Skip to main content
BMC Genomics logoLink to BMC Genomics
. 2021 Aug 4;22:592. doi: 10.1186/s12864-021-07876-9

Multi-omics data integration reveals novel drug targets in hepatocellular carcinoma

Christos Dimitrakopoulos 1,2,3,#, Sravanth Kumar Hindupur 4,5,#, Marco Colombi 4, Dritan Liko 4, Charlotte K Y Ng 6,7, Salvatore Piscuoglio 6,8,9, Jonas Behr 1,2, Ariane L Moore 1,2, Jochen Singer 1,2, Hans-Joachim Ruscheweyh 1,2, Matthias S Matter 6, Dirk Mossmann 4, Luigi M Terracciano 6, Michael N Hall 4,✉, Niko Beerenwinkel 1,2,✉
PMCID: PMC8340535  PMID: 34348664

Abstract

Background

Genetic aberrations in hepatocellular carcinoma (HCC) are well known, but the functional consequences of such aberrations remain poorly understood.

Results

Here, we explored the effect of defined genetic changes on the transcriptome, proteome and phosphoproteome in twelve tumors from an mTOR-driven hepatocellular carcinoma mouse model. Using Network-based Integration of multi-omiCS data (NetICS), we detected 74 ‘mediators’ that relay via molecular interactions the effects of genetic and miRNA expression changes. The detected mediators account for the effects of oncogenic mTOR signaling on the transcriptome, proteome and phosphoproteome. We confirmed the dysregulation of the mediators YAP1, GRB2, SIRT1, HDAC4 and LIS1 in human HCC.

Conclusions

This study suggests that targeting pathways such as YAP1 or GRB2 signaling and pathways regulating global histone acetylation could be beneficial in treating HCC with hyperactive mTOR signaling.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12864-021-07876-9.

Keywords: HCC, mTOR signaling, NetICS, Omics

Background

Liver cancer is the second leading cause of cancer-related deaths worldwide, and hepatocellular carcinoma (HCC) accounts for approximately 90% of primary liver cancer cases [1]. Approximately 50% of HCC tumors exhibit loss of the tumor suppressors Pten, Tsc1, or Tsc2 leading to aberrant PI3K–AKT–mTOR signaling. However, the effector pathways via which mTOR promotes tumorgenicity are widely unknown. We generated an mTOR-driven HCC mouse model, by liver-specific deletion of the tumor suppressors Pten and Tsc1 [2, 3], to investigate the molecular and cellular mechanisms of mTOR-driven tumorgenicity.

While DNA sequencing has enabled a comprehensive characterization of tumor genomes and stratification of patients, translating such information into treatment strategies has remained a major challenge. A limitation of relying entirely on genomic data to determine a therapeutic strategy is that it ignores functionally-related, non-mutated genes that could also encode potential drug targets. In addition, different mutations across cancer patients (genetic divergence) could result in the same pathways being activated (functional convergence) [4]. Apart from somatic mutations, tumorigenesis can be regulated by the levels of specific miRNAs, mRNAs, proteins and protein phosphorylation. miRNAs are key regulators of the transcriptome and can act as either oncogenes or tumor suppressors. Common mechanisms that can dysregulate miRNA expression in human cancers include amplification, deletion or epigenetic changes [5]. Transcriptomic and proteomic analyses have been performed to stratify HCC patients into clinically-relevant groups [6–8]. However, to further understand the effect of a genetic aberration or dysregulated gene expression (possibly due to aberrant miRNA expression) it is necessary to identify the mediators common to diverse alterations. Distinct genomic aberrations (in different tumors) are expected to converge functionally on the same downstream protein, referred to here as a ‘mediator’. To identify such mediators, it is essential to integrate omics data, i.e., the genome, transcriptome, proteome and phosphoproteome (commonly referred to as multi-omics analysis), from diverse tumors.

Recently, multi-omics analysis has been informative in the characterization of tumors. For example, integration of DNA, RNA and phosphoproteomic data enabled stratification of prostate cancer patients and to identify individualized treatment options [9]. Computational methods that focus on the direct effect of genetic aberrations, i.e., the effect of a gene mutation on the encoded protein, have also been proposed [10]. However, a major drawback of these studies is that they rely solely on genomic analysis. New methods are necessary to integrate different types of omics data to identify dysregulated pathways.

In this study we use NetICS, a computational method to integrate multi-omic data (somatic mutations, miRNA differential expression, transcriptomics, proteomics and phospho proteomics) from an mTOR-driven mouse HCC tumor model [11], to understand the molecular mechanisms of mTOR-driven HCC. NetICS provides a comprehensive framework that reveals how specific genetic aberrations (i.e., deletion of the tumor suppressors Pten and Tsc1) and tumor-specific changes in miRNA expression can affect downstream mediators. NetICS employs a sample-specific network diffusion process that reveals the convergence of diverse changes in distinct tumors (mutations and differentially expressed miRNAs) on common downstream mediators. The identified mediators include transcription factors, kinases, phosphatases and deacetylases. While, some of the mediators are known oncogenes, others are novel oncogenic mediators. These mediators are potential, novel drug targets.

Results

We isolated tumors from an HCC mouse model generated by liver-specific deletion of Pten and Tsc1 (Fig. 1A). We hereafter refer to this model as the liver-specific double-knockout (L-dKO) mouse. We isolated twelve distinct liver tumors, three each from four 20 week old L-dKO mice. To detect somatic mutations, we compared exome sequence data from tumors and from matched muscle tissue (Fig. 1B). For all other analyses (RNA, miRNA, proteome and phosphoproteome), we compared the tumor nodules to healthy liver tissue from six control mice (cre-negative, age- and sex-matched littermates) (Fig. 1C). We detected a total of 157 point mutations and small insertions/deletions in the twelve tumors (Table 1). Except for the originally introduced Pten and Tsc1 deletions (Fig. S1), no specific mutation was found in more than a single tumor (Fig. 2A-B). In contrast to somatic mutations, we detected mRNAs, miRNAs, proteins and phosphosites commonly dysregulated across multiple tumor samples (Fig. 2C-F). On average, 4,348 mRNA, 108 miRNAs, 2,389 proteins and 906 phosphosites were dysregulated in the tumor samples (Fig. 3A-D).

Fig. 1.

Fig. 1

Experimental setting. A. Representative images of whole livers from 20-week-old L-dKO (tumors are indicated with arrowheads) and control mice. B. Three independent tumor samples were taken from each of four 20-week-old L-dKO mice. For each mouse, one muscle sample was used as the matched healthy tissue. This setting was used for exome sequencing. Each of the three tumor nodules was compared against the matched muscle tissue sample. C. Three independent tumor samples were taken from each of four 20-week-old L-dKO mice. Liver tissues from six cre-negative age- and sex- matched littermates were used as a control. This setting was used for mRNA sequencing, miRNA sequencing, proteome and phosphoproteome quantification

Table 1.

Shown are the results of exome sequencing in the 12 tumor nodules. Relevant information are given such as the position in thechromosome, the reference and alternative alleles, the type of mutation, the amino acid substitution and variant allele frequency

TUMOR_SAMPLE NORMAL_SAMPLE CHROM POS REF ALT GENE EFFECT Alteration (cDNA) Alteration (AA) Depth in tumor Variant allele fraction
368N4 368muscle 1 65050991 C T Cryge missense_variant c.31G>A p.Gly11Ser 58 8.80%
357N1 357muscle 1 85577158 G C G530012D18Rik missense_variant c.283G>C p.Glu95Gln 15 26.70%
368N2 368muscle 1 86426453 C A 1700019O17Rik missense_variant c.83C>A p.Ala28Asp 42 7.10%
373N4 373muscle 1 92942579 C A Capn10 missense_variant c.786C>A p.His262Gln 48 6.30%
373N4 373muscle 1 1.06E+08 C T Phlpp1 stop_gained c.4243C>T p.Arg1415* 110 21.80%
358N3 358muscle 1 1.28E+08 C A Lct missense_variant c.3054G>T p.Met1018Ile 43 7.00%
373N4 373muscle 1 1.31E+08 C A Pfkfb2 missense_variant c.619G>T p.Asp207Tyr 89 4.50%
358N3 358muscle 1 1.66E+08 C A Gm4846 missense_variant c.1305G>T p.Met435Ile 72 5.60%
358N3 358muscle 1 1.67E+08 G T Aldh9a1 missense_variant c.712G>T p.Ala238Ser 44 6.80%
368N2 368muscle 1 1.81E+08 C A Acbd3 missense_variant c.337C>A p.His113Asn 25 12.00%
358N3 358muscle 2 13486755 C A Cubn missense_variant&splice_region_variant c.480G>T p.Lys160Asn 47 6.40%
357N1 357muscle 2 25911320 C A Kcnt1 synonymous_variant c.3409C>A p.Arg1137Arg 35 8.60%
368N2 368muscle 2 58982966 G T Ccdc148 missense_variant c.614C>A p.Ala205Asp 28 10.70%
358N3 358muscle 2 66565161 C A Scn9a stop_gained c.538G>T p.Glu180* 24 12.50%
368N4 368muscle 2 1.04E+08 A C D430041D05Rik missense_variant c.1942T>G p.Leu648Val 267 13.10%
373N4 373muscle 2 1.12E+08 A G Olfr1308 missense_variant c.344T>C p.Leu115Pro 51 11.80%
368N2 368muscle 2 1.2E+08 C A Rpap1 missense_variant c.1903G>T p.Ala635Ser 34 8.80%
373N4 373muscle 2 1.2E+08 C A Pla2g4e missense_variant c.665G>T p.Cys222Phe 38 7.90%
373N3 373muscle 2 1.46E+08 C A Cfap61 missense_variant c.1976C>A p.Ala659Asp 46 6.50%
368N2 368muscle 2 1.53E+08 C A Asxl1 missense_variant c.3191C>A p.Pro1064Gln 84 4.80%
368N4 368muscle 2 1.62E+08 A G Ptprt synonymous_variant c.295T>C p.Leu99Leu 75 16.00%
368N2 368muscle 2 1.67E+08 C A B4galt5 missense_variant c.766G>T p.Ala256Ser 16 18.80%
368N2 368muscle 3 86780226 G T Lrba missense_variant c.8437G>T p.Ala2813Ser 48 6.30%
358N3 358muscle 3 88360373 G A Smg5 synonymous_variant c.2799G>A p.Arg933Arg 86 4.70%
357N1 357muscle 3 88367297 G A Paqr6 missense_variant c.685G>A p.Ala229Thr 22 18.20%
373N3 373muscle 3 1.03E+08 C A Csde1 missense_variant c.845C>A p.Pro282Gln 47 6.40%
357N5 357muscle 3 1.04E+08 C A Rsbn1 missense_variant c.1871C>A p.Ala624Asp 27 11.10%
358N3 358muscle 4 24536440 G T Mms22l synonymous_variant c.2028G>T p.Ala676Ala 77 5.20%
357N1 357muscle 4 40738329 G T Smu1 stop_gained c.1404C>A p.Cys468* 35 8.60%
358N3 358muscle 4 41034270 G T Aqp7 synonymous_variant c.888C>A p.Gly296Gly 17 17.60%
358N1 358muscle 4 56937908 C A Tmem245 missense_variant c.639G>T p.Leu213Phe 19 15.80%
358N2 358muscle 4 1.01E+08 G T Jak1 synonymous_variant c.1245C>A p.Leu415Leu 41 7.30%
368N4 368muscle 4 1.26E+08 C T Csf3r synonymous_variant c.2145C>T p.Ser715Ser 53 13.20%
358N3 358muscle 4 1.53E+08 G T Nphp4 synonymous_variant c.1500G>T p.Ser500Ser 46 6.50%
373N4 373muscle 4 1.54E+08 A G Cep104 missense_variant c.1544A>G p.Lys515Arg 121 4.10%
373N4 373muscle 4 1.55E+08 G A Plch2 synonymous_variant c.3087C>T p.Ala1029Ala 38 8.10%
373N3 373muscle 4 1.56E+08 A G Mib2 synonymous_variant c.966T>C p.Ala322Ala 102 5.90%
358N3 358muscle 4 1.56E+08 C A Agrn missense_variant c.4334G>T p.Arg1445Leu 46 6.50%
368N2 368muscle 5 34813050 C A Htt missense_variant c.1541C>A p.Ser514Tyr 50 6.00%
358N3 358muscle 5 63937830 C A Rell1 stop_gained c.292G>T p.Glu98* 83 4.80%
357N1 357muscle 5 1.12E+08 C A Hps4 synonymous_variant c.1359C>A p.Pro453Pro 39 7.70%
373N3 373muscle 5 1.22E+08 C A Rad9b missense_variant c.727G>T p.Ala243Ser 40 7.50%
368N2 368muscle 6 29283208 G T Fam71f2 missense_variant c.204G>T p.Met68Ile 35 8.60%
357N1 357muscle 6 89342587 G A Plxna1 missense_variant&splice_region_variant c.1735C>T p.Pro579Ser 31 9.70%
358N2 358muscle 6 91486900 C G Tmem43 missense_variant c.1156C>G p.Pro386Ala 89 5.60%
358N3 358muscle 6 92189633 C T Zfyve20 missense_variant c.2029G>A p.Ala677Thr 75 20.00%
373N4 373muscle 6 1.29E+08 G T BC048546 missense_variant c.2389C>A p.Pro797Thr 41 7.30%
358N3 358muscle 7 24710200 C A BC049730 missense_variant c.43C>A p.Leu15Met 28 10.70%
368N2 368muscle 7 29292075 C A Ppp1r14a missense_variant c.307C>A p.Pro103Thr 44 6.80%
368N2 368muscle 7 34204130 T C Gpi1 missense_variant c.1297A>G p.Thr433Ala 46 6.50%
373N3 373muscle 7 80738221 G A Iqgap1 missense_variant c.2677C>T p.Arg893Cys 46 6.50%
358N2 358muscle 7 1.18E+08 C G Xylt1 missense_variant c.2763C>G p.Cys921Trp 38 10.50%
368N4 368muscle 7 1.26E+08 G A Gsg1l synonymous_variant c.918C>T p.His306His 121 5.00%
368N2 368muscle 7 1.27E+08 C A Zfp768 missense_variant c.937G>T p.Gly313Cys 41 7.30%
373N1 373muscle 7 1.4E+08 G T Olfr525 missense_variant c.686G>T p.Arg229Leu 95 4.20%
368N2 368muscle 7 1.44E+08 C A Ppfia1 missense_variant c.2471G>T p.Ser824Ile 48 6.30%
373N1 373muscle 8 11517878 C G Cars2 missense_variant c.1216G>C p.Val406Leu 169 8.30%
368N2 368muscle 8 13955760 C A Tdrp stop_gained c.160G>T p.Glu54* 50 6.00%
368N2 368muscle 8 15041975 C T BB014433 missense_variant c.877G>A p.Val293Met 42 14.30%
358N3 358muscle 8 68358564 G T Csgalnact1 missense_variant c.1453C>A p.Pro485Thr 50 6.00%
373N4 373muscle 8 72346037 C A Eps15l1 missense_variant c.2509G>T p.Asp837Tyr 18 16.70%
373N4 373muscle 8 80730168 C T Smarca5 synonymous_variant c.444G>A p.Glu148Glu 91 5.50%
368N2 368muscle 8 95327967 G A Zfp319 missense_variant c.1607C>T p.Ala536Val 50 6.00%
358N3 358muscle 8 1.05E+08 G A Rrad missense_variant c.118C>T p.Pro40Ser 41 7.30%
358N3 358muscle 8 1.08E+08 G T Wwp2 missense_variant c.1034G>T p.Arg345Met 43 7.00%
358N3 358muscle 8 1.11E+08 C A Fuk missense_variant c.970G>T p.Gly324Cys 40 7.50%
358N3 358muscle 8 1.26E+08 C A Ntpcr synonymous_variant c.21C>A p.Leu7Leu 42 7.10%
357N1 357muscle 9 24582820 C A Dpy19l2 synonymous_variant c.2013G>T p.Val671Val 44 6.80%
358N2 358muscle 9 43311472 G A Trim29 synonymous_variant c.597G>A p.Leu199Leu 173 4.00%
357N5 357muscle 9 45450529 C T Dscaml1 missense_variant c.586C>T p.Arg196Cys 50 8.00%
368N8 368muscle 9 55168284 G A Ube2q2 missense_variant c.376G>A p.Asp126Asn 71 7.00%
368N8 368muscle 9 55168290 C T Ube2q2 missense_variant c.382C>T p.Pro128Ser 69 7.20%
373N1 373muscle 9 56260482 C T Peak1 missense_variant c.161G>A p.Arg54Gln 340 2.90%
358N3 358muscle 9 92287625 C A Plscr2 missense_variant c.127C>A p.Gln43Lys 97 4.10%
357N4 357muscle 9 1.08E+08 G C Bsn missense_variant c.4976C>G p.Pro1659Arg 47 21.30%
368N2 368muscle 10 20246611 C A Map7 missense_variant c.422C>A p.Ala141Asp 37 8.10%
358N3 358muscle 10 20322064 C G Bclaf1 missense_variant c.52C>G p.Gln18Glu 21 14.30%
368N2 368muscle 10 38966046 C A Lama4 missense_variant c.92C>A p.Ala31Glu 47 6.40%
358N2 358muscle 10 70534879 G A Fam13c missense_variant c.848G>A p.Ser283Asn 40 20.00%
357N5 357muscle 10 80773112 C A Dot1l missense_variant c.502C>A p.Gln168Lys 39 7.70%
373N4 373muscle 10 81420600 G A Nfic synonymous_variant c.229C>T p.Leu77Leu 150 8.70%
357N1 357muscle 10 1.27E+08 G T Mettl1 missense_variant c.577G>T p.Asp193Tyr 45 6.70%
373N4 373muscle 11 5707370 G A Mrps24 missense_variant c.148C>T p.Pro50Ser 97 4.10%
358N3 358muscle 11 60202880 C A Srebf1 synonymous_variant c.2232G>T p.Ser744Ser 74 5.60%
357N4 357muscle 11 69853226 A G Tnk1 missense_variant c.1306T>C p.Phe436Leu 114 30.70%
373N3 373muscle 11 78499753 C A Vtn missense_variant c.237C>A p.Asp79Glu 48 6.30%
368N4 368muscle 11 87889211 G A Olfr462 synonymous_variant c.684C>T p.His228His 50 6.00%
357N4 357muscle 11 98250228 A G Cdk12 missense_variant c.4294A>G p.Lys1432Glu 35 8.60%
368N2 368muscle 11 1.01E+08 A G Aoc2 synonymous_variant c.195A>G p.Thr65Thr 38 7.90%
368N2 368muscle 11 1.01E+08 A G Aoc2 missense_variant c.269A>G p.Asn90Ser 35 20.00%
357N4 357muscle 11 1.03E+08 C G Fzd2 synonymous_variant c.1419C>G p.Leu473Leu 109 28.40%
368N2 368muscle 11 1.08E+08 C A Helz synonymous_variant c.1356C>A p.Thr452Thr 32 9.40%
368N2 368muscle 12 4209383 C A Adcy3 synonymous_variant c.2659C>A p.Arg887Arg 44 9.10%
368N4 368muscle 12 33342134 C A Atxn7l1 synonymous_variant c.771C>A p.Thr257Thr 85 4.70%
368N4 368muscle 12 70246446 C A Trim9 synonymous_variant c.2310G>T p.Thr770Thr 67 6.00%
373N1 373muscle 12 72567232 G A Pcnxl4 synonymous_variant c.1950G>A p.Leu650Leu 47 6.40%
368N2 368muscle 12 82387603 C A Sipa1l1 missense_variant c.2146C>A p.Gln716Lys 29 10.30%
358N3 358muscle 12 1.02E+08 G T Slc24a4 synonymous_variant c.117G>T p.Leu39Leu 46 6.50%
368N2 368muscle 12 1.02E+08 C A Golga5 missense_variant c.197C>A p.Ala66Asp 49 6.10%
358N3 358muscle 13 73672769 G T Slc6a18 missense_variant c.695C>A p.Ala232Glu 26 11.50%
357N5 357muscle 13 73821238 G T Nkd2 missense_variant c.1108C>A p.Pro370Thr 46 6.50%
357N1 357muscle 13 93387596 C A Homer1 synonymous_variant c.648C>A p.Ala216Ala 25 12.00%
373N4 373muscle 14 7945932 G T Flnb missense_variant c.7336G>T p.Ala2446Ser 36 8.30%
368N4 368muscle 14 54907149 C T Slc22a17 synonymous_variant c.1128G>A p.Arg376Arg 99 4.00%
357N1 357muscle 14 55745048 C A Dhrs1 missense_variant c.20G>T p.Gly7Val 20 15.00%
358N3 358muscle 15 81692128 G T Chadl synonymous_variant c.2239C>A p.Arg747Arg 66 6.10%
358N3 358muscle 15 99104471 G T Dnajc22 missense_variant c.996G>T p.Gln332His 36 8.60%
373N4 373muscle 16 5240002 G T Alg1 synonymous_variant c.837G>T p.Leu279Leu 63 6.30%
368N4 368muscle 16 14233649 C A Myh11 missense_variant c.1292G>T p.Arg431Leu 74 5.40%
373N3 373muscle 16 23357761 C T St6gal1 missense_variant c.1103C>T p.Pro368Leu 155 5.80%
357N1 357muscle 16 45731773 G T Abhd10 missense_variant c.736C>A p.Gln246Lys 73 5.50%
373N4 373muscle 16 56000642 C A Zbtb11 missense_variant c.2101C>A p.Gln701Lys 38 7.90%
373N4 373muscle 16 96673771 G T Dscam missense_variant c.3590C>A p.Ala1197Glu 47 6.40%
368N2 368muscle 16 97576326 C A Tmprss2 missense_variant&splice_region_variant c.570G>T p.Lys190Asn 47 6.40%
373N4 373muscle 17 24265204 C A Abca17 missense_variant&splice_region_variant c.4938G>T p.Lys1646Asn 48 6.30%
358N3 358muscle 17 27101185 C A Itpr3 synonymous_variant c.3009C>A p.Pro1003Pro 97 5.20%
358N3 358muscle 17 28877021 C A Pnpla1 synonymous_variant c.415C>A p.Arg139Arg 50 6.00%
373N4 373muscle 17 28982146 T C Stk38 synonymous_variant c.555A>G p.Thr185Thr 39 25.60%
368N2 368muscle 17 34685203 G T Tnxb missense_variant c.3686G>T p.Gly1229Val 48 6.40%
357N4 357muscle 17 80145171 C A Galm missense_variant c.537C>A p.Phe179Leu 46 6.50%
368N2 368muscle 18 38259948 G T 0610009O20Rik missense_variant c.1204G>T p.Ala402Ser 20 15.00%
358N1 358muscle 18 42337039 C A Rbm27 missense_variant c.2900C>A p.Ser967Tyr 44 6.80%
358N3 358muscle 18 44886378 C A Ythdc2 missense_variant c.4213C>A p.Pro1405Thr 37 8.10%
368N4 368muscle 19 4733741 G A Sptbn2 missense_variant c.1741G>A p.Ala581Thr 213 5.20%
373N4 373muscle 19 8896787 A G Ints5 synonymous_variant c.2109A>G p.Leu703Leu 49 6.10%
373N4 373muscle 19 8896820 C T Ints5 synonymous_variant c.2142C>T p.Thr714Thr 42 9.50%
368N4 368muscle 19 8978064 G T Eef1g missense_variant c.1276G>T p.Val426Leu 24 12.50%
357N1 357muscle 19 34950052 G T Kif20b missense_variant c.2713G>T p.Ala905Ser 45 6.70%
373N3 373muscle 19 40072400 G A Cyp2c54 missense_variant c.298C>T p.Leu100Phe 101 5.00%
373N3 373muscle 19 50225150 G A Sorcs1 missense_variant c.2138C>T p.Ala713Val 47 6.40%
357N4 357muscle 19 55207920 C T Gucy2g missense_variant c.2582G>A p.Arg861His 244 6.10%
358N2 358muscle 19 56851528 C T Tdrd1 synonymous_variant c.2019C>T p.Asp673Asp 71 9.90%
358N2 358muscle X 6583974 A C Shroom4 missense_variant c.1187A>C p.Asn396Thr 26 15.40%
373N3 373muscle X 20936595 G A Elk1 synonymous_variant c.726C>T p.Gly242Gly 53 7.50%
358N3 358muscle X 56501662 G T Ddx26b missense_variant&splice_region_variant c.1775G>T p.Gly592Val 43 7.00%
357N1 357muscle X 1.67E+08 G T Tlr7 missense_variant c.2212C>A p.Gln738Lys 31 16.10%
357N5 357muscle 17 24267574 GCA G Abca17 frameshift_variant c.4476_4477delTG p.Ala1493fs 120 3.33%
358N1 358muscle 6 47554188 GTCA G Ezh2 disruptive_inframe_deletion c.558_560delTGA p.Asp187del 57 5.26%
358N1 358muscle 10 58223101 CA C AW822073 frameshift_variant c.1007delT p.Leu336fs 74 5.41%
358N1 358muscle 15 78935001 C CAAG Nol12 disruptive_inframe_insertion c.24_26dupGAA p.Lys9dup 13 30.77%
358N2 358muscle 11 3524692 CGTG C Smtn disruptive_inframe_deletion c.2115_2117delCAC p.Thr706del 208 2.88%
358N3 358muscle 2 1.55E+08 GT G Itch splice_donor_variant&intron_variant c.1430+2delT . 55 5.45%
358N3 358muscle 4 1.37E+08 GCTT G Zbtb40 inframe_deletion c.2461_2463delAAG p.Lys821del 134 3.73%
358N3 358muscle 5 1.11E+08 TTGC T Ep400 disruptive_inframe_deletion c.7974_7976delGCA p.Gln2659del 90 3.33%
358N3 358muscle 5 1.35E+08 ATC A Fkbp6 frameshift_variant c.927_928delGA p.Glu309fs 84 3.57%
358N3 358muscle 7 1.01E+08 GAC G Atg16l2 frameshift_variant c.972_973delGT p.Ser325fs 191 3.66%
358N3 358muscle 9 5302474 TC T Casp1 frameshift_variant c.396delC p.Lys133fs 64 6.25%
358N3 358muscle 10 1.1E+08 TGAA T Nav3 disruptive_inframe_deletion c.5574_5576delTTC p.Ser1859del 78 3.85%
358N3 358muscle 11 84860577 TG T Ggnbp2 frameshift_variant c.395delC p.Ala132fs 86 3.49%
358N3 358muscle 16 32793328 AATAG A Muc20 frameshift_variant c.1674_1677delCTAT p.Tyr559fs 76 3.95%
368N2 368muscle 12 1.04E+08 TAC T Serpina3k frameshift_variant c.1161_1162delAC p.Leu387fs 108 3.70%
368N4 368muscle 11 71182505 TGAA T Nlrp1b inframe_deletion c.508_510delTTC p.Phe170del 225 1.78%
373N3 373muscle 9 38449182 C CT Olfr902 frameshift_variant c.313dupT p.Cys105fs 131 3.82%
373N4 373muscle 2 85770217 CTG C Olfr1013 frameshift_variant c.425_426delGT p.Cys142fs 85 3.53%
373N4 373muscle 11 23745586 TG T Rel frameshift_variant c.695delC p.Ser232fs 67 4.48%
373N4 373muscle 12 76609154 GGC G Sptb frameshift_variant c.4151_4152delGC p.Arg1384fs 95 4.21%
373N4 373muscle 14 48659272 TCTG T Otx2 inframe_deletion c.325_327delCAG p.Gln109del 68 4.41%

Shown are the results of exome sequencing in the 12 tumor nodules. Relevant information are given such as the position in the chromosome, the reference and alternative alleles, the type of mutation, the amino acid substitution and variant allele frequency.

Fig. 2.

Fig. 2

A. Shown are Venn diagrams for each of the 4 mice demonstrating the common somatic mutations (point mutations and small insertions/deletions) between the tumor samples of the same mouse. We observe no common mutations between the tumor samples, implying that these are more likely passenger mutations. B. Graph showing the number of common mutated genes, differentially expressed mRNAs, C., miRNAs, D. proteins, E., and phosphoproteins, F., across the tumor samples as a cumulative histogram. In each of the subfigures, the number of genes or proteins being dysregulated in at least k samples is shown (y-axis), where k ranges from 1 to 12 (x-axis)

Fig. 3.

Fig. 3

Shown are number of differentially expressed mRNAs, A., and miRNAs, B., proteins, C., and phosphosites, D., in each of the 12 tumor samples. Red color determines up regulation, blue color downregulation and grey color unchanged. mRNAs and miRNAs have been detected from RNA sequencing data and proteins and phosphosites have been detected from mass spectrometry data.

To identify the downstream mediators, we used NetICS, a network-based method that integrates multi-omic data to prioritize cancer genes [11]. NetICS provides a framework to simulate how upstream events lead to the dysregulation of downstream genes and proteins. It detects how mediators are dysregulated in each sample, using sample-specific network diffusion. NetICS then systematically integrates the individual ranks to infer a global gene ranking across all tumor samples [11]. However, our NetICS framework failed to predict functional convergence among the 157 detected somatic mutations (except for Pten and Tsc1) after a random permutation test, suggesting that additional information is required to identify a common downstream mediator. Hence, we integrated the Pten and Tsc1 deletions, the somatic mutations, and the differentially expressed miRNAs in each sample as upstream events. As downstream events, we used the differentially expressed mRNAs, proteins and differentially regulated phosphosites per tumor. After systematic integration, NetICS analysis predicted 74 mediators that are functionally related to differentially expressed miRNA and somatic mutations (upstream) as well as to differentially expressed genes, proteins and phosphosites (downstream) (Table 2).

Table 2.

Genes are ranked based on the mediator score from the final ranked gene list across all tumor nodules. The top 5% ranked genes are shown, excluding the ones with a FDR adjusted P-value > 0.05 after the random permutation test. For each gene, the gene name and type are given. For each tumor nodule, +1 denotes upregulation at the RNA, proteome or phosphoproteome levels. Similarly, -1 denotes downregulation. If empty, the gene’s, protein’s or phosphosite’s levels did not change significantly between tumor nodules and control samples

Gene type RNA(+1 significant upregulation, -1 significant downregulation (compared to normal samples)) PROTEOME(+1 significant upregulation, -1 significant downregulation (compared to normal samples)) PHOSPHOPROTEOME(number of phosphosites upregulated/number of phosphosites downregulated)
Mouse1-N1 Mouse1-N2 Mouse1-N3 Mouse2-N1 Mouse2-N2 Mouse2-N3 Mouse3-N1 Mouse3-N2 Mouse3-N3 Mouse4-N1 Mouse4-N2 Mouse4-N3 Mouse1-N1 Mouse1-N2 Mouse1-N3 Mouse2-N1 Mouse2-N2 Mouse2-N3 Mouse3-N1 Mouse3-N2 Mouse3-N3 Mouse4-N1 Mouse4-N2 Mouse4-N3 Mouse1-N1 Mouse1-N2 Mouse1-N3 Mouse2-N1 Mouse2-N2 Mouse2-N3 Mouse3-N1 Mouse3-N2 Mouse3-N3 Mouse4-N1 Mouse4-N2 Mouse4-N3
phosphatase -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
transcription activator 1 1 1 1 1 1 1 1 1 1 1/0 1/0 1/0
transcription factor -1 1/0 1/0
transcription factor
kinase -1 -1 -1 -1 1/0
kinase -1
transcriptional regulator
kinase 1 1 1 1 1 1 1 1 1 1 1 1
transcriptional inhibitor -1 -1 -1 -1
kinase 1 1 1 1 1 1 1 1 1 1 1 1/0 1/0 0/1 2/0 1/0
arginase -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 0/1 0/2 0/1 0/2
E3 ubiquitin protein ligase 1 1 1 1 1 1 1 1
transcription factor 1 1 1 1 1 1 1 1 1 1 1 1
deacetylase -1 -1 -1 -1
transcription factor -1 -1
kinase -1 1
growth factor -1 -1 -1 -1 -1 -1 -1 -1
growth factor -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 0/1 0/1 0/1 0/1 0/1
transcription factor -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 1 -1 1 1 1 1 1/0 1/0 1/2 3/0 3/0 3/0 2/0
kinase -1 1 1 1 0/1
transcriptional repressor -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
deacetylase 1/0 1/0
kinase -1 -1
methyltransferase 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1/0
transcription factor 1 1 1 1 1 1
S-transferase 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1/0 1/0 2/0 1/0
cyclin 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
chloride intracellular channel 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
kinase 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1/0 1/0 1/0 1/0
kinase 1 1 1 1 1 -1
growth factor 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
chromatin-binding factor -1 1 0/1 0/1
transcription factor (forkhead family) -1 -1 1/0
kinase -1 -1 -1 1
transcription factor -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
mitochondrial uncoupling proteins 1 1 1 1 1 1 1 1 1 1 1 1
growth inhibitory protein -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 1 0/1 0/2 0/1
signal transduction proteins 1 1 1 1
inhibitor metalloproteises 1 1 1 1 1 1 1 1 1 1 1 1
aspartic proteases -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
transcription factor
adapter protein 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1/0
Insulin Receptor Substrate -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
transcription factor 1 1 1 1 1 1 1 1 1 1 1
Histone-lysine N-methyltransferase 1 1
lymphoid-specific helicase 1 1 1 1 1 1 1 1 1 1 1 1 -1
anti- and pro-apoptotic regulators -1
kinase
versican proteoglycan 1 1 1 1 1 1 1 1 1 1 1 1
transcription factor -1 -1 -1 -1 -1 -1 -1 -1 1/0
spermidine Synthase 1 1 1 1 1 1
enzyme in polyamine biosynthesis 1 1 1 1 1 1 1 1 1 1 1 1
inhibits axol extension
transcription factor -1 -1 0/1
transcription activator 1 1 1 1 1 1 1 1 1 1 1 1
secreted mitoattractant 1 1 1 1 1 1 1 1 1 1 1 1
Ras protein 1 1 1
transcription factor -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 1
kinase 1 1/0 1/0 1/0 1/0 1/0 1/0
transcriptional regulator
chromosomal protein -1 -1 -1 -1 -1 -1 -1 1 -1 0/1 0/2 1/0
phosphatase
phosphatase 1 1 1 1 1 1 1 1 1 1 1 1 1 1/0 1/0
transcription factor 1
acetylhydrolase 1 1 1
kinase -1 -1 1 1 1 1 1 1 1 1/0 1/1 1/0 0/1
vitamin D receptors -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
calcium binding protein 1 1 1 1 1 1 1
transcription factor
transcriptional modulator -1 -1 -1 -1 -1 -1
Ras protein 1 1 1 1 1 1 1 1 1 1 1 1
transcription factor -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
kinase 1 1 1 1 -1 1 1 1 1 1 1 2/0 1/0 1/0 2/0 3/0
scaffolding protein within caveolar membranes 1 1 1 1 1 1 1 1

Genes are ranked based on the mediator score from the final ranked gene list across all tumor nodules. The top 5% ranked genes are shown, excluding the ones with a FDR adjusted P-value > 0.05 after the random permutation test. For each gene, the gene name and type are given. For each tumor nodule, +1 denotes upregulation at the RNA, proteome or phosphoproteome levels. Similarly, -1 denotes downregulation. If empty, the gene’s, protein’s or phosphosite’s levels did not change significantly between tumor nodules and control samples.

Pathway enrichment analysis of the mediators indicated a strong enrichment of cellular signaling pathways regulating cell cycle proteins and of TGF☐ signaling, suggesting strong proliferation potential of malignant hepatocytes (Table 3). We also observed an upregulation of epithelial to mesenchymal transition (EMT) factors, suggesting increased metastatic potential. For example, many of the detected mediators are involved in Notch signaling, consistent with the observation that approximately 30% of human HCC displays active Notch signaling [12]. Furthermore, we observed upregulation of IL6 and leptin signaling which have been suggested to play crucial roles in the initiation and development of HCC [13, 14]. Leptin is an important activator of cell proliferation and an inhibitor of cell death. Leptin signaling is also known to have angiogenic effects in multiple cancers including HCC [14]. The 74 mediators, consisting of various different types of regulatory proteins, include 14 kinases, 23 transcription factors, 2 deacetylates and 3 phosphatases. As expected, the mediators include known downstream targets of PTEN and TSC1, such as mTOR, AKT2 and AKT3. The mediators also include known HCC-related proteins, such as YWHAZ [15] and KLF4 [16]. Below, we discuss in detail five of the 74 detected mediators, namely YAP1, GRB2, HDAC4, SIRT1 and LIS1.

Table 3.

Pathway enrichment results by using Metacore tool

# Networks Total p-value FDR In Data Gene names
1 Cell cycle_G1-S Growth factor regulation 195 3.776E-15 2.760E-13 21 AKT3, GRB2, NF-kB, VEGF-A, EGFR, STAT3, c-Myc, Cyclin D, GSK3 alpha/beta, N-Ras, AKT(PKB), NF-kB p50/p50, AKT2, c-Raf-1, GSK3 beta, IRS-1, IGF-1 receptor, AKT1, Cyclin D1, NF-kB1 (p50), SMAD4
2 Cell cycle_G1-S Interleukin regulation 128 3.972E-15 2.760E-13 18 AKT3, GRB2, NF-kB, STAT3, c-Myc, Cyclin D, GSK3 alpha/beta, N-Ras, AKT(PKB), NF-kB p50/p50, AKT2, c-Raf-1, GSK3 beta, Elk-1, IRS-1, AKT1, Cyclin D1, NF-kB1 (p50)
3 Development_Hemopoiesis, Erythropoietin pathway 136 1.868E-13 8.656E-12 17 GRB2, SHIP, NF-kB, STAT3, c-Kit, c-Myc, Cyclin D, N-Ras, AKT(PKB), Bim, NF-kB p50/p50, c-Raf-1, K-RAS, FOXO3A, Elk-1, AKT1, Cyclin D1
4 Signal transduction_NOTCH signaling 235 1.677E-11 5.215E-10 19 GRB2, NF-kB, VEGF-A, NF-kB1 (p105), EGFR, STAT3, c-Myc, AKT(PKB), AKT2, c-Raf-1, Skp2/TrCP/FBXW, GSK3 beta, Cyclin D1, PTEN, mTOR, NF-kB1 (p50), SMAD4, FBXW7, HIF1A
5 Signal Transduction_TGF-beta, GDF and Activin signaling 154 1.876E-11 5.215E-10 16 SIP1 (ZFHX1B), GRB2, NF-kB, EGFR, RUNX2, c-Kit, c-Myc, AKT(PKB), c-Raf-1, IRS-1, IGF-1 receptor, Cyclin D1, mTOR, SMAD4, HIF1A, CREB1
6 Signal transduction_ERBB-family signaling 75 4.616E-11 1.069E-09 12 GRB2, NF-kB, EGFR, STAT3, c-Myc, N-Ras, AKT(PKB), c-Raf-1, K-RAS, Elk-1, IRS-1, PTEN
7 Development_EMT_Regulation of epithelial-to-mesenchymal transition 224 6.898E-11 1.254E-09 18 SIP1 (ZFHX1B), GRB2, EGFR, TCF8, STAT3, EGR1, ROCK1, AKT(PKB), c-Raf-1, GSK3 beta, Elk-1, TNF-alpha, CTGF, PTEN, mTOR, SMAD4, HIF1A, CREB1
8 Inflammation_IL-6 signaling 119 7.216E-11 1.254E-09 14 AKT3, GRB2, NF-kB, STAT3, c-Myc, AKT(PKB), NF-kB p50/p50, AKT2, c-Raf-1, 14-3-3 zeta/delta, Elk-1, AKT1, NF-kB1 (p50), 14-3-3
9 Signal transduction_Leptin signaling 107 2.434E-10 3.760E-09 13 GRB2, NF-kB, VEGF-A, STAT3, EGR1, GSK3 alpha/beta, AKT(PKB), AKT2, c-Raf-1, IRS-1, AMPK alpha subunit, HIF1A, CREB1
10 Cardiac development_Role of NADPH oxidase and ROS 134 3.626E-10 4.742E-09 14 GRB2, HDAC5, MEF2C, NF-kB, GSK3 alpha/beta, AKT(PKB), TBX3, c-Raf-1, GSK3 beta, SMAD5, Hamartin, PTEN, SMAD4, HIF1A
11 Reproduction_FSH-beta signaling pathway 160 3.752E-10 4.742E-09 15 NF-kB, VEGF-A, EGFR, EGR1, c-Myc, Cyclin D, AKT(PKB), c-Raf-1, IRS-1, IGF-1 receptor, CTGF, mTOR, SMAD4, HIF1A, CREB1
12 Signal transduction_Androgen receptor signaling cross-talk 72 5.284E-10 6.120E-09 11 GRB2, NF-kB, EGFR, STAT3, AKT(PKB), c-Raf-1, FOXO3A, GSK3 beta, IGF-1 receptor, mTOR, CREB1
13 Inflammation_Amphoterin signaling 118 8.432E-10 9.015E-09 13 ROCK, AKT3, NF-kB, NF-kB1 (p105), ROCK1, AKT(PKB), NF-kB p50/p50, AKT2, c-Raf-1, Elk-1, AKT1, TNF-alpha, NF-kB1 (p50)
14 Signal transduction_ESR1-membrane pathway 91 6.908E-09 6.859E-08 11 GRB2, EGFR, GSK3 alpha/beta, AKT(PKB), c-Raf-1, GSK3 beta, Elk-1, IRS-1, IGF-1 receptor, Cyclin D1, CREB1
15 Inflammation_TREM1 signaling 145 1.087E-08 1.007E-07 13 AKT3, GRB2, MEF2C, NF-kB, EGR1, AKT(PKB), AKT2, c-Raf-1, 14-3-3 zeta/delta, Elk-1, AKT1, TNF-alpha, 14-3-3
16 Translation_Regulation of initiation 127 2.325E-08 1.968E-07 12 AKT3, GRB2, EGFR, GSK3 alpha/beta, AKT(PKB), AKT2, c-Raf-1, GSK3 beta, IRS-1, Hamartin, AKT1, mTOR
17 Signal transduction_ESR1-nuclear pathway 216 2.407E-08 1.968E-07 15 GRB2, VEGF-A, NF-kB1 (p105), EGFR, c-Myc, AKT(PKB), AKT2, c-Raf-1, GSK3 beta, IRS-1, HDAC4, IGF-1 receptor, Cyclin D1, NF-kB1 (p50), SMAD4
18 Development_Hedgehog signaling 253 2.929E-08 2.262E-07 16 GRB2, VEGF-A, TCF8, EGR1, c-Myc, Sirtuin1, ROCK1, c-Raf-1, Skp2/TrCP/FBXW, GSK3 beta, SMAD5, AKT1, Cyclin D1, SMAD4, FBXW7, CREB1
19 Development_Regulation of angiogenesis 222 3.480E-08 2.546E-07 15 GRB2, NF-kB, VEGF-A, EGFR, TCF8, STAT3, c-Myc, AKT(PKB), c-Raf-1, CTGF, SMAD4, HIF1A, IGFBP7/8, CREB1, VEGFR-1
20 Immune response_BCR pathway 137 5.467E-08 3.800E-07 12 GRB2, SHIP, NF-kB, EGR1, GSK3 alpha/beta, AKT(PKB), NF-kB p50/p50, c-Raf-1, Elk-1, PTEN, mTOR, NF-kB1 (p50)
21 Signal transduction_Nitric oxide signaling 88 6.433E-08 4.258E-07 10 NF-kB, VEGF-A, AKT(PKB), NF-kB p50/p50, c-Raf-1, Elk-1, IRS-1, CaMK II alpha, TNF-alpha, CREB1
22 Inflammation_IL-13 signaling pathway 91 8.902E-08 5.624E-07 10 GRB2, STAT3, ARG1, c-Myc, AKT(PKB), c-Raf-1, Elk-1, IRS-1, NF-kB1 (p50), CREB1
23 Immune response_TCR signaling 174 9.726E-08 5.669E-07 13 ROCK, GRB2, NF-kB, NF-kB1 (p105), ROCK1, AKT(PKB), Bim, NF-kB p50/p50, c-Raf-1, Elk-1, AKT1, TNF-alpha, NF-kB1 (p50)
24 Cell cycle_G2-M 206 9.789E-08 5.669E-07 14 AKT3, GRB2, EGFR, c-Myc, AKT(PKB), AKT2, DNMT1, c-Raf-1, Skp2/TrCP/FBXW, 14-3-3 zeta/delta, HDAC4, IGF-1 receptor, AKT1, 14-3-3
25 Cardiac development_FGF_ErbB signaling 124 1.804E-07 1.003E-06 11 GRB2, MEF2C, EGFR, FOG2, Neurofibromin, AKT(PKB), TBX3, c-Raf-1, GSK3 beta, Versican, Hamartin
26 Inflammation_IL-10 anti-inflammatory response 87 6.923E-07 3.701E-06 9 NF-kB, STAT3, c-Myc, Cyclin D, AKT(PKB), NF-kB p50/p50, Cyclin D1, TNF-alpha, NF-kB1 (p50)
27 Inflammation_IL-4 signaling 115 8.212E-07 4.228E-06 10 GRB2, SHIP, NF-kB, AKT(PKB), Bim, c-Raf-1, GSK3 beta, Elk-1, IRS-1, PTEN
28 Signal Transduction_BMP and GDF signaling 91 1.018E-06 5.054E-06 9 RUNX2, c-Myc, AKT(PKB), YY1, AKT2, SMAD5, AKT1, SMAD4, CREB1
29 Apoptosis_Anti-Apoptosis mediated by external signals via PI3K/AKT 233 2.791E-06 1.338E-05 13 GRB2, NF-kB, VEGF-A, EGFR, AKT(PKB), Bim, NF-kB p50/p50, FOXO3A, IRS-1, IGF-1 receptor, TNF-alpha, NF-kB1 (p50), VEGFR-1
30 Inflammation_IL-2 signaling 104 3.152E-06 1.461E-05 9 GRB2, NF-kB, STAT3, AKT(PKB), NF-kB p50/p50, c-Raf-1, Elk-1, PTEN, NF-kB1 (p50)
31 Proliferation_Positive regulation cell proliferation 221 9.263E-06 4.154E-05 12 GRB2, VEGF-A, EGFR, STAT3, c-Kit, c-Myc, AKT(PKB), c-Raf-1, GSK3 beta, IGF-1 receptor, Cyclin D1, VEGFR-1
32 Cardiac development_Wnt_beta-catenin, Notch, VEGF, IP3 and integrin signaling 151 9.785E-06 4.250E-05 10 MEF2C, VEGF-A, GSK3 alpha/beta, TBX3, c-Raf-1, GSK3 beta, Versican, MEF2, PTEN, VEGFR-1
33 Development_Blood vessel morphogenesis 228 1.272E-05 5.358E-05 12 GRB2, NF-kB, VEGF-A, EGFR, STAT3, c-Myc, AKT(PKB), c-Raf-1, CTGF, HIF1A, IGFBP7/8, VEGFR-1
34 Reproduction_Feeding and Neurohormone signaling 210 3.159E-05 1.292E-04 11 NF-kB, STAT3, c-Kit, c-Myc, AKT(PKB), c-Raf-1, Elk-1, TNF-alpha, mTOR, HIF1A, CREB1
35 Proliferation_Negative regulation of cell proliferation 184 5.446E-05 2.163E-04 10 GRB2, KLF4, EGR1, Neurofibromin, c-Myc, Mxi1, c-Raf-1, Elk-1, IGF-1 receptor, Cyclin D1
36 Immune response_IL-5 signalling 38 7.474E-05 2.886E-04 5 GRB2, STAT3, c-Myc, AKT(PKB), c-Raf-1
37 Muscle contraction_Nitric oxide signaling in the cardiovascular system 124 9.686E-05 3.639E-04 8 MEF2C, VEGF-A, Sirtuin1, AKT(PKB), AMPK alpha 1 subunit, Elk-1, HIF1A, CREB1
38 Apoptosis_Anti-Apoptosis mediated by external signals by Estrogen 95 1.178E-04 4.309E-04 7 GRB2, c-Myc, AKT(PKB), c-Raf-1, Elk-1, NF-kB1 (p50), CREB1
39 Development_ERK5 in cell proliferation and neuronal survival 24 1.597E-04 5.691E-04 4 MEF2C, c-Myc, c-Raf-1, CREB1
40 Proliferation_Lymphocyte proliferation 210 1.643E-04 5.711E-04 10 AKT3, GRB2, NF-kB, STAT3, AKT(PKB), AKT2, c-Raf-1, AKT1, TNF-alpha, mTOR
41 Cell adhesion_Integrin-mediated cell-matrix adhesion 214 1.918E-04 6.280E-04 10 ROCK, GRB2, Caveolin-2, c-Myc, ROCK1, AKT(PKB), c-Raf-1, GSK3 beta, Hamartin, Cyclin D1
42 Reproduction_Progesterone signaling 214 1.918E-04 6.280E-04 10 GRB2, VEGF-A, EGFR, STAT3, c-Myc, c-Raf-1, GSK3 beta, IGF-1 receptor, AKT1, CREB1
43 Inflammation_IgE signaling 137 1.943E-04 6.280E-04 8 GRB2, NF-kB, AKT(PKB), NF-kB p50/p50, c-Raf-1, Elk-1, TNF-alpha, NF-kB1 (p50)
44 Inflammation_Neutrophil activation 215 1.992E-04 6.294E-04 10 ROCK, GRB2, NF-kB, STAT3, ROCK1, AKT(PKB), NF-kB p50/p50, c-Raf-1, TNF-alpha, NF-kB1 (p50)
45 Inflammation_MIF signaling 140 2.256E-04 6.967E-04 8 GRB2, NF-kB, Cyclin D, NF-kB p50/p50, Cyclin D1, TNF-alpha, NF-kB1 (p50), CREB1
46 Apoptosis_Anti-Apoptosis mediated by external signals via MAPK and JAK/STAT 179 2.375E-04 7.176E-04 9 GRB2, STAT3, EGR1, c-Myc, Bim, c-Raf-1, Elk-1, TNF-alpha, CREB1
47 Inflammation_Protein C signaling 108 2.628E-04 7.606E-04 7 ROCK, NF-kB, ROCK1, AKT(PKB), NF-kB p50/p50, TNF-alpha, NF-kB1 (p50)
48 Signal transduction_ESR2 pathway 77 2.727E-04 7.606E-04 6 GRB2, VEGF-A, EGFR, c-Raf-1, AKT1, TNF-alpha
49 Apoptosis_Apoptosis stimulation by external signals 144 2.736E-04 7.606E-04 8 GRB2, SHIP, NF-kB, AKT(PKB), Bim, c-Raf-1, TNF-alpha, SMAD4
50 Development_Skeletal muscle development 144 2.736E-04 7.606E-04 8 HDAC5, MEF2C, VEGF-A, Sirtuin, Histone deacetylase class II, Sirtuin1, HDAC4, MEF2
Info
General
Date 21/07/2018
Server portal.genego.com
Version 6.35.69300
Workflow Settings
Type Enrichment analysis
Signals both
Active Data
Name Type Size
74_NetICS_mouse_data_hub_19_Jul_2018_genelist General 74

Shown are pathway enrichment results generated by using Metacore version 6.35.69300 at 21.07.2018. The final list of predicted genes from NetICS were used (Table 2). Pathways are ranked based on the adjusted FDR P-value (column E) and the number and names of the pathway genes that are present in the final list of 74 predicted genes is given (column F-G).

YAP1 is a transcription factor that activates genes involved in cell proliferation and suppresses apoptotic genes [17]. Directly upstream of YAP1 is the microRNA miR-375, the expression of which was significantly downregulated in L-dKO tumors compared to control liver tissues (Fig. 4A and S2A). miR-375 has been shown to inhibit the expression of YAP1 [18]. Our data suggests that the reduced expression of miR-375 could in turn increase YAP1 protein levels that promote tumorigenesis. We also investigated multiple proteins whose expression is regulated by YAP1 (directly or indirectly). As expected, the transcript levels of YAP1 targets were significantly high in HCC tumors, including mRNAs of the direct YAP1 targets Ctgf, Birc5, Cyce1, Cyr61, Ki63 (Fig. S2B). Increased YAP1 levels upon immunoblot analysis in murine (4 out of 4 tumors) and human HCC (5 out of 5 patients) confirmed the dysregulation of YAP1 signaling in HCC (Fig. 5A-D).

Fig. 4.

Fig. 4

A. Aberrant upstream and downstream interactors of YAP1. Upstream interactors include one significantly downregulated miRNAs (miR-375) and interaction with TSC1 and PTEN. Downstream, YAP1 interacts directly or indirectly with several genes the RNA expression of which has been found significantly upregulated. B. Aberrant upstream and downstream interactors of GRB2 are shown. Upstream interactors include an indirect interaction with PTEN (through PTK2). Downstream, GRB2 interacts with several genes like SHC1, K-RAS, JUN and CDK4. C. miRNAs upstream of HDAC4 significantly downregulated in HCC tumors compared to the control tissue. D. miRNAs upstream of SIRT1 significantly upregulated in HCC tumors compared to the control tissue. The expression counts have been normalized with respect to library sizes and have been transformed for variance stabilization. Shown are normalized expression counts of the miRNAs upstream of Sirt1. The expression counts have been normalized in the same way as in C. Blue color indicates downregulated or genomic deletion, grey color indicates not regulated and red color indicates upregulation

Figure 5.

Figure 5

A. Immunoblot analysis indicates increased Hdac4 and Yap1 and reduced Sirt1 protein levels in L-dKO tumors (n = 4) compared to age-matched littermate control (liver samples from control mice (n = 4)). B. Quantification of immunoblot (from Fig. 5A) indicates increased Hdac4 (****P = 0.000004) and increased Yap1 (**P = 0.0016) and reduced Sirt1 (**P = 0.0025) expression in tumors compared to age-matched control littermates (band intensities in each lane are normalized to intensity of corresponding total Akt protein levels). P values are from a two-sided unpaired t-test. Data is mean ± s.d. C. Immunoblot analysis indicates increased Hdac4 and Yap1 and reduced Sirt1 protein levels in liver tissue from patients with HCC compared to adjacent non- tumor liver tissue in a total of n = 5 HCC patients. D. Quantification of immunoblot (from Fig. 5C) indicates increased Hdac4 (*P = 0.040032) and increased Yap1 (*P = 0.013164) in 5 out of 5 patients and reduced Sirt1 (**P = 0.007155) in 4 out of 5 patients. 1 out of 5 patients did not show a reduction in Sirt1 protein levels (circles in red) and has been excluded in the significance analysis. (band intensities in each lane are normalized to intensity of corresponding total Akt protein levels). P values are from a two-sided paired t-test. Data are mean ± standard deviation. E. Lis1 mRNA is downregulated in liver cancer. Graphical representation of Lis1 mRNA regulation in n=373 liver cancer patients downloaded from TCGA (provisional) (accessed on 10.10.2018). Each circle represents a patient. 2 fold regulation of mRNA expression compared to control was used to define up regulation (log2 fold change ≥ 1) or down regulation (log2 fold change ≤ 1). Lis1 mRNA expression is downregulated in 47%, unchanged in 43% and upregulated in 10% of the liver cancer patients. The full length images are shown in supplementary figure 5 (Figure S5)

The signaling adaptor protein GRB2 was found to be upregulated at both the mRNA and protein level in L-dKO tumors. According to the network (Fig. 4B), GRB2 upregulation can be attributed to downregulation of PTEN. Consistent with the previous observation that PTEN inhibits PTK2 [19], loss of PTEN in the L-dKO tumors correlates with upregulation of PTK2-GRB signaling. GRB2 signaling activates several proteins including SHC1, K-RAS and H-RAS (Fig. 4B). H-RAS is a small GTPase that positively controls phosphorylation of the transcription factor JUN. Mass spectrometry analysis showed that phosphorylation of Ser63 and Ser73 (indicating active JUN) in JUN was significantly increased in L-dKO tumors. JUN in turn regulates transcription of the gene CDK4. CDK4 transcript levels and protein levels were upregulated in L-dKO tumors. CDK4 is a known oncoprotein that can be targeted by inhibitors [20]. SHC1 activates MAPK1 and MAPK3, two known protein-serine/threonine kinases that participate in the RAS-RAF-MEK-MAPK signal transduction cascade and are known to be involved in tumorigenesis [21].

NetICS also detected two deacetylases, namely HDAC4 (class II histone deacetylase) and SIRT1 (class III histone deacetylase) as mediators. HDAC4 is known to mediate tumorigenesis through chromatin structure remodeling and controlling protein access to DNA in colon cancer [22], glioblastoma [23], ovarian cancer [24], gastric cancer [18], and esophageal carcinoma [25]. Immunoblot analysis confirmed that HDAC4 protein levels were significantly increased in murine and human HCC tumor tissues (Fig. 5A-D). These observations also suggest that mechanisms similar to mouse L-dKO tumors (i.e., miRNAs) could be regulating HDAC4 protein levels in human HCC. NetICS analysis suggested that five significantly downregulated miRNAs (miR-10a, miR-140, miR-22, miR-29b and miR-29c) could lead to increased HDAC4 levels in tumors (Fig. 4C and S3). SIRT1 is another histone deacetylase detected as a mediator. Immunoblot analysis revealed that SIRT1 protein levels were significantly reduced in murine and human (four of five patients) HCC (Fig. 5A-D). The full length images are shown in supplementary figure 5 (Figure S5). However, unlike HDAC4, SIRT1 mRNA levels were reduced in four out of twelve L-dKO tumors. Upstream of SIRT1, NetICS detected four miRNAs that were significantly upregulated, namely miR-138, miR-146b, miR-34a and miR-9, that could contribute to reduced SIRT1 levels (Fig. 4D and S4). The role of SIRT1 in tumorigenesis is debated due to conflicting reports on SIRT1 as a tumor promoter or suppressor. SIRT1 deacetylates and downregulates two well-known tumor suppressors, TP53 and E2F1, suggesting an oncogenic role [26]. Conversely, SIRT1 also deacetylates and represses the oncogenic transcription factor β-catenin, suggesting a role as a tumor suppressor [27]. Based on our analysis, we suggest that SIRT1 has a tumor suppressing role in mTOR-driven HCC tumors.

NetICS also detected proteins largely unexplored in cancer biology as mediators of tumorigenesis. For example, LIS1 (lissencephaly-1) is a conserved regulator of dynein. It binds to dynein’s motor domain and induces a tight microtubule-dynein interaction [28]. A potential role of LIS1 in tumor progression is now being explored [29, 30]. We examined TCGA transcriptome data for LIS1 expression. We found that 47.1% of HCC patients have reduced LIS1 expression, suggesting that LIS1 has a tumor suppressing role in mTOR-driven tumors (Fig. 5E).

Discussion

We have utilized NetICS, a multi-omics data integration method that predicts mediators, and an mTOR-driven HCC mouse model to detect novel drug targets in HCC. NetICS detected 74 mediators that were ranked in the top 5% among network proteins. These mediators were found to be significant after a random permutation test of the aberrant and differentially expressed genes and proteins. We described five of the mediators in detail, namely YAP1, GRB2, HDAC4, SIRT1, and LIS1, and suggest upstream causes of their dysregulation as well as their downstream effects.

Importantly, NetICS is able to predict ‘silent’ genes as mediators, i.e., genes not affected by mutation or differentially expressed (Table 2). This could be because NetICS scans the neighborhood of the potential mediator and detects aberrant expression and mutation patterns even if the gene itself is neither mutated nor aberrantly expressed. To demonstrate the power of NetICS approach, we tested the ability of multi-omic NetICS to detect mediators that would not be predicted in single-omic approaches, i.e. RNA, proteome or phosphoproteome data alone. Of the 74 top 5%-ranked mediators detected in the multi-omics NetICS approach, we detected 12 relying exclusively on the transcriptome, and none relying only on the proteome or phosphoproteome (Table 4). Thus, NetICS has power in predicting silent genes that would not be detected by a single-omics approach.

Table 4.

Tumor samples are compared against control samples at the RNA (column B), proteome (column C) and phosphoproteome (column D) levels for the 74 predicted mediators. The gene is indicated as “dysregulated”, if it is ranked at the top 5% of all genes based on P-value

Gene RNA all vs all, top 5% PROT all vs all, top 5% PHOSPHOPROTEOME all vs all, top 5%
PTEN
STAT3
NFKB1
TNF
AKT1
IGF1R
HIF1A
CAMK2A
ZEB2
GSK3B dysregulated
ARG1
FBXW7
RUNX1
SIRT1
ZFPM2
AKT2
VEGFA dysregulated
EGFR
YAP1
ROCK1
MXI1
HDAC4
AKT3 dysregulated
DNMT1
MYC
GSTM1
CCND1 dysregulated
CLIC5
PRKAA1
FLT1
GRB2
ATXN1
FOXO3
KIT dysregulated
TBX3
UCP2
TSC1
SMAD4
TIMP3
BACE1
RUNX2 dysregulated
YWHAZ dysregulated
IRS1
KLF4
EZH2 dysregulated
HELLS
BCL2L11
AKT dysregulated
VCAN
NF1
SRM
AMD1
SEMA4B
ZEB1
MEF2C dysregulated
CTGF
KRAS
CREB1
RIOK3
EGR1
MECP2
ENPP6 dysregulated
INPP5D
ELK1
PAFAH1B1
MTOR dysregulated
NR1I3
CAB39
MEOX2
SMAD5
NRAS
YY1
RAF1
CAV2

Tumor samples are compared against control samples at the RNA (column B), proteome (column C) and phosphoproteome (column D) levels for the 74 predicted mediators. The gene is indicated as “dysregulated”, if it is ranked at the top 5% of all genes based on P-value.

Pathway enrichment on the detected mediator genes suggested multiple tumor-related pathways that could be potentially targeted to curb tumor growth. We focused on the mechanistic insights and pathways of 5 of these mediators that we picked manually. NetICS suggests that overexpression of HDAC4 - which is frequently dysregulated in human malignancies - drives tumor growth in HCC. Inhibitors of HDAC4, such as LMK-235 [31], could be potentially useful in HCC with HDAC4 overexpression. Similarly, HCC with YAP1 overexpression could benefit from using inhibitors for YAP1 [32].

Conclusions

To conclude, application of NetICS to multi-omics data from an mTOR-driven HCC mouse model detected new potential drug targets. This approach could be used to identify drug targets in other tumor types.

Methods

Animal experiments

Liver-specific Tsc1 and Pten double knockout mice were generated as described in [2] and [3] at Biozentrum, University of Basel. In short, tumors from 20 week-old L-dKO mice and whole liver from control mice were snap-frozen and pulverized. This powder was used for subsequent exome sequencing, total RNA sequencing (including miRNA and mRNA), proteomics and phosphoproteomics. For exome sequencing, muscle tissue from the quadriceps of 4 L-dKO mice was used as a control. The mice were on mixed genetic background (C57BL/6J, 129/SvJae, BALB/cJ). Age and sex matched littermate mice without the Cre gene were used as controls. Only male mice were used in all experiments. Mice were fasted overnight before euthanasia by CO2 inhalation. The total number of mice used were 6 control mice and 4 L-dKO mice.

Exome sequencing

DNA extracted from three tumor nodules and a muscle tissue sample each from four mice were subjected to whole-exome capture using the SureSelect Mouse All Exon (Agilent) capture system and to massively parallel sequencing on an Illumina HiSeq 2000 at the Genomics Facility Basel, ETH Zurich, Switzerland. A median of 141 and 97 million 101-bp paired-end reads were generated from DNA extracted from tumor nodules and the muscle, respectively, equivalent to median depths of 78x (tumor nodules, range 34x-124x) and 57x (germline, range 35x-129x; Table 5). Exome sequencing data have been deposited in the Sequence Read Archive under the accession SRP156216.

Table 5.

Statistics of whole-exome sequencing

SAMPLE Total number of reads Mean Target Coverage % target bases covered at least 10X % target bases covered at least 20X % target bases covered at least 50X % target bases covered at least 100X
357muscle 55,062,491 35.5 88.9% 66.7% 19.6% 3.3%
368muscle 68,408,757 43.6 92.1% 75.1% 28.2% 5.8%
373muscle 125,208,792 69.7 96.1% 88.5% 54.2% 18.3%
358muscle 249,603,786 128.7 98.0% 95.4% 80.1% 49.2%
358N1 52,236,649 33.8 88.1% 64.8% 18.1% 3.0%
357N5 59,870,967 37.5 90.0% 69.5% 22.3% 4.1%
368N8 69,492,339 43.2 91.9% 75.0% 28.6% 6.1%
373N4 92,890,008 55.4 94.0% 82.4% 42.4% 12.2%
368N2 126,289,004 63.6 95.8% 87.2% 50.1% 15.5%
357N1 140,082,301 77.6 96.2% 89.4% 59.0% 23.8%
358N3 144,107,456 78.4 96.5% 90.2% 61.2% 25.2%
373N3 141,719,445 84.8 96.7% 91.0% 64.2% 28.4%
357N4 172,106,294 91.2 97.2% 92.4% 67.3% 31.1%
368N4 207,370,862 110.2 97.9% 94.8% 76.5% 42.3%
358N2 209,306,186 113.7 97.8% 94.5% 76.3% 43.0%
373N1 235,568,319 123.9 97.9% 95.0% 79.0% 47.9%

Statistics about whole-exome sequencing are given. These include the total number of reads, the mean target coverage and the percent of target bases covered at least at 10X, 20X, 50X and 100X for each tumor and muscle tissue sample.

Whole-exome sequencing data pre-processing was performed as described in Nuciforo et al, 2018 against the reference mouse genome GRCm38. In brief, paired-end reads in FASTQ format were aligned to the reference mouse genome GRCm38 using Burrows-Wheeler Aligner (v0.7.12) [33]. Local realignment was performed using the Genome Analysis Toolkit (GATK, v3.6) [34]. PCR duplicates were removed using Picard (v2.4.1, http://broadinstitute.github.io/picard/). Base quality adjustment was performed using GATK (v3.6) [34].

Somatic single-nucleotide variants (SNVs) were identified using MuTect (v1.1.4) [35] and somatic small insertions and deletions (indels) were identified using Strelka (v1.0.15) [36]. To remove false mutation calls resulting from sequencing and/or alignment artifacts, a panel of normal was created from the four normal samples in this cohort using the artifact detection mode of MuTect2 (packaged in GATK, v3.6). Variants present in at least two of the four samples in the panel of normal were disregarded. Variants outside the target regions, covered by <10 reads in the tumor or <5 reads in the germline were disregarded. Variants supported by <3 reads in the tumor or for which the tumor variant allele fraction was <5 times than that of the normal variant allele fraction were disregarded [37]. 157 putative somatic mutations passed the filters (Table 1).

FACETS [38] was used to define copy number alterations. Specifically, read counts for positions within the target regions with dbSNP (Build 142) entries were generated for each matched tumor nodule and normal samples as input to FACETS, which performs a joint segmentation of the total and allelic copy ratio and infers allele-specific copy number states. To enable detection of the intragenic deletions of Tsc1 and Pten, 15-20 evenly-spaced positions per deleted exon were tiled within the regions of the deletions (Fig. S1).

Transcriptome sequencing and quantitative PCR (qPCR) analysis

Raw fastq files were aligned to the reference genome Mus_musculus.GRCm38.72 using PALMAPPER with default parameters [39]. The length of the seeds of the PALMAPPER index was set to 15. Then we computed read counts using htseq-count against the reference genome annotation (Mus_musculus.GRCm38.72.gtf). Based on these counts we performed the differential gene expression analysis using DESeq2 where we compared each tumor sample individually against all six control samples. Exact numbers of detected dysregulated mRNA per tumor sample are given in Table 6. For quantitative PCR analysis, RNA was prepared as shown above, 500ng RNA was used to make cDNA using Superscript III (Invitrogen) as per manufacturers instructions. ABI Step One (Applied Biosystems) machine was used together with Syber Green PCR Kit (Invitrogen) and the primers below (100pM) to perform qPCR as per manufacturer instructions. TBP was used as a normalizer and ddCT method was used for analysis. Primer sequences:

Table 6.

Number of upregulated, downregulated and unchanged mRNA, miRNAs, proteins and phosphosites per tumor nodule

RNA PROTEOME PHOSPHOPROTEOME miRNA
MOUSE|NODULE DOWN NOT UP DOWN NOT UP DOWN NOT UP DOWN NOT UP
Mouse1-N1 1621 18953 2158 867 2029 1651 413 850 899 37 1243 51
Mouse1-N2 2269 18208 2651 979 2111 1328 407 1803 1701 60 1212 59
Mouse1-N3 1785 18786 2394 681 2117 1155 314 808 619 55 1234 42
Mouse2-N1 1909 18674 2473 1249 2568 1407 283 335 428 46 1234 51
Mouse2-N2 1692 19053 2310 774 1786 1653 887 1125 815 54 1235 42
Mouse2-N3 1950 18843 2559 860 2269 1310 251 1131 1299 49 1225 57
Mouse3-N1 2005 18645 2404 627 2959 715 294 1021 1255 49 1240 42
Mouse3-N2 2211 18392 2609 1228 2151 1933 286 411 514 59 1218 54
Mouse3-N3 1862 18803 2326 986 2028 1849 158 505 1019 51 1228 52
Mouse4-N1 1919 18640 2532 950 2128 1256 323 1759 1239 53 1210 68
Mouse4-N2 1538 19196 2275 840 2019 1588 300 1811 1461 62 1197 72
Mouse4-N3 2034 18319 2689 1070 2096 1715 454 1345 1185 70 1196 65

For each nodule of each mouse the number of upregulated, downregulated and unchanged mRNAs, miRNAs, proteins and phosphosites are given.

TBP F: ATGATGCCTTACGGCACAGG; R: GTTGCTGAGATGTTGATTGCTG;

CYR61 F: TAAGGTCTGCGCTAAACAACTC; R: CAGATCCCTTTCAGAGCGGT;

KI67 F: CGCAGGAAGACTCGCAGTTT; R: CTGAATCTGCTAATGTCGCCAA

CTGF F: GGCCTCTTCTGCGATTTCG; R: GCAGCTTGACCCTTCTCGG

BIRC5 F: GAGGCTGGCTTCATCCACTG; R: ATGCTCCTCTATCGGGTTGTC

CYCE1 F: CTCCGACCTTTCAGTCCGC; R: CACAGTCTTGTCAATCTTGGCA

miRNA sequencing

miRNA sequencing libraries were generated using a modified protocol from [40]. Briefly, RNA from tissues was isolated using the Qiagen miRNAeasy kit as described above (section Animal experiments). 10 microgram of total RNA was run in a 15% polyacrylamide gel, the part containing small RNAs was cut and subjected to nucleotide extraction using overnight 0.4M NaCl and ethanol precipitation. Isolated small RNA mix was subjected to Illumina TrueSeq Small library preparation kit used as per manufacturer’s instructions. Afterwards the small-RNA libraries were run in a 10% Polyacrylamide gel to clean up the adaptor-adaptor fraction. The gel part containing the small-RNA libraries was cut and libraries were extracted using overnight 0.4M NaCl and ethanol precipitation. They were run using Illumina NextSeq500 sequencer as per manufacturer’s instructions. Exact numbers of detected dysregulated miRNA per tumor sample are given in Table 6.

Mass spectrometry for proteomics and phosphoproteomics

Liver tissues from L-dKO tumors and control mice were obtained as detailed above (Animal experiments). Label free mass spectrometry was performed on the tumor nodules. Tumor proteome was always compared to the proteome obtained from livers of six control mice pooled together. A detailed description about the proteomics method used to analyse L-dKO tumor nodules and the softwares used for data analysis can be found in [2]. For the phosphoproteome, the desalted peptides were enriched for phosphopeptides using TiO2 beads. Detailed protocol is available in [3]. After data processing, the protein groups datasets and phospho peptide datasets were exported into a FileMaker Pro-12 databank. For statistical analysis, an R-based program - Perseus, version 1.4.0.2, was used [41]. ANOVA-based two-sample t-test was performed by adjusting S0 to 1 and the number of randomizations to 250 (default). The 5% FDR was used for analysis. Exact numbers of detected dysregulated proteins and phosphosites per tumor sample are given in Table 6.

Detection of differentially expressed mRNA and miRNA

The DESeq2 tool [42] with default settings was used to detect differentially expressed genes and miRNA between tumor and normal tissue. Every tumor sample was compared against the six control samples from healthy liver tissue. We considered as significant the genes detected with an FDR adjusted P-value lower than 0.05.

Interaction network

In order to construct a directed functional network, we downloaded functional interactions for the species Mus Musculus from three different databases including Kegg, Signor and miRTarBase. From miRTarBase, we only kept the interactions supported by strong experimental evidence (either reporter assay or western blot). The interactions cover a variety of types at different cellular levels, including (de) phosphorylation (phosphoproteome), expression/repression (RNA) and activation/inhibition (proteome). Interactions characterized as “binding” or “complex” were treated as undirected edges. The network contained 5,546 genes and 44,423 interactions in total. In order for network diffusion to converge to a unique solution (steady state), we only used the largest strongly connected component of the network, which contains 2,484 genes and miRNAs and 32,954 interactions. We excluded self-interactions.

NetICS

We employed NetICS [11] for data integration and network gene ranking. We used differentially expressed miRNAs and somatic mutations (SNV, indels) as upstream causal events. miRNA differential expression was computed in a sample-specific manner by comparing each tumor nodule to the 6 control samples from healthy liver tissue. As downstream events, we used differentially expressed genes/proteins at the RNA, proteome and phosphoproteome levels. At the phosphoproteome level, one gene was included if there was at least one differentially expressed phosphosite in its protein when tested between tumor and normal tissue. Data at the downstream level were integrated by using the rule described at Table 7.

Table 7.

Combination rules for differentially expressed genes

Combinations
RNA PROT or PH Output
Significant/Insignificant Significant PROT or PH
Significant/Insignificant Insignificant Not taken
Significant Not Detected RNA
Insignificant Not Detected Not taken
Not Detected Not Detected Not taken

The genes at the downstream level are combined as follows: If the protein is significantly changed at the proteome or phosphoproteome levels, it is taken into account in the set of differentially expressed genes/proteins given as input in NetICS. If the protein is detected but not significantly changed at the proteome or phosphoproteome levels, it is not taken into account. If the protein or its phosphosites are not detected at all, then the change at the RNA level is taken into account.

After we run NetICS, we kept the top 5% of the genes in the ranked list. We performed a random permutation test by permuting the labels of differentially expressed genes, miRNAs and mutated genes for each sample. We then recomputed the gene list and computed an empirical p-value for each gene by counting how many times the score given by NetICS was higher than the original score. We repeated the random permutation procedure 10,000 times and adjusted the p-value by FDR correction [43]. We ended up with 74 genes in total.

Antibodies

Yap1 ((G-6) sc-376830), HDAC4 (CST 7628), Sirt1 (CST 3931) and total AKT (CST, 9272) were obtained commercially. Horseradish peroxidase (HRP)-coupled anti-mouse (115-035- 774) and anti-rabbit (211-032-171) secondary antibodies were purchased from Jackson laboratories.

Immunoblotting

Both human and murine liver tissue was homogenized in T-PER (ThermoFisher scientific, 78510) supplemented with 1 mM PMSF, 1× Complete Mini Protease Inhibitors (Roche), 1× PhosSTOP (Roche) using a Polytron (PT 10-35 GT) at 500g for 2 min. Equal amounts of homogenate were SDS–PAGE fractionated and transferred onto a nitrocellulose membrane that was incubated, after blocking (5% BSA in TBST), with appropriate antibodies.

Source of human samples

All human samples used in this study were obtained after following the relevant ethical regulations. An informed consent was obtained from the human subjects.

Supplementary Information

12864_2021_7876_MOESM1_ESM.pdf (1.3MB, pdf)

Additional file 1: Figure S1. Copy number profiles derived from whole-exome sequencing demonstrates the intragenic deletions of Tsc1 and Pten. For each nodule, segmented Log2 ratios (y-axis) were plotted according to their genomic positions (x-axis), for chromosomes 2 or 19. Red arrows indicate the loci of the intragenic deletions of Tsc1 and Pten.

12864_2021_7876_MOESM2_ESM.pdf (1MB, pdf)

Additional file 2: Figure S2. A. Graph showing miRNA expression of miR-375 in L-dKO tumors (n=12) compared to control mice (n=6). B. mRNA expression analysis of indicated genes in 20-week-old L-dKO tumors compared to livers from age-matched control mice (n = 6). Expression for each gene is normalized to intensity of TBP gene expression (normalising control) in the corresponding mice. Two-sided unpaired t-test is used. Data is mean ± s.d.

12864_2021_7876_MOESM3_ESM.pdf (1MB, pdf)

Additional file 3: Figure S3. Graph showing the expression of miRNAs (upstream of HDAC4) in L-dKO tumors (n=12) compared to control mice (n=6).

12864_2021_7876_MOESM4_ESM.pdf (1MB, pdf)

Additional file 4: Figure S4. Graph showing the expression of miRNAs (upstream of SIRT1) in L-dKO tumors (n=12) compared to control mice (n=6).

12864_2021_7876_MOESM5_ESM.pdf (17.5MB, pdf)

Additional file 5: Figure S5. Original western blots full length images of the images shown in Figures 5A and C.

Acknowledgements

Not applicable

Abbreviations

HCC

Hepatocellular carcinoma

NetICS

Network-based integration of multi-omics data

miRNA

Micro RNA

mRNA

Messenger RNA

L-dKO

Liver-specific double-knockout

PCR

Polymerase chain reaction

qPCR

Quantitative polymerase chain reaction

FDR

False discovery rate

SNV

Single nucleotide variant

Indel

Insertion/deletion

EMT

Epithelial to mesenchymal transition

TCGA

The cancer genome atlas

Authors’ contributions

CD, SKH, NB and MH conceived the idea and designed the analysis. CD and SKH analyzed the data, implemented the network analysis and interpreted the results. NB and MH have substantially revised the manuscript. SKH and MC performed the proteomics data analysis. DM performed the western blot analysis. LT and MM performed histological sectioning and analysis of the L-dKO murine liver tissues, obtained ethics approval for patient samples and provided patient material. DL performed the RNA rt PCR analysis. CKYN, SP, JB, ALM, JS and HLR performed the DNA sequencing analysis. JB performed the RNA sequencing analysis and DL performed the miRNA sequencing analysis. All authors have read and approved the manuscript.

Funding

The Swiss Institute of Bioinformatics (SIB) PhD Fellowship Programme, European Research Council (ERC) Synergy Grant 609883, SystemsX.ch Research, Technology and Development (RTD) Grant 2013/150 and the European Commission (EC) Horizon 2020 project 633974 SOUND, have supported this work. The Swiss Institute of Bioinformatics (SIB) PhD Fellowship Programme scholarship has funded the PhD of Christos Dimitrakopoulos. The rest of the funding sources funded HCC-specific studies. The funders had no role in the design, execution, or analysis of the study.

Availability of data and materials

The DNA and RNA raw murine data analyzed in this study is available in the Sequence Read Archive repository, under the accession SRP156216 [https://www.ncbi.nlm.nih.gov/sra/?term=SRP156216]. The raw proteomic and phosphoproteomic murine data as well as the interaction network used for the analysis are available in our github repository [https://github.com/cbg-ethz/netics/tree/master/mouse_data]. The reference mouse genome GRCm38 was downloaded from [https://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.20/].

Declarations

Ethics approval and consent to participate

All relevant ethical regulations were followed in this study. An informed consent was obtained from the human subjects. The collection and analysis of patient samples was approved by the ethics committee of Northern Switzerland (EKNZ, Study ID: 310/12/PB_2019-00154/Genetische Analyse des Leberzellkarzinoms). Samples collected after 2016 were obtained under a written consent by the patient. Before 2016, samples were included if no active refusal of the patient existed, which was approved by the ethics committee. The animal license number was 2555. For two samples, we had no refusal from the patient to use the tissue for research purpose and because the tissue derived from 1999 and 2002 only an approval from the Ethics committee (EKNZ, Basel Switzerland) was needed at that time by the Swiss regulation to use the tissue for research purpose. For all remaining samples, a written informed consent of the patient was present to use the tissue for research purposes, as well as an approval from the Ethics committee (EKNZ, Basel Switzerland).

Consent for publication

Not applicable

Competing interests

There is no financial or non-financial competing interest.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Christos Dimitrakopoulos and Sravanth Kumar Hindupur are first authors.

Contributor Information

Michael N. Hall, Email: m.hall@unibas.ch

Niko Beerenwinkel, Email: beerenwinkel@bsse.ethz.ch.

References

  • 1.Llovet JM, et al. Hepatocellular carcinoma. Nat Rev Dis Primers. 2016;2:16018–16023. doi: 10.1038/nrdp.2016.18. [DOI] [PubMed] [Google Scholar]
  • 2.Hindupur SK, et al. The protein histidine phosphatase LHPP is a tumour suppressor. Nature. 2018;555(7698):678–682. doi: 10.1038/nature26140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Guri Y, et al. mTORC2 promotes tumorigenesis via lipid synthesis. Cancer Cell. 2017;32(6):807–823.e12. doi: 10.1016/j.ccell.2017.11.011. [DOI] [PubMed] [Google Scholar]
  • 4.Gerlinger M, et al. Intratumor heterogeneity and branched evolution revealed by multiregion sequencing. N Engl J Med. 2012;366(10):883–892. doi: 10.1056/NEJMoa1113205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Peng Y, Croce CM. The role of MicroRNAs in human cancer. Signal Transduct Target Ther. 2016;1:15004. [DOI] [PMC free article] [PubMed]
  • 6.Yu CB, et al. Systemic transcriptome analysis of hepatocellular carcinoma. Tumor Biol. 2016;37(10):13323–13331. doi: 10.1007/s13277-016-5286-5. [DOI] [PubMed] [Google Scholar]
  • 7.Jiang Y, et al. Proteomics identifies new therapeutic targets of early-stage hepatocellular carcinoma. Nature. 2019;567(7747):257–261. doi: 10.1038/s41586-019-0987-8. [DOI] [PubMed] [Google Scholar]
  • 8.Dazert E, et al. Quantitative proteomics and phosphoproteomics on serial tumor biopsies from a sorafenib-treated HCC patient. Proc Natl Acade Sci. 2016;113(5):1381–1386. doi: 10.1073/pnas.1523434113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ally A, et al. Comprehensive and integrative genomic characterization of hepatocellular carcinoma. Cell. 2017;169(7):1327–1341.e23. doi: 10.1016/j.cell.2017.05.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mertins P, et al. Proteogenomics connects somatic mutations to signalling in breast cancer. Nature. 2016;534:55–62. doi: 10.1038/nature18003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dimitrakopoulos C, et al. Network-based integration of multi-omics data for prioritizing cancer genes. Bioinformatics. 2018;34(14):2441–2448. doi: 10.1093/bioinformatics/bty148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Villanueva A, et al. Notch signaling is activated in human hepatocellular carcinoma and induces tumor formation in mice. Gastroenterology. 2012;143(6):1660–1669.e7. doi: 10.1053/j.gastro.2012.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.He G, et al. Identification of liver cancer progenitors whose malignant progression depends on autocrine IL-6 signaling. Cell. 2013;155(2):384–396. doi: 10.1016/j.cell.2013.09.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sun Q, Jiang N, Sun R. Leptin signaling molecular actions and drug target in hepatocellular carcinoma. Drug Design Dev Ther. 2014;8:2295–2302. doi: 10.2147/DDDT.S69004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zhao JF, et al. The ASH1-miR-375-YWHAZ signaling axis regulates tumor properties in hepatocellular carcinoma. Mol Ther Nucleic Acids. 2018;11:538–553. doi: 10.1016/j.omtn.2018.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sun H, et al. Loss of KLF4 and consequential downregulation of smad7 exacerbate oncogenic tgfbeta signaling in and promote progression of hepatocellular carcinoma. Oncogene. 2017;36(21):2957–2968. doi: 10.1038/onc.2016.447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Moroishi T, et al. The emerging roles of YAP and TAZ in cancer. Nat Rev Cancer. 2015;15(2):73–79. doi: 10.1038/nrc3876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kang ZH, et al. Histone deacetylase HDAC4 promotes gastric cancer SGC-7901 cells progression via p21 repression. PLoS One. 2014;9(6):e98894. doi: 10.1371/journal.pone.0098894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tamura M, Gu Jenny X, Yamada KM. Tumor suppressor pten inhibition of cell invasion, migration, and growth: differential involvement of focal adhesion kinase and p130cas. Cancer Res. 1999;59(2):442–449. [PubMed] [Google Scholar]
  • 20.Bollard J, et al. Palbociclib (PD-0332991), a selective CDK4/6 inhibitor, restricts tumour growth in preclinical models of hepatocellular carcinoma. Gut. 2016;66(7):1286–1296. doi: 10.1136/gutjnl-2016-312268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chetram MA, Hinton CV. PTEN regulation of ERK1/2 signaling in cancer. J Recept Signal Transduct. 2012;32(4):190–195. doi: 10.3109/10799893.2012.695798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wilson AJ, et al. HDAC4 promotes growth of colon cancer cells via repression of p21. Mol Biol Cell. 2008;19(10):4062–4075. doi: 10.1091/mbc.e08-02-0139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mottet D, et al. HDAC4 represses p21waf1/cip1 expression in human cancer cells through a sp1-dependent, p53-independent mechanism. Oncogene. 2008;28(2):243–256. doi: 10.1038/onc.2008.371. [DOI] [PubMed] [Google Scholar]
  • 24.Shen YF, Wei AM, Kou Q, Zhu QY, Zhang L. Histone deacetylase 4 increases progressive epithelial ovarian cancer cells via repression of p21 on fibrillar collagen matrices. Oncol Rep. 2015;35(2):948–954. doi: 10.3892/or.2015.4423. [DOI] [PubMed] [Google Scholar]
  • 25.Zeng LS, et al. Overexpressed HDAC4 is associated with poor survival and promotes tumor progression in esophageal carcinoma. Aging. 2016;8(6):1236–1248. doi: 10.18632/aging.100980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li L, et al. Activation of p53 by SIRT1 inhibition enhances elimination of CML leukemia stem cells in combination with imatinib. Cancer Cell. 2012;21(2):266–281. doi: 10.1016/j.ccr.2011.12.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chalkiadaki A, Guarente L. The multifaceted functions of sirtuins in cancer. Nat Rev Cancer. 2015;15(10):608–624. doi: 10.1038/nrc3985. [DOI] [PubMed] [Google Scholar]
  • 28.Moon HM, et al. LIS1 controls mitosis and mitotic spindle organization via the LIS1–NDEL1–dynein complex. Hum Mol Genet. 2014;23(2):449–466. doi: 10.1093/hmg/ddt436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li X, et al. Hepatic loss of Lissencephaly 1 (Lis1) induces fatty liver and accelerates liver tumorigenesis in mice. J Biol Chem. 2018;293(14):5160–5171. doi: 10.1074/jbc.RA117.001474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang S, et al. Dysregulation of miR484-TUSC5 axis takes part in the progression of hepatocellular carcinoma. J Biochem. 2019;166(3):271–279. doi: 10.1093/jb/mvz034. [DOI] [PubMed] [Google Scholar]
  • 31.Wanke J, et al. Pharmacological Inhibition of Class IIA HDACs by LMK-235 in pancreatic neuroendocrine tumor cells. Int J Mol Sci. 2018;19(10):3128. doi: 10.3390/ijms19103128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kandasamy S, et al. The YAP1 Signaling Inhibitors, Verteporfin and CA3, suppress the mesothelioma cancer stem cell phenotype. Mol Cancer Res. 2020;18(3):343–351. doi: 10.1158/1541-7786.MCR-19-0914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20:1297–1303. doi: 10.1101/gr.107524.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Cibulskis K, Lawrence MS, Carter SL, Sivachenko A, Jaffe D, Sougnez C, et al. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat Biotechnol. 2013;31:213–219. doi: 10.1038/nbt.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Saunders CT, Wong WS, Swamy S, Becq J, Murray LJ, Cheetham RK. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs. Bioinformatics. 2012;28:1811–1817. doi: 10.1093/bioinformatics/bts271. [DOI] [PubMed] [Google Scholar]
  • 37.Nuciforo S, et al. Organoid models of human liver cancers derived from tumor needle biopsies. Cell Reports. 2018;24(5):1363–1376. doi: 10.1016/j.celrep.2018.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Shen R, Seshan VE. FACETS: allele-specific copy number and clonal heterogeneity analysis tool for high-throughput DNA sequencing. Nucleic Acids Res. 2016;44:e131. doi: 10.1093/nar/gkw520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Jean G, Kahles A, Sreedharan VT, De Bona F, Rätsch G. Rna-seq read alignments with palmapper. Curr Protoc Bioinformatics. 2010; Chapter 11:Unit 11.6. https://pubmed.ncbi.nlm.nih.gov/21154708/. [DOI] [PubMed]
  • 40.Hafner M, et al. Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing. Methods. 2008;44(1):3–12. doi: 10.1016/j.ymeth.2007.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Tyanova S, et al. The perseus computational platform for comprehensive analysis of (prote) omics data. Nat Methods. 2016;13(9):731–740. doi: 10.1038/nmeth.3901. [DOI] [PubMed] [Google Scholar]
  • 42.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yekutieli D, et al. Resampling-based false discovery rate controlling multiple test procedures for correlated test statistics. J Stat Plan Inf. 1999;82:171–196. doi: 10.1016/S0378-3758(99)00041-5. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12864_2021_7876_MOESM1_ESM.pdf (1.3MB, pdf)

Additional file 1: Figure S1. Copy number profiles derived from whole-exome sequencing demonstrates the intragenic deletions of Tsc1 and Pten. For each nodule, segmented Log2 ratios (y-axis) were plotted according to their genomic positions (x-axis), for chromosomes 2 or 19. Red arrows indicate the loci of the intragenic deletions of Tsc1 and Pten.

12864_2021_7876_MOESM2_ESM.pdf (1MB, pdf)

Additional file 2: Figure S2. A. Graph showing miRNA expression of miR-375 in L-dKO tumors (n=12) compared to control mice (n=6). B. mRNA expression analysis of indicated genes in 20-week-old L-dKO tumors compared to livers from age-matched control mice (n = 6). Expression for each gene is normalized to intensity of TBP gene expression (normalising control) in the corresponding mice. Two-sided unpaired t-test is used. Data is mean ± s.d.

12864_2021_7876_MOESM3_ESM.pdf (1MB, pdf)

Additional file 3: Figure S3. Graph showing the expression of miRNAs (upstream of HDAC4) in L-dKO tumors (n=12) compared to control mice (n=6).

12864_2021_7876_MOESM4_ESM.pdf (1MB, pdf)

Additional file 4: Figure S4. Graph showing the expression of miRNAs (upstream of SIRT1) in L-dKO tumors (n=12) compared to control mice (n=6).

12864_2021_7876_MOESM5_ESM.pdf (17.5MB, pdf)

Additional file 5: Figure S5. Original western blots full length images of the images shown in Figures 5A and C.

Data Availability Statement

The DNA and RNA raw murine data analyzed in this study is available in the Sequence Read Archive repository, under the accession SRP156216 [https://www.ncbi.nlm.nih.gov/sra/?term=SRP156216]. The raw proteomic and phosphoproteomic murine data as well as the interaction network used for the analysis are available in our github repository [https://github.com/cbg-ethz/netics/tree/master/mouse_data]. The reference mouse genome GRCm38 was downloaded from [https://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.20/].


Articles from BMC Genomics are provided here courtesy of BMC

RESOURCES