Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes

Ketaki Ganti; Julianna Han; Balaji Manicassamy; Anice C Lowen

doi:10.1371/journal.ppat.1009321

. 2021 Sep 2;17(9):e1009321. doi: 10.1371/journal.ppat.1009321

Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes

Ketaki Ganti ^1,^*, Julianna Han ^2,^¤, Balaji Manicassamy ³, Anice C Lowen ^1,^4,^*

Editor: Meike Dittmann⁵

PMCID: PMC8443049 PMID: 34473799

Abstract

Influenza A virus [IAV] genomes comprise eight negative strand RNAs packaged into virions in the form of viral ribonucleoproteins [vRNPs]. Rab11a plays a crucial role in the transport of vRNPs from the nucleus to the plasma membrane via microtubules, allowing assembly and virus production. Here, we identify a novel function for Rab11a in the inter-cellular transport of IAV vRNPs using tunneling nanotubes [TNTs]as molecular highways. TNTs are F-Actin rich tubules that link the cytoplasm of nearby cells. In IAV-infected cells, Rab11a was visualized together with vRNPs in these actin-rich intercellular connections. To better examine viral spread via TNTs, we devised an infection system in which conventional, virion-mediated, spread was not possible. Namely, we generated HA-deficient reporter viruses which are unable to produce progeny virions but whose genomes can be replicated and trafficked. In this system, vRNP transfer to neighboring cells was observed and this transfer was found to be dependent on both actin and Rab11a. Generation of infectious virus via TNT transfer was confirmed using donor cells infected with HA-deficient virus and recipient cells stably expressing HA protein. Mixing donor cells infected with genetically distinct IAVs furthermore revealed the potential for Rab11a and TNTs to serve as a conduit for genome mixing and reassortment in IAV infections. These data therefore reveal a novel role for Rab11a in the IAV life cycle, which could have significant implications for within-host spread, genome reassortment and immune evasion.

Author summary

Influenza A viruses infect epithelial cells of the upper and lower respiratory tract in humans. Infection is propagated by the generation of viral particles from infected cells, which disseminate within the tissue. Disseminating particles can encounter obstacles in the extracellular environment, including mucus, ciliary movement, antibody neutralization and uptake by phagocytic immune cells. An alternative mode of spread, which avoids these hazards, involves direct transport of viral components between cells. This cell-cell spread of infection is not a well understood process. In this study we demonstrate that the host factor Rab11a mediates the transport of viral genomes in the cell-cell spread of infection. Rab11a is already known to play a pro-viral role in the transport of viral genomes to the plasma membrane for assembly into virus particles. Here, we see that this same transport mechanism is co-opted for direct cell-cell spread through cellular connections called tunneling nanotubes. We show that complexes of Rab11a and viral components can be trafficked across tunneling nanotubes, transmitting infection without the formation of virus particles. Importantly, this route of spread often seeds viral genomes from multiple donor cells into recipient cells, which in turn increases viral genetic diversity.

Introduction

Influenza A virus[IAV] genomes are composed of eight RNA segments that are packaged into the virion in the form of viral ribonucleoproteins [vRNPs], which contain viral nucleoprotein [NP] as well as the polymerase complex [PB2, PB1 and PA] [1]. Influenza genome packaging mechanisms have been studied extensively and, although there are a lot of unknowns, it has been demonstratively shown that the host cell protein Rab11a is crucial for the trafficking of newly synthesized vRNPs after they exit the nucleus to the site of assembly at the plasma membrane [2,3]. Rab11a is a small GTPase that has multiple roles in the host cell, including a pivotal role in retrograde transport of cargoon recycling endosomes [4,5]. The intracellular transport of vRNP-Rab11a complexes is thought to occur via the microtubule network with the help of dynein motors [6–11]. There are, however, conflicting observations about the impact of microtubule disruptionon the viral lifecycle, with results ranging from no detectable effect [6] to an attenuation of viral progeny production [8]. Our prior work revealed that loss of Rab11a reduces infectious viral titers, most likely due to a defect in the packaging of vRNPs, leading to the formation of incomplete viral particles [12]. Taken together, these data demonstrate the importance of an intact microtubule network as well as Rab11a in the IAV life cycle.

Tunneling nanotubes [TNTs] are F-Actin rich cellular connections that are formed between two or more cells [13]. These connections can be formed over long distances and provide cytoplasmic connectivity between the cells, allowing for exchange of materials including organelles, nutrients, and membrane vesicles [14–16]. Many viruses including HIV [17–19], herpesviruses [20] and IAVs [21,22] have been shown to utilize these TNTs for cell-cell spread. Previous work has shown that IAV spread via TNTs proceeds in the presence of neutralizing antibodies or antivirals such as oseltamivir [21,22]. This mode of infection does not depend on the formation of viral particles, thus allowing for the assembly stage of the lifecycle to be bypassed. Although the use of TNTs by IAVs has been demonstrated, the exact mechanism is unclear.

In this study, we show that Rab11a mediates the transport of IAV vRNPs and proteins through TNTs, as evidenced by Rab11a co-localization with viral components in TNTs and the disruption of this transport between Rab11a knock out cells. This system was observed to be functional in multiple host cell backgrounds and virus strains. Using HA deficient viruses, we confirm that transport of viral components through TNTs can seed productive infection in recipient cells. In the context of viral co-infection, we find direct cell-cell spread often seeds viral genomes from multiple donor cells into recipient cells, thus romoting genome mixing and reassortment. Finally, our data suggest that, at least in the case of IAV infection, TNTs access the cytosol of both connected cells and allow bi-directional movement of cargo. Taken together, these findingsdemonstrate a novel and crucial role for Rab11a in the trafficking of IAV genomes via tunneling nanotubes and extend mechanistic understanding of this unconventional mode of viral dissemination.

Results

IAV vRNPs associate with Rab11a within F-Actin rich TNTs

Upon nuclear exit, IAV vRNPs bind to Rab11a via PB2, allowing their transport to the plasma membrane for assembly [8,23,24]. We hypothesized that vRNP-Rab11a complexes could also be routed to F-Actin rich intercellular connections called tunneling nanotubes [TNTs] and could seed new infections by direct transport through TNTs. To test this hypothesis, we visualized Rab11a, F-Actin and viral nucleoprotein [NP]—as a marker for vRNPs—in MDCK cells infected with either influenza A/Netherlands/602/2009 [NL09; pH1N1] or A/Panama/2007/99 [P99; H3N2] virus. NP and Rab11a were seen to co-localize in a perinuclear compartment, as has been shown previously [2,9]. In addition, co-localization of these components was observed within the F-Actin rich TNTs connecting infected and uninfected cells [Figs 1A and S1]. This observation suggests that there are at least two functional pathways for the trafficking of vRNP-Rab11a complexes post nuclear exit: the canonical assembly pathway and the TNT-mediated genome transfer pathway.

Fig 1 — [A] MDCK cells,[B] A549 WT and [C]A549 Rab11a KO cells were mock-infected or infected with NL09 or P99 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [pink]. Representative images are shown withadditional images in S1–S3 Figs. Scale bar is 20μm for all images.

To further corroborate the role of Rab11a in the transport of vRNPs across TNTs, we used Rab11a knockout [KO]A549 cells generated by CRISPR/Cas9 [12] and wild type [WT]A549 cells as a control. As before, cells were infected with either NL09 or P99 viruses and then stained for NP, Rab11a and F-Actin. WT cells showed co-localization of NP and Rab11a in the perinuclear region and within TNTs [Figs 1B and S2]. Conversely, Rab11a KO cells did not show NP staining within the TNTs, indicating that Rab11a drives the transfer of vRNPs through TNTs [Figs 1C and S3].

We used super resolution Stimulated Emission Depletion [STED] microscopy to analyze the association of Rab11a and vRNPs within TNTs in more detail. STED microscopy overcomes the diffraction resolution limit of confocal microscopy and allows for imaging with up to 30nm resolution [25,26]. A549 WT or Rab11a KO cells were infected with NL09 viruses and stained for NP, Rab11a and F-Actin. Using 3 color STED imaging of TNTs, we observed punctate Rab11a and NP staining in close proximity within the TNTs in WT cells. In the case of the Rab11a KO cells, the NP staining was relatively diffuse in the cytoplasm and could not be observed within the TNTs [Fig 2A]. Co-localization of Rab11a and NP within TNTs was analyzed quantitatively for both WT and KO cells. A resolution of 41.67 nm for the Rab11a-NP staining was achieved, giving a high degree of confidence in the co-localization quantitation. Of note, Rab11a was previously determined to interact with vRNPs via PB2 [24] and not with NP, the target of our vRNP staining. The observed colocalization co-efficient of 0.9 in the WT cells indicates that the majority of the NP puncta within TNTs coincide with Rab11a puncta [Fig 2B]. These data indicate that Rab11a and vRNPs are indeed interacting with each other within TNTs and are likely trafficked as a complex.

Fig 2 — [A]A549 WT and Rab11a KO cells were infected with NL09 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [grey]. Representative confocal images are shown with the high-resolution STED images depicted in the insets. The arrows depict the co-localized puncta of NP and Rab11a. [B] Co-localization coefficient of NP and Rab11a within TNTs from A549 WT and Rab11a KO cells [n = 10 TNTs]. Significance of differences in co-localization between the WT and KO cells was tested using a two tailed unpaired t-test [**** P-value <0.0001]. [C] A549 WT cells were mock infected or infected with NL09 viruses and the percentage of TNTs formed between 50 cell pairs were counted manually as NP+Rab11a+ [blue], NP-Rab11a+ [magenta] and NP+Rab11a- [teal]. Error bars represent the SEM of two biological replicates.

To evaluate the frequency with which Rab11a accesses TNTs, we quantified the percentage of TNTs that were NP+Rab11a+, NP+Rab11a- and NP-Rab11a+ in uninfected and NL09 infected A549 WT cells. Rab11a was routinely detected within the TNTs of uninfected cells, indicating that Rab11a+ recycling endosomes are trafficked within TNTs under normal conditions [Fig 2C]. In infected cells, a majority of TNTs carried NP+Rab11a+ puncta, indicating that transport of vRNPs into TNTs is a common feature of the viral life cycle [Fig 2C].

Rab11a does not modulate TNT formation

IAV infection increases the number of TNTs formed between cells [21,22]. To test whetherthe loss of Rab11a had an impact on TNT formation, we counted the number of TNTs formed between cells in WT and Rab11a KO cells in the presence and absence of NL09 infection. Consistent with prior work, a significant increase in the number of TNTs formed upon IAV infection was observed in both WT and KO cells [Fig 3]. Conversely, we saw no significant difference between WT and KO cells in the number of TNTs formed, either in the context of infection or mock infection [Fig 3]. The observation that loss of Rab11a does not significantly impact TNT formation suggests that the reliance of vRNP trafficking through TNTs on Rab11a arises through the observed interaction between these components.

Fig 3 — A549 WT and Rab11a KO cells were mock infected or infected with NL09 viruses and the total number of TNTs formed between 50 cell pairs were counted manually. Significance of differences in the number of TNTs between mock and NL09 infected groups was tested using 1-way ANOVA [** P-value <0.01]. Error bars represent the SEM of two biological replicates.

Disruption of actin or loss of Rab11a significantly attenuates direct cell-cell transmission of infection

Since we observed the presence of vRNP-Rab11a complexes within TNTs, we next tested whether the loss of either the TNTs or Rab11a influences the cell-cell spread of IAV infection. Previously, neutralizing antibodies or neuraminidase inhibitors have been used to block conventional viral infection and allow examination of IAV protein and RNA transport via TNTs[21,22]. Although these methods are effective in abrogating conventional spread, we wanted to fully eliminate the generation of viral progeny to define the role of Rab11a and TNTs in IAV genome transfer more clearly. To this end, we rescued recombinant viruses in the NL09 and P99 strain backgrounds that lack the HA gene but instead contain either mVenus [NL09 ΔHAVenus; P99 ΔHAVenus] or mScarlet [NL09 ΔHAScarlet] fluorescent reporter ORFs flanked by HA packaging signals. These HA deficient reporter viruses are infection competent but are unable to produce progeny in the absence of a HA complementing cell line. Therefore, these viruses are excellent tools to study the cell-cell spread of IAV infection via TNTs.

To analyze the role of F-actin in the cell-cell spread of viral genomes, MDCK cells were infected with either NL09 ΔHAVenus or P99 ΔHA Venus viruses in the presence or absence of Cytochalasin D, which is a potent inhibitor of actin polymerization and disrupts TNTs[21,22]. Cytochalasin D was added 2h post internalization. mVenus positive cells were counted at 16, 24, and 48 h post-infection [p.i.]and binned into one of two categories: single cells or foci comprising > = 2 contiguous, positive cells. We hypothesized that the disruption of TNTs by Cytochalasin D would severely limit the spread of IAV genomes from infected cells, preventing the formation of infected foci. As shown in Fig 4A and 4B, there was a significant reduction in the number of infected foci in the Cytochalasin D treated cells compared to the untreated controls in both the NL09 ΔHA Venus and P99 ΔHA Venus infected cells. These data confirm that intact TNTs are required for direct cell-cell spread of IAV genetic material.

Fig 4 — MDCK cells infected with NL09 ΔHA Venus WT [A] or P99 ΔHA Venus WT [B]at a MOI of 0.5 were counted as single infected cells or foci of infected cells. Significance of differences in the number of infected foci between the control and Cytochalasin D treated groups was tested using 2-way ANOVA with Bonferroni’s correction for multiple comparisons [**** P-value <0.0001]. Error bars represent the standard error of three biological replicates. A549 WT or A549 Rab11a KO cells infected with NL09 ΔHA Venus WT [C] or P99 ΔHA Venus WT [D] at a MOI of 0.5 were counted as single infected cells or foci of infected cells.Significance of differences in the number of infected foci between cell types was tested using 2-way ANOVA with Bonferroni’s correction for multiple comparisons [**** P-value <0.0001]. Error bars represent the standard error of three biological replicates.

Next, we analyzed the role of Rab11a in direct cell-cell spread of IAV. To do this, A549 WT and Rab11a KO cells were infected with either NL09 ΔHA Venus or P99 ΔHA Venus viruses. Venus positive cells were counted at 16, 24, and 48 h p.i. and categorized based on their presence as single cells or within foci at each time point. If Rab11a directs transport of vRNPs across TNTs, the loss of Rab11a would be expected to reduce the cell-cell spread of IAV genetic material. As shown in Fig 4C and 4D, this was indeed the case. In contrast to WT controls, the number of infected foci did not increase over time in the Rab11 KO cells. These data provide further evidence for the role of Rab11a in this alternate infection pathway.

Virion-independent genome transfer leads to productive infection by an actin-dependent mechanism

To assess whether all eight genome segments can be transported via TNTs leading to the production of infectious progeny, we performed a co-culture experiment using MDCK cells and a MDCK-derived cell line which expresses the HA ofinfluenza A/WSN/33 [H1N1] virus on the cell surface [MDCK WSN HA cells]. When infected with an HA deficient reporter virus, these cells provide the HA protein required for the generation of infectious virus particles. For subsequent analysis of co-infection via TNT/Rab11a mediated genome transfer, these experiments were set up using two IAV strains, NL09 ΔHAVenus WT and NL09 ΔHAScarlet VAR viruses. In addition to carrying differing reporter genes, these viruses differ in the presence of a silent mutation in each segment of the VAR virus, which acts as a genetic tag [27]. Neither of these differences is important for the purposes of the present analysis.

As outlined in Fig 5A, separate dishes of MDCK cells were singly infected with either NL09 ΔHAVenus WT or NL09 ΔHAScarlet VAR virus. After infection for 2 hours, the cells were acid washed to remove residual inoculum and then trypsinized to make a cell slurry. MDCK cells infected with NL09 ΔHAVenus WT and NL09 ΔHAScarlet VAR were mixed with naïve MDCK WSN HA cells in the ratio 1:1:2. The cell mixture was plated in medium containing trypsin [to allow activation of HA] and ammonium chloride [to prevent secondary infections mediated by virus particles]. If all eight segments of the viral genome can be transported across TNTs to a conducive cell, which in this case must be a MDCK WSN HA cell, then the recipient cell will produce virus particles. To detect any such progeny viruses produced, supernatant was collected at 0, 24, 48 and 72 h post mixing and plaque assays were performed on MDCK WSN HA cells.

To evaluate the role of TNTs in cell-cell spread of infection, cells were treated with either vehicle or 30 μM Cytochalasin D, which disrupts F-Actin. As can be seen from Fig 5B, infectious virus was detected in the vehicle treated control cells, but not in the Cytochalasin D treated cells. Virus production in vehicle treated cells demonstrates the transfer of the full complement of IAV genome segments from infected cells, which lack HA protein and cannot produce virions, to cells which express complementing HA protein. A lack of virus production in Cytochalasin D treated cells indicates that this transfer was F-Actin-dependent, strongly implicating TNTs. Comparing the two MOIs tested[2.5 and 25 PFU/cell], a dose dependence was observed at 24 h, which is most likely due to the increased probability of an infected cell making a connection with a naïve MDCK WSN HA cell at higher MOI.

To assess if actin depolymerization was impairing vRNP transport upstream of TNT transfer, we tested the effect of Cytochalasin D on conventional virus production in the context of multicycle replication. No difference in viral yield from vehicle treated or Cytochalasin D treated cells was detected [Fig 5C]. Taken together, these data indicate that actin depolymerization specifically abrogates TNT mediated transfer of viral genomes but has no impact on conventional viral assembly.

To test if microtubules play a role in TNT mediated transport of IAV genomes, we performed the co-culture assay as described above with vehicle treated and 30 μM Nocodazole, which depolymerizes microtubules. We detected infectious virus in both control and nocodazole treated cells [Fig 5D], indicating that microtubules most likely did not play a role in the trafficking of vRNPs through TNTs.

Finally, to analyze the effect of the loss of Rab11a on the production of infectious progeny, we co-cultured either A549 WT or A549 Rab11a KO cells infected with the NL09 ΔHAVenus WT or NL09 ΔHAScarlet VAR viruses with the MDCK WSN HA complementing line as described above. Supernatant was collected at 24, 48 and 72 h post mixing and plaque assays were performed on MDCK WSN HA cells. As can be seen from Fig 5E, infectious virus was detected from both A549 WT and Rab11a KO cells, with a marginal difference in titers at 48 and 72 hpi. Since this observation was incongruent with our previous data demonstrating the importance of Rab11a in the transport of vRNPs, we hypothesized the transfer of viral genomes from the Rab11a KO cells was occurring via Rab11a that originates in the MDCK WSN HA cells. If correct, this observation would indicate that TNTs are open ended and allow for bi-directional movement of cargo.

TNTs likely allow bidirectional shuttling of Rab11a between cells

To analyze if Rab11a could shuttle form one cell to another in a bi-directional manner, we used A549 WT and Rab11a KO cells in combination. Briefly, A549 Rab11a KO cells were infected with NL09 WT virus. The infected cells were then mixed in a 1:1 ratio with uninfected A549 WT cells which were pre-stained with CellTracker Blue dye. The mixed cells were stained for NP, Rab11a and F-Actin at 24h post-mixing and imaged using STED microscopy. We observed NP and Rab11a within the TNTs connecting the infected KO cells and the uninfected WT cells[Fig 6A]. Co-localization analysis again showed Rab11a-NP colocalization within TNTs in this KO-WT co-culture system [Fig 6B], although the coefficient was lower than that seen in a fully Rab11a competent system [Fig 2B]. Since the WT cell is the only source of Rab11a in the KO-WT co-culture, our data show that Rab11a traveling from an uninfected cell to an infected cell can pick up vRNPs. The production of viral progeny observed in this system further indicates that this Rab11a from the originally uninfected cell can then transport vRNPs back through the TNTs, mediating infection. Our data suggest that TNTs formed in the context of IAV infection are most likely open ended and bi-directional.

Fig 6 — [A]A549 Rab11a KO cells were infected with NL09 viruses and mixed with A549 WT cells pre-stained with CellTracker Blue CMAC dye [blue]. Cells were stained for NP [red], Rab11a [green] and F-Actin [grey]. Representative confocal image is shown with the high-resolution STED images depicted in the inset. [B] Co-localization coefficient of NP and Rab11a within TNTs formed between A549 WT and Rab11a KO cells [n = 10 TNTs]. Error bars represent the SEM of two biological replicates with two technical replicates each.

TNTs serve as conduits for genome mixing and reassortment

Since we observed that infectious progeny could be generated via Rab11a-mediated genome transfer through TNTs, we hypothesized that this process could also mediate co-infection and therefore reassortment. In particular, reassortment would be expected if differentially infected donor cells connect to the same recipient cell. To test this hypothesis, the genotypes of virus produced from the co-cultures described in Fig 5E were evaluated. In these experiments, cells infected with NL09 ΔHA Venus WT virus were mixed with cells infected withNL09 ΔHA Scarlet VAR virus and these infected cells were in turn mixed with MDCK WSN HA cells; thus, co-infections could occur if WT infected and VAR infected cells each formed connections with the same HA-expressing recipient cell and a full complement of IAV segments was reconstituted therein. The silent mutations differentiating each of the non-HA gene segments of the WT and VAR viruses allow the parental origin of segments to be identified. Thus, to evaluate reassortment, plaque clones were isolated from co-culture supernatants and the genotype of each was determined. The results show that viruses generated from MDCK WSN HA cells mixed with infected A549 WT cells were predominantly reassortant under all conditions evaluated [Fig 7A]. In contrast, when MDCK WSN HA cells were mixed with infected A549 Rab11 KO cells, parental viruses typically dominated [Fig 7B]. Thus, in a Rab11a-sufficient system, intercellular transfer of IAV vRNPs through TNTs readily yielded reassortants, indicating that TNTs are forming a network rather than pairwise connections between cells. When Rab11a was absent from infected donor cells, however, reassortants were rarely observed. Since Rab11a knock out does not impact the number of TNTs formed [Fig 3], this relative lack of reassortants suggests that vRNP transport through TNTs is less efficient when Rab11a is absent from donor cells.

We note that, in both data sets shown in Fig 7, richness of viral genotypes was low, with at most four distinct gene constellations detected in each sample of 21 plaque isolates. This observation suggests that very few cells are producing most of the progeny virus in this experimental system, and that each producer cell is releasing virus with only one or a small number of genotypes. In turn, this suggests that MDCK WSN HA cells that receive a full complement of IAV vRNPs do not tend to receive multiple copies of a given segment. Although low in both culture systems, richness was significantly higher in the samples derived from A549 WT cells compared to those from A549 Rab11a KO cells, with 2.8 and 1.9 unique genotypes detected on average, respectively [p = 0.019, t-test]. This difference is consistent with less efficient vRNP transfer when donor cells lack Rab11a.

Discussion

Our data reveal a novel role for the host GTPase Rab11a in the trafficking of IAV genomes via tunneling nanotubes. We decisively show that productive infection can be mediated through this direct cell-to-cell route and find evidence that Rab11a can move through TNTs in a bidirectional manner to mediate IAV genome transfer. In the context of mixed infections, we furthermore find that TNT/Rab11a-mediated transfer readily leads to cellular coinfection and reassortment.

The trafficking of IAV genomes is a complex and poorly understood process. Although it is known that newly synthesized vRNPs form transient complexes with active Rab11a post nuclear exit and are trafficked to the plasma membrane for assembly on microtubule structures [6–9], the fate of these complexes is not completely elucidated. Here we examined the potential for Rab11a-vRNP complexes to be trafficked through TNTs to neighboring cells. Tunneling nanotubes [TNTs] are F-Actin based cytoplasmic connections that are utilized for long distance communication and have been shown to have a role in the IAV life cycle [21,22].TNTs can be used to transport vesicular cargo [14,28–30], so we posed the question of whether the Rab11a-vRNP vesicular complexes could be re-routed to these structures. We show that Rab11a and vRNPs co-localize within TNTs in multiple cell types, with near complete concordance of NP with Rab11a in high resolution STED images of TNTs. Loss of Rab11a leads to severely reduced detection of NP within the TNTs and more dispersed NP localization within the cytoplasm. These observations strongly suggest that Rab11a-vRNP complexes are transported within TNTs.

TNTs are mainly composed of F-Actin and the transport of organelles through TNTs requires myosin motor activity on actin filaments [11,23–25]. Since Rab11a can utilize both dynein motors, which drive microtubule movement [6,26,27], and myosin motors, which drive actin dynamics [28–30], the observation that Rab11a mediates transport through TNTs raises the question of which motor proteins are involved. Studies to date on IAV infection have mainly focused on the role of Rab11a and microtubules. Further studies are needed to determine whether the same transport mechanism is active within TNTs and, conversely, whether Rab11a-actin dynamics may function in vRNP transport both within and between cells. Although Rab11a has been shown to be important for trafficking and efficient assembly of IAV genomes [2,8,12], we have shown that the loss of Rab11a does not completely abrogate genome assembly and viral particle release, indicating that there may exist an alternative pathway for canonical assembly of virions [12].

We observed that infectious progeny could be recovered from co-cultures of infected Rab11a KO A549 cells with MDCK WSN HA cells, which was incongruous with our previous observation that Rab11a KO abrogated the cell-cell transmission of infection. We were able to resolve this paradox by utilizing high-resolution STED imaging to visualize the transport of Rab11a from uninfected A549 WT cells to infected A549 Rab11a KO cells, where vRNPs could be picked up and trafficked through TNTs. TNTs can be formed in multiple ways- single ended, open ended or closed—and therefore support varying modes of transport [13,16,31]. The generation of progeny virions in the Rab11a KO co-culture is likely due to the formation of open ended, bi-directional TNTs that allow Rab11a from the HA-expressing producer cell to shuttle to and from infected KO cells where it could pick up vRNPs. This process seems to be inefficient, however, as evidenced by the low rate of reassortment observed when infected cells do not encode Rab11a. Bi-directional transfer of organelles such as mitochondria through TNTs have been observed in various cell types, including lung mesothelioma cells [32]. It is also possible that there exists another host factor that can mediate vRNP transport through TNTs in the absence of Rab11a, albeit inefficiently. The possibility of bidirectional trafficking of vRNPs between cells, or potential novel host factors involved in vRNP transport, opens hitherto unexplored avenues of viral infection.

Our datarevealing that coinfection and reassortment can occur through TNT transfer of vRNPs between cells raise new questions about the processes driving IAVgenetic exchange. The prevalence of reassortants produced via TNT transfer from Rab11a+ cells indicates that vRNPs may be trafficked individually or as subgroups and not as a constellation of 8 segments. This process would then seed incomplete viral genomes into recipient cells, which require complementation to allow the production of progeny viruses. Owing to this reliance on complementation, incomplete viral genomes are known to augment reassortment[33–35]. Our data suggest that both seeding and complementation of incomplete viral genomes can occur via TNT transfer of vRNPs. In the presence of a conventional viral infection system, co-infection with multiple virions is thought to be the modus operandi of IAV reassortment, where reassortment efficiency is a function of the dose and relative timing of two infections, as well as levels of incomplete viral genomes [27,33]. It will be interesting to determine whether TNT-mediated co-infection is also sensitive to dose and timing. More broadly, further work is needed to tease out the extent to which TNT mediated reassortment occurs alongside conventional modes of reassortment.

The human airway is composed of multiple cell types, including polarized epithelial cells in a tightly packed environment [36]. It is yet unclear what role TNTs may play in the normal homeostasis of the airway, but TNTs have been demonstrated to mediate the transfer of cargo and organelles in various solid tumors of the lung, including adenocarcinomas and mesotheliomas [32]. TNT mediated transfer of organelles and other components including viruses has been observed between heterotypic cells, mostly involving immune cells such as macrophages [37–40]. It is therefore likely that IAV infection of the airway epithelium or potentially immune cells can spread via TNTs in vivo. The extent to which TNT mediated spread acts in conjunction with particle-based transmission of infection within the host is as yet unexplored. IAV spread through TNTs may be particularly important in the evasion of antibodies, and other antiviral factors that act directly on extracellular virions, in a manner that does not depend on the generation of escape mutants. Additional routes of HA-independent direct cell-cell spread of infection are possible. It has been recently shown that cell-cell spread of H5N1 IAVs can occur via trogocytosis, in which there is an actin dependent exchange of the plasma membrane and its associated molecules between conjugated cells [41]. Direct cell-cell spread of human metapneumovirus occurs via reorganization of the actin cytoskeleton [42], while measles virusinfection of neighboring cells can occur through tight junctions [43,44]; whether IAV exploits these two routes of spread remains unclear. Direct cell-cell spread may make an important contribution to spatial structure of infection within the host, leading to more localized spread and limiting mixing among de novo variants [45]. To further investigate these potential implications, an exciting prospect for future work is the development of ex vivo and in vivo models for the study and visualization of TNT mediated cell-cell spread.

In summary, our data show a novel role for Rab11a in the IAV life cycle, where it can mediate vesicular transport of vRNPs across TNTs and seed new infections [Fig 8]. Future work to elucidate the exact mechanism of transport of the Rab11a-vRNP complexes, including the motors utilized and the fate of the incoming Rab11a-vRNP complexes in the recipient cytosol, are exciting avenues to be studied and will further our understanding of IAV-host interactions.

Fig 8 — vRNP complexes synthesized within the nucleus are exported out and form Rab11a-vRNP complexes. Two potential fates of these complexes are shown- the classical assembly and egress pathway for production of progeny virions and transport of these complexes via TNTs to an uninfected cell. A new infection is initiated in the recipient cell, resulting in progeny virion production. Generated via BioRender.com.

Materials and methods

Cells and cell culture media

MDCK cells [obtained from Dr. Daniel Perez] and MDCK WSN HA cells [obtained from Dr. Ryan Langlois] were maintained Minimal Essential Medium [Sigma] supplemented with 10% fetal bovine serum [FBS; Atlanta Biologicals], penicillin [100 IUml⁻¹], and streptomycin [100 μg ml⁻¹; PS; Corning]. A549 WT, A549 Rab11a KO were maintained in Dulbecco’s Modified Essential Medium [Gibco] supplemented with 10% FBS [Atlanta Biologicals], and PS. All cells were cultured at 37°C and 5% CO₂ in a humidified incubator. All cell lines were tested monthly for mycoplasma contamination while in use. The medium for culture of IAV in each cell line [termed virus medium] was prepared by eliminating FBS and supplementing the appropriate medium with 4.3% BSA and PS. Ammonium chloride-containing virus medium was prepared by the addition of HEPES buffer and NH₄Cl at final concentrations of 50 mM and 20 mM, respectively. OPTi-MEM [Gibco] was used as a serum free medium where indicated.

Generation of Rab11aKO cells

Generation and characterization of Rab11a KO A549 cells wasreported in [12,46]. Briefly, two guide RNAs [gRNA] targeting the promoter and exon 1 of the Rab11a gene were used. Oligonucleotides for the CRISPR target sitesT1[forwardCACCGCATTTCGAGTAAATCGAGAC and reverseAAACGTCTCGATTTACTCGAAATGC] and T2 [forward CACCGTAACATCAGCGTAAGTCTCA and reverse AAACTGAGACTTACGCTGATGTTAC] were annealed and cloned into lentiCRISPRv2 [Addgene #52961] and LRG [Addgene #65656] expression vectors, respectively. A549 cells transduced with lentivirus vectors expressing gRNAs were selected in the presence of 2 μg/mL puromycin for 10 days and clonal Rab11a KO cells were generated by limiting dilution of the polyclonal population. Rab11a KO cells were identified by PCR analysis of the targeted genomic region using the following primers [forward TGTTCAACCCCCTACCCCCATTC and reverseTGGAAGCAAACACCAGGAAGAACTC] and further confirmed by western blot analysis of Rab11a expression [46].

Viruses

All viruses used in this study were generated by reverse genetics [47]. For influenza A/Panama/2007/99 virus [P99; H3N2], 293T cells transfected with reverse-genetics plasmids 16–24 h previously were injected into the allantoic cavity of 9- to 11-d-old embryonated chicken eggs and incubated at 37°C for 40–48 h. The resultant egg passage 1 stocks were used in experiments. For influenza A/Netherlands/602/2009 virus[NL09; pH1N1], 293T cells transfected with reverse-genetics plasmids 16–24 h previously were co-cultured with MDCK cells at 37°C for 40–48 h. The supernatants were then propagated in MDCK cells at a low MOI to generate NL09 working stocks. The titers for these viruses were obtained by plaque assays on MDCK cells.

The NL09 ΔHA Venus WT, P99 ΔHA Venus WT and NL09 ΔHA Scarlet VAR viruses were generated by reverse genetics by co-culture with MDCK WSN HA cells rather than MDCK cells. The ΔHA Venus and ΔHA Scarlet rescue plasmids were prepared by inserting either the mVenus [48] or mScarlet [49] ORF within the HA sequence, retaining only the 3’ terminal 136 nucleotides of the HA segment upstream of the reporter gene start codon and the 5’ terminal 136 nucleotides of the HA segment downstream of the reporter gene stop codon. ATG sequences within the upstream portion were mutated to ATT to prevent premature translation start [50]. As previously described [51], one silent mutation was introduced into each NL09 cDNAto generate the NL09 VAR reverse genetics system, which was used to generate the NL09 ΔHA Scarlet VAR virus. These silent mutations enable differentiation of VAR virus segments from those of the WT virus using high-resolution melt analysis [27,52].

Immunofluorescence and confocal imaging

For fixed cell imaging, MDCK, A549 WT or A549 Rab11a KO cells were seeded onto glass coverslips. Infection with either NL09 or P99 viruses was performed the next day by adding 250μl of inoculum to the coverslips and incubating at 37°C for 1 h with intermittent rocking. Inoculum was removed, cells washed twice with 1X PBS and Opti-MEM added to the dish. After incubation at 37°C for 24h,cells were washed with 1X PBS [Corning] thrice and fixed with 4% paraformaldehyde [AlfaAesar] for 15 minutes at room temperature. Cells were washed with 1X PBS and permeabilized using 1% Triton X-100 [Sigma] in PBS for 5 minutes at room temperature and washed with 1X PBS. Cells were stained with mouse anti NP antibody [Abcam ab43821][1:100], rabbit anti Rab11a antibody [Sigma HPA051697][1:100], and Phalloidin Alexa Fluor 647 [Invitrogen A22287][1:40] overnight at 4°C. Cells were washed thrice with 1X PBS and incubated with donkeyanti mouse Alexa Fluor 555 [Invitrogen A32773][1:1000] and Anti rabbit Alexa Fluor 488 [Invitrogen A32731][1:1000] for 1 h at 37°C. Coverslips were washed thrice with 1X PBS and mounted on glass slides using ProLong Diamond Anti-Fade Mountant with DAPI [Invitrogen P36962] prior to imaging.

Confocal images were collected using the Olympus FV1000 Inverted Microscope at 60X 1.49 NA Oil magnification on a Prior motorized stage. Images were acquired with a Hamamatsu Flash 4.0 sCMOS camera controlled with Olympus Fluoview v4.2 software. All images were processed using Fijiimage analysis software [53].

Immunofluorescence and high-resolution STED imaging

A549 WT or A549 Rab11a KO cells were seeded onto glass coverslips. Infection with NL09 WT viruses was performed the next day by adding 250 μl of inoculum to the coverslips and incubating at 37°C for 1 h with intermittent rocking. Inoculum was removed, cells washed twice with 1X PBS and Opti-MEM added to the dish. After incubation at 37°C for 24 h, cells were washed with 1X PBS [Corning] thrice and fixed with 4% paraformaldehyde [AlfaAesar] for 15 minutes at room temperature. Cells were washed with 1X PBS and permeabilized using 1% Triton X-100 [Sigma] in PBS for 5 minutes at room temperature and washed with 1X PBS. Cells were stained with mouse anti NP antibody [Abcam ab43821][1:50], rabbit anti Rab11a antibody [Proteintech 20229-1-AP][1:50], and CellMask Deep Red Actin Tracking Stain [Invitrogen A57248][1:1000] overnight at 4°C. Cells were washed thrice with 1X PBS and incubated with goat anti- mouse STAR ORANGE [Abberior STORANGE-1001] and goat anti-rabbit STAR GREEN [Abberior STGREEN-1002] for 1 h at 37°C. Coverslips were washed thrice with 1X PBS and mounted on glass slides using ProLong Diamond Anti-Fade Mountant with DAPI [Invitrogen P36962] prior to imaging.

For the A549 KO-WT co-culture experiment, WT cells were pre-stained with CellTracker Blue CMAC dye [Invitrogen C2110][1:500] overnight at 37°C in OPTIMEM. This dye stains thiols in the cytoplasm and fluoresces blue under the DAPI filter. Cells were washed with 1X PBS, trypsinized and then mixed with NL09 infected Rab11a KO cells and seeded onto glass coverslips. After incubation at 37°C for 24 h, cells were processed and stained as described above. Coverslips were washed thrice with 1X PBS and mounted on glass slides using ProLong Glass Anti-Fade Mountant [Invitrogen P36980] prior to imaging.

Images were taken using an Abberior Facility Line STED microscope, controlled via Lightbox. The microscope is a custom design with a built-inOlympus IX3-ZDC-12 z-drift compensation unit for steady confocal/STED imaging to correct for chromatic abberration. Single planes were acquired at 900 x 900 px [150 μm × 150 μm] with a 4μs dwell time and a line accumulation of 4. A 60X NA 1.4 [oil immersion; UPLXAPO60XO] objective lens was used with a confocal pinhole of 0.5 AU. The Alexa 647 STED channel [F-Actin] was excited with a 1mW pulsed 640nm laser line at 1% and spectral detection at 650–735 nm. 2D STED was induced with a 2750 mW 775nm pulsed laser at 25%. The STAR ORANGE channel [NP] was excited with a 200μW pulsed 561 nm laser line at 10% and spectral detection at 574–637 nm. 2D STED was induced with a 2750 mW 775 nm pulsed laser at 25%. The STAR GREEN channel [Rab11a] was excited with a 1mW pulsed485 nm laser line at 5% and spectral detection at 498–574 nm. 2D STED was induced with a 400mW 595 nm pulsed laser at 30%. The DAPI/CellTracker Blue channel was excited with a 20 mW 405 nm laser line at 3% and spectral detection at 415–497 nm. All 2D STED images were acquired at a 2 μs dwell time. All images were acquired using the same parameters and pixel intensities were consistent across all datasets.

Quantification of co-localization

Co-localization efficiency of NP and Rab11a was calculated using the Manders coefficient [54] with the Costes threshold [55] on both A549 WT and Rab11a KO cells using the JaCoP plugin[56] in FiJi [53].The quantification of co-localization was limited to the TNT regions of interest. All images were acquired in 2D and quantification was performed on the single slice.

Quantification of cell-cell transmission

MDCK, A549 WT and A549 KO cells were inoculated with NL09 ΔHA Venus WT or P99 ΔHA Venus WT virus at aMOI of 0.5 PFU/cell and incubated for 1 h at 37°C. Cells were washed with 1X PBS [Corning] to remove residual inoculum and supplemented with OPTI-MEM [Gibco] without trypsin and in the presence of 30μM Cytochalasin D [Sigma] where indicated and incubated at 37°C. Infected cells were counted manually by the presence of green fluorescence using an epifluorescence microscope [Zeiss] at the time points indicated and binned into single infected or foci of infected cells. Foci were defined as clusters of at least two contiguous, positive, cells. The cell counts were graphed using the GraphPad Prism software [57].

Co-culture for production of infectious virus

MDCK, A549 WT or A549 Rab11a KO cells were inoculated with either NL09 ΔHA Venus WT or NL09 ΔHA Venus VAR at a MOI of 25 PFU/cell or 2.5 PFU/cell and were incubated in virus medium without trypsin for 2 h at 37°C. Cells were washed twice with 1X PBS [Corning] and then treated with PBS-HCl, pH 3.0 for 5 min at room temperature to remove residual inoculum. Cells were washed once with 1X PBS and then trypsinized using 0.5 M trypsin-EDTA [Corning]. Cell slurry was collected in growth medium containing FBS and centrifuged at 1000 rpm or 5 minutes in a tabletop centrifuge [ThermoSorvall ST16]to pellet cells. Supernatant was aspirated and cells resuspended in virus medium containing TPCK-trypsin [Sigma], 20 mM HEPES [Corning] and 50 mM NH₄Cl [Sigma] with or without 30 μM Cytochalasin D [Sigma] or 30 μM Nocodazole [Sigma] as indicated. Infected cell slurry was mixed with naïve MDCK WSN HA cells in a ratio of 1:1:2 of NL09 ΔHA Venus WT: NL09 ΔHA Scarlet VAR: Naïve MDCK WSN HA cells respectively and plated onto 6-well plates. Cells were allowed to attach at 37°C and supernatant was collected at indicated time points for analysis.

Conventional production of infectious virus with Cytochalasin D treatment

MDCK cells were infected with NL09 WT virus at a MOI of 25 PFU/cell, acid washed as described above to remove residual inoculum and incubated with or without 30 μM Cytochalasin D in virus medium containing TPCK-trypsin. Supernatant was collected at indicated time points for analysis.

Quantification of reassortment

Reassortment was quantified for coinfection supernatants as described previously [27]. Briefly, plaque assays were performed on MDCK WSN HA cells in 10cm dishes to isolate virus clones. Serological pipettes [1 ml] were used to collect agar plugs into 160 μl PBS. Using a ZR-96 viral RNA kit [Zymo], RNA was extracted from the agar plugs and eluted in 40 μl nuclease-free water [Invitrogen]. Reverse transcription was performed using Maxima reverse transcriptase [RT; ThermoFisher] according to the manufacturer’s protocol. The resulting cDNA was diluted 1:4 in nuclease-free water, each cDNA was combined with segment-specific primers [S1 Table] and Precision melt supermix[Bio-Rad] and analysed by qPCR using a CFX384 Touch real-time PCR detection system [Bio-Rad] designed to amplify a region of approximately 100 bp from each gene segment that contains a single nucleotide change in the VAR virus. The qPCR was followed by high-resolution melt analysis to differentiate the WT and VAR amplicons [27]. Precision Melt Analysis software [Bio-Rad] was used to determine the parental virus origin of each gene segment based on the melting properties of the cDNA fragments and comparison to WT and VAR controls. Each plaque was assigned a genotype based on the combination of WT and VAR genome segments, with two variants on each of seven segments allowing for 128 potential genotypes.

Supporting information

S1 Fig. IAV vRNPs associate with Rab11a within F-Actin rich TNTs in MDCK cells.

MDCK cells were mock-infected or infected with NL09 or P99 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [pink]. Scale bar is 20μm for all images.

(TIF)

Click here for additional data file.^{(269.6KB, tif)}

S2 Fig. IAV vRNPs associate with Rab11a within F-Actin rich TNTs in A549 WT cells.

A549 WT cells were mock-infected or infected with NL09 or P99 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [pink]. Scale bar is 20μm for all images.

(TIF)

Click here for additional data file.^{(249.2KB, tif)}

S3 Fig. IAV vRNPs associate with Rab11a within F-Actin rich TNTs in A549 Rab11a KO cells.

A549 Rab11a KO cells were mock-infected or infected with NL09 or P99 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [pink]. Scale bar is 20μm for all images.

(TIF)

Click here for additional data file.^{(225KB, tif)}

S1 Table. Sequence specific primers for High Resolution Melt Analysis.

Forward and Reverse primer sequences for all eight genome segments from NL09 [PB2, PB1, PA, HA, NP, NA, M and NS] are depicted in the table.

(XLSX)

Click here for additional data file.^{(11.2KB, xlsx)}

Acknowledgments

We thank Drs. Daniel Perez and Ryan Langlois for generous sharing of cell lines. We also thank the Emory University Integrated Cellular Imaging Microscopy Core for assistance in image acquisition. The content of this article is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This research project was supported in part by the Emory University Integrated Cellular Imaging Microscopy Core, supported by the Office of the Director, NIH (S10OD028673). The project was funded by NIH/NIAID Centers of Excellence in Influenza Research and Surveillance (CEIRS), contract number HHSN272201400004C (ACL; KG) and NIH R01AI127799 (ACL; KG). JH was partly supported by the NIH Molecular and Cellular Biology training program at The University of Chicago (T32GM007183); JH was partly supported by the NIH Diversity Supplement (R01AI123359- 02S1). BM is supported by NIAID grants (R01AI123359 and R01AI127775). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Noda T. Selective Genome Packaging Mechanisms of Influenza A Viruses. Cold Spring Harb Perspect Med. 2020; [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Eisfeld AJ, Kawakami E, Watanabe T, Neumann G, Kawaoka Y. RAB11A Is Essential for Transport of the Influenza Virus Genome to the Plasma Membrane. J Virol. 2011; doi: 10.1128/JVI.00378-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Amorim MJ. A comprehensive review on the interaction between the host GTPase Rab11 and influenza A virus [Internet]. Vol. 6, Frontiers in Cell and Developmental Biology. Frontiers Media S.A.; 2019. [cited 2021 Jun 9]. p. 176. Available from: www.frontiersin.org doi: 10.3389/fcell.2018.00176 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Weisz OA, Rodriguez-Boulan E. Apical trafficking in epithelial cells: Signals, clusters and motors. Journal of Cell Science. 2009. doi: 10.1242/jcs.032615 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Chen W, Feng Y, Chen D, Wandinger-Ness A. Rab11 is required for trans-Golgi network-to-plasma membrane transport and a preferential target for GDP dissociation inhibitor. Mol Biol Cell. 1998; doi: 10.1091/mbc.9.11.3241 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Nturibi E, Bhagwat AR, Coburn S, Myerburg MM, Lakdawala SS. Intracellular Colocalization of Influenza Viral RNA and Rab11A Is Dependent upon Microtubule Filaments. J Virol. 2017; doi: 10.1128/JVI.01179-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Bhagwat AR, Le Sage V, Nturibi E, Kulej K, Jones J, Guo M, et al. Quantitative live cell imaging reveals influenza virus manipulation of Rab11A transport through reduced dynein association. Nat Commun. 2020; doi: 10.1038/s41467-019-13838-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Amorim MJ, Bruce EA, Read EKC, Foeglein A, Mahen R, Stuart AD, et al. A Rab11- and Microtubule-Dependent Mechanism for Cytoplasmic Transport of Influenza A Virus Viral RNA. J Virol. 2011; doi: 10.1128/JVI.02606-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Bruce EA, Digard P, Stuart AD. The Rab11 Pathway Is Required for Influenza A Virus Budding and Filament Formation. J Virol. 2010; doi: 10.1128/JVI.00307-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.De Castro Martin IF, Fournier G, Sachse M, Pizarro-Cerda J, Risco C, Naffakh N. Influenza virus genome reaches the plasma membrane via a modified endoplasmic reticulum and Rab11-dependent vesicles. Nat Commun [Internet]. 2017. Dec 1 [cited 2021 Jun 9];8[1]:1–12. Available from: www.nature.com/naturecommunications doi: 10.1038/s41467-016-0009-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Alenquer M, Vale-Costa S, Etibor TA, Ferreira F, Sousa AL, Amorim MJ. Influenza A virus ribonucleoproteins form liquid organelles at endoplasmic reticulum exit sites. Nat Commun [Internet]. 2019. Dec 1 [cited 2021 Jun 9];10[1]:1–19. Available from: doi: 10.1038/s41467-018-07882-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Han J, Ganti K, Sali VK, Twigg C, Zhang Y, Manivasagam S, et al. Host factor Rab11a is critical for efficient assembly of influenza A virus genomic segments. PLOS Pathog [Internet]. 2021. May 10 [cited 2021 May 26];17[5]:e1009517. Available from: https://pubmed.ncbi.nlm.nih.gov/33970958/ doi: 10.1371/journal.ppat.1009517 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Austefjord MW, Gerdes HH, Wang X. Tunneling nanotubes: Diversity in morphology and structure. Commun Integr Biol. 2014; [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Gerdes HH, Carvalho RN. Intercellular transfer mediated by tunneling nanotubes. Current Opinion in Cell Biology. 2008. doi: 10.1016/j.ceb.2008.03.005 [DOI] [PubMed] [Google Scholar]
15.Abounit S, Zurzolo C. Wiring through tunneling nanotubes—from electrical signals to organelle transfer. J Cell Sci. 2012; doi: 10.1242/jcs.083279 [DOI] [PubMed] [Google Scholar]
16.Marzo L, Gousset K, Zurzolo C. Multifaceted roles of tunneling nanotubes in intercellular communication. Frontiers in Physiology. 2012. doi: 10.3389/fphys.2012.00072 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Hashimoto M, Bhuyan F, Hiyoshi M, Noyori O, Nasser H, Miyazaki M, et al. Potential Role of the Formation of Tunneling Nanotubes in HIV-1 Spread in Macrophages. J Immunol. 2016; doi: 10.4049/jimmunol.1500845 [DOI] [PubMed] [Google Scholar]
18.Bracq L, Xie M, Benichou S, Bouchet J. Mechanisms for cell-to-cell transmission of HIV-1. Frontiers in Immunology. 2018. doi: 10.3389/fimmu.2018.00260 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Eugenin E a, Gaskill PJ, Berman JW. A potential mechanism for intercellular HIV trafficking. Commun Integr Biol. 2009; [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Panasiuk M, Rychłowski M, Derewońko N, Bieńkowska-Szewczyk K. Tunneling Nanotubes as a Novel Route of Cell-to-Cell Spread of Herpesviruses. J Virol. 2018; doi: 10.1128/JVI.00090-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Kumar A, Kim JH, Ranjan P, Metcalfe MG, Cao W, Mishina M, et al. Influenza virus exploits tunneling nanotubes for cell-to-cell spread. Sci Rep. 2017; doi: 10.1038/srep40360 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Roberts KL, Manicassamy B, Lamb RA. Influenza A Virus Uses Intercellular Connections To Spread to Neighboring Cells. J Virol. 2015; doi: 10.1128/JVI.03306-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Momose F, Sekimoto T, Ohkura T, Jo S, Kawaguchi A, Nagata K, et al. Apical transport of influenza A virus ribonucleoprotein requires Rab11-positive recycling endosome. PLoS One. 2011; doi: 10.1371/journal.pone.0021123 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Avilov S V., Moisy D, Naffakh N, Cusack S. Influenza A virus progeny vRNP trafficking in live infected cells studied with the virus-encoded fluorescently tagged PB2 protein. Vaccine [Internet]. 2012. Dec 7 [cited 2021 Jun 25];30[51]:7411–7. Available from: https://pubmed.ncbi.nlm.nih.gov/23063830/ doi: 10.1016/j.vaccine.2012.09.077 [DOI] [PubMed] [Google Scholar]
25.Hell SW, Wichmann J. Breaking the diffraction resolution limit by stimulated emission: stimulated-emission-depletion fluorescence microscopy. Opt Lett [Internet]. 1994. Jun 1 [cited 2021 May 26];19[11]:780. Available from: https://pubmed.ncbi.nlm.nih.gov/19844443/ doi: 10.1364/ol.19.000780 [DOI] [PubMed] [Google Scholar]
26.Klar TA, Jakobs S, Dyba M, Egner A, Hell SW. Fluorescence microscopy with diffraction resolution barrier broken by stimulated emission. Proc Natl Acad Sci U S A [Internet]. 2000. Jul 18 [cited 2021 May 26];97[15]:8206–10. Available from: https://pubmed.ncbi.nlm.nih.gov/10899992/ doi: 10.1073/pnas.97.15.8206 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Marshall N, Priyamvada L, Ende Z, Steel J, Lowen AC. Influenza Virus Reassortment Occurs with High Frequency in the Absence of Segment Mismatch. PLoS Pathog. 2013; doi: 10.1371/journal.ppat.1003421 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Jansens RJJ, Tishchenko A, Favoreel HW. Bridging the Gap: Virus Long-Distance Spread via Tunneling Nanotubes. J Virol. 2020; doi: 10.1128/JVI.02120-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Kimura S, Hase K, Ohno H. Tunneling nanotubes: Emerging view of their molecular components and formation mechanisms. Exp Cell Res. 2012; doi: 10.1016/j.yexcr.2012.05.013 [DOI] [PubMed] [Google Scholar]
30.Zhu S, Bhat S, Syan S, Kuchitsu Y, Fukuda M, Zurzolo C. Rab11a-Rab8a cascade regulates the formation of tunneling nanotubes through vesicle recycling. J Cell Sci. 2018; doi: 10.1242/jcs.215889 [DOI] [PubMed] [Google Scholar]
31.Kimura S, Hase K, Ohno H. The molecular basis of induction and formation of tunneling nanotubes. Cell and Tissue Research. 2013. [DOI] [PubMed] [Google Scholar]
32.Lou E, Fujisawa S, Morozov A, Barlas A, Romin Y, Dogan Y, et al. Tunneling nanotubes provide a unique conduit for intercellular transfer of cellular contents in human malignant pleural mesothelioma. PLoS One [Internet]. 2012. Mar 9 [cited 2021 Jun 16];7[3]:33093. Available from: www.plosone.org doi: 10.1371/journal.pone.0033093 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Fonville JM, Marshall N, Tao H, Steel J, Lowen AC. Influenza Virus Reassortment Is Enhanced by Semi-infectious Particles but Can Be Suppressed by Defective Interfering Particles. PLoS Pathog. 2015; doi: 10.1371/journal.ppat.1005204 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Jacobs NT, Onuoha NO, Antia A, Steel J, Antia R, Lowen AC. Incomplete influenza A virus genomes occur frequently but are readily complemented during localized viral spread. Nat Commun. 2019; doi: 10.1038/s41467-019-11428-x [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Phipps KL, Ganti K, Jacobs NT, Lee CY, Carnaccini S, White MC, et al. Collective interactions augment influenza A virus replication in a host-dependent manner. Nat Microbiol. 2020; [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Crystal RG, Randell SH, Engelhardt JF, Voynow J, Sunday ME. Airway epithelial cells: Current concepts and challenges. In: Proceedings of the American Thoracic Societ y [Internet]. American Thoracic Society; 2008. [cited 2021 Jun 17]. p. 772–7. Available from: /pmc/articles/PMC5820806/ [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Naphade S, Sharma J, Gaide Chevronnay HP, Shook MA, Yeagy BA, Rocca CJ, et al. Brief reports: Lysosomal cross-correction by hematopoietic stem cell-derived macrophages via tunneling nanotubes. Stem Cells [Internet]. 2015. Jan 1 [cited 2021 Jun 17];33[1]:301–9. Available from: https://pubmed.ncbi.nlm.nih.gov/25186209/ doi: 10.1002/stem.1835 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Jackson M V., Morrison TJ, Doherty DF, McAuley DF, Matthay MA, Kissenpfennig A, et al. Mitochondrial Transfer via Tunneling Nanotubes is an Important Mechanism by Which Mesenchymal Stem Cells Enhance Macrophage Phagocytosis in the In Vitro and In Vivo Models of ARDS. Stem Cells [Internet]. 2016. Aug 1 [cited 2021 Jun 17];34[8]:2210–23. Available from: https://pubmed.ncbi.nlm.nih.gov/27059413/ doi: 10.1002/stem.2372 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Campana S, De Pasquale C, Carrega P, Ferlazzo G, Bonaccorsi I. Cross-dressing: An alternative mechanism for antigen presentation [Internet]. Vol. 168, Immunology Letters. Elsevier B.V.; 2015. [cited 2021 Jun 17]. p. 349–54. Available from: https://pubmed.ncbi.nlm.nih.gov/26551033/ doi: 10.1016/j.imlet.2015.11.002 [DOI] [PubMed] [Google Scholar]
40.Xu W, Santini PA, Sullivan JS, He B, Shan M, Ball SC, et al. HIV-1 evades virus-specific IgG2 and IgA responses by targeting systemic and intestinal B cells via long-range intercellular conduits. Nat Immunol [Internet]. 2009. [cited 2021 Jun 17];10[9]:1008–17. Available from: https://pubmed.ncbi.nlm.nih.gov/19648924/ doi: 10.1038/ni.1753 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Kongsomros S, Manopwisedjaroen S, Chaopreecha J, Wang SF, Borwornpinyo S, Thitithanyanont A. Rapid and efficient cell-to-cell transmission of avian influenza h5n1 virus in mdck cells is achieved by trogocytosis. Pathogens [Internet]. 2021. Apr 16 [cited 2021 Jun 28];10[4]:483. Available from: doi: 10.3390/pathogens10040483 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Najjar F El, Cifuentes-Muñoz N, Chen J, Zhu H, Buchholz UJ, Moncman CL, et al. Human metapneumovirus Induces Reorganization of the Actin Cytoskeleton for Direct Cell-to-Cell Spread. PLOS Pathog [Internet]. 2016. Sep 1 [cited 2021 Aug 13];12[9]:e1005922. Available from: https://journals.plos.org/plospathogens/article?id = 10.1371/journal.ppat.1005922 doi: 10.1371/journal.ppat.1005922 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Singh BK, Hornick AL, Krishnamurthy S, Locke AC, Mendoza CA, Mateo M, et al. The Nectin-4/Afadin Protein Complex and Intercellular Membrane Pores Contribute to Rapid Spread of Measles Virus in Primary Human Airway Epithelia. J Virol [Internet]. 2015. Jul 15 [cited 2021 Aug 13];89[14]:7089–96. Available from: doi: 10.1128/JVI.00821-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Singh BK, Li N, Mark AC, Mateo M, Cattaneo R, Sinn PL. Cell-to-Cell Contact and Nectin-4 Govern Spread of Measles Virus from Primary Human Myeloid Cells to Primary Human Airway Epithelial Cells. J Virol. 2016Aug;90[15]:6808–17. doi: 10.1128/JVI.00266-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Gallagher ME, Brooke CB, Ke R, Koelle K. Causes and consequences of spatial within-host viral spread. Viruses. 2018. doi: 10.3390/v10110627 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Han J, Perez JT, Chen C, Andrade J, Manicassamy B, Han J, et al. Genome-wide CRISPR / Cas9 Screen Identifies Host Factors Essential for Influenza Virus Replication. Cell Rep. 2018;23[2]:596–607. doi: 10.1016/j.celrep.2018.03.045 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Neumann G, Watanabe T, Ito H, Watanabe S, Goto H, Gao P, et al. Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A. 1999; doi: 10.1073/pnas.96.16.9345 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Cox RS, Dunlop MJ, Elowitz MB. A synthetic three-color scaffold for monitoring genetic regulation and noise. J Biol Eng. 2010; doi: 10.1186/1754-1611-4-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Bindels DS, Haarbosch L, Van Weeren L, Postma M, Wiese KE, Mastop M, et al. MScarlet: A bright monomeric red fluorescent protein for cellular imaging. Nat Methods. 2016; doi: 10.1038/nmeth.4074 [DOI] [PubMed] [Google Scholar]
50.White MC, Steel J, Lowen AC. Heterologous Packaging Signals on Segment 4, but Not Segment 6 or Segment 8, Limit Influenza A Virus Reassortment. J Virol. 2017; doi: 10.1128/JVI.00195-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Phipps KL, Marshall N, Tao H, Danzy S, Onuoha N, Steel J, et al. Seasonal H3N2 and 2009 Pandemic H1N1 Influenza A Viruses Reassort Efficiently but Produce Attenuated Progeny. J Virol. 2017; doi: 10.1128/JVI.00830-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem. 2003; doi: 10.1373/49.6.853 [DOI] [PubMed] [Google Scholar]
53.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: An open-source platform for biological-image analysis. Nature Methods. 2012. doi: 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Manders EMM, Visser AE, Koppen A, De Leeuw WC, Van Liere R, Brakenhoff GJ, et al. Four-dimensional imaging of chromatin dynamics during the assembly of the interphase nucleus. Chromosom Res [Internet]. 2003. [cited 2021 Jun 11];11[5]:537–47. Available from: https://pubmed.ncbi.nlm.nih.gov/12971728/ doi: 10.1023/a:1024995215340 [DOI] [PubMed] [Google Scholar]
55.Costes S V., Daelemans D, Cho EH, Dobbin Z, Pavlakis G, Lockett S. Automatic and quantitative measurement of protein-protein colocalization in live cells. Biophys J [Internet]. 2004. [cited 2021 Jun 11];86[6]:3993–4003. Available from: https://pubmed.ncbi.nlm.nih.gov/15189895/ doi: 10.1529/biophysj.103.038422 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Bolte S, Cordelières FP. A guided tour into subcellular colocalization analysis in light microscopy [Internet]. Vol. 224, Journal of Microscopy. Blackwell Publishing Ltd; 2006. [cited 2021 Jun 11]. p. 213–32. Available from: https://onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2818.2006.01706.x [DOI] [PubMed] [Google Scholar]
57.Motulsky H. Analyzing Data with GraphPad Prism. PRism. 1999. [Google Scholar]

PLoS Pathog. doi: 10.1371/journal.ppat.1009321.r001

Decision Letter 0

Carolina B Lopez, Meike Dittmann

14 Feb 2021

Dear Dr Ganti,

Thank you very much for submitting your manuscript "Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes." for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

The proposed model Rab11a-mediated cell-to-cell spread via nanotubes is a novel and exciting mechanism for influenza A virus dissemination. However, all three reviewers had significant reservations as to whether the experiments used in this study fully support this model. I therefore have to ask for major revisions. Additional work needs to include the major points voiced by reviewers, with a focus on: 1. enhancing image quality and quantify imaging data, 2. discussing limitations of experimental systems and alternative explanations of findings, 3. addressing specific comments as to additional control experiments voiced by reviewer 1 and 3. Although experiments in air-liquid interface as requested by reviewer 2 would be nice, I acknowledge that these experiments would also be experimentally challenging. Thus, I recommend clearly discussing the limitations of A549 or other monolayer cultures used in this study.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Meike Dittmann, Ph.D.

Associate Editor

PLOS Pathogens

Carolina Lopez

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

The proposed model Rab11a-mediated cell-to-cell spread via nanotubes is a novel and exciting mechanism for influenza A virus dissemination. However, all three reviewers had significant reservations as to whether the experiments used in this study fully support this model. I therefore have to ask for major revisions. Additional work needs to include the major points voiced by reviewers, with a focus on: 1. enhancing image quality and quantify imaging data, 2. better discussion of limitations of experimental systems and alternative explanations of findings, 3. specific comments as to additional control experiments voiced by reviewer 1 and 3. Although experiments in air-liquid interface would be nice, I acknowledge that these experiments would also be experimentally challenging. Thus, I recommend clearly discussing the limitations of A549 or other monolayer cultures used in this study.

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: In the present manuscript, Ganti et al. extend previous observations that IAV can spread through TNTs to include a role for Rab11a (already known to facilitate RNP trafficking to the plasma membrane) in mediating genome transport directly between cells.

The authors have established and effectively utilized several very nice experimental systems to dissect viral spread through TNTs, including HA-deficient reporter viruses harboring genetic tags (paired with an HA-expressing ‘recipient’ cells) and Rab11a KO cells. Still, the paper is heavily based on selected images, lacks discussion of the literature on Rab11a’s role in TNT formation and trafficking in other contexts, and fails to present convincing data that Rab11a mediates bidirectional transport of viral genomes, weakening their overall conclusions. Overall, tempering their conclusions and improving analysis by enhancing image quality and/or pairing their microscopy with more quantitative approaches would improve the paper.

Reviewer #2: In the manuscript entitled, “Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes”, the authors address whether tunneling nanotubes (TNTs) facilitate an alternative cell-spread mechanism during influenza infection. Using primarily static imaging techniques, Rab11A knockout cells, mutant viruses, and drug treatments the authors conclude that Rab11a transports NP (presumably viral RNP complexes – although viral RNA was not specifically visualized), through TNTs to neighboring cells. The author cleverly utilize an HA-deficient viruses, which cannot undergo secondary infection through a receptor-mediated process, to control for HA-dependent spread between cells. Capitalizing on the VAR virus strategy from the Lowen lab, the authors observe a reduction in reassortment events infected Rab11a KO cells compared to WT cells in a coinfection experiment, which is the most exciting result of this paper but unfortunately is not followed up.

The use of TNTs in influenza assembly is an exciting concept. Unfortunately, this study falls short of conclusively demonstrating that TNTs are used for transport of vRNP. The following experiments are suggested to provide a stronger foundation for which to conclude that TNTs are involved.

Reviewer #3: This study by Ganti et al. extends previous work showing that influenza virus uses intercellular nanotubes for cell-to-cell spread of their segmented genome (in the form of viral ribonucleoproteins or vRNPs), by investigating to what extent the host GTPase Rab11 is involved in this process. The experimental approach is innovative in two respect : i) HA-deficient reporter viruses were used, that are unable to produce of infectious progeny virions at the plasma membrane (instead of antibodies or drugs interfering with secondary infection in previous studies), and ii) genetically tagged viruses were used to investigate the potential of TNTs to mediate genetic mixing and reassortment.

The findings are novel and will be of interest for readers in the field. In particular, the observed difference between Rab11+ and Rab11-KO cells in richness of viral genotypes produced in a TNT-dependent experimental setting, is in favor of a role of Rab11 in TNT-mediated spread of influenza viruses. However to fully support the conclusions and model proposed by the authors, some experiments need to be strengthened with additional quantifications and/or controls.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: 1) The authors comment on colocalization of Rab11a with NP inside TNTs in Fig 1, yet this is very difficult to discern from the images provided. NP appears to fill the entire cytosol. Higher magnification / better resolution of the TNTs in these images would be helpful. Also, colocalization analysis would strengthen their argument (e.g. does 100% of NP within TNTs colocalize with Rab11a?). Note that one of the images in the main figure for the KO cells appears to be duplicated in the supplemental figure (S1C).

2) As no characterization of the KO cells is provided beyond the lack of Rab11a staining in IF images, a rescue experiment would provide confirmation that the phenotype (loss of foci formation) is indeed specific for Rab11a.

3) The authors suggest that the production of infectious virus in Fig 4C could be due to the action of Rab11a from the HA-expressing recipient cells. To support this, they coculture A549 cells expressing Rab11a-mCherry with IAV-infected Rab11a KO cells and note that they “observe colocalization of Rab11a and NP in the Rab KO cells, indicating the transfer of mCherry Rab11a to the infected cells.” How do we know that this is Rab11a-mCherry in KO cells and not NP transfer to Rab-mCherry expressing cells? Overall these data are not sufficient to support the conclusion that TNTs allow bidirectional movement and that Rab11a from uninfected cells can essentially grab RNPs from their neighbors.

4) Based on their data showing low efficiency, it seems unlikely that all 8 segments are routinely transported from cell-cell (at least in this system). Indeed, the authors state in the conclusion that “…indicates that vRNPs may be trafficked individually or as subgroups and not as a constellation of 8 segments”. Thus, do the authors think this is a true driver of virus spread and means to evade immune detection? How do the authors think TNTs play a role in infection in the airway? Is this likely between airway cells and other cells types? More discussion on this topic is warranted to better understand the relevance of these findings during natural infection especially since the cell lines and culture conditions used do not recapitulate the tightly packed, polarized epithelial cells in vivo.

5) At line 222, the authors speculate that fewer TNT connections may underlie the fact that fewer reassortant viruses are observed when Rab11a is absent from infected donor cells. This argument could be bolstered by quantitation of these connections, and/or citing the literature on this topic (e.g. DOI: 10.1242/jcs.215889 ; DOI: 10.1038/cddis.2016.441). If mutation of either in Rab11a or PB2 to prevent the direct interaction is possible, it may provide a means to decouple the role of Rab11a in TNT formation (indirect) vs. RNP trafficking (direct). At the moment, it seems assumed that Rab11a is responsible for RNP trafficking through the TNTs based on a similar role for Rab11a in bringing RNPs to the site of assembly and the images in Fig 1 (see point #1 above)).

Reviewer #2: Additional Experiments:

1. Examine cell-to-cell spread through TNTs in differentiated airways cells at an air liquid interface. The studies presented are restricted to A549 cells sparsely seeded on the coverslip to create the extended filaments between the cells. However, in the airway cells are densely packed together with TNTs are found through tight junctions between cells; thus, a physiologically relevant system should be used to complement the studies presented.

2. Image TNTs and the cargo (NP and vRNP) within them using super-resolution or electron microscopy to confirm that they are within the tube and not traveling along the outside of the plasma membrane.

3. Examine the role of microtubules on HA-independent cell-to-cell spread. The authors focus on the use of F-actin in TNTs and use Cytochalsin D (actin depolymerization durg) to examine cell-to-cell spread. However, the authors should include a microtubule depolymerization treatment as a control to ensure that the impact on cell-to-cell spread is dependent upon actin and not just on the disruption of cytoskeletal trafficking.

Other Major Concerns:

1. Details on image acquisition and analysis are missing. It is unclear if authors used computational or manual image analysis pipelines. What were the thresholds used for the analysis etc. It is difficult to interpret the data without these details.

2. The authors ignore many caveats to the experimental setup and alternative entry pathways, such as:

a. Rab11a has a multitude of roles in intercellular membrane trafficking of cellular and viral components. Presumably, the canonical pathway of IAV assembly would have been disrupted in the knockout system many steps upstream of vRNPs reaching the TNTs.

b. Depolymerization of actin drastically impacts cell morphology that could impact trafficking of vRNP.

c. There may be other strategies of cell-to-cell spread that are HA-independent in addition to TNTs.

d. The experiments leading to the conclusion of bidirectional Rab11A should be done with live cell imaging, since in the current model the Rab11A-mCherry cells could be infected with virus produced in the Rab11A KO cells.

3. In addition, the viral titers in Fig 4C, suggest to this reviewer that Rab11A is unnecessary for influenza assembly. It is surprising that the authors conclude that viral replication between the WT and KO cells was significantly different when less than a 0.5 log10 decrease was observed. The authors need to resolve why Rab11A would be necessary for vRNP TNT spread and endocytic-based assembly pathways, but not dramatically impact viral titers.

Reviewer #3: Figure 1. In addition to representative images, quantitative data should be provided to to convincingly support the authors' conclusions: how many TNTs were observed in each conditions ? what were the proportions of NP+ Rab11+, NP+ Rab11- and NP-Rab11+ TNTs ?

From a mechanistic perspective it would also be of interest to clarify the following points: in mock-infected cells, were TNTs positive for Rab11 staining, i.e. are Rab11-positive vesicles naturally trafficking through TNTs ? was the average number of TNTs per cell enhanced upon viral infection as described previously by Roberts et al (ref # xx) ? was the average number of TNTs per cell modified by Rab11 KO ?

Finally, it would be preferable to state that infected cells show TNTs that are positive for both Rab11 and NP staining, as the imaging resolution is not sufficient to demonstrate colocalisation of the two proteins, and therefore does not allow to conclude that “vRNPs associate with Rab11a” within TNTs (line 95), although this association is likely.

Figure 4. As high MOIs are used for the initial infection and low infectious titers (~10e3-10e4 PFU/ml) are detected in the supernatant of the coculture, it is important to check that there is no residual infectivity upon acid wash. The percentages of Venus-positive and Scarlet-positive cells in the coculture should be provided to allow a thorough interpretation of the data showed in Figure 4 and Figure 6.

Figure 5. Figure 5 does not convincingly demonstrate that Rab11 transfer from non-infected cells to infected cells could account for TNT-dependent cell-to-cell spread in the experiment shown in Figure 4B. In DMSO cells, could NP+ mCherryRab11+ TNTs be observed ? if yes, was the presence of NP in the TNTs strictly dependent upon the presence of mCherry-Rab11 ? if no, can NP+ mCherryRab11+ TNTs be observed at later time-points ?

To further confirm the author’s hypothesis of Rab11 transfer from non-infected cells to infected cells, the experiment shown in Figure 4B should be performed using MDCK-WSN-HA cells depleted in Rab11a, eg pre-treated with siRNAs targeting Rab11a.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: 1) Figure 6 would benefit from additional labeling within the figure itself

2) Line 58 should be either “comprises eight RNA” or “is composed of”

3) Line 97 seems to be missing a reference after the first sentence of the results “Upon nuclear exit…”

4) Line 144 should read “shown in Figure 3”

Reviewer #2: 1. All images presented in this manuscript are small include a wide field of view. They would benefit from zoomed-in insets of regions of interests, highlighted interactions within the tunneling nanotubes, and a scale bar needs to be added.

2. Line 144 – missing “in” before “figure 3, this is…”.

3. Fig. 6 lacks the “A” and “B” subpanel labels mentioned in the text.

Reviewer #3: Figure 2 and 3. The effects of cytochalasin or Rab11-KO are quite striking, in that they suppress the increase in foci number over time. However the authors should show a baseline i.e. the same counts at an earlier time point such as 4-6 hpi, to demonstrate that the ~50 foci detected in the presence of cytochalasin or Rab11-KO were most likely formed during the initial infection round. It would also be interesting to show analysis of the same experiments with a higher threshold of ≥3 cells instead of ≥ 2 cells per foci.

Figure legends. Indications regarding MOI and time-point should be provided in the main text and/or legend figure for each experiment. Line 534 and line 540, the number of independent experiments should be indicated. Line 549 : whether the three replicates are technical or biological replicates should be clarified.

In the introduction, line 60-68. When referring to the role of Rab11 in the trafficking of newly synthesized vRNPs, the recent review by M Amorim (PMID 30687703) should be cited in addition to ref #2. Recent mechanistic insights into the transport of Rab11-vRNP complexes provided by the studies of Alenquer et al (PMID 30967547) and de Castro Martin et al (PMID 29123131) should be cited in addition to ref #5-8.

Line 96. Appropriate references (PMID 21307188 and 23063830) should be cited to support the notion that vRNPs bind to Rab11 via PB2.

Line 248. The manuscript provides no evidence that loss of Rab11a leads to a more “dispersed NP localisation within the cytoplasm”. The sentence should be rephrased.

Line 51. The manuscript provides no evidence that “complexes of Rab11a and viral components can be trafficked” across tunelling nanotubes. loss of Rab11a leads to a more “dispersed NP localisation within the cytoplasm”. The sentence should be rephrased.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see http://journals.plos.org/plospathogens/s/submission-guidelines#loc-materials-and-methods

PLoS Pathog. 2021 Sep 2;17(9):e1009321. doi: 10.1371/journal.ppat.1009321.r002

Author response to Decision Letter 0

29 Jun 2021

Attachment

Submitted filename: Responses to Reviewers.docx

Click here for additional data file.^{(44.9KB, docx)}

PLoS Pathog. doi: 10.1371/journal.ppat.1009321.r003

Decision Letter 1

Carolina B Lopez, Meike Dittmann

9 Aug 2021

Dear Dr Ganti,

Thank you very much for submitting your manuscript "Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes." for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic and found this revision 1 much improved from the original submission. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations, with no additional experiments needed.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Meike Dittmann, Ph.D.

Associate Editor

PLOS Pathogens

Carolina Lopez

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

All three reviewers found this revision much improved from the original submission. Therefore, I recommend minor revision with no additional experiments needed.

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: The authors have submitted a revised version of their study which suggests Rab11a mediates vRNP transport through TNTs to promote cell-cell spread and genome reassortment. Overall, the incorporation of new data (including high resolution microscopy of NP+/Rab11a+ TNTs and colocalization analysis) has improved the manuscript and strengthened their conclusions.

Notably, the data in Figure 6 are still not definitive proof that these TNTs are bidirectional. (The image provided suggests Rab11a is actually not required for vRNPs to enter TNTs. Furthermore, we cannot know which direction the NP+/Rab11a+ puncta are going from a still image.) Live cell imaging would really be needed to address this hypothesis. However, the authors are careful in their discussion of these findings (e.g. lines 312-316), thus, I am satisfied with their updated approach.

Reviewer #2: In the revised manuscript entitled, “Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes”, the authors have addressed many of the original concerns by including super resolution microscopy and quantitation of Rab11a and NP colocalization. The authors now conclusively demonstrate that in A549 cells the TNT are formed that contain both Rab11a and IAV NP. The use of HA-deficient viruses with a co-culture system of wt and HA-expressing cells reveals a strong role for actin in HA-independent spread of the virus. As mentioned in the original review one of the most compelling observations is that the reduction in reassortment events infected Rab11a KO cells compared to WT cells with the VAR and WT coinfection studies.

The authors have improved upon the first version of this manuscript and modification of the discussion, figures, methods and some conclusions are requested to avoid over-interpretation of the results.

Reviewer #3: In the revised version of the manuscript, the authors have adressed most of the concerns raised by the reviewers. A few points should still be improved.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: -The cells in Figure 2A should be labeled as Rab11a KO in the figure for clarity

-Line 157 – I believe the authors mean Venus-positive cells as these are HA deleted viruses here.

Reviewer #2: 1. Since tight junctions could function similarly to TNT in differentiated airways and other viruses (hMPV and measles viruses – see work by Dutch Lab and Cattaneo Lab) have been shown to travel cell-cell through these sort of connections it is feasible IAV would as well. Inclusion of this point in paragraph starting on line 334 would be nice.

2. STED imaging comments:

a. Was there any correction for chromatic aberration?

b. What was considered in “close proximity”? An image resolution of 30 nm can provide a more precise quantification for colocalization between Rab11a and NP is possible in an unbiases computational manner (rather than manual counting).

c. Was a 30nm resolution confirmed for your specific images and setup? If not – please provide the limit of resolution

d. In Fig 2 and 6 the resolution of the high resolution images is still pixelated when zoomed in. Please consider making the zoomed images larger so that the power of the STED images can be revealed.

3. Fig 1 – no scale bars is included. The legend of the cells is inaccurate. The resolution and image size makes it difficult to assess colocalization.

4. Fig 2 – what is the time point of infection? Was the mander’s colocalization coefficient used only on TNT region of interest? Please include that detail in the methods. Also, was the coefficient derived from a single slice or an 3D volume of the cell? Please include these details in the methods.

5. Fig 6 – include the number of independent replicates for this study. What was the time post infection. The Rab11a signal is interested since it is present in the cytoplasm of the KO cell as well. Please comment on whether the same staining procedures, imaging parameters and pixel intensities are consistent between this data set and the STED images in Fig 2 of Rab11a KO cells.

6. Please note that STED images do not indicate direct interaction. The examination of PB2 and Rab11a direct interaction is most convincingly shown in Avilov et al – using bi-fluorescence complementation assay with split GFP on PB2 and Rab11a. Consider modifying line 122.

Reviewer #3: In the absence of live imaging data, the authors’ claim that they find evidence for bidirectional movement of Rab11 through TNTs (e.g line 226, lines 276-277) should be attenuated. The experiment shown in Figure 6 does not prove bi-directionality. The only argument for bidirectionality is the production of viral progeny when A549-Rab11KO cells are co-cultured with MDCK-HA cells (Figure 5E), however it is a very indirect argument. Therefore bidirectionality may be referred to as likely, but not certain.

Line 221: it should be clarified “with a marginal difference in titers at 48 and 72 hpi ”, as the difference in titers between A549-WT and A549-Rab11KO cells is not marginal at 24 hpi.

Figure 2 : the inclusion of STED imaging and quantification data represent a significant improvement. However the confocal and STED images shown in Figure 2A are very pixelated, and higher quality images should be provided (the same comment applies to Figure 6). The labeling of the right panel of Figure 2A should state « Rab11a-KO ».

In Figure 2B, does it really make sense to quantify the co-localisation of NP with Rab11 in Rab11-KO cells ?

In the introduction, lines 65-71: the notion that an intact microtubule network is important for the transport of vRNP should be tempered, as several pulbications have reported only a modest decrease of the production of infectious viruses upon treatment with nocodazole. The authors themselves, in Figure 5D of the present manuscript, show no effect (or even a positive effect) of nocodazole treatment on the productious of infectious viruses.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

PLoS Pathog. 2021 Sep 2;17(9):e1009321. doi: 10.1371/journal.ppat.1009321.r004

Author response to Decision Letter 1

16 Aug 2021

Attachment

Submitted filename: Response to Reviewer comments-2.docx

Click here for additional data file.^{(28.3KB, docx)}

PLoS Pathog. doi: 10.1371/journal.ppat.1009321.r005

Decision Letter 2

Carolina B Lopez, Meike Dittmann

22 Aug 2021

Dear Dr Ganti,

We are pleased to inform you that your manuscript 'Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes.' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Meike Dittmann, Ph.D.

Associate Editor

PLOS Pathogens

Carolina Lopez

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

PLoS Pathog. doi: 10.1371/journal.ppat.1009321.r006

Acceptance letter

Carolina B Lopez, Meike Dittmann

27 Aug 2021

Dear Dr Ganti,

We are delighted to inform you that your manuscript, "Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes.," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. IAV vRNPs associate with Rab11a within F-Actin rich TNTs in MDCK cells.

MDCK cells were mock-infected or infected with NL09 or P99 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [pink]. Scale bar is 20μm for all images.

(TIF)

Click here for additional data file.^{(269.6KB, tif)}

S2 Fig. IAV vRNPs associate with Rab11a within F-Actin rich TNTs in A549 WT cells.

A549 WT cells were mock-infected or infected with NL09 or P99 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [pink]. Scale bar is 20μm for all images.

(TIF)

Click here for additional data file.^{(249.2KB, tif)}

S3 Fig. IAV vRNPs associate with Rab11a within F-Actin rich TNTs in A549 Rab11a KO cells.

A549 Rab11a KO cells were mock-infected or infected with NL09 or P99 viruses. Cells were stained for DAPI [blue], NP [red], Rab11a [green] and F-Actin [pink]. Scale bar is 20μm for all images.

(TIF)

Click here for additional data file.^{(225KB, tif)}

S1 Table. Sequence specific primers for High Resolution Melt Analysis.

Forward and Reverse primer sequences for all eight genome segments from NL09 [PB2, PB1, PA, HA, NP, NA, M and NS] are depicted in the table.

(XLSX)

Click here for additional data file.^{(11.2KB, xlsx)}

Attachment

Submitted filename: Responses to Reviewers.docx

Click here for additional data file.^{(44.9KB, docx)}

Attachment

Submitted filename: Response to Reviewer comments-2.docx

Click here for additional data file.^{(28.3KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[ppat.1009321.ref001] 1.Noda T. Selective Genome Packaging Mechanisms of Influenza A Viruses. Cold Spring Harb Perspect Med. 2020; [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref002] 2.Eisfeld AJ, Kawakami E, Watanabe T, Neumann G, Kawaoka Y. RAB11A Is Essential for Transport of the Influenza Virus Genome to the Plasma Membrane. J Virol. 2011; doi: 10.1128/JVI.00378-11 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref003] 3.Amorim MJ. A comprehensive review on the interaction between the host GTPase Rab11 and influenza A virus [Internet]. Vol. 6, Frontiers in Cell and Developmental Biology. Frontiers Media S.A.; 2019. [cited 2021 Jun 9]. p. 176. Available from: www.frontiersin.org doi: 10.3389/fcell.2018.00176 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref004] 4.Weisz OA, Rodriguez-Boulan E. Apical trafficking in epithelial cells: Signals, clusters and motors. Journal of Cell Science. 2009. doi: 10.1242/jcs.032615 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref005] 5.Chen W, Feng Y, Chen D, Wandinger-Ness A. Rab11 is required for trans-Golgi network-to-plasma membrane transport and a preferential target for GDP dissociation inhibitor. Mol Biol Cell. 1998; doi: 10.1091/mbc.9.11.3241 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref006] 6.Nturibi E, Bhagwat AR, Coburn S, Myerburg MM, Lakdawala SS. Intracellular Colocalization of Influenza Viral RNA and Rab11A Is Dependent upon Microtubule Filaments. J Virol. 2017; doi: 10.1128/JVI.01179-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref007] 7.Bhagwat AR, Le Sage V, Nturibi E, Kulej K, Jones J, Guo M, et al. Quantitative live cell imaging reveals influenza virus manipulation of Rab11A transport through reduced dynein association. Nat Commun. 2020; doi: 10.1038/s41467-019-13838-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref008] 8.Amorim MJ, Bruce EA, Read EKC, Foeglein A, Mahen R, Stuart AD, et al. A Rab11- and Microtubule-Dependent Mechanism for Cytoplasmic Transport of Influenza A Virus Viral RNA. J Virol. 2011; doi: 10.1128/JVI.02606-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref009] 9.Bruce EA, Digard P, Stuart AD. The Rab11 Pathway Is Required for Influenza A Virus Budding and Filament Formation. J Virol. 2010; doi: 10.1128/JVI.00307-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref010] 10.De Castro Martin IF, Fournier G, Sachse M, Pizarro-Cerda J, Risco C, Naffakh N. Influenza virus genome reaches the plasma membrane via a modified endoplasmic reticulum and Rab11-dependent vesicles. Nat Commun [Internet]. 2017. Dec 1 [cited 2021 Jun 9];8[1]:1–12. Available from: www.nature.com/naturecommunications doi: 10.1038/s41467-016-0009-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref011] 11.Alenquer M, Vale-Costa S, Etibor TA, Ferreira F, Sousa AL, Amorim MJ. Influenza A virus ribonucleoproteins form liquid organelles at endoplasmic reticulum exit sites. Nat Commun [Internet]. 2019. Dec 1 [cited 2021 Jun 9];10[1]:1–19. Available from: doi: 10.1038/s41467-018-07882-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref012] 12.Han J, Ganti K, Sali VK, Twigg C, Zhang Y, Manivasagam S, et al. Host factor Rab11a is critical for efficient assembly of influenza A virus genomic segments. PLOS Pathog [Internet]. 2021. May 10 [cited 2021 May 26];17[5]:e1009517. Available from: https://pubmed.ncbi.nlm.nih.gov/33970958/ doi: 10.1371/journal.ppat.1009517 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref013] 13.Austefjord MW, Gerdes HH, Wang X. Tunneling nanotubes: Diversity in morphology and structure. Commun Integr Biol. 2014; [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref014] 14.Gerdes HH, Carvalho RN. Intercellular transfer mediated by tunneling nanotubes. Current Opinion in Cell Biology. 2008. doi: 10.1016/j.ceb.2008.03.005 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref015] 15.Abounit S, Zurzolo C. Wiring through tunneling nanotubes—from electrical signals to organelle transfer. J Cell Sci. 2012; doi: 10.1242/jcs.083279 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref016] 16.Marzo L, Gousset K, Zurzolo C. Multifaceted roles of tunneling nanotubes in intercellular communication. Frontiers in Physiology. 2012. doi: 10.3389/fphys.2012.00072 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref017] 17.Hashimoto M, Bhuyan F, Hiyoshi M, Noyori O, Nasser H, Miyazaki M, et al. Potential Role of the Formation of Tunneling Nanotubes in HIV-1 Spread in Macrophages. J Immunol. 2016; doi: 10.4049/jimmunol.1500845 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref018] 18.Bracq L, Xie M, Benichou S, Bouchet J. Mechanisms for cell-to-cell transmission of HIV-1. Frontiers in Immunology. 2018. doi: 10.3389/fimmu.2018.00260 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref019] 19.Eugenin E a, Gaskill PJ, Berman JW. A potential mechanism for intercellular HIV trafficking. Commun Integr Biol. 2009; [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref020] 20.Panasiuk M, Rychłowski M, Derewońko N, Bieńkowska-Szewczyk K. Tunneling Nanotubes as a Novel Route of Cell-to-Cell Spread of Herpesviruses. J Virol. 2018; doi: 10.1128/JVI.00090-18 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref021] 21.Kumar A, Kim JH, Ranjan P, Metcalfe MG, Cao W, Mishina M, et al. Influenza virus exploits tunneling nanotubes for cell-to-cell spread. Sci Rep. 2017; doi: 10.1038/srep40360 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref022] 22.Roberts KL, Manicassamy B, Lamb RA. Influenza A Virus Uses Intercellular Connections To Spread to Neighboring Cells. J Virol. 2015; doi: 10.1128/JVI.03306-14 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref023] 23.Momose F, Sekimoto T, Ohkura T, Jo S, Kawaguchi A, Nagata K, et al. Apical transport of influenza A virus ribonucleoprotein requires Rab11-positive recycling endosome. PLoS One. 2011; doi: 10.1371/journal.pone.0021123 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref024] 24.Avilov S V., Moisy D, Naffakh N, Cusack S. Influenza A virus progeny vRNP trafficking in live infected cells studied with the virus-encoded fluorescently tagged PB2 protein. Vaccine [Internet]. 2012. Dec 7 [cited 2021 Jun 25];30[51]:7411–7. Available from: https://pubmed.ncbi.nlm.nih.gov/23063830/ doi: 10.1016/j.vaccine.2012.09.077 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref025] 25.Hell SW, Wichmann J. Breaking the diffraction resolution limit by stimulated emission: stimulated-emission-depletion fluorescence microscopy. Opt Lett [Internet]. 1994. Jun 1 [cited 2021 May 26];19[11]:780. Available from: https://pubmed.ncbi.nlm.nih.gov/19844443/ doi: 10.1364/ol.19.000780 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref026] 26.Klar TA, Jakobs S, Dyba M, Egner A, Hell SW. Fluorescence microscopy with diffraction resolution barrier broken by stimulated emission. Proc Natl Acad Sci U S A [Internet]. 2000. Jul 18 [cited 2021 May 26];97[15]:8206–10. Available from: https://pubmed.ncbi.nlm.nih.gov/10899992/ doi: 10.1073/pnas.97.15.8206 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref027] 27.Marshall N, Priyamvada L, Ende Z, Steel J, Lowen AC. Influenza Virus Reassortment Occurs with High Frequency in the Absence of Segment Mismatch. PLoS Pathog. 2013; doi: 10.1371/journal.ppat.1003421 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref028] 28.Jansens RJJ, Tishchenko A, Favoreel HW. Bridging the Gap: Virus Long-Distance Spread via Tunneling Nanotubes. J Virol. 2020; doi: 10.1128/JVI.02120-19 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref029] 29.Kimura S, Hase K, Ohno H. Tunneling nanotubes: Emerging view of their molecular components and formation mechanisms. Exp Cell Res. 2012; doi: 10.1016/j.yexcr.2012.05.013 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref030] 30.Zhu S, Bhat S, Syan S, Kuchitsu Y, Fukuda M, Zurzolo C. Rab11a-Rab8a cascade regulates the formation of tunneling nanotubes through vesicle recycling. J Cell Sci. 2018; doi: 10.1242/jcs.215889 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref031] 31.Kimura S, Hase K, Ohno H. The molecular basis of induction and formation of tunneling nanotubes. Cell and Tissue Research. 2013. [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref032] 32.Lou E, Fujisawa S, Morozov A, Barlas A, Romin Y, Dogan Y, et al. Tunneling nanotubes provide a unique conduit for intercellular transfer of cellular contents in human malignant pleural mesothelioma. PLoS One [Internet]. 2012. Mar 9 [cited 2021 Jun 16];7[3]:33093. Available from: www.plosone.org doi: 10.1371/journal.pone.0033093 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref033] 33.Fonville JM, Marshall N, Tao H, Steel J, Lowen AC. Influenza Virus Reassortment Is Enhanced by Semi-infectious Particles but Can Be Suppressed by Defective Interfering Particles. PLoS Pathog. 2015; doi: 10.1371/journal.ppat.1005204 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref034] 34.Jacobs NT, Onuoha NO, Antia A, Steel J, Antia R, Lowen AC. Incomplete influenza A virus genomes occur frequently but are readily complemented during localized viral spread. Nat Commun. 2019; doi: 10.1038/s41467-019-11428-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref035] 35.Phipps KL, Ganti K, Jacobs NT, Lee CY, Carnaccini S, White MC, et al. Collective interactions augment influenza A virus replication in a host-dependent manner. Nat Microbiol. 2020; [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref036] 36.Crystal RG, Randell SH, Engelhardt JF, Voynow J, Sunday ME. Airway epithelial cells: Current concepts and challenges. In: Proceedings of the American Thoracic Societ y [Internet]. American Thoracic Society; 2008. [cited 2021 Jun 17]. p. 772–7. Available from: /pmc/articles/PMC5820806/ [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref037] 37.Naphade S, Sharma J, Gaide Chevronnay HP, Shook MA, Yeagy BA, Rocca CJ, et al. Brief reports: Lysosomal cross-correction by hematopoietic stem cell-derived macrophages via tunneling nanotubes. Stem Cells [Internet]. 2015. Jan 1 [cited 2021 Jun 17];33[1]:301–9. Available from: https://pubmed.ncbi.nlm.nih.gov/25186209/ doi: 10.1002/stem.1835 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref038] 38.Jackson M V., Morrison TJ, Doherty DF, McAuley DF, Matthay MA, Kissenpfennig A, et al. Mitochondrial Transfer via Tunneling Nanotubes is an Important Mechanism by Which Mesenchymal Stem Cells Enhance Macrophage Phagocytosis in the In Vitro and In Vivo Models of ARDS. Stem Cells [Internet]. 2016. Aug 1 [cited 2021 Jun 17];34[8]:2210–23. Available from: https://pubmed.ncbi.nlm.nih.gov/27059413/ doi: 10.1002/stem.2372 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref039] 39.Campana S, De Pasquale C, Carrega P, Ferlazzo G, Bonaccorsi I. Cross-dressing: An alternative mechanism for antigen presentation [Internet]. Vol. 168, Immunology Letters. Elsevier B.V.; 2015. [cited 2021 Jun 17]. p. 349–54. Available from: https://pubmed.ncbi.nlm.nih.gov/26551033/ doi: 10.1016/j.imlet.2015.11.002 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref040] 40.Xu W, Santini PA, Sullivan JS, He B, Shan M, Ball SC, et al. HIV-1 evades virus-specific IgG2 and IgA responses by targeting systemic and intestinal B cells via long-range intercellular conduits. Nat Immunol [Internet]. 2009. [cited 2021 Jun 17];10[9]:1008–17. Available from: https://pubmed.ncbi.nlm.nih.gov/19648924/ doi: 10.1038/ni.1753 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref041] 41.Kongsomros S, Manopwisedjaroen S, Chaopreecha J, Wang SF, Borwornpinyo S, Thitithanyanont A. Rapid and efficient cell-to-cell transmission of avian influenza h5n1 virus in mdck cells is achieved by trogocytosis. Pathogens [Internet]. 2021. Apr 16 [cited 2021 Jun 28];10[4]:483. Available from: doi: 10.3390/pathogens10040483 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref042] 42.Najjar F El, Cifuentes-Muñoz N, Chen J, Zhu H, Buchholz UJ, Moncman CL, et al. Human metapneumovirus Induces Reorganization of the Actin Cytoskeleton for Direct Cell-to-Cell Spread. PLOS Pathog [Internet]. 2016. Sep 1 [cited 2021 Aug 13];12[9]:e1005922. Available from: https://journals.plos.org/plospathogens/article?id = 10.1371/journal.ppat.1005922 doi: 10.1371/journal.ppat.1005922 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref043] 43.Singh BK, Hornick AL, Krishnamurthy S, Locke AC, Mendoza CA, Mateo M, et al. The Nectin-4/Afadin Protein Complex and Intercellular Membrane Pores Contribute to Rapid Spread of Measles Virus in Primary Human Airway Epithelia. J Virol [Internet]. 2015. Jul 15 [cited 2021 Aug 13];89[14]:7089–96. Available from: doi: 10.1128/JVI.00821-15 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref044] 44.Singh BK, Li N, Mark AC, Mateo M, Cattaneo R, Sinn PL. Cell-to-Cell Contact and Nectin-4 Govern Spread of Measles Virus from Primary Human Myeloid Cells to Primary Human Airway Epithelial Cells. J Virol. 2016Aug;90[15]:6808–17. doi: 10.1128/JVI.00266-16 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref045] 45.Gallagher ME, Brooke CB, Ke R, Koelle K. Causes and consequences of spatial within-host viral spread. Viruses. 2018. doi: 10.3390/v10110627 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref046] 46.Han J, Perez JT, Chen C, Andrade J, Manicassamy B, Han J, et al. Genome-wide CRISPR / Cas9 Screen Identifies Host Factors Essential for Influenza Virus Replication. Cell Rep. 2018;23[2]:596–607. doi: 10.1016/j.celrep.2018.03.045 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref047] 47.Neumann G, Watanabe T, Ito H, Watanabe S, Goto H, Gao P, et al. Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A. 1999; doi: 10.1073/pnas.96.16.9345 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref048] 48.Cox RS, Dunlop MJ, Elowitz MB. A synthetic three-color scaffold for monitoring genetic regulation and noise. J Biol Eng. 2010; doi: 10.1186/1754-1611-4-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref049] 49.Bindels DS, Haarbosch L, Van Weeren L, Postma M, Wiese KE, Mastop M, et al. MScarlet: A bright monomeric red fluorescent protein for cellular imaging. Nat Methods. 2016; doi: 10.1038/nmeth.4074 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref050] 50.White MC, Steel J, Lowen AC. Heterologous Packaging Signals on Segment 4, but Not Segment 6 or Segment 8, Limit Influenza A Virus Reassortment. J Virol. 2017; doi: 10.1128/JVI.00195-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref051] 51.Phipps KL, Marshall N, Tao H, Danzy S, Onuoha N, Steel J, et al. Seasonal H3N2 and 2009 Pandemic H1N1 Influenza A Viruses Reassort Efficiently but Produce Attenuated Progeny. J Virol. 2017; doi: 10.1128/JVI.00830-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref052] 52.Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem. 2003; doi: 10.1373/49.6.853 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref053] 53.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: An open-source platform for biological-image analysis. Nature Methods. 2012. doi: 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref054] 54.Manders EMM, Visser AE, Koppen A, De Leeuw WC, Van Liere R, Brakenhoff GJ, et al. Four-dimensional imaging of chromatin dynamics during the assembly of the interphase nucleus. Chromosom Res [Internet]. 2003. [cited 2021 Jun 11];11[5]:537–47. Available from: https://pubmed.ncbi.nlm.nih.gov/12971728/ doi: 10.1023/a:1024995215340 [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref055] 55.Costes S V., Daelemans D, Cho EH, Dobbin Z, Pavlakis G, Lockett S. Automatic and quantitative measurement of protein-protein colocalization in live cells. Biophys J [Internet]. 2004. [cited 2021 Jun 11];86[6]:3993–4003. Available from: https://pubmed.ncbi.nlm.nih.gov/15189895/ doi: 10.1529/biophysj.103.038422 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009321.ref056] 56.Bolte S, Cordelières FP. A guided tour into subcellular colocalization analysis in light microscopy [Internet]. Vol. 224, Journal of Microscopy. Blackwell Publishing Ltd; 2006. [cited 2021 Jun 11]. p. 213–32. Available from: https://onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2818.2006.01706.x [DOI] [PubMed] [Google Scholar]

[ppat.1009321.ref057] 57.Motulsky H. Analyzing Data with GraphPad Prism. PRism. 1999. [Google Scholar]

PERMALINK

Rab11a mediates cell-cell spread and reassortment of influenza A virus genomes via tunneling nanotubes

Ketaki Ganti

Julianna Han

Balaji Manicassamy

Anice C Lowen

Roles

Abstract

Author summary

Introduction

Results

IAV vRNPs associate with Rab11a within F-Actin rich TNTs

Fig 1. IAV vRNPs associate with Rab11a in F-Actin rich TNTs.

Fig 2. IAV vRNPs co-localize with Rab11a within TNTs.

Rab11a does not modulate TNT formation

Fig 3. Rab11a does not modulate TNT formation.

Disruption of actin or loss of Rab11a significantly attenuates direct cell-cell transmission of infection

Fig 4. Disruption of actin or loss of Rab11a abrogates direct cell-cell transmission of infection.

Virion-independent genome transfer leads to productive infection by an actin-dependent mechanism

Fig 5. Virion-independent genome transfer leads to productive infection by an actin-dependent mechanism.

TNTs likely allow bidirectional shuttling of Rab11a between cells

Fig 6. TNTs allow for bidirectional shuttling of Rab11a between cells.

TNTs serve as conduits for genome mixing and reassortment

Fig 7. TNTs serve as conduits for genome mixing and reassortment in a Rab11a dependent manner.

Discussion

Fig 8. Working model for Rab11a mediated vRNP transport across TNTs.

Materials and methods

Cells and cell culture media

Generation of Rab11aKO cells

Viruses

Immunofluorescence and confocal imaging

Immunofluorescence and high-resolution STED imaging

Quantification of co-localization

Quantification of cell-cell transmission

Co-culture for production of infectious virus

Conventional production of infectious virus with Cytochalasin D treatment

Quantification of reassortment

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Carolina B Lopez

Meike Dittmann

Roles

Author response to Decision Letter 0

Decision Letter 1

Carolina B Lopez

Meike Dittmann

Roles

Author response to Decision Letter 1

Decision Letter 2

Carolina B Lopez

Meike Dittmann

Roles

Acceptance letter

Carolina B Lopez

Meike Dittmann

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases