Skip to main content
Microbial Biotechnology logoLink to Microbial Biotechnology
. 2021 Jul 26;14(5):2176–2186. doi: 10.1111/1751-7915.13900

A newly developed PCR‐based method revealed distinct Fusobacterium nucleatum subspecies infection patterns in colorectal cancer

Dexi Bi 1, , Yin Zhu 2, , Yaohui Gao 1, Hao Li 2, Xingchen Zhu 1, Rong Wei 1, Ruting Xie 1, Qing Wei 1,*,, Huanlong Qin 2,**,
PMCID: PMC8449656  PMID: 34309194

Summary

Fusobacterium nucleatum, which has four subspecies (nucleatum, animalis, vincentii and polymorphum), plays an important role in promoting colorectal cancer (CRC). However, as there is no efficient method of differentiating these subspecies in the context of a rich gut microbiota, the compositions in CRC remain largely unknown. In this study, a PCR‐based differentiation method enabling profiling of Fnucleatum infection in CRC at the subspecies level was developed. Based on the analysis of 53 Fnucleatum genomes, we identified genetic markers specific to each subspecies and designed primers for the conserved sequences of those markers. The PCR performance of the primers was tested with Fnucleatum and non‐nucleatum Fusobacterium strains, and complete consistence with taxonomy was achieved. Additionally, no non‐specific amplification occurred when using human DNA. The method was then applied to faecal (n = 58) and fresh‐frozen tumour tissue (n = 100) samples from CRC patients, and wide heterogeneity in Fnucleatum subspecies compositions in the gut microbiota among CRC patients was observed. Single‐subspecies colonization was common, whereas coexistence of four subspecies was rare. Subspecies animalis was most prevalent, while nucleatum was not frequently detected. The results of this study contribute to our understanding of the pathogenicity of Fnucleatum at the subspecies level and the method developed has potential for clinical and epidemiological use.

Keywords: Fusobacterium nucleatum, colorectal cancer, genomics, subspecies classification, microbiota

Introduction

Fusobacterium nucleatum has long been recognized as an opportunistic oral pathogen. However, knowledge about its pathogenicity is being updated, as emerging evidence has uncovered that it is also involved in a wide range of diseases, especially colorectal cancer (CRC), in humans (Brennan and Garrett, 2019, Lopez, et al., 2020). Fnucleatum is a commensal of the oral cavity and a key causative agent of oral diseases such as periodontitis (Roques, et al., 2000). Furthermore, it acts as a bridging microbe that can coaggregate other pathogens, such as Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans (Kolenbrander, et al., 2010). With high invasiveness and a tendency towards translocation, Fnucleatum can also induce extraoral infections, such as those involved in preterm birth and pregnancy complications (Han, 2015). More importantly, recent studies have demonstrated that Fnucleatum infection is not only prevalent in but also has a close association with CRC (Brennan and Garrett, 2019), emphasizing the urgent need for continued research into its exact roles and clinical relevance in this malignant disease.

Fnucleatum has well‐recognized genotypic and phenotypic heterogeneity (Thurnheer, et al., 1999; Strauss, et al., 2008). Sequencing‐facilitated phylogenetic studies have greatly advanced the taxonomy of Fnucleatum, which currently includes four subspecies: nucleatum, animalis, vincentii and polymorphum (Mira, et al., 2004; Strauss, et al., 2008; Kim, et al., 2010; Kook, et al., 2017, Brennan and Garrett, 2019). It should be noted that vincentii and the formerly proposed fusiforme are now considered as one subspecies (Kim, et al., 2010, Kook, et al., 2013). These subspecies display relatively high genetic divergence (Kook, et al., 2017), with possible variable phenotypic patterns in growth (Chew, et al., 2012), habitat preference (Thurnheer, et al., 2019) and pathogenicity (Kurgan, et al., 2017). Subspecies nucleatum is mostly found in periodontal diseases, and animalis and polymorphum are often associated with extraoral infectious diseases; in contrast, vincentii is usually considered as a commensal of the healthy oral flora (Han and Wang, 2013). The different subspecies also display distinct biofilm behaviours (Thurnheer, et al., 2019) and can differentially modulate neutrophil function (Kurgan, et al., 2017). Moreover, a recent study suggested that the subspecies animalis might be prevalent in CRC tissues and influence proinflammatory cytokine expression and monocyte activation (Ye, et al., 2017). However, the pathogenic effects and oncogenic mechanisms of particular subspecies in CRC are mostly unknown, and it remains unclear whether these subspecies have different levels of pathogenicity and/or play different roles in CRC. Hence, accurate classification of Fnucleatum subspecies could be of great importance, as it will help to further reveal pathogenic Fnucleatum members, establish precise etiological relationships with CRC and other associated diseases and ultimately benefit clinical practice and epidemiological investigation.

To date, various efforts to differentiate Fnucleatum subspecies have been made. Matrix‐assisted laser desorption ionization‐time of flight mass spectrometry (MALDI‐TOF MS) has been employed for subspecies identification, and among 34 Fnucleatum clinical isolates, it performed accurately for 28 (82%) but misclassified or failed to classify the remaining isolates (Nie, et al., 2015). An arbitrarily primed PCR (AP‐PCR) method has also been developed to subtype Fnucleatum, but it was designed for isolate comparison rather than subspecies typing (George, et al., 1997). In addition, both of the above methods require successful isolation prior to use and cannot be applied directly to microbiota‐containing samples such as faeces and tumour tissues from CRC patients. Although 16S rRNA gene amplicon sequencing and metagenomic sequencing are frequently used for microbiota profiling, neither has achieved subspecies‐level resolution for Fnucleatum (He, et al., 2021, Yeoh, et al., 2020). A 16S rRNA gene‐targeted sequencing method determining the V2‐V4 region was also used to identify specific Fnucleatum subspecies in CRC tumour specimens, but with the requirement of multistep PCR, sequencing and complex analysis (Ye, et al., 2017). Additionally, Fnucleatum shows extensive 16S rRNA genes conservation (Mira, et al., 2004; Kim, et al., 2010), and a short partial region would hardly provide a clear resolution (He, et al., 2021). Accordingly, there is still a lack of genotyping methods to accurately and intuitively differentiate Fnucleatum subspecies.

By taking advantage of large‐scale comparative genomics, this study has identified subspecies‐specific genetic markers and subsequently developed a PCR‐based typing assay that allows easy differentiation of Fnucleatum subspecies in CRC.

Results

Large‐scale comparative genomic analysis identified subspecies‐specific markers inFnucleatum

The genomes of 54 unique Fnucleatum strains from the NCBI genome database were used in this study (Table S1). Whole‐genome phylogenetic analysis was performed to ensure correct subspecies assignment. The strains formed five clades in the phylogenetic tree: four corresponded well to the subspecies nucleatum, animalis, vincentii and polymorphum, but one showed a distant relationship to these four clades and constituted only strain W1481 (Fig 1). It has been suggested that strain W1481 does not belong to Fnucleatum (Ang, et al., 2016), and it was thus excluded from subsequent analysis and reassigned as Fusobacterium sp. W1481. The 53 Fnucleatum strains, including 6 subsp. nucleatum, 17 subsp. animalis, 10 subsp. vincentii and 20 subsp. polymorphum, were evaluated by comparative analysis to search for specific regions (SRs) that can act as subspecies markers. Genes or non‐coding sequences occurring in all genomes of one subspecies but completely absent in other subspecies and in non‐Fnucleatum organisms were selected as SRs. Six (designated SR‐n1 to SR‐n6) and three (designated SR‐a1 to SR‐a3) genes were found to be specific to the subspecies nucleatum and animalis respectively (Fig 2). We did not find any subsp. vincentii‐specific genes, but instead identified two intergenic regions (IGRs) specific to this subspecies (designated SR‐v1 and SR‐v2) (Fig 2). With regard to subspecies polymorphum, we were unable to obtain any specific gene or IGR that could independently cover all its members. However, we detected three genes (designated SR‐p1 to SR‐p3) specific to different subsets of subsp. polymorphum strains that could be used in combination (SR‐p1 + SR‐p2 or SR‐1 + SR‐p3) to achieve full‐member coverage (Fig 2). Importantly, inter‐ and intrasubspecies comparisons showed that the identified markers (or marker combinations) exhibited strict subspecies specificity, with highly conserved sequences (with 87.6%‐100% identities to reference strains; median: 99.2%) (Fig 2). Homologs of these markers were not found in other organisms, as examined in the NCBI nucleotide database. There was only one exception: SR‐v2 exhibits 100% identity with Fusobacterium sp. oral taxon 203. Note that for intersubspecies comparison and wider comparison involving other organisms, somewhat homologous hits were inevitable when non‐strict parameters were used, but they showed only limited identity and/or coverage.

Fig 1.

Fig 1

Phylogenetic tree of sequenced Fusobacterium nucleatum genomes. A total of 54 genomes were analysed. The tree was generated by using kSNP3 with the maximum likelihood algorithm. The strain formerly known as Fnucleatum W1481 was reassigned as Fusobacterium sp. W1481 and excluded for subsequent investigation.

Fig 2.

Fig 2

Distribution of the identified subspecies markers in sequenced Fusobacterium nucleatum genomes. The occurrence and nucleotide‐level conservation of the identified subspecies markers are shown as a heatmap. Marker names are listed on the left of the heatmap. SR‐n, SR‐a, SR‐v and SR‐p denote regions specific to subsp. nucleatum, animalis, vincentii and polymorphum respectively. For markers that are genes, corresponding reference locus tags are given in brackets. The ‘IGR’ identifiers for SR‐v1 and SR‐v2 indicate that they are in intergenic regions (reference regions: HMPREF0946_02001HMPREF0946_02000 for SR‐v1 and HMPREF0946_01002HMPREF0946_01003 for SR‐v2). Strain names are listed under the heatmap. A colour gradient was employed to visualise the nucleotide identity between the reference sequences and their counterparts. ND, not detected.

Development of a PCR‐based assay for robustFnucleatum subspecies differentiation

Universal primers were designed for the identified markers within their consensus or near‐consensus regions (Table 1). For practical use, all primers had similar Tms, and the theoretical amplicon sizes were 100 bp–400 bp (mostly <300 bp). The performance of the designed primers was assessed using Fnucleatum strains spanning the four subspecies and strains of other Fusobacterium species, including Fhwasookii, Fmortiferum, Fperiodonticum and Fvarium. Remarkably, the amplification results were exactly in accord with the taxonomy of these strains (Fig 3). For subspecies nucleatum, animalis and vincentii markers, each primer set resulted in amplification for its target subspecies of a clear single band at the expected position. For markers of subspecies polymorphum, we obtained positive amplification for SR‐p1 and SR‐p3, but not SR‐p2 with the strains used, which was not unexpected, as we have shown that these markers could not independently cover the entire subspecies. The results for combinations SR‐p1 + SR‐p2 (expected as being positive for either SR‐p1 or SR‐p2 or both) and SR‐p1 + SR‐p3 (positive for either SR‐p1 or SR‐p3 or both) matched well with this subspecies. None of the designed primers yielded amplification with strains of other subspecies or other Fusobacterium species or human DNA. In addition, we examined the primer set (Fn‐F/R) (Castellarin, et al., 2012; Mima, et al., 2015) widely used for Fnucleatum detection in these strains, and it also produced bright bands when using Fhwasookii and Fperiodonticum. Indeed, sequence analysis revealed that its target sequence is not strictly specific to Fnucleatum and is found in Fhwasookii, Fperiodonticum and Fusobacterium pseudoperiodonticum (Fig S1).

TABLE 1.

Primers designed to differentiate Fusobacterium nucleatum subspecies.

Subspecies Marker Primers Sequences (5’ to 3’) Amplicon size (bp)
nucleatum SR‐n1 N1‐F GAGATGGAAGTACAAAACAAATTACAGTAG 196
N1‐R TCTTGGACATCAACATCATAAACAGA
SR‐n2 N2‐F GAGTTACAACTTCCTATATTTGACCGA 285
N2‐R CAAACATTTTGATAATTCATCTGCAT
SR‐n3 N3‐F CAAGCAACTGAAAATGCTTTAAAAG 216
N3‐R TCCAGGTAAGGAAATTACACCTACTG
SR‐n4 N4‐F GGGAGCTACATTTTTCCTACTCTTCC 183
N4‐R TCTATCTACACCTTCAGCAGCCTTT
SR‐n5 N5‐F AAACTTACTGTCTATCCCTATGCTTTAA 241
N5‐R CTTTATTCAAGTAGGGTTCTATCCATAAT
SR‐n6 N6‐F GATAGACAACGAAGAGAAAGAGAAGCT 107
N6‐R GTATCCTCATTCCATACAAAGACTGC
animalis SR‐a1 A1‐F TTGGTTTYAGTTGGACAATGCTCTT 189
A1‐R CATCTGCTGGTTTATARCCCTGT
SR‐a2 A2‐F ACTCAAATTATTATGAATGTGATGAAAGA 125
A2‐R GCTACTGAAGGATGAAATGCTGG
SR‐a3 A3‐F TTTYTTTATCCTGTTGTTTATGTGATTAA 224
A3‐R ACAATTTCTAYATTGYCAATATATGAGATT
vincentii SR‐v1 V1‐F GAGGCTATTGCAAATTAAACTGTTAAA 124
V1‐R CTTTACCACTATTATAAACTAAATAAATGAGAC
SR‐v2 V2‐F GGCAARYASAAGATAGGGCA 118
V2‐R GAACTRTCAACATTCCTAAARCAACCA
polymorphum SR‐p1 P1‐F TTAGGAAATCTTTTAGAAGCAAAAACA 134
P1‐R TCTACTGTAATAGTTACAAACTCTGCWCC
SR‐p2 P2‐F TKGCTTTCACTTCTTGTTCATTGTT 102
P2‐R TAGCYAYYCTTTTTTGTGCTCTTGT
SR‐p3 P3‐F CYTATGGYTTTGATTTTGACTTATTTG 375
P3‐R CCAAAGTAATTAAAGCCTCTTGAGC

Fig 3.

Fig 3

Subspecies differentiation performance of the designed primers in Fusobacterium nucleatum strains. Strain names and species information are listed on the top. Primers used for amplification are given in brackets. Strains of other Fusobacterium species were also tested.

Fnucleatum subspecies detection in the gut microbiota of colorectal cancer (CRC) patients

With the developed method, we profiled the subspecies composition of Fnucleatum in the gut microbiota of CRC patients. One representative primer set or set combination was used for each subspecies according to the performance in bacterial strains (Fig 3). Both faeces (n = 58) and fresh‐frozen tumour tissues (n = 100) were evaluated (Figs 4 and 5). All positive amplifications yielded a single band at the expected position, and a non‐specific band was rarely observed. Interestingly, we found diverse Fnucleatum subspecies composition patterns across the samples (Figs 4A and 5A), varying in types and numbers of colonized subspecies. Fnucleatum was detected in 31 (53.5%) faecal and 50 (50.0%) tumour samples. Among them, colonization by one subspecies was mostly observed (14 faeces and 31 tumours); colonization by two subspecies was also common (12 faeces and 14 tumours), whereas colonization by three or four subspecies was detected only in a limited number of samples (5 faeces and 5 tumours). Moreover, the four subspecies showed distinct detection rates, and their distribution patterns were similar in the two types of samples (Figs 4B and 5B). Detected in 37.9% of faeces and 30.0% of tumours, animalis was consistently the most prevalent subspecies, followed by polymorphum and vincentii; nucleatum had the lowest detection rates (6.9% and 7.0% in faeces and tumours respectively). In addition, we again found that the primer set Fn‐F/R lacked sufficient specificity, resulting in amplification when using samples negative for subspecies‐specific primers (Figs 4 and 5).

Fig 4.

Fig 4

Fusobacterium nucleatum subspecies detection in faeces from colorectal cancer (CRC) patients. (A) Detection result in faeces from 58 CRC patients. Primers used for amplification are given in brackets. V6‐mix refers to the mixture of five primers targeting the V6 region of the 16S rRNA gene. (B) Detection rates of Fnucleatum and its subspecies with the designed primers (black histograms) and that resulting from Fn‐F/R primers (grey histogram).

Fig 5.

Fig 5

Fusobacterium nucleatum subspecies detection in tumour tissues from colorectal cancer (CRC) patients. (A) Detection results in fresh‐frozen tumour tissues from 100 CRC patients. Primers used for amplification are given in brackets. V6‐mix refers to the mixture of five primers targeting the V6 region of the 16S rRNA gene. (B) Detection rates of Fnucleatum and its subspecies with the designed primers (black histograms) and that resulting from Fn‐F/R primers (grey histogram).

Discussion

In this study, we developed a PCR‐based method to discriminate Fnucleatum subspecies by probing subspecies‐specific genetic markers, and with this method, we uncovered that the gut microbiota of CRC patients shows heterogeneous Fnucleatum subspecies patterns.

We obtained fourteen subspecies‐specific markers for Fnucleatum, including twelve genes and two IGRs. Among the genes, four are predicted to encode a transcriptional regulator and enzymes likely participating in metabolism; eight have unknown functions (Table 2). These genes might be involved in biological behaviours that are exclusive to the corresponding subspecies. Nevertheless, the intersubspecies difference cannot be explained only by these markers, as genome‐wide nucleotide variations are predominant (Kook, et al., 2017). Additionally, other undiscovered subspecies‐specific genetic markers may exist, as our analysis included unfinished genomes. We next designed primers targeting the identified markers and tested them on Fusobacterium strains. All primer sets exhibited satisfactory performance. The results indicated that for subspecies nucleatum, animalis and vincentii markers, each primer set can be independently used to probe its targeted subspecies; conversely, combined sets should be used for markers of subsp. Polymorphum. Given that we have not yet obtained positive amplification with P2‐F/R, the combination P1‐F/R + P3‐F/R (for SR‐p1 + SR‐p3) is recommended.

TABLE 2.

Annotation of the subspecies marker genes.

Marker Representative gene Product
SR‐n1 C7Y58_07315 Hypothetical protein
SR‐n2 C7Y58_06070 LysR family transcriptional regulator
SR‐n3 C7Y58_06085 RidA family protein
SR‐n4 C7Y58_06080 Pyridoxal phosphate‐dependent aminotransferase
SR‐n5 C7Y58_05110 Hypothetical protein
SR‐n6 C7Y58_08045 Hypothetical protein
SR‐a1 FSDG_01049 Hypothetical protein
SR‐a2 FSDG_01299 M20/M25/M40 family metallo‐hydrolase
SR‐a3 FSDG_00906 Hypothetical protein
SR‐p1 EII28_03630 Hypothetical protein
SR‐p2 EII28_07115 Hypothetical protein
SR‐p3 EII28_10930 Hypothetical protein

Note: SR‐v1 and SR‐v2 are not listed because they are in intergenic regions.

In samples such as faeces and tumour tissues from CRC patients, isolation of Fnucleatum is tedious due to the complex and rich commensal microbiota context and lack of highly selective medium (Gur, et al., 2015; Komiya, et al., 2019; Abed, et al., 2020). Therefore, the implementation of isolate‐based classification approaches for such samples can hardly be achieved in clinical practice. Moreover, the sequencing techniques currently applied to microbiota‐containing samples have not yet achieved sufficient resolution to distinguish Fnucleatum subspecies (He, et al., 2021, Yeoh, et al., 2020). The widely used Fn‐F/R primers (Castellarin, et al., 2012; Mima, et al., 2015) are only able to detect Fnucleatum at the species level, and we also found that they are not strictly specific to this species. In this study, we adopted a stringent strategy to ensure that the markers identified and corresponding primer sets have strict specificity as they were cross‐compared against not only the Fnucleatum genomes but also the sequences of other organisms in the public database, making it possible to implement our method for both Fnucleatum isolates and microbiota‐containing samples. Indeed, the primers resulted in no amplification in human DNA and did not produce non‐specific bands when using faecal or tissue samples.

Fnucleatum is known to play an important role in promoting CRC, but studies at the subspecies level are scarce (Ye, et al., 2017; Richardson, et al., 2020), partly due to the lack of an efficient approach to clearly identify Fnucleatum subspecies in the gut microbiota. Remarkably, our method provided a well‐resolved view of the composition of Fnucleatum subspecies in CRC. Given the heterogeneity within Fnucleatum, it is worth exploring whether composition diversity has an impact on the pathogenesis of CRC and whether it can be linked to tumour heterogeneity. Notably, subspecies animalis was most prevalent in the gut of CRC patents, whereas nucleatum, which has been extensively used as a model organism (such as its ATCC 25586 and ATCC 23726 strains) in CRC studies, actually had a much lower prevalence than the other subspecies, suggesting the necessity of comparing the pathogenicity of different subspecies and choosing more representative model organisms in future CRC studies. Furthermore, Fnucleatum subspecies determination might contribute to strain‐level studies, as it may help to narrow down the taxonomic range of pathogenic strains. In addition, there were significant variations in the detection rate of Fnucleatum among CRC patients across studies, owing to not only the regional and ethnic differences but also the different primers used targeting either Fusobacterium spp. or specifically Fnucleatum (Lee, et al., 2019). Therefore, the degree to which Fnucleatum potentiates tumorigenesis still requires in‐depth investigation. Our method can be implemented using various types of specimens to further elucidate the distribution and clinical relevance of Fnucleatum at the subspecies level in large clinical and epidemiological studies with increased credibility of detection.

To our knowledge, a genotyping method for Fnucleatum subspecies classification, such as ours, has not been developed to date. Compared with MALDI‐TOF MS, this method can be easily implemented because it does not require special equipment (Singhal, et al., 2015). However, due to the limited resources of isolates, further assays using more Fnucleatum strains are needed to validate the performance of this method. In addition, the current procedure requires separate PCRs for each primer set, leading to increased consumption of the DNA template and repetitive labour. Further studies should explore the feasibility of multiplex PCR based on these markers.

Experimental procedures

Ethics

This study was approved by the Ethics Committee of Shanghai Tenth People’s Hospital (No. SHSY‐IEC‐4.1/20‐85/01). Written consent was obtained from each participant.

Genomic data

A total of 68 Fnucleatum genomes were retrieved from the NCBI database (ftp://ftp.ncbi.nih.gov/genomes/). Duplicated genomes, unannotated genomes or those not meeting the RefSeq criteria were excluded. After selection, 54 unique genomes, including 14 complete and 40 draft genomes, were included for analysis (Table S1). The phylogeny of those genomes was analysed with kSNP3 (Gardner, et al., 2015).

Bacterial strains

Fnucleatum subsp. nucleatum ATCC 25586 and ATCC 23726 were purchased commercially. Nineteen Fusobacterium strains previously isolated from freshly resected tumour tissues of CRC cancer patients were also used, including four Fnucleatum subsp. animalis (THCT5A4, THCT6B3, THCT7A2 and THCT5A5), two Fnucleatum subsp. polymorphum (THCT7E2 and THCT15E1), two Fnucleatum subsp. vincentii (THCT14A3 and THCT14B3), one Fusobacterium hwasookii (THCT14E2), one Fusobacterium mortiferum (THCT6B2), one Fusobacterium periodonticum (THCT18E1) and eight Fvarium strains (THCT1E1, THCT1E2, THCT4E2, THCT4E4, THCT13E1, THCT23E1, THCT23B1 and THCT23E3). The bacteria were cultivated on Columbia agar supplemented with 5% sheep blood (Comagal Microbial).

Clinical specimens

Faecal (n = 58) or fresh‐frozen tumour tissue (n = 100) samples were collected from 158 newly diagnosed primary CRC patients (aged >18 years) at Shanghai Tenth People's Hospital between March 2017 and January 2020. The samples were retrieved from the Biobank of Shanghai Tenth People's Hospital. The faecal samples had been collected upon admission. Patients who had received antibiotics or probiotics within one month prior to sample collection were excluded.

Identification of subspecies‐specific markers and primer design

Fnucleatum genomes were subject to pangenome analysis with PGAP to sort homologous genes into clusters with the GeneFamily method (Zhao, et al., 2012). Gene clusters occurring in all genomes of one subspecies but completely absent in other subspecies were selected. The genes in the selected clusters were then aligned with all the genomes to verify whether they are actually specific to a subspecies, as distantly related but still homologous genes defined in different clusters by PGAP or degenerated homologous non‐coding sequences not included for PGAP analysis may exist in other subspecies. The selected clusters were also compared against the NCBI nucleotide database to exclude those with homologous sequences in non‐ Fnucleatum organisms. Clusters having genes with truncation or disruption were also excluded. The clusters ultimately included were defined as subspecies‐specific markers. For subspecies with no gene cluster meeting the above criteria, markers were similarly searched for in intergenic regions. If both strategies failed, gene clusters specific to a subspecies but not occurring in all its genomes were selected as markers to use in combination to cover all subspecies members. For each defined marker, multiple sequence alignment of its allelic sequences was performed with MUSCLE (Edgar, 2004). Primers were designed to have a similar melting temperature (Tm) within a consensus or near‐consensus region. The primer sequences were compared against the NCBI nucleotide database to assess putative non‐specific amplification.

DNA preparation

Genomic DNA of bacterial strains was prepared with the TIANamp Bacteria DNA Kit (TIANGEN Biotech) according to the manufacturer’s instructions. Total DNA from faeces and tumour tissues was prepared with the cetyltrimethylammonium bromide (CTAB)‐based method.

Polymerase chain reaction

Polymerase chain reaction (PCR) was conducted with Premix Taq™ (Ex Taq™ Version 2.0 plus dye, TAKARA) using a Mastercycler nexus gradient thermal cycler (Eppendorf) according to the manufacturer’s instructions; 10 ng DNA was used for each reaction. The PCR conditions were 30 cycles (or 35 cycles for faecal and tissue DNA) of 98°C for 30 seconds, 55°C for 30 seconds and 72°C for 20 seconds with the Cool Start procedure unless otherwise specified. The products were electrophoresed on 0.8% or 2% agarose gels as applicable, stained with SYBR Green I (Yeasen Biotech) and visualised with a Tanon 3500 UV gel image system (Tanon Science & Technology). The subspecies‐specific primers designed in this study are listed in Table 1. For bacterial strains, 16S rRNA genes were amplified with the universal primers 27F (5’‐AGAGTTTGATCMTGGCTCAG‐3’) and 1492R (5’‐CGGTTACCTTGTTACGACTT‐3’) as a positive control (with a 90 second extension process in each PCR cycle). For faecal and tissue samples, the V6 regions of the 16S rRNA genes were amplified with a set of five primers (5’‐CNACGCGAAGAACCTTANC‐3’, 5’‐ATACGCGARGAACCTTACC‐3’, 5’‐CTAACCGANGAACCTYACC‐3’, 5’‐CAACGCGMARAACCTTACC‐3’, 5’‐CGACRRCCATGCANCACCT‐3’) (Geller, et al., 2017) as a positive control. The primer set widely used to detect Fnucleatum (Fn‐F: 5’‐CAACCATTACTTTAACTCTACCATGTTCA‐3’ and Fn‐R: 5’‐GTTGACTTTACAGAAGGAGATTATGTAAAAATC‐3’) (Castellarin, et al., 2012; Mima, et al., 2015) was also included for comparison. Human blood DNA from healthy volunteers was used as a negative control.

Heatmap

A heatmap was generated with the ComplexHeatmap (Gu, et al., 2016) package in R. The accompanying dendrogram was drawn with default parameters.

Conflict of interest

D. B., Y. Z., Q.W. and H.Q are the inventors on a patent application (No. 202110250360.7) filed by the Shanghai Tenth People’s Hospital relating to the Fnucleatum subspecies differentiation method described herein.

Supporting information

Fig. S1. Genomes used in this study.

Table S1. Regions targeted by the widely used Fusobacterium nucleatum detection primer set have homologs in other Fusobacterium species.

Acknowledgements

This work was supported by the National Natural Science Foundation of China under grant 82072236 (to D.B.), 82072634 (to Q.W.) and 81972221 (to H.Q.), Clinical Research Plan of SHDC under grant SHDC2020CR2069B (to Q.W.) and the Pandeng Research Foundation of Shanghai Tenth People’s Hospital under grant 2018SYPDRC015 (to D.B.).

Microb. Biotechnol. (2021) 14(5), 2176–2186

Contributor Information

Qing Wei, Email: weiqing1971@126.com.

Huanlong Qin, Email: qinhuanlong@tongji.edu.cn.

REFERENCES

  1. Abed, J., Maalouf, N., Manson, A.L., Earl, A.M., Parhi, L., Emgård, J.E.M., et al. (2020) Colon cancer‐associated Fusobacterium nucleatum may originate from the oral cavity and reach colon tumors via the circulatory system. Front Cell Infect Microbiol 10: 400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ang, M.Y., Dutta, A., Wee, W.Y., Dymock, D., Paterson, I.C., and Choo, S.W. (2016) Comparative genome analysis of Fusobacterium nucleatum . Genome Biol Evol 8: 2928–2938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brennan, C.A., and Garrett, W.S. (2019) Fusobacterium nucleatum‐symbiont, opportunist and oncobacterium. Nat Rev Microbiol 17: 156–166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Castellarin, M., Warren, R.l., Freeman, J.d., Dreolini, L., Krzywinski, M., Strauss, J., et al. (2012) Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res 22: 299–306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chew, J., Zilm, P.S., Fuss, J.M., and Gully, N.J. (2012) A proteomic investigation of Fusobacterium nucleatum alkaline‐induced biofilms. BMC Microbiol 12: 189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gardner, S.N., Slezak, T., and Hall, B.G. (2015) kSNP3.0: SNP detection and phylogenetic analysis of genomes without genome alignment or reference genome. Bioinformatics 31: 2877–2878. [DOI] [PubMed] [Google Scholar]
  8. Geller, L.T., Barzily‐Rokni, M., Danino, T., Jonas, O.H., Shental, N., Nejman, D., et al. (2017) Potential role of intratumor bacteria in mediating tumor resistance to the chemotherapeutic drug gemcitabine. Science 357: 1156–1160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. George, K.S., Reynolds, M.A., and Falkler, W.A.Jr (1997) Arbitrarily primed polymerase chain reaction fingerprinting and clonal analysis of oral Fusobacterium nucleatum isolates. Oral Microbiol Immunol 12: 219–226. [DOI] [PubMed] [Google Scholar]
  10. Gu, Z., Eils, R., and Schlesner, M. (2016) Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 32: 2847–2849. [DOI] [PubMed] [Google Scholar]
  11. Gur, C., Ibrahim, Y., Isaacson, B., Yamin, R., Abed, J., Gamliel, M., et al. (2015) Binding of the Fap2 protein of Fusobacterium nucleatum to human inhibitory receptor TIGIT protects tumors from immune cell attack. Immunity 42: 344–355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Han, Y.W. (2015) Fusobacterium nucleatum: a commensal‐turned pathogen. Curr Opin Microbiol 23: 141–147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Han, Y.W., and Wang, X. (2013) Mobile microbiome: oral bacteria in extra‐oral infections and inflammation. J Dent Res 92: 485–491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. He, Y., Mujagond, P., Tang, W., Wu, W., Zheng, H., Chen, X., et al. (2021) Non‐nucleatum Fusobacterium species are dominant in the southern Chinese population with distinctive correlations to host diseases compared with F. nucleatum , Gut 70(4): 810–812. 10.1136/gutjnl-2020-322090 [DOI] [PubMed] [Google Scholar]
  15. Kim, H.S., Lee, D.S., Chang, Y.H., Kim, M.J., Koh, S., Kim, J., et al. (2010) Application of rpoB and zinc protease gene for use in molecular discrimination of Fusobacterium nucleatum subspecies. J Clin Microbiol 48: 545–553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kolenbrander, P.E., Palmer, R.J.Jr, Periasamy, S., and Jakubovics, N.S. (2010) Oral multispecies biofilm development and the key role of cell‐cell distance. Nat Rev Microbiol 8: 471–480. [DOI] [PubMed] [Google Scholar]
  17. Komiya, Y., Shimomura, Y., Higurashi, T., Sugi, Y., Arimoto, J., Umezawa, S., et al. (2019) Patients with colorectal cancer have identical strains of Fusobacterium nucleatum in their colorectal cancer and oral cavity. Gut 68: 1335–1337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kook, J. K., Park, S. N., Lim, Y. K., Choi, M. H., Cho, E., Kong, S. W., et al. (2013) Fusobacterium nucleatum subsp. fusiforme Gharbia and Shah 1992 is a later synonym of Fusobacterium nucleatum subsp. vincentii Dzink et al. 1990. Curr Microbiol 66: 414–417. [DOI] [PubMed] [Google Scholar]
  19. Kook, J. K., Park, S. N., Lim, Y.K., Cho, E., Jo, E., Roh, H., et al. (2017) Genome‐based reclassification of Fusobacterium nucleatum subspecies at the species level. Curr Microbiol 74: 1137–1147. [DOI] [PubMed] [Google Scholar]
  20. Kurgan, S., Kansal, S., Nguyen, D., Stephens, D., Koroneos, Y., Hasturk, H., et al. (2017) Strain‐specific impact of Fusobacterium nucleatum on neutrophil function. J Periodontol 88: 380–389. [DOI] [PubMed] [Google Scholar]
  21. Lee, S.A., Liu, F., Riordan, S.M., Lee, C.S., and Zhang, L. (2019) Global investigations of Fusobacterium nucleatum in human colorectal cancer. Front Oncol 9: 566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lopez, L.R., Bleich, R.M., and Arthur, J.C. (2020) Microbiota effects on carcinogenesis: initiation, promotion and progression. Annu Rev Med 72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mima, K., Sukawa, Y., Nishihara, R., Qian, Z.R., Yamauchi, M., Inamura, K., et al. (2015) Fusobacterium nucleatum and T cells in colorectal carcinoma. JAMA Oncol 1: 653–661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mira, A., Pushker, R., Legault, B.A., Moreira, D., and Rodriguez‐Valera, F. (2004) Evolutionary relationships of Fusobacterium nucleatum based on phylogenetic analysis and comparative genomics. BMC Evol Biol 4: 50. 10.1186/1471-2148-4-50 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nie, S., Tian, B., Wang, X., Pincus, D.H., Welker, M., Gilhuley, K., et al. (2015) Fusobacterium nucleatum subspecies identification by matrix‐assisted laser desorption ionization‐time of flight mass spectrometry. J Clin Microbiol 53: 1399–1402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Richardson, M., Ren, J., Rubinstein, M.R., Taylor, J.A., Friedman, R.A., Shen, B., and Han, Y.W. (2020) Analysis of 16S rRNA genes reveals reduced Fusobacterial community diversity when translocating from saliva to GI sites. Gut Microbes 12: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Roques, C.G., El kaddouri, S., Barthet, P., Duffort, J. F., and Arellano, M. (2000) Fusobacterium nucleatum involvement in adult periodontitis and possible modification of strain classification. J Periodontol 71: 1144–1150. [DOI] [PubMed] [Google Scholar]
  28. Singhal, N., Kumar, M., Kanaujia, P.K., and Virdi, J.S. (2015) MALDI‐TOF mass spectrometry: an emerging technology for microbial identification and diagnosis. Front Microbiol 6: 791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Strauss, J., White, A., Ambrose, C., McDonald, J., and Allen‐Vercoe, E. (2008) Phenotypic and genotypic analyses of clinical Fusobacterium nucleatum and Fusobacterium periodonticum isolates from the human gut. Anaerobe 14: 301–309. [DOI] [PubMed] [Google Scholar]
  30. Thurnheer, T., Guggenheim, B., Gruica, B., and Gmür, R.J.A. (1999) Infinite serovar and ribotype heterogeneity among oral Fusobacterium nucleatum strains? Anaerobe 5: 79–92. 10.1006/anae.1999.0188 [DOI] [Google Scholar]
  31. Thurnheer, T., Karygianni, L., Flury, M., and Belibasakis, G.N. (2019) Fusobacterium species and subspecies differentially affect the composition and architecture of supra‐ and subgingival biofilms models. Front Microbiol 10: 1716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ye, X., Wang, R., Bhattacharya, R., Boulbes, D.R., Fan, F., Xia, L., et al. (2017) Fusobacterium nucleatum subspecies animalis influences proinflammatory cytokine expression and monocyte activation in human colorectal tumors. Cancer Prev Res (Phila) 10: 398–409. [DOI] [PubMed] [Google Scholar]
  33. Yeoh, Y.K., Chen, Z., Wong, M.C.S., Hui, M., Yu, J., Ng, S.C., et al. (2020) Southern Chinese populations harbour non‐nucleatum Fusobacteria possessing homologues of the colorectal cancer‐associated FadA virulence factor. Gut 69: 1998–2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhao, Y., Wu, J., Yang, J., Sun, S., Xiao, J., and Yu, J. (2012) PGAP: pan‐genomes analysis pipeline. Bioinformatics 28: 416–418. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. Genomes used in this study.

Table S1. Regions targeted by the widely used Fusobacterium nucleatum detection primer set have homologs in other Fusobacterium species.


Articles from Microbial Biotechnology are provided here courtesy of Wiley

RESOURCES