Skip to main content
Stem Cell Research & Therapy logoLink to Stem Cell Research & Therapy
. 2021 Oct 7;12:530. doi: 10.1186/s13287-021-02588-z

Therapeutic effects of mesenchymal stem cells-derived extracellular vesicles’ miRNAs on retinal regeneration: a review

Ali Rajool Dezfuly 1,#, Azadeh Safaee 1,#, Hossein Salehi 1,✉
PMCID: PMC8499475  PMID: 34620234

Abstract

Extracellular vesicles (EVs), which consist of microvesicles and exosomes, are secreted from all cells to transform vital information in the form of lipids, proteins, mRNAs and small RNAs such as microRNAs (miRNAs). Many studies demonstrated that EVs’ miRNAs have effects on target cells. Numerous people suffer from the blindness caused by retinal degenerations. The death of retinal neurons is irreversible and creates permanent damage to the retina. In the absence of acceptable cures for retinal degenerative diseases, stem cells and their paracrine agents including EVs have become a promising therapeutic approach. Several studies showed that the therapeutic effects of stem cells are due to the miRNAs of their EVs. Considering the effects of microRNAs in retinal cells development and function and studies which provide the possible roles of mesenchymal stem cells-derived EVs miRNA content on retinal diseases, we focused on the similarities between these two groups of miRNAs that could be helpful for promoting new therapeutic techniques for retinal degenerative diseases.

Keywords: Extracellular vesicles, Retina, miRNA, Mesenchymal stem cells

Introduction

The retina is a part of the central nervous system (CNS) which originates from diencephalon. The inner sensory retina and retinal pigment epithelium (RPE) are two layers of it [1, 2]. The association neurons (amacrine and horizontal cells), the conducting neurons (bipolar and ganglion cells), the photoreceptor neurons (cone and rod receptors), and the supporting Müller cells are four cell groups of inner sensory retina whereas the RPE is made up of cuboidal cells which are organized in one layer[1]. The light photons are transformed to electrochemical signals by the retina and projected to the brain via the optic nerve. The whole process gives the organism the ability of vision [3].

Many people suffer from the blindness caused by retinal degenerations around the world. The death of retinal neurons, same as the CNS, is irreversible and causes permanent damage to the retina. Degenerative inherited retinal diseases such as retinitis pigmentosa and age-related macular degeneration (AMD) are important causes of visual disability [1, 3–6]. The principal reason of retinal degeneration is the loss of photoreceptors, but no effective treatment has been discovered yet [7]. Retina’s structure and anatomical position have made it an ideal tissue for examining new treatment methods such as prosthetic therapy, gene therapy and cell therapy for its neurodegenerative diseases. It is an easily accessible structure of the central nervous system which is quite isolated from the other parts of the body. Researches on cell therapy have become prevalent in recent decades. One of the cell therapy advantages is restricting degeneration via delivering trophic and neuroprotective agents that might inhibit the progression of the visual disease. Another advantage of cell therapy over other methods is the possible differentiation of transplanted cells that might replace the dead cells and restore the function of the tissue [8]. Considering the specifications of stem cells such as their differentiation capacity, multipotency and self-renewal, stem cell therapy has become an important therapeutic approach [1, 3]. Different types of stem cells have been used for retinal differentiation and transplantation including induced pluripotent stem cells (iPSCs), isolated retinal stem cells (RSCs), human embryonic stem cells (hESCs) and mesenchymal stem cells (MSCs) [9, 10]. MSCs do not have the clinical limitations of other stem cells and owing to their immunomodulatory and autologous features, easy isolation and relative abundance, they are more promising choices than other types of stem cells for retinal regeneration [10].

Many studies on regenerative medicine have shown that most of MSCs will be lost in the cell therapy process, this suggests that the main part of tissue regeneration is possibly made by the paracrine factors of the MSCs [11–14]. One of the main components of MSCs paracrine factors which are highly regarded as tissue regenerators are EVs. The inner components of EVs generally consist of proteins and nucleic acids, especially miRNAs [15]. As new studies have suggested that EVs miRNA content seems to play a more important role in retinal regeneration than other components [12], in this review, we will discuss the potential role of MSCs-derived EVs’ (MSC-EVs) miRNAs as a treatment for retinal diseases.

Mesenchymal stem cells (MSCs)

MSCs are non-hematopoietic stem cells which are derived from various somatic tissues and have the self-renewal capacity. They can be found in different tissues including umbilical cord, embryonic tissues, fetal membranes, dental pulp, adipose tissue, liver, cartilage, skin, breast milk, skeletal muscle, peripheral blood, corneal limbal stroma of the eye and bone marrow [16, 17]. MSCs can migrate to the sites of injury to advance tissue regeneration and suppress the immune reactions by regulating the function of both innate and acquired immune systems [17]. Because of their anti-inflammatory [16], regenerative and immunosuppressive features, they are being used widely in the field of cellular therapy studies nowadays [11]. According to the International Society for Cellular Therapy (ISCT) the minimal requirements of the MSCs are the expression of cell surface markers CD73, CD90 and CD105, and negative expression of CD34, CD45, or CD11b, CD79-α, or CD19, CD14 and HLA-DR markers. The other main requirement is the plastic adherence in standard culture conditions. Moreover, MSCs must be able to differentiate into mesenchymal cells such as chondrocytes, osteoblasts, adipocytes and fibroblasts in vitro [1, 11, 18]. Moreover, researches have shown that MSCs can differentiate into a range of numerous cells such as cardiomyocytes, muscle fibers, renal tubular cells, hepatocytes, pancreatic islands and neurons [11]. So these kinds of cells could be used in many types of tissue regeneration including the retina [12, 16]. For example, Özmert et al. treated 32 patients of retinitis pigmentosa with subtenon space transplantation of Wharton’s jelly mesenchymal stem cells (WJ-MSCs) in a clinical trial. They concluded that the subtenon injection of WJ-MSCs could restrict the disease progression while being completely safe after twelve months of follow-up [19]. Despite the fact that therapeutic use of MSCs was promising, the possible unwanted differentiation of transplanted cells remains a safety issue [20]. Moreover, administration of MSCs for inflammatory bowel disease (IBD) and idiopathic pulmonary fibrosis (IPF) patients who were receiving immunosuppressive drugs shortly before MSC injection caused serious respiratory and gastrointestinal infections, suggesting that applying MSCs in combination or instantly after administering immunosuppressive drugs could be harmful [21].

Also, it has been shown that the positive effects of MSC therapy are substantially due to their trophic and immunosuppressive secreted factors and most of the transplanted cells will not differentiate and integrate into retinal tissue [20, 22]. MSCs secrete various trophic factors including FGF-2, IGF-1, BDNF, HGF, VEGF, IGF1, TGF-β1, bFGF and GDNF which attribute to neuronal survival and regeneration [23].

Recent studies have shown that these kinds of cells also release EVs which play an important part in cellular communications that promote tissue regeneration [11, 24].

Extracellular vesicles

EVs are secreted vesicles which are approximately found in all body fluids and the extracellular matrix [3]. They are secreted from all cells to transform vital information as lipids, proteins, mRNAs and small RNAs. EVs’ proteins are mostly a representation of their parent cells; however, the number of certain types of molecules such as cytokines, proteinases, chemokines, cell-specific antigens, cytoplasmic enzymes, signal transduction proteins, heat shock proteins and the ones which are related to cell adhesion and membrane trafficking are higher in the vesicles [25]. EVs include exosomes, microvesicles and apoptotic bodies. They are categorized by the proteins which are located on their surface, the range of their size in nanometer, their inner components and their biogenesis pathway [3].

Exosome formation is via the inward budding of the late endosome membranes which are called multivesicular bodies (MVBs). As the MVBs fuse with cell membrane, they would be released in the extracellular space [26]. The size of exosomes is considered as 30–150 nm [3]. Significant physiological and pathological functions have been attributed to exosomes including antigen presentation, inflammation regulation, immunological responses, angiogenesis processes, neuroprotection, regeneration processes, discarding inessential proteins and diffusing pathogens or oncogenes [27]. Exosomes can regulate the cellular status and their features would change in numerous diseases including cancer [28]. This suggests them as diagnostic and therapeutic tools [15]. For example, Galardi et al. showed that proteins that are characteristically associated with retinoblastoma vitreous seeding (RBVS) invasion and metastasis have been upregulated in RBVS exosomes [29]. Exosomes also have a drug delivery function [25, 30]. Schindler et al. demonstrated that exosomes which are loaded with doxorubicin, an anthracycline antibiotic that is prescribed in the treatment process of many kind of cancers, would be absorbed by cells quickly and their inner doxorubicin would be re-distributed from endosomes to the cytoplasm and nucleus of the recipient cells [31].

Another type of EVs that are formed through the outward budding of cell membrane is microvesicles which their sizes are 100–1000 nm [3]. Microvesicles are also called shedding vesicles, microparticles, shedding bodies, ectosomes and oncosomes. A number of functions are attributed to microvesicles such as intercellular signaling and changing the extracellular environment. They also facilitate cell invasion through cell-independent matrix proteolysis [32]. Microvesicles, same as exosomes, carry mRNA, short interfering RNA (siRNA) and ectopically expressed reporter proteins, but it has been shown that plasmid DNAs, which have reporter functions, could only be transferred to target cells by microvesicles [32, 33]. Researches demonstrated that microvesicles have also crucial roles in stem cell expansion and renewal [34], tumor progression [35, 36], coagulation [37] and inflammation [38].

Apoptotic bodies are formed via the membrane blebbing of apoptotic cells. Their usual size is more than 1000 nm [39]. As far as we know to date, no therapeutic effect of apoptotic bodies has been seen in eye diseases [3]. However, exosomes have noteworthy therapeutic effects against many diseases including neurologic ones [40–42]. MSC-derived exosomes’ (MSC-Exo) neuroprotective effect was also discovered in retinal cell injuries such as retinal cell degeneration, refractory macular holes, retinal detachment and optic nerve injury. MSC-Exos could reduce cell apoptosis and restrict the area of the injury in these diseases [27].

The main reason that why the EVs have become a research interest is their inner load which contain mRNAs, miRNAs, lipids and proteins. EVs’ cell signaling task is done by these components [3]. Many studies have shown that mRNAs and miRNAs play important roles in this task. While mRNAs can induce translation of new proteins in target cells, miRNAs can regulate the expression of genes [43, 44]. EVs’ multiple therapeutic effects are done by entering mRNAs, miRNAs and proteins into target cells [3]. MSC-EVs express adhesion molecules such as CD29, CD73 and CD44 which allow them to adhere to the damaged and inflamed sites of tissues [21]. Considering the source of EVs, their inner components vary. The two other factors which also influence the inner cargo and subsequently the therapeutic effects of exosomes are the source cell passages and its phase of differentiation [3]. It has been shown that the neuroprotective efficacy of MSC-Exos reduces with raising cell passages [45]. It has also been indicated that exosomes’ cargos vary at different stages of their source cell differentiation. For instance, exosomal miRNAs were differentially expressed in distinct stages of BMSCs osteogenic differentiation [46]. The composition of EVs’ cargos is not just a sample of the cytoplasm of their cell of origin. Studies demonstrated that some proteins, mRNAs, miRNAs and transfer RNAs are more abundant in EVs than the cytoplasm of their original cells [47–49].

Ocular therapies which are based on EVs have many advantages over cell-based therapies. Retina MSC-based therapy has incurred safety concerns. For example, a report showed that three patients with AMD who underwent intravitreal injection of adipose-derived MSCs, became blind because of the hemorrhage and retinal detachment [50]. One explanation for these pathologies is the adherence of transplanted MSCs to the inner limiting membrane of retina that would make an epiretinal membrane [51–53]. Another explanation would be the possible result of undesired differentiation of transplanted MSCs [20]. Other complications of cell therapy are the lack of information of the rate of cell death and cell division after administration [54]. Moreover, an important downside of cell therapy in retina is that the transplanted cells would not become integrated into the retina efficiently [13, 55]. The occasionally cell integration will be done through the digestion of inner limiting membrane and retinal glial activity modulation that might damage the retina themselves [22]. Since many studies have shown that keeping the therapeutic benefits of cell therapy, the EV therapy would avoid most of the above complications and also some EVs can cross the inner limiting membrane freely, it would be a better choice than cell therapy [12, 15].

miRNAs

miRNAs are a subdivision of evolutionary conserved long non-coding RNAs with approximately 22 nucleotides and a post-transcriptive repressive influence on gene expression [56–58]. First step in the biogenesis of miRNAs is the production of partially complementary primary RNA transcripts (pri-miRNA) mostly by RNA polymerase II and sometimes by RNA polymerase III. miRNAs will derive from these structures. Pri-miRNAs become hairpin structures by self-annealing. Then, the miRNA processing complex, which is made of Drosha ribonuclease and the DiGeorge Critical Region 8 (Dgcr8) proteins, will make a cut in the hairpin structure at the end of 11 base pairs (bp) from the foundation of the hairpin stem [59]. A seventy nucleotide sequence called precursor miRNA (pre-miRNA) will be released as a result [56]. The pre-miRNA is transferred to the cytoplasm by Exportin-5. Then, the Dicer endoribonuclease will attach to the pre-miRNA and cleave it to release a ~ 22 nucleotide long double strand RNA named miRNA* duplex. Since the pre-miRNA itself has a 5′ phosphