutations.

Figure 2—figure supplement 1.

(a) Bar chart showing population steady-state current densities at +100 mV for 1:1 co-expressed BEST1 WT-CFP and WT/mutant-YFP in HEK293 cells in the absence (open) or presence (solid) of 1.2 μM [Ca2+]i; n = 5–6 for each point. *#p<0.05 compared to WT only in the absence or presence of Ca2+, respectively, using two-tailed unpaired Student’s t test. (b) Bar chart showing population steady-state current densities at +100 mV for 4:1 co-expressed BEST1 WT-CFP and WT/mutant-YFP in HEK293 cells in the absence (open) or presence (solid) of 1.2 μM [Ca2+]i; n = 5–6 for each point. *#p<0.05 compared to WT only in the absence or presence of Ca2+, respectively, using two-tailed unpaired Student’s t test. All error bars in this figure represent s.e.m.

Since BEST1 is presumably a pentamer based on known bestrophin structures (Yang et al., 2014a; Kane Dickson et al., 2014; Owji et al., 2020), it is possible that as few as one gain-of-function mutant monomer in the pentameric assembly could alter the channel function. To test this idea, HEK293 cells were co-transfected with mutant/WT BEST1 at a 1:4 ratio for patch clamp analysis. Under this condition, Ca2+-dependent Cl- currents from co-expression of a gain-of-function mutant and WT BEST1 were still similar to those from the mutant only (Figure 2a–c right, Figure 2—figure supplement 1b). These results suggest a potent dominant effect of the gain-of-function mutations: just one mutant monomer is sufficient to dominate the function of the pentameric channel. To confirm the interaction between the gain-of-function mutant and WT monomers, mutant BEST1-YFP-His and WT BEST1-CFP-Myc were co-expressed in HEK293 cells, followed by immunoprecipitation with an antibody against Myc and immunoblotting with antibodies against His and Myc, respectively. All three gain-of-function mutants were expressed at similar levels to that of WT BEST1 after transient transfection, and retained the interaction with WT BEST1 (Figure 2d), consistent with our previous observation that the interaction between BEST1 monomers is not affected by loss-of-function autosomal dominant mutations (Ji et al., 2019b).

Modeling BEST1 gain-of-function mutations in hPSC-RPE cells

We previously showed that WT gene augmentation is sufficient to restore Ca2+-dependent Cl- currents in iPSC-RPE cells with a BEST1 loss-of-function mutation, while the exogenous BEST1 is expressed at a comparable level to the endogenous protein (Ji et al., 2019b). As BEST1 gain-of-function mutations are dominant over the WT even at a 1:4 ratio (Figure 2a–c right, Figure 2—figure supplement 1b), it raises an important question on the efficacy of gene augmentation. However, iPSC-RPE cells bearing a gain-of-function mutation are currently unavailable due to the lack of patient samples.

To circumvent this obstacle, we generated isogenic RPE cells (human pluripotent stem cell [hPSC] derived RPE [hPSC-RPE]) from an H1 background hPSC line carrying an inducible Cas9 cassette (H1-iCas9), which allows efficient genome editing (González et al., 2014Moshfegh et al., 2016; Idelson et al., 2009). The RPE status of the hPSC-RPE cells was recognized by morphological signatures including intracellular pigment and hexagonal shape, and confirmed by immunoblotting with RPE-specific marker proteins RPE65 (retinal pigment epithelium-specific 65 kDa protein) and CRALBP (cellular retinaldehyde-binding protein) (Figure 3—figure supplement 1a; Moshfegh et al., 2016), consistent with the results from donor-derived iPSC-RPE (Figure 3—figure supplement 1b). Ca2+-dependent Cl- currents on the plasma membrane of BEST1WT/WT hPSC-RPE cells were recorded as 4 ± 1 and 267 ± 79 pA/pF at 0 and 1.2 μM [Ca2+]i, respectively, consistent with results from donor-derived BEST1WT/WT iPSC-RPE (Figure 3a). To evaluate the genetic dependency of Ca2+-dependent Cl- currents in RPE cells, we individually knocked out BEST1 and three other CaCCs, namely TMEM16A, TMEM16B, and LRRC8A in the H1-iCas9 cell line, and generated the corresponding knockout hPSC-RPE cells for patch clamp analysis. It should be noted that only the mRNA of BEST1, but not of the other three CaCCs, can be detected in WT PSC-RPE or donor native RPE cells (Figure 3—figure supplement 2a–b). Remarkably, Ca2+-dependent Cl- current was completely eliminated in BEST1-/- hPSC-RPE and a patient-derived BEST1 null (IVS1 +5G>A homo) iPSC-RPE (Figure 3b, Figure 3—figure supplement 3a–d; Fung et al., 2015), in contrast to the WT-like currents from TMEM16A-/-, TMEM16B-/-, or LRRC8A-/- hPSC-RPE cells (Figure 3c–e, Figure 3—figure supplement 3d). Consistently, the protein and mRNA levels of BEST1 were abolished in BEST1-/- hPSC-RPE cells, but not affected in TMEM16A-/-, TMEM16B-/-, or LRRC8A-/- hPSC-RPE cells (Figure 3—figure supplements 1a and 2c). Moreover, when WT BEST1 was expressed from a baculovirus vector in BEST1-/- hPSC-RPE and the patient-derived BEST1 null iPSC-RPE, Ca2+-dependent Cl- currents were fully rescued (Figure 3b, Figure 3—figure supplement 3c). Taken together, these results validate hPSC-RPE as a model system to study BEST1 function, and indicate that BEST1, but not TMEM16A, TMEM16B, or LRRC8A, is the CaCC conducting Ca2+-dependent Cl- current in human RPE.

Figure 3. BEST1 is responsible for conducting Ca2+-dependent Cl- currents in hPSC-RPE.

(a) Ca2+-dependent Cl- currents measured by whole-cell patch clamp in WT hPSC-RPE. Left, representative current traces recorded at 1.2 μM [Ca2+]i. Inset, voltage protocol used to elicit currents. Middle, population steady-state current density-voltage relationship in WT hPSC-RPE (black) compared to that from WT iPSC-RPE (gray), at 1.2 μM [Ca2+]i, n = 5–6 for each point. Right, steady-state current density recorded at +100 mV plotted vs. [Ca2+]i from WT hPSC-RPE (black) compared to that from WT iPSC-RPE (gray), n = 5–6 for each point. The plot was fitted to the Hill equation. (b–e) Ca2+-dependent Cl- currents measured by whole-cell patch clamp in BEST1-/- (b), TMEM16A-/- (c), TMEM16B-/- (d), or LRRC8A-/- (e) hPSC-RPE cells, respectively. Left, representative current traces recorded at 1.2 μM [Ca2+]i. Middle, population steady-state current density-voltage relationship in knockout hPSC-RPE cells (red), compared to that from WT hPSC-RPE cells (black), at 1.2 μM [Ca2+]i, n = 5–6 for each point. Right, steady-state current density recorded at +100 mV plotted vs. [Ca2+]i from knockout (red) and WT BEST1 supplemented (blue in b) hPSC-RPE cells, compared to the plot from WT hPSC-RPE (dotted black), n = 5–6 for each point. Plots were fitted to the Hill equation. *p<0.05 (1.8 × 10−2) compared to WT cells, using two-tailed unpaired Student’s t test. All error bars in this figure represent s.e.m. See also Figure 3—figure supplements 13 and Figure 3—source data 1.

Figure 3—source data 1. gRNA sequences for CRISPR/Cas9.

Figure 3.

Figure 3—figure supplement 1. Expression of RPE-specific marker proteins in hPSC-RPE and iPSC-RPE cells.

Figure 3—figure supplement 1.

(a–b) Immunoblotting showing the expression of RPE-specific proteins BEST1, RPE65, CRALBP, and the loading control β-Actin in hPSC-RPE (a) and iPSC-RPE (b) cells. Two gels/blots in the same panel were prepared from the same cell lysate of each PSC-RPE to detect BEST1 + β-Actin, and RPE65 + CRALBP, respectively.
Figure 3—figure supplement 2. mRNA levels of Ca2+-activated Cl- channels (CaCCs) in hPSC-RPE cells.

Figure 3—figure supplement 2.

(a) Reverse transcription polymerase chain reaction (RT-PCR) detecting BEST1 and control β-Actin mRNA in WT native RPE, iPSC-RPE and hPSC-RPE cells. Plasmids bearing the corresponding full-length cDNA were used as positive controls in PCR reactions. (b) RT-PCR detecting mRNA of TMEM16A, TMEM16B, and LRRC8A in WT native RPE, iPSC-RPE, and hPSC-RPE cells. Plasmids bearing the corresponding full-length cDNA were used as positive controls in PCR reactions. (c) RT-PCR detecting BEST1 and control β-Actin mRNA in WT and knockout hPSC-RPE cells.
Figure 3—figure supplement 3. Ca2+-dependent Cl- currents in iPSC-RPE and hPSC-RPE cells.

Figure 3—figure supplement 3.

(a) Ca2+-dependent Cl- currents measured by whole-cell patch clamp in patient-derived BEST1 null iPSC-RPE. Representative current traces recorded at 1.2 μM [Ca2+]i. (b) Population steady-state current density-voltage relationship in BEST1 null iPSC-RPE (red) compared to that in WT iPSC-RPE (gray), at 1.2 μM [Ca2+]i, n = 5–6 for each point. *p<0.05 compared to WT cells, using two-tailed unpaired Student’s t test. (c) Steady-state current density recorded at +100 mV plotted vs. [Ca2+]i from BEST1 null (red), and BEST1 null supplemented with WT BEST1 (blue), compared to WT iPSC-RPE (gray), n = 5–6 for each point. The plots were fitted to the Hill equation. (d) Bar chart showing population steady-state current densities at +100 mV in hPSC-RPE cells at 1.2 μM [Ca2+]i, n = 5–6 for each point. Two clonal hPSC-RPE cells from each genotype were recorded. Black, WT. Gray, knockout or knock-in mutants. All error bars in this figure represent s.e.m.

To model gain-of-function mutations, we individually introduced heterozygous I205T and Y236C mutations to the BEST1 gene in the H1-iCas9 cell line, generating BEST1I205T/WT and BEST1Y236C/WT hPSC cells, which were then differentiated to BEST1I205T/WT and BEST1Y236C/WT hPSC-RPE cells, respectively, for patch clamp analysis (Figure 3—figure supplement 1a). Consistent with results from transiently transfected HEK293 cells (Ji et al., 2019a), Cl- currents from BEST1I205T/WT hPSC-RPE were significantly bigger than those from WT under no or low Ca2+ conditions, but similar in the presence of high Ca2+ (Figure 4a–c, Figure 3—figure supplement 3d). On the other hand, the Ca2+-dependent Cl- currents from BEST1Y236C/WT hPSC-RPE were significantly larger than those from WT at all tested [Ca2+]is (Figure 4d–f, Figure 3—figure supplement 3d). These results reaffirm the gain-of-function and dominant behavior of the BEST1 I205T and Y236C mutations in RPE.

Figure 4. Ca2+-dependent Cl- currents in hPSC-RPE cells bearing BEST1 gain-of-function mutations.

(a) Representative current traces of BEST1I205T/WT hPSC-RPE in the absence of Ca2+. (b) Population steady-state current density-voltage relationships in BEST1I205T/WT hPSC-RPE, in the absence (open red) or presence (solid red) of 1.2 μM [Ca2+]i, compared to cells with WT BEST1 augmentation in the absence of Ca2+ (open blue), n = 5–8 for each point. *p<0.05 (1.3 × 10−3) compared to cells without augmentation in the absence of Ca2+, using two-tailed unpaired Student’s t test. (c) Steady-state current densities recorded at +100 mV plotted vs. [Ca2+]i in BEST1I205T/WT hPSC-RPE (red) compared to those in BEST1WT/WT hPSC-RPE cells (black), n = 5–6 for each point. (d–f) Data for BEST1Y236C/WT in the same format as (a–c), respectively. *p<0.05 (2.5 × 10−5) compared to cells without augmentation in the absence of Ca2+, using two-tailed unpaired Student’s t test. n = 5–10 for each point. All error bars in this figure represent s.e.m. See also Figure 4—figure supplement 1.

Figure 4.

Figure 4—figure supplement 1. CRISPR/Cas9-mediated gene silencing in combination with augmentation.

Figure 4—figure supplement 1.

(a) Augmented BEST1-GFP and endogenous BEST1 were detected by immunoblotting in hPSC-RPE cells. (b) Schematic of the baculovirus-based silencing (BVSi) vector. (c) Immunoblotting showing the knockdown of endogenous BEST1 expression with BVSi vectors and augmentation of wobble BEST1-mCherry in WT hPSC-RPE cells. (d) Immunoblotting showing the knockdown of endogenous BEST1 expression with BVSi 3–8 and augmentation of wobble BEST1-mCherry in hPSC-RPE cells carrying BEST1 gain-of-function mutations.

BEST1 gain-of-function mutations cannot be rescued by gene augmentation in hPSC-RPE

To test if the aberrant Ca2+-dependent Cl- current in hPSC-RPE bearing a BEST1 gain-of-function mutation is rescuable by gene augmentation, BEST1I205T/WT and BEST1Y236C/WT hPSC-RPE cells were infected with baculoviruses expressing WT BEST1-GFP and subjected to patch clamp analysis. Notably, Ca2+-dependent Cl- currents in these mutant hPSC-RPE cells remained aberrant after gene augmentation in the absence of Ca2+ (Figure 4b and e, open blue), despite the exogenous WT BEST1 being expressed at a higher level to that of the endogenous BEST1 (Figure 4—figure supplement 1a). This is in sharp contrast to the restoration of Ca2+-dependent Cl- current in BEST1-/- (Figure 3b, Figure 4—figure supplement 1a) or loss-of-function mutant RPE cells using the same approach (Ji et al., 2019b). Therefore, our results suggest that gene augmentation alone is insufficient to rescue BEST1 gain-of-function mutations.

Rescue of BEST1 gain-of-function mutations by non-selective CRISPR/Cas9-mediated gene silencing in combination with augmentation

There are two strategies to overcome the dominant effect of gain-of-function mutations: (1) specific silencing of the mutant allele and (2) non-selective silencing of both endogenous alleles and simultaneously supplying an exogenous WT gene. We reasoned that the latter is a more general approach as one design can be used for various mutations. For the targeted silencing of endogenous BEST1, we employed a programmable transcriptional repressor composed of a nuclease-dead Cas9 (dCas9) fused with a bipartite KRAB–MeCP2 repressor domain in the C-terminus (dCas9-KRAB-MeCP2) (Yeo et al., 2018). For the simultaneous delivery of the complete CRISPR machinery, we constructed a baculovirus-based silencing (BVSi) vector containing a CMV promoter-driven dCas9-KRAB-MeCP2-T2A-GFP expression cassette and a U6 promoter-driven gRNA expression cassette (Figure 4—figure supplement 1b). Multiple guides targeting exons 3 and 5 of BEST1 were screened by nuclease surveyor assay, and the most efficient ones along with a non-specific scramble guide were individually constructed into the BVSi backbone for virus production. The resultant BEST1-targeting (BVSi 3–8 and BVSi 5–4) and control (BVSi-Ctrl) viruses were used to infect WT hPSC-RPE cells. Immunoblotting showed a better BEST1 knockdown efficiency of the BVSi 3–8 virus compared to the BVSi 5–4 virus (Figure 4—figure supplement 1c). Consistently, Ca2+-dependent Cl- current from BVSi 3–8 infected cells was more effectively diminished compared to that from BVSi 5–4 infected cells at 1.2 μM [Ca2+]i (Figure 5a), where RPE cells display the peak Cl- current amplitude. These results indicate a high silencing efficacy of the BVSi 3–8 design, which was used for later steps of the silencing/augmentation strategy.

Figure 5. Knockdown and rescue of BEST1 gain-of-function mutations in hPSC-RPE cells.

Figure 5.

(a) Population steady-state current density-voltage relationships in WT hPSC-RPE cells treated with BVSi-Ctrl (black) compared to those in BVSi 3–8 (red) or BVSi 5–4 (blue) treated cells, at 1.2 μM [Ca2+]i, n = 5–17 for each point. *p<0.05 (8.3 × 10−7 for BVSi 3–8 and 1.6 × 10−6 for BVSi 5–4) compared to BVSi-Ctrl treated cells, using two-tailed unpaired Student’s t test. (b) Population steady-state current density-voltage relationships in WT hPSC-RPE cells treated with BVSi 3–8 plus wobble WT BEST1 (blue) compared to those in untreated cells (black), at 1.2 μM [Ca2+]i, n = 5–6 for each point. (c–d) Population steady-state current density-voltage relationships in BEST1I205T/WT (c) or BEST1Y236C/WT (d) hPSC-RPE cells treated with BVSi 3–8 alone (red), or BVSi 3–8 plus wobble WT BEST1 (blue), at 1.2 μM [Ca2+]i, n = 5–9 for each point. *p<0.05 (3.8 × 10−3 for I205T and 2.7 × 10−4 for Y236C) compared to cells treated with BVSi 3–8 alone, using two-tailed unpaired Student’s t test. (e–f) Steady-state current densities recorded at +100 mV plotted vs. [Ca2+]i in BEST1I205T/WT (e) or BEST1Y236C/WT (f) hPSC-RPE cells treated with BVSi 3–8 plus wobble WT BEST1 (blue) compared to those in untreated WT hPSC-RPE (black), n = 5–6 for each point. The plots were fitted to the Hill equation. All error bars in this figure represent s.e.m.

For augmentation of WT BEST1 in the presence of BVSi 3–8, we generated baculovirus bearing a wobble WT BEST1-mCherry resistant to the recognition by gRNA 3–8 (Figure 4—figure supplement 1c). When wobble WT BEST1-mCherry was co-expressed, the diminished Ca2+-dependent Cl- current in BVSi 3–8 treated WT hPSC-RPE cells was fully rescued at 1.2 μM [Ca2+]i (Figure 5b), validating our silencing/augmentation system in WT hPSC-RPE cells. To test this strategy for the rescue of gain-of-function mutations, we carried out the same set of experiments in BEST1I205T/WT and BEST1Y236C/WT hPSC-RPE cells. Remarkably, the endogenous BEST1 protein was diminished with BVSi 3–8 treatment (Figure 4—figure supplement 1d) in the mutant hPSC-RPE cells, concomitant with abolished Ca2+-dependent Cl- currents in these cells at 1.2 μM [Ca2+]i (Figure 5c–d), while co-expression of the wobble WT BEST1-mCherry restored Cl- currents to the WT levels at all tested [Ca2+]is (Figure 5c–f, Figure 4—figure supplement 1d), providing a proof-of-concept for the cure of bestrophinopathies associated with BEST1 gain-of-function mutations.

Discussion

In this study, we compared the influence of 10 patient-derived BEST1 mutations, including one autosomal recessive mutation, six autosomal dominant loss-of-function mutations, and three autosomal dominant gain-of-function mutations, on the channel activity of BEST1 in transiently transfected HEK293 cells. Although the recessive and gain-of-function mutations indeed exhibited their expected recessive and dominant behaviors, respectively, the autosomal dominant loss-of-function mutations only dominated over the WT BEST1 at a superior 4:1 ratio, but not at a canonical 1:1 ratio (Figure 1). As the majority of the over 250 documented BEST1 disease-causing mutations are autosomal dominant and display loss-of-function when tested in vitro, our results indicate an important role of allele-specific epigenetic control in the development of bestrophinopathies. In strong support of this finding, imbalanced transcription of the two endogenous BEST1 alleles was detected in donor-derived iPSC-RPE and native RPE cells (Table 1), consistent with the previous observation that BEST1 is one of the inherited retinal disease genes with AEI in the human retinal transcriptome (Llavona et al., 2017).

AEI has been proven to be a common phenomenon in mammals (Yan et al., 2002b). An SNP array-based survey of 602 human genes discovered that more than half of the genes display AEI (Lo et al., 2003), while a separate study analyzing the mouse transcriptome revealed that ~20% of genes are prone to AEI in a tissue-specific manner (Pinter et al., 2015). Moreover, AEI of somatic mutations has been well documented in the context of cancer (Bielski et al., 2018; Rhee et al., 2017; Yan et al., 2002a; Bielski and Taylor, 2021), representing an important mechanism of tumorigenesis. However, the implication of AEI in monogenic diseases is poorly understood. To our knowledge, the linkage between an inherited missense mutation and AEI in pathogenesis has not been established yet. Our results suggest that bestrophinopathies caused by autosomal dominant mutations of BEST1 may serve as a paradigm to address the influence of AEI in Mendelian disorders.

Conventionally, BEST1 autosomal dominant mutations are identified when the mutation is present on just one of the two BEST1 alleles in a bestrophinopathy patient. However, this classification only takes the genomic gene dosage into account but neglects the allelic transcription/expression level. The six autosomal dominant loss-of-function mutations tested in this study all behave recessively in HEK293 cells when co-expressed with the WT BEST1 at a 1:1 ratio, whereas the significantly decreased BEST1 channel activity in patient-derived iPSC-RPE cells is associated with a higher transcription level of the mutant allele compared to the WT counterpart, reflecting a dominant-negative effect rather than a canonical dominant effect. Therefore, we anticipate that a portion of the bestrophinopathy-causing mutations previously classified as autosomal dominant are de facto recessive and exhibit a dominant-negative phenotype when their expression outweighs that of the WT allele in vivo. This is in line with our previous finding that gene augmentation is sufficient to rescue BEST1 loss-of-function mutations regardless of their inheritance patterns (Ji et al., 2019b), and provides an explanation for incomplete penetrance and variable clinical expressivity in patients bearing the same BEST1 mutations (Sodi et al., 2012; Cohn et al., 2011; Arora et al., 2016).

BEST1’s intrinsic functionality as a CaCC, physiological localization in RPE, and pathological relevance to retinal degenerative bestrophinopathies strongly suggest that BEST1 is the primary CaCC in RPE. Consistent with this idea, we previously reported an indispensable role of BEST1 in generating Ca2+-dependent Cl- currents in donor-derived iPSC-RPE cells (Li et al., 2017). However, other candidates, including TMEM16A and TMEM16B, have also been proposed to be the physiological CaCC(s) in porcine or mouse RPE and the human RPE-derived ARPE-19 cells (Schreiber and Kunzelmann, 2016; Keckeis et al., 2017). Our results from isogenic knockout hPSC-RPE cells showed that Ca2+-dependent Cl- currents were diminished in BEST1-/- cells, and remained intact in TMEM16A-/-, TMEM16B-/-, or LRRC8A-/- cells (Figure 3). Therefore, we conclude that BEST1 is the bona fide CaCC in human RPE.

We previously established a ‘disease-in-a-dish’ model, in which skin fibroblasts collected from the carriers of different BEST1 mutations were reprogrammed into iPSC lines, and then differentiated into the corresponding iPSC-RPE cells for functional studies (Figure 3a, Figure 3—figure supplement 3a–c; Li et al., 2017; Kittredge et al., 2018). This iPSC-RPE- based model retains the patients’ genetic background and thus has direct relevance to BEST1-associated retinal disorders, but is limited by the availability of patient samples. For instance, some BEST1 mutations are rarer than others, and the carrier(s) may not be willing or logistically feasible to provide a sample. Here, we expanded the scope of our ‘disease-in-a-dish’ model based on an engineered hPSC line (H1-iCas9), which allows convenient introduction of desired BEST1 mutations via the CRISPR/Cas9-mediated genome editing technique, generating isogenic hPSC lines that can be differentiated into isogenic hPSC-RPE cells (Figures 34). Importantly, almost identical Ca2+-dependent Cl- currents were recorded from BEST1WT/WT hPSC-RPE compared to those from BEST1WT/WT iPSC-RPE (Figure 3a), validating hPSC-RPE as a versatile tool to model BEST1 mutations.

As the BEST1 channel is a pentameric assembly, the number of mutant protomers required for displaying a phenotype could theoretically be 1, 2, 3, 4, or 5. Interestingly, five subtypes of bestrophinopathies have been documented, implying a potential correlation between the ‘power’ of the mutations and the resultant diseases. Supporting this hypothesis, ARB is specifically caused by BEST1 autosomal recessive mutations, which represent the ‘weakest’ class that requires five mutant protomers in a channel pentamer to be phenotypic (Figure 1h, Figure 1—figure supplement 1). On the other hand, gain-of-function mutations such as D203A, I205T, and Y236C represent the ‘strongest’ class, which predominates over the WT BEST1 even at a 1:4 ratio (presumably one protomer per channel, Figure 2a–c and Figure 2—figure supplement 1b), although it remains unclear if they are specifically linked to a certain type of bestrophinopathy. Autosomal dominant loss-of-function mutations likely represent the ‘intermediate’ classes, which require 2–4 protomers in a BEST1 channel to display the mutant phenotype. For instance, the six loss-of-function mutations tested in this study (A10T, R218H, L234P, A243T, Q293K, and D302A) may represent the 4-mutant-protomer class as they are only dominant-negative at a 4:1 ratio with the WT in HEK293 cells, while Y85H, R92C, R218S, and G299E may represent the 2/3-mutant-protomer class(es), as they were previously shown to be dominant over the WT at a 1:1 ratio in HEK293 cells (Sun et al., 2002). However, the endogenous BEST1 mutant to WT molecule ratio in the RPE of bestrophinopathy patients with autosomal dominant mutations is still unknown, due to the lack of a quantitative approach to distinguish BEST1 missense variants from the WT counterpart at the protein level.

All three BEST1 gain-of-function mutations in this study exhibit a strong dominant effect, suppressing the WT even at a 1:4 ratio (Figure 2a–c, Figure 2—figure supplement 1b). This suggests that for effective gene augmentation therapy, the total level of WT BEST1 protein, supplied both endogenously and exogenously, must be at least four folds higher than that of the endogenous mutant BEST1. However, we showed that even with a CMV promoter, which produces an apparently higher level of exogenous BEST1 protein compared to that of endogenous BEST1, the gain-of-function phenotype in BEST1I205T/WT and BEST1Y236C/WT hPSC-RPE cells cannot be rescued (Figure 4b and e, Figure 4—figure supplement 1a). Therefore, it seems impractical to rescue BEST1 gain-of-function mutations by gene augmentation alone, especially considering that clinical applications may require the use of the native BEST1 promotor, which is presumably not as strong as the CMV promotor. Structurally, the three gain-of-function mutations (D203A, I205T, and Y236C) are located at or in a close proximity to the neck (I76, F80, and F84) or the aperture (I205) of the channel (Figure 1—figure supplement 2), and are involved in the opening of at least one of these two Ca2+-dependent gates (Ji et al., 2019a; Zhang et al., 2018). For instance, the I205T mutation, replacing a bulky isoleucine with a smaller side-chained threonine at the aperture (Figure 1—figure supplement 2), causes a Ca2+-independent “leak” due to enlargement of the channel constriction (Figure 2b, Figure 4a-cJi et al., 2019a). By contrast, loss-of-function mutations are located in various regions of the channel (Ji et al., 2019b).

There are two common strategies to overcome the strong dominant effect of gain-of-function mutations: (1) specific suppression of the endogenous mutant allele and (2) non-selective suppression of both endogenous alleles in combination with WT gene augmentation. We applied the latter approach in this study using a CRISPR/Cas9-based gene silencing vector (BVSi) to suppress the endogenous BEST1 expression (Tsai, 2018). As the BEST1 genomic locus recognized by our BVSi does not have any reported disease-causing mutations or polymorphisms, this BVSi design is universally suited for BEST1 silencing in bestrophinopathy patients no matter where their mutations are located within the gene. Notably, although gene augmentation alone is readily sufficient to rescue loss-of-function mutations (Ji et al., 2019b), simultaneously suppressing the endogenous BEST1 does not interfere with the functional restoration. Therefore, our silencing plus augmentation combination strategy can potentially be utilized for the treatment of all bestrophinopathies.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Escherichia coli) HST08 (Stellar cells) TaKaRa 636766 Chemical competent cells
Cell line (Spodoptera frugiperda) Sf9 Thermo Fisher Scientific RRID:CVCL_0549 Insect cell line for baculovirus production
Cell line (Homo sapiens) HEK293 ATCC RRID:CVCL_0045 Embryonic kidney cells
Cell line (Homo sapiens) H1-iCas9 Sloan Kettering Institute,
González et al., 2014
Embryonic stem cell line with an inducible CRISPR cassette
Cell line (Homo sapiens) H1-iCas9
BEST1-/-
This paper BEST1-/- knockout generated from the H1-iCas9 line
Cell line (Homo sapiens) H1-iCas9
TMEM16A-/-
This paper TMEM16A-/- knockout generated from the H1-iCas9 line
Cell line (Homo sapiens) H1-iCas9
TMEM16B-/-
This paper TMEM16B-/- knockout generated from the H1-iCas9 line
Cell line (Homo sapiens) H1-iCas9
LRRC8A-/-
This paper LRRC8A-/- knockout generated from the H1-iCas9 line
Cell line (Homo sapiens) H1-iCas9
BEST1I205T/WT
This paper BEST1I205T/WT knock-in generated from the H1-iCas9 line
Cell line (Homo sapiens) H1-iCas9
BEST1Y236C/WT
This paper BEST1Y236C/WT knock-in generated from the H1-iCas9 line
Biological sample (Homo sapiens) RPE cells Li et al., 2017 Human RPE cells from a post-mortem donor
Biological sample (Homo sapiens) iPSC-RPE cells Ji et al., 2019a iPSC-RPE cells derived from patient skin cells
Antibody Anti- RPE65 (Mouse monoclonal) Novus Biologicals Cat#: NB100-355, RRID:AB_10002148 WB (1:1,000)
Antibody Anti-CRALBP (mouse monoclonal) Abcam Cat#: ab15051, RRID:AB_2269474 WB (1:500)
Antibody Anti- BEST1 (mouse monoclonal) Novus Biologicals Cat#: NB300-164, RRID:AB_10003019 WB (1:500)
Antibody Anti-β-actin
(rabbit polyclonal)
Abcam Cat#: ab8227, RRID:AB_2305186 WB (1:2,000)
Antibody Anti- 6xHis
(rabbit polyclonal)
Thermo Fisher Scientific Cat#: PA1-983B, RRID:AB_1069891 WB (1:1,000)
Antibody Anti-Myc
(rabbit polyclonal)
Thermo Fisher Scientific Cat#: PA1-981, RRID:AB_325961 WB (1:1,000)
Antibody IRDye 680RD anti-mouse IgG (goat polyclonal) LI-COR Biosciences Cat#: 925–68070, RRID:AB_2651128 WB (1:10,000)
Antibody IRDye 800CW anti-rabbit IgG (donkey polyclonal) LI-COR Biosciences Cat#: 925–32213, RRID:AB_2715510 WB (1:10,000)
Recombinant DNA reagent pEG BacMam Goehring et al., 2014 Baculoviral vector for gene expression
Recombinant DNA reagent pBacMam-BEST1-GFP
(plasmid)
Li et al., 2017 To express exogenous BEST1 in HEK293 cells
Recombinant DNA reagent pBacMam-BEST1-mCherry
(plasmid)
This paper Made from pEG BacMam by inserting BEST1-mCherry
Recombinant DNA reagent dCas9-KRAB-MeCP2
(plasmid)
Addgene RRID
:Addgene_110821
Improved dCas9 repressor-dCas9-KRAB-MeCP2
Recombinant DNA reagent pSpCas9(BB)−2A-GFP (PX458)
(plasmid)
Addgene RRID
:Addgene_48138
Cas9 from Streptococcus pyogenes with 2A-EGFP, and cloning backbone for sgRNA
Recombinant DNA reagent BVSi 5–4-GFP (plasmid) This paper Made from pEG BacMam, dCas9-KRAB-MeCP2 and pSpCas9(BB)−2A-GFP, for BEST1 silencing
Recombinant DNA reagent BVSi 3–8-GFP (plasmid) This paper Made from pEG BacMam, dCas9-KRAB-MeCP2 and pSpCas9(BB)−2A-GFP, for BEST1 silencing
Recombinant DNA reagent BVSi ctrl-GFP (plasmid) This paper Made from pEG BacMam, dCas9-KRAB-MeCP2 and pSpCas9(BB)−2A-GFP, serving as a control for BEST1 silencing
Sequence-based reagent hBest1-I205T-ssDNA This paper Knock-in ssDNA template GCCCTGGGTGTGGTTTGCCAACCTGTCAATGAAGGCGTGGCTTGGAGGTCGAATTCGGGACCCTACCCTGCTCCAGAGCCTGCTGAACGTGAGCCCACTGTACAGACAGGGCTGCCGCAG
Sequence-based reagent hBest1-Y236C-ssDNA This paper Knock-in ssDNA template TCAGTGTGGACACCTGTATGCCTACGACTGGATTAGTATCCCACTGGTGTGTACACAGGTGAGGACTAGTCTGGTGAGGCTGCCCTTTTGGGAAACTGAGGCTAGAAGGACCAAGGAAGC
Commercial assay or kit CytoTune-iPS 2.0 Sendai reprogramming kit Thermo Fisher Scientific Cat#: A16517 To generate iPSC
Commercial assay or kit In-Fusion HD Cloning Clontech Clontech:639647 For molecular cloning
Commercial assay or kit PolyJet In Vitro DNA Transfection Reagent SignaGen Laboratories SL100688 For cell transfection
Software, algorithm Patchmaster HEKA RRID:SCR_000034 Patch clamp data collection and analysis
Software, algorithm PyMOL PyMOL RRID:SCR_000305 Structural analysis

Generation of human iPSC

The CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, A16517) was used to reprogram donor-provided skin fibroblasts into pluripotent stem cells (iPSC). Immunocytofluorescence assays were carried out following the previously published protocol to score iPSC pluripotency (Li et al., 2016). The iPSC cells from all the subjects enrolled in this study were characterized by detecting four standard pluripotency markers (SSEA4, Tra-1–60, SOX2, and Nanog). Nuclei were detected by Hoechst staining. All iPSC lines were passaged every 3–6 days while maintained in mTeSR-1 medium (STEMCELL Technologies, 85850). The morphology and nuclear/cytoplasmic ratio were closely monitored to ensure the stability of the iPSC lines. All the iPSC lines were sent for karyotyping by G-banding to verify genome integrity at Cell Line Genetics (Madison, WI).

Differentiation of iPSC and hPSC lines into RPE cells

iPSC and hPSC lines were cultured to confluence in six-well culture dishes pretreated with 1:50 diluted matrigel (CORNING, 356230). For the first 14 days, the differentiation medium consisted of Knock-Out (KO) DMEM (Thermo Fisher Scientific, 10829018), 15% KO serum replacement (Thermo Fisher Scientific, 10829028), 2 mM glutamine (Thermo Fisher Scientific, 35050061), 50 U/ml penicillin-streptomycin (Thermo Fisher Scientific, 10378016), 1% nonessential amino acids (Thermo Fisher Scientific, 11140050), and 10 mM nicotinamide (Sigma-Aldrich, N0636). During days 15–28 of differentiation, the differentiation medium was supplemented with 100 ng/ml human Activin-A (PeproTech, 120–14). From day 29 on, the differentiation medium without Activin-A supplementation was used again until differentiation was completed. After roughly 8–10 weeks, dispersed pigmented flattened clusters were formatted and manually picked to matrigel-coated dishes. These cells were kept in RPE culture medium as previously described (Maminishkis et al., 2006). It takes another 6–8 weeks in culture for them to form a functional monolayer, which would be ready for function assays. In addition to well-established classical mature RPE markers (Bestrophin1, CRALBP, and RPE65), two more markers (PAX6 and MITF) were also used to validate the RPE fate of the cells. All iPSC-RPE cells in this study were at passage 1. DNA sequencing was used to verify genomic mutations in the mutant iPSC-RPE cells.

Cell lines

HEK293 cells were purchased from ATCC. As HEK293 is on the International Cell Line Authentication Committee’s list of commonly misidentified cell lines, the cells used in this study were authenticated by short tandem repeat DNA profiling and tested negative for mycoplasma contamination. The culture medium was DMEM (4.5 g/l glucose, Corning 10013CV) supplemented with 100 μg/ml penicillin-streptomycin and 10% fetal bovine serum.

H1-iCas9 cells were purchased from the Stem Cell Research Facility of Memorial Sloan Kettering Cancer Center. The culture medium was mTeSR1 with supplement (STEMCELL Technologies, 85850).

Electrophysiology

An EPC10 patch clamp amplifier (HEKA Electronics) controlled by Patchmaster (HEKA) was utilized to conduct whole-cell recordings 24–72 hr after splitting of RPE cells or transfection of HEK293 cells. Micropipettes were pulled and fashioned from 1.5 mm thin-walled glass with filament (WPI Instruments) and filled with internal solution containing (in mM): 130 CsCl, 10 EGTA, 1 MgCl2, 2 MgATP (added fresh), 10 HEPES (pH 7.4, adjusted by CsOH), and CaCl2 to obtain the desired free Ca2+ concentration (maxchelator.stanford.edu/CaMgATPEGTA-TS.htm). Series resistance was usually 1.5–2.5 MΩ. No electronic series resistance compensation was used. External solution contained (in mM): 140 NaCl, 15 glucose, 5 KCl, 2 CaCl2, 1 MgCl2, and 10 HEPES (pH 7.4, adjusted by NaOH). Solution osmolarity was between 310 and 315. A family of step potentials (−100 to +100 mV from a holding potential of 0 mV) were used to generate I-V curves. Currents were sampled at 25 kHz and filtered at 5 or 10 kHz. Traces were acquired at a repetition interval of 4 s (Yang et al., 2014b). All experiments in this study were carried out at ambient temperature (23 ± 2°C).

Immunoblotting

Cell pellets were extracted by the M-PER mammalian protein extraction reagent (Thermo Fisher Scientific, 78501) supplemented with proteinase inhibitors (Roche, 04693159001), and the protein concentration was quantified by a Bio-Rad protein reader. After denaturing at 95°C for 5 min, the samples (20 μg) were run on 4–15% gradient SDS-PAGE gel at room temperature, and wet transferred onto nitrocellulose membrane at 4°C. The membranes were incubated in blocking buffer containing 5% (w/v) non-fat milk for 1 hr at room temperature and subsequently incubated overnight at 4°C in blocking buffer supplemented with primary antibody. Primary antibodies against the following proteins were used: CRALBP (1:500 Abcam, ab15051), RPE65 (1:1,000 Novus Biologicals, NB100-355), β-Actin (1:2,000 Abcam, ab8227), BEST1 (1:500 Novus Biologicals, NB300-164), His (1:1,000 Fisher Scientific, PA1983B), and Myc (1:1,000 Fisher Scientific, PA1981). Fluorophore-conjugated mouse and rabbit secondary antibodies (LI-COR Biosciences, 925–68070 and 925–32213, respectively) were used at a concentration of 1:10,000 and an incubation time of 1 hr at room temperature, followed by infrared imaging.

Immunoprecipitation

HEK293 cells cultured on 6 cm dishes were co-transfected with pBacMam-BEST1(WT)-CFP-Myc and pBacMam-BEST1(mutant or WT)-YFP-His at 1:1 ratio using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories, SL100688) following the manufacturer’s standard manual. Forty-eight hours post transfection, cells were harvested by centrifugation at 1000 × g for 5 min at room temperature. Cell pellets were lysed in pre-cooled lysis buffer (150 mM NaCl, 50 mM Tris, 0.5% IGEPAL CA-630, pH 7.4) supplemented with protease inhibitor cocktails (Roche, 04693159001) for 30 min on ice, and then centrifuged at 13,000 rpm for 12 min at 4°C. The supernatant (300 μg) was collected and mixed with 2 μg Myc monoclonal antibody (Thermo Fisher Scientific, MA1-980). After rotating overnight at 4°C, the mixture was incubated with Dynabeads M-280 sheep anti-mouse IgG (Thermo Fisher Scientific, 11202D) for 5 hr at 4°C. After thorough washing of the beads, bound fractions were eluted in 1× SDS sample buffer (Biorad, 1610747) by heating for 10 min at 75°C. Proteins were then resolved by SDS-PAGE and analyzed by immunoblotting.

Baculovirus production and transduction

BacMam baculovirus bearing BVSi 5–4-GFP, BVSi 3–8-GFP, BVSi-Ctrl-GFP, or wobble BEST1-mcherry were generated in-house as previously described (Goehring et al., 2014). For transduction, the viruses were added to the culture medium of freshly split hPSC-RPE cells.

Molecular cloning

Point mutations in BEST1 were made by site-directed mutagenesis PCR with the In-fusion Cloning Kit (Clontech). All constructs were fully sequenced.

Measuring allelic transcription level

Total RNA was extracted from cell pellets with the PureLink RNA Mini Kit (ThermoFisher, 12183020) and subjected to cDNA synthesis using the RevertAid First Strand cDNA synthesis kit (Thermo Fisher K1621). The resultant cDNA was used as the template for PCR amplification of the target BEST1 regions that contain mutations/polymorphisms, and the PCR products were sub-cloned using the TOPO Cloning Kit (Thermo Fisher, 451245) for sequencing.

Knockout/knock-in in H1-iCas9 cells

Doxycycline (2 µg/ml) was supplemented to the culture medium to induce Cas9 expression and maintained in the medium for 3 days. Twenty-four hours post doxycycline addition, the cells were transfected with gRNA (+ssDNA for knock-in) as previously described (Zhu et al., 2014). After recovery to ~50% confluency, the cells were lifted by TrypLE (Thermo Fisher, 12604013) treatment, and seeded to 2 × 10 cm2 fresh plates at 1000 and 2000 cells/plate, respectively. Ten to 12 days later, single colonies became visible and were picked into individual wells on a 96-well plate. After amplification, each single colony was subjected for genotyping by Sanger sequencing.

For the knockout of BEST1, TMEM16A, TMEM16B, and LRRC8A, gRNAs were designed to target the N-terminal portion of the coding genomic sequences, such that all or most of the transmembrane domain is eliminated in the residual translated product (if it exists), rendering it functionally null.

gRNA design for CRISPR/Cas9-mediated gene editing/silencing

The gRNAs were designed using online software (http://www.IDTdna.com) and are summarized in Figure 3—source data 1.

Transfection

Twenty to 24 hr before transfection, HEK293 cells were lifted by incubation with 0.25% trypsin at room temperature for 5 min and split into new 3.5 cm culture dishes at ~50% confluency. Plasmids (1 μg) bearing the WT BEST1 or desired mutant were transfected using PolyJet transfection reagent (SignaGen SL100688). The transfection mix was removed after 4–8 hr, and cells were rinsed with PBS once and cultured in supplemented DMEM. Twenty-four hours post transfection, cells were lifted again by trypsin treatment and split onto fibronectin-coated glass coverslips for patch clamp (Yang et al., 2013).

Electrophysiological data and statistical analyses

Patch clamp data were analyzed off-line with Patchmaster (HEKA), Microsoft Excel, and Origin. Statistical analyses were conducted using built-in functions in Origin. For comparisons between two groups, statistically significant differences between means (p<0.05) were determined using Student’s t test. Data are presented as means ± s.e.m (Yang et al., 2007).

Homology modeling of human BEST1

A homology model for BEST1 was generated using the Swiss-Model server from the chicken BEST1 crystal structure (Kane Dickson et al., 2014). The structural figure was made in PyMOL.

Human samples

Skin biopsy samples were obtained from a healthy control donor and patients, and processed and cultured as previously described (Li et al., 2016). For these procedures, all of which were approved by Columbia University Institutional Review Board (IRB) protocol AAAF1849, the donors provided written informed consent. All methods were performed in accordance with the relevant regulations and guidelines. Donor native RPE was isolated from human autopsy eye shell purchased from the Eye-Bank for Sight Restoration (New York, NY, 10005).

Acknowledgements

We thank the Unrestricted Grant to the Department of Ophthalmology, Columbia University, from Research to Prevent Blindness (RPB). YS was supported by National Key R and D Program of China (2017YFE0103400). The Jonas Children’s Vision Care was supported by NIH grants (EY028758, CA013696, EY030580, OD020351, EY027285, EY019007, EY018213, EY024698, EY026682, AG050437), the Schneeweiss Stem Cell Fund, New York State (SDHDOH01-C32590GG-3450000), the Foundation Fighting Blindness New York Regional Research Center Grant (PPA-1218–0751-COLU), Nancy and Kobi Karp, the Crowley Family Funds, the Rosenbaum Family Foundation, Alcon Research Institute, the Gebroe Family Foundation, and the RPB Physician-Scientist Award. TY was supported by NIH grants (GM127652, EY028758), the Irma T Hirschl/Monique Weill-Caulier Research Award, and Columbia University Faculty Recruitment Award.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Yin Shen, Email: yinshen@whu.edu.cn.

Yu Zhang, Email: yz3802@cumc.columbia.edu.

Stephen H Tsang, Email: sht2@cumc.columbia.edu.

Tingting Yang, Email: ty2190@cumc.columbia.edu.

Merritt Maduke, Stanford University School of Medicine, United States.

Richard W Aldrich, The University of Texas at Austin, United States.

Funding Information

This paper was supported by the following grants:

  • National Key R&D Program of China 2017YFE0103400 to Yin Shen.

  • National Institutes of Health EY028758 to Stephen H Tsang.

  • National Institutes of Health CA013696 to Stephen H Tsang.

  • National Institutes of Health EY030580 to Stephen H Tsang.

  • National Institutes of Health OD020351 to Stephen H Tsang.

  • National Institutes of Health EY027285 to Stephen H Tsang.

  • National Institutes of Health EY019007 to Stephen H Tsang.

  • National Institutes of Health EY018213 to Stephen H Tsang.

  • National Institutes of Health EY024698 to Stephen H Tsang.

  • National Institutes of Health EY026682 to Stephen H Tsang.

  • National Institutes of Health AG050437 to Stephen H Tsang.

  • Foundation Fighting Blindness PPA-1218-0751-COLU to Stephen H Tsang.

  • Schneeweiss Stem Cell Fund SDHDOH01-C32590GG-3450000 to Stephen H Tsang.

  • Nancy & Kobi Karp to Stephen H Tsang.

  • Crowley Family Funds to Stephen H Tsang.

  • Rosenbaum Family Foundation to Stephen H Tsang.

  • Alcon Research Institute to Stephen H Tsang.

  • Gebroe Family Foundation to Stephen H Tsang.

  • Research to Prevent Blindness Physician-Scientist Award to Stephen H Tsang.

  • National Institutes of Health GM127652 to Tingting Yang.

  • National Institutes of Health EY028758 to Tingting Yang.

  • Irma T. Hirschl/Monique Weill-Caulier Trust Research Award to Tingting Yang.

  • Columbia University Faculty Recruitment Award to Tingting Yang.

Additional information

Competing interests

No competing interests declared.

Provisional Patent Application No. 63/174,090.

Provisional Patent Application No. 63/174,090. Stephen H Tsang has received financial benefits from Spark Therapeutics and research support from Abeona Therapeutics, Inc and Emendo.

Provisional Patent Application No. 63/174,090.

Author contributions

Data curation, Validation, Investigation, Methodology, Formal analysis.

Data curation, Validation, Investigation, Methodology, Writing - review and editing.

Data curation, Investigation, Writing - review and editing.

Data curation.

Supervision, Writing - review and editing.

Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Resources, Supervision, Funding acquisition, Validation, Writing - review and editing.

Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Additional files

Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for Figure 2 and Figure 3.

References

  1. Allikmets R, Seddon JM, Bernstein PS, Hutchinson A, Atkinson A, Sharma S, Gerrard B, Li W, Metzker ML, Wadelius C, Caskey CT, Dean M, Petrukhin K. Evaluation of the best disease gene in patients with age-related macular degeneration and other maculopathies. Human Genetics. 1999;104:449–453. doi: 10.1007/s004390050986. [DOI] [PubMed] [Google Scholar]
  2. Arora R, Khan K, Kasilian ML, Strauss RW, Holder GE, Robson AG, Thompson DA, Moore AT, Michaelides M. Unilateral BEST1-Associated retinopathy. American Journal of Ophthalmology. 2016;169:24–32. doi: 10.1016/j.ajo.2016.05.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bielski CM, Donoghue MTA, Gadiya M, Hanrahan AJ, Won HH, Chang MT, Jonsson P, Penson AV, Gorelick A, Harris C, Schram AM, Syed A, Zehir A, Chapman PB, Hyman DM, Solit DB, Shannon K, Chandarlapaty S, Berger MF, Taylor BS. Widespread selection for oncogenic mutant allele imbalance in Cancer. Cancer Cell. 2018;34:852–862. doi: 10.1016/j.ccell.2018.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bielski CM, Taylor BS. Mutant allele imbalance in Cancer. Annual Review of Cancer Biology. 2021;5:221–234. doi: 10.1146/annurev-cancerbio-051320-124252. [DOI] [Google Scholar]
  5. Burgess R, Millar ID, Leroy BP, Urquhart JE, Fearon IM, De Baere E, Brown PD, Robson AG, Wright GA, Kestelyn P, Holder GE, Webster AR, Manson FD, Black GC. Biallelic mutation of BEST1 causes a distinct retinopathy in humans. The American Journal of Human Genetics. 2008;82:19–31. doi: 10.1016/j.ajhg.2007.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cohn AC, Turnbull C, Ruddle JB, Guymer RH, Kearns LS, Staffieri S, Daggett HT, Hewitt AW, Mackey DA. Best's macular dystrophy in Australia: phenotypic profile and identification of novel BEST1 mutations. Eye. 2011;25:208–217. doi: 10.1038/eye.2010.180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Davidson AE, Millar ID, Urquhart JE, Burgess-Mullan R, Shweikh Y, Parry N, O'Sullivan J, Maher GJ, McKibbin M, Downes SM, Lotery AJ, Jacobson SG, Brown PD, Black GC, Manson FD. Missense mutations in a retinal pigment epithelium protein, bestrophin-1, cause retinitis pigmentosa. The American Journal of Human Genetics. 2009;85:581–592. doi: 10.1016/j.ajhg.2009.09.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Fung AT, Yzer S, Goldberg N, Wang H, Nissen M, Giovannini A, Merriam JE, Bukanova EN, Cai C, Yannuzzi LA, Tsang SH, Allikmets R. New best1 mutations in autosomal recessive bestrophinopathy. Retina. 2015;35:773–782. doi: 10.1097/IAE.0000000000000387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Goehring A, Lee CH, Wang KH, Michel JC, Claxton DP, Baconguis I, Althoff T, Fischer S, Garcia KC, Gouaux E. Screening and large-scale expression of membrane proteins in mammalian cells for structural studies. Nature Protocols. 2014;9:2574–2585. doi: 10.1038/nprot.2014.173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. González F, Zhu Z, Shi ZD, Lelli K, Verma N, Li QV, Huangfu D. An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells. Cell Stem Cell. 2014;15:215–226. doi: 10.1016/j.stem.2014.05.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hartzell HC, Qu Z, Yu K, Xiao Q, Chien LT. Molecular physiology of bestrophins: multifunctional membrane proteins linked to best disease and other retinopathies. Physiological Reviews. 2008;88:639–672. doi: 10.1152/physrev.00022.2007. [DOI] [PubMed] [Google Scholar]
  12. Idelson M, Alper R, Obolensky A, Ben-Shushan E, Hemo I, Yachimovich-Cohen N, Khaner H, Smith Y, Wiser O, Gropp M, Cohen MA, Even-Ram S, Berman-Zaken Y, Matzrafi L, Rechavi G, Banin E, Reubinoff B. Directed differentiation of human embryonic stem cells into functional retinal pigment epithelium cells. Cell Stem Cell. 2009;5:396–408. doi: 10.1016/j.stem.2009.07.002. [DOI] [PubMed] [Google Scholar]
  13. Ji C, Kittredge A, Hopiavuori A, Ward N, Chen S, Fukuda Y, Zhang Y, Yang T. Dual Ca2+-dependent Gates in human Bestrophin1 underlie disease-causing mechanisms of gain-of-function mutations. Communications Biology. 2019a;2:240–433. doi: 10.1038/s42003-019-0433-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ji C, Li Y, Kittredge A, Hopiavuori A, Ward N, Yao P, Fukuda Y, Zhang Y, Tsang SH, Yang T. Investigation and restoration of BEST1 activity in Patient-derived RPEs with dominant mutations. Scientific Reports. 2019b;9:19026. doi: 10.1038/s41598-019-54892-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Johnson AA, Lee YS, Chadburn AJ, Tammaro P, Manson FD, Marmorstein LY, Marmorstein AD. Disease-causing mutations associated with four bestrophinopathies exhibit disparate effects on the localization, but not the Oligomerization, of Bestrophin-1. Experimental Eye Research. 2014;121:74–85. doi: 10.1016/j.exer.2014.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Johnson AA, Guziewicz KE, Lee CJ, Kalathur RC, Pulido JS, Marmorstein LY, Marmorstein AD. Bestrophin 1 and retinal disease. Progress in Retinal and Eye Research. 2017;58:45–69. doi: 10.1016/j.preteyeres.2017.01.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kane Dickson V, Pedi L, Long SB. Structure and insights into the function of a ca(2+)-activated cl(-) channel. Nature. 2014;516:213–218. doi: 10.1038/nature13913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Keckeis S, Reichhart N, Roubeix C, Strauß O. Anoctamin2 (TMEM16B) forms the Ca2+-activated Cl- channel in the retinal pigment epithelium. Experimental Eye Research. 2017;154:139–150. doi: 10.1016/j.exer.2016.12.003. [DOI] [PubMed] [Google Scholar]
  19. Kittredge A, Ji C, Zhang Y, Yang T. Differentiation, maintenance, and analysis of human retinal pigment epithelium cells: a Disease-in-a-dish model for BEST1 mutations. Journal of Visualized Experiments. 2018;138:57791. doi: 10.3791/57791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Krämer F, White K, Pauleikhoff D, Gehrig A, Passmore L, Rivera A, Rudolph G, Kellner U, Andrassi M, Lorenz B, Rohrschneider K, Blankenagel A, Jurklies B, Schilling H, Schütt F, Holz FG, Weber BH. Mutations in the VMD2 gene are associated with juvenile-onset vitelliform macular dystrophy (Best disease) and adult vitelliform macular dystrophy but not age-related macular degeneration. European Journal of Human Genetics. 2000;8:286–292. doi: 10.1038/sj.ejhg.5200447. [DOI] [PubMed] [Google Scholar]
  21. Li Y, Nguyen HV, Tsang SH. Skin biopsy and Patient-Specific stem cell lines. Methods in Molecular Biology. 2016;1353:77–88. doi: 10.1007/7651_2015_225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li Y, Zhang Y, Xu Y, Kittredge A, Ward N, Chen S, Tsang SH, Yang T. Patient-specific mutations impair bestrophin1's essential role in mediating Ca2+-dependent Cl- currents in human RPE. eLife. 2017;6:e29914. doi: 10.7554/eLife.29914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Llavona P, Pinelli M, Mutarelli M, Marwah VS, Schimpf-Linzenbold S, Thaler S, Yoeruek E, Vetter J, Kohl S, Wissinger B. Allelic expression imbalance in the human retinal transcriptome and potential impact on inherited retinal diseases. Genes. 2017;8:283. doi: 10.3390/genes8100283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lo HS, Wang Z, Hu Y, Yang HH, Gere S, Buetow KH, Lee MP. Allelic variation in gene expression is common in the human genome. Genome Research. 2003;13:1855–1862. doi: 10.1101/gr.1006603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Maminishkis A, Chen S, Jalickee S, Banzon T, Shi G, Wang FE, Ehalt T, Hammer JA, Miller SS. Confluent monolayers of cultured human fetal retinal pigment epithelium exhibit morphology and physiology of native tissue. Investigative Opthalmology & Visual Science. 2006;47:3612–3624. doi: 10.1167/iovs.05-1622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Marmorstein AD, Marmorstein LY, Rayborn M, Wang X, Hollyfield JG, Petrukhin K. Bestrophin, the product of the best vitelliform macular dystrophy gene (VMD2), localizes to the basolateral plasma membrane of the retinal pigment epithelium. PNAS. 2000;97:12758–12763. doi: 10.1073/pnas.220402097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Marquardt A, Stöhr H, Passmore LA, Krämer F, Rivera A, Weber BH. Mutations in a novel gene, VMD2, encoding a protein of unknown properties cause juvenile-onset vitelliform macular dystrophy (Best's disease) Human Molecular Genetics. 1998;7:1517–1525. doi: 10.1093/hmg/7.9.1517. [DOI] [PubMed] [Google Scholar]
  28. Moshfegh Y, Velez G, Li Y, Bassuk AG, Mahajan VB, Tsang SH. Bestrophin1 mutations cause defective chloride conductance in patient stem cell-derived RPE. Human Molecular Genetics. 2016;25:2672–2680. doi: 10.1093/hmg/ddw126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Owji AP, Zhao Q, Ji C, Kittredge A, Hopiavuori A, Fu Z, Ward N, Clarke OB, Shen Y, Zhang Y, Hendrickson WA, Yang T. Structural and functional characterization of the bestrophin-2 anion channel. Nature Structural & Molecular Biology. 2020;27:382–391. doi: 10.1038/s41594-020-0402-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Petrukhin K, Koisti MJ, Bakall B, Li W, Xie G, Marknell T, Sandgren O, Forsman K, Holmgren G, Andreasson S, Vujic M, Bergen AA, McGarty-Dugan V, Figueroa D, Austin CP, Metzker ML, Caskey CT, Wadelius C. Identification of the gene responsible for best macular dystrophy. Nature Genetics. 1998;19:241–247. doi: 10.1038/915. [DOI] [PubMed] [Google Scholar]
  31. Pinter SF, Colognori D, Beliveau BJ, Sadreyev RI, Payer B, Yildirim E, Wu CT, Lee JT. Allelic imbalance is a prevalent and Tissue-Specific feature of the mouse transcriptome. Genetics. 2015;200:537–549. doi: 10.1534/genetics.115.176263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rhee JK, Lee S, Park WY, Kim YH, Kim TM. Allelic imbalance of somatic mutations in Cancer genomes and transcriptomes. Scientific Reports. 2017;7:1653. doi: 10.1038/s41598-017-01966-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Schreiber R, Kunzelmann K. Expression of anoctamins in retinal pigment epithelium (RPE) Pflügers Archiv - European Journal of Physiology. 2016;468:1921–1929. doi: 10.1007/s00424-016-1898-2. [DOI] [PubMed] [Google Scholar]
  34. Sodi A, Passerini I, Murro V, Caputo R, Bacci GM, Bodoj M, Torricelli F, Menchini U. BEST1 sequence variants in italian patients with vitelliform macular dystrophy. Molecular Vision. 2012;18:2736–2748. [PMC free article] [PubMed] [Google Scholar]
  35. Sun H, Tsunenari T, Yau KW, Nathans J. The vitelliform macular dystrophy protein defines a new family of chloride channels. PNAS. 2002;99:4008–4013. doi: 10.1073/pnas.052692999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tsai YT. CRISPR-based genome surgery for the treatment of autosomal dominant retinitis pigmentosa. Ophthalmology. 2018;125:1421–1430. doi: 10.1016/j.ophtha.2018.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yan H, Dobbie Z, Gruber SB, Markowitz S, Romans K, Giardiello FM, Kinzler KW, Vogelstein B. Small changes in expression affect predisposition to tumorigenesis. Nature Genetics. 2002a;30:25–26. doi: 10.1038/ng799. [DOI] [PubMed] [Google Scholar]
  38. Yan H, Yuan W, Velculescu VE, Vogelstein B, Kinzler KW. Allelic variation in human gene expression. Science. 2002b;297:1143. doi: 10.1126/science.1072545. [DOI] [PubMed] [Google Scholar]
  39. Yang T, Suhail Y, Dalton S, Kernan T, Colecraft HM. Genetically encoded molecules for inducibly inactivating CaV channels. Nature Chemical Biology. 2007;3:795–804. doi: 10.1038/nchembio.2007.42. [DOI] [PubMed] [Google Scholar]
  40. Yang T, He LL, Chen M, Fang K, Colecraft HM. Bio-inspired voltage-dependent calcium channel blockers. Nature Communications. 2013;4:2540. doi: 10.1038/ncomms3540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yang T, Liu Q, Kloss B, Bruni R, Kalathur RC, Guo Y, Kloppmann E, Rost B, Colecraft HM, Hendrickson WA. Structure and selectivity in bestrophin ion channels. Science. 2014a;346:355–359. doi: 10.1126/science.1259723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yang T, Hendrickson WA, Colecraft HM. Preassociated apocalmodulin mediates Ca2+-dependent sensitization of activation and inactivation of TMEM16A/16B Ca2+-gated cl- channels. PNAS. 2014b;111:18213–18218. doi: 10.1073/pnas.1420984111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Yang T, Justus S, Li Y, Tsang SH. BEST1: the best target for gene and cell therapies. Molecular Therapy. 2015;23:1805–1809. doi: 10.1038/mt.2015.177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yardley J, Leroy BP, Hart-Holden N, Lafaut BA, Loeys B, Messiaen LM, Perveen R, Reddy MA, Bhattacharya SS, Traboulsi E, Baralle D, De Laey JJ, Puech B, Kestelyn P, Moore AT, Manson FD, Black GC. Mutations of VMD2 splicing regulators cause nanophthalmos and autosomal dominant vitreoretinochoroidopathy (ADVIRC) Investigative Opthalmology & Visual Science. 2004;45:3683–3689. doi: 10.1167/iovs.04-0550. [DOI] [PubMed] [Google Scholar]
  45. Yeo NC, Chavez A, Lance-Byrne A, Chan Y, Menn D, Milanova D, Kuo CC, Guo X, Sharma S, Tung A, Cecchi RJ, Tuttle M, Pradhan S, Lim ET, Davidsohn N, Ebrahimkhani MR, Collins JJ, Lewis NE, Kiani S, Church GM. An enhanced CRISPR repressor for targeted mammalian gene regulation. Nature Methods. 2018;15:611–616. doi: 10.1038/s41592-018-0048-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang Y, Kittredge A, Ward N, Ji C, Chen S, Yang T. ATP activates bestrophin ion channels through direct interaction. Nature Communications. 2018;9:3126. doi: 10.1038/s41467-018-05616-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhu Z, González F, Huangfu D. The iCRISPR platform for rapid genome editing in human pluripotent stem cells. Methods in Enzymology. 2014;546:215–250. doi: 10.1016/B978-0-12-801185-0.00011-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Merritt Maduke1
Reviewed by: Wallace B Thoreson2

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This study addresses the genetic basis for different "bestrophinopathies" which are a family of retinal diseases caused by gene mutations in BEST1, an ion channel. The experiments are methodically planned and executed, the data are well-described and interpreted, and the results will be very interesting to a broad audience, including channel biophysicists and clinicians alike as they consider the physiological function of BEST1 and the development of therapies to treat Best's dystrophy.

Decision letter after peer review:

Thank you for submitting your article "Distinct expression requirements and rescue strategies for BEST1 loss- and gain-of-function mutations" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Richard Aldrich as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Wallace B Thoreson (Reviewer #1).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1. The text states that Ca2+-independent currents in both HEK cells and iPSC-derived RPE cells expressing the I205T mutant gene were significantly larger than WT currents. However, the differences shown in the paper are extremely small and not very convincing. Is this truly a gain-of-function Ca2+-dependent Cl- current? Especially since there was no change in Ca2+-dependent currents? In the rescue experiments of Figure 5, the generality of their conclusion that one must first silence the mutant gene would be more strongly supported if they tested the D203A mutant that shows a more appreciable increase in function. Do the authors have data with this mutant? What is the rationale for studying the I205T mutant rather than the D203A mutant? We hope you may have data in hand from the D203A mutant to further substantiate their conclusions, but if not we think you can answer this question without further experiments.

2. Please state explicitly in the text that the mutants studied in Table 1 are the loss-of-function mutants shown in Figure 2. We do not see it stated clearly in the text. In addition, it would be interesting to see the transcription levels for gain-of-function mutants if they are available.

3. Please provide some discussion on mutant transcription regulation of WT alleles in other diseases. Is this common? Uncommon?

4. There were many mutations tested in this manuscript, some tested dominant negative, some dominant, some recessive. Since there are structures of BEST1 and -2 and are similar in structure to each other, it is curious if the site of mutants reside closely in a region or close in space to each other on the 3D structure, especially in the pentameric form. If so, it would be helpful and intriguing to show that in a final figure; if they do not align close in space to each other, then stating that within the text would be beneficial.

5. The difference between iPSCs (used in figure 3) and hPSCs (used in figure 4) is not clear.

6. The authors might consider including a key in the figure, especially where four traces are included in a single I-V plot. Although all of the information is included in the figure legend, the reader might be able to more quickly understand figure without needing to go back and forth with the figure legend when examining the data.

7. The authors might also consider using labels within the figures to remind readers when the data are 1:1, 4:1 or 1:4 in figures 1-3 and where applicable. Although the text explains when the different ratios are used and the experiments are well motivated, it took us a second read to clarify these differences, which are important in the light of loss-of-function versus gain-of-function mutations.

Reviewer #1:

This study addresses the genetic basis for different "bestrophinopathies" which are a family of retinal diseases caused by BEST1 gene mutations. The authors tested gene dosage effects by expressing different levels of various loss-of-function and gain-of-function BEST1 mutants in HEK293 cells. Mutant Ca2+-activated Cl- currents matched WT currents when dominant loss-of-function mutants were expressed at 1:1 ratio with WT BEST1 but were reduced when mutants were expressed at 4:1 ratio. Expression of loss-of-function mutant alleles in RPE cells differentiated from human iPSC cells with BEST1 mutations and in native RPE cells from a Best's patient showed 3-4 fold greater transcription of the mutant allele. These data suggest that these nominally autosomal dominant mutants actually behave like dominant-negative mutants. By comparison, an autosomal recessive mutation behaved as expected, exhibiting WT currents at both 1:1 and 4:1 ratios but diminished currents when the mutant was expressed in the absence of WT cDNA. Two gain of function mutants showed enhanced Ca2+-dependent Cl- currents when expressed at a ratio of only 1:4 with WT cDNA. In RPE cells derived from human iPSCs, endogenous Ca2+-activated Cl- currents were eliminated after knockout of BEST1 gene but not other potential candidates (e.g., TMEM16), providing further evidence in support of the hypothesis that BEST1 forms Ca2+-activated Cl- channels in these cells. They then examined two gain-of-function mutants in derived RPE cells to test whether over-expressing WT genes could rescue these mutant cells. Unlike loss-of-function mutants, they found that rescue only occurred if they first silenced the mutant gene. This suggests a potential strategy for treating gain-of-function mutations.

The study design is clear and clean. The data quality is quite high, incorporating both molecular and electrophysiological studies of expression levels in two types of cells: HEK293 cells and iPSC-derived RPE cells. The results are generally clear and convincing. The potential impact for future treatment of Best's dystrophy is high.

Reviewer #2:

This manuscript is an elegant study that reports that BEST1 patient-derived loss-of-function and gain-of-function mutations require different mutant/WT molecule ratios in order to produce a phenotype. Through quantitative examination in first transiently transfected HEK cells then in patient-derived RPE cells and in an hPSC-RPE model system, the authors showed that six mutations in the BEST1 gene that were found associated with an autosomal dominant form of bestrophiopathy were affecting the function of the Ca++-dependent Cl- channel (CaCC) in a dominant manner. In fact, these six mutations required a 4:1 ratio with WT BEST1 to exhibit the mutant phenotype, indicative of a recessive trait. This is an intriguing result, and correlates well with data they obtained from RT-PCR of mRNA taken from patient-derived iPSC-RPE clones. These data indicated the transcription level of the mutant allele is 3-4-fold higher than that of the WT allele in these patients' cells. In contrast, the authors showed that three autosomal dominant gain-of-function mutations all displayed a dominant behavior, even at a 1:4 ratio with the WT BEST1. Additionally, the authors confirmed the role of BEST1 as the genuine CaCC in RPE.

The manuscript is very well-written. The experiments are methodically planned and executed, the data are well-described and interpreted, and are very interesting to a broad audience.

Reviewer #3:

Background: Bestrophin 1 (BEST1) is a Ca2+-activated Cl- implicated in a number of retinal degeneration disorders known as bestrophinopathies. There are 250 distinct BEST1 mutations linked to autosomal dominant disorders whereas autosomal recessive mutations are linked to autosomal recessive bestrophinopathy (ARB). Despite these findings, the pathological mechanisms behind these autosomal dominance or autosomal recessive mutations remains unclear. Here, the authors sought to determine whether autosomal dominant loss-of-function and gain-of-function BEST1 mutations influence channel activity differently in heterozygous carriers.

Synopsis: Using recordings of Best1 channels with disease causing mutations, the authors report that BEST1 loss-of-function and gain-of-function mutations require different mutant:WT ratios to manifest phenotypes. They also report that BEST1 gain-of-function mutations do not restore BEST1-dependent Cl- currents whereas loss-of-function mutations get rescued. Finally, they report that the combination of gene augmentation and CRISPR/Cas9-mediated knockdown of BEST1 could be a potential treatment.

The experiments presented here are exciting and would be interesting to channel biophysicists and clinicians alike as they address an important question in relation to bestrophinopathies as well as the effects of mutant to wild-type ratio in disease manifestation.

eLife. 2021 Jun 1;10:e67622. doi: 10.7554/eLife.67622.sa2

Author response


Essential revisions:

1. The text states that Ca2+-independent currents in both HEK cells and iPSC-derived RPE cells expressing the I205T mutant gene were significantly larger than WT currents. However, the differences shown in the paper are extremely small and not very convincing. Is this truly a gain-of-function Ca2+-dependent Cl- current? Especially since there was no change in Ca2+-dependent currents? In the rescue experiments of Figure 5, the generality of their conclusion that one must first silence the mutant gene would be more strongly supported if they tested the D203A mutant that shows a more appreciable increase in function. Do the authors have data with this mutant? What is the rationale for studying the I205T mutant rather than the D203A mutant? We hope you may have data in hand from the D203A mutant to further substantiate their conclusions, but if not we think you can answer this question without further experiments.

The gain-of-function phenotype of I205T is exhibited under no or low Ca2+ conditions, where significantly larger currents are consistently recorded from both endogenous BEST1 in hPSC-RPE (BEST1I205T/WT vs. BEST1WT/WT: 73 ± 22 vs. 4 ± 1 pA/pF in the absence of Ca2+, 71 ± 26 vs. 6 ± 2 pA/pF in the presence of 139 nM Ca2+, Figure 4c) and exogenous BEST1 transiently expressed in HEK293 (I205T vs. WT: 13 ± 3 vs. 3 ± 0.4 pA/pF in the absence of Ca2+, Figure 2b and Figure 2‒figure supplement 1), representing a Ca2+-independent “leak” due to the enlarged aperture (I205, which is a Ca2+-dependent gate of the channel), caused by the I205T mutation. We have added a figure showing the locations of these mutations (Figure 1‒figure supplement 2), and a description paragraph in Discussion (Page 15).

We attempted to generate BEST1D203A/WT, BEST1I205T/WT and BEST1Y236C/WT hPSC cells at the same time, but unfortunately failed to obtain BEST1D203A/WT hPSC due to technical issues. We have been actively trouble shooting, but so far only have data from BEST1I205T/WT and BEST1Y236C/WT hPSC-RPE cells.

2. Please state explicitly in the text that the mutants studied in Table 1 are the loss-of-function mutants shown in Figure 2. We do not see it stated clearly in the text. In addition, it would be interesting to see the transcription levels for gain-of-function mutants if they are available.

As the reviewer suggested, we have added in the Table 1 legend that they are donor derived iPSC-RPEs carrying the same BEST1 mutations as those analyzed in transiently expressed HEK293 in Figure 1.

We currently do not have any BEST1 gain-of-function patient samples, so cannot access the transcription levels of these mutants under a pathologically relevant setting such as patient derived iPSC-RPE cells. The hPSC-RPE cells carrying gain-of-functions (BEST1I205T/WT and BEST1Y236C/WT) in the manuscript are both engineered from the same parental iCas9-H1 hPSC line, so their BEST1 allelic transcription levels would unlikely inform the epigenetic control of BEST1 in real patients.

3. Please provide some discussion on mutant transcription regulation of WT alleles in other diseases. Is this common? Uncommon?

As the reviewer suggested, we have added a paragraph of discussion on this point (Page 12).

4. There were many mutations tested in this manuscript, some tested dominant negative, some dominant, some recessive. Since there are structures of BEST1 and -2 and are similar in structure to each other, it is curious if the site of mutants reside closely in a region or close in space to each other on the 3D structure, especially in the pentameric form. If so, it would be helpful and intriguing to show that in a final figure; if they do not align close in space to each other, then stating that within the text would be beneficial.

As the reviewer suggested, we have added a figure (Figure 1‒figure supplement 2) showing the locations of the examined mutations in a BEST1 channel homology model. The three gain-of-function mutations (D203A, I205T and Y236C) are at or in a close proximity to the neck or the aperture (composed of I76/F80/F84 and I205, respectively, both are Ca2+-dependent gates of the channel), and are involved in the opening of at least one of the gates. By contrast, loss-offunction mutations are located in various regions of the channel. We have added this information in Discussion (Page 15).

5. The difference between iPSCs (used in figure 3) and hPSCs (used in figure 4) is not clear.

iPSCs are generated from skin cells of different donors by reprogramming, and then differentiated into the corresponding iPSC-RPEs. hPSCs used in this study are all derived from the parental H1-iCas9 hPSC line, and then differentiated into the corresponding hPSC-RPEs. The cells in Figures 3 and 4 are all hPSC-RPEs, except for a BEST1WT/WT iPSC-RPE which is used in Figure 3a to serve as a control for the validation of BEST1WT/WT hPSC-RPE. For clarification, we have labelled the results from iPSC-RPE and hPSC-RPE cells in Figure 3a and added a paragraph in Discussion (Page 13).

6. The authors might consider including a key in the figure, especially where four traces are included in a single I-V plot. Although all of the information is included in the figure legend, the reader might be able to more quickly understand figure without needing to go back and forth with the figure legend when examining the data.

As the reviewer suggested, we have added labels illustrating which trace is from which experimental group in Figures 1-4 and Figure 2‒figure supplement 1.

7. The authors might also consider using labels within the figures to remind readers when the data are 1:1, 4:1 or 1:4 in figures 1-3 and where applicable. Although the text explains when the different ratios are used and the experiments are well motivated, it took us a second read to clarify these differences, which are important in the light of loss-of-function versus gain-of-function mutations.

As the reviewer suggested, we have added labels illustrating which trace is from which experimental group in Figures 1-4 and Figure 2‒figure supplement 1.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 2—source data 1. The uncropped blots in Figure 2d and Figure 3—figure supplement 1.
    Figure 3—source data 1. gRNA sequences for CRISPR/Cas9.
    Transparent reporting form

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for Figure 2 and Figure 3.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES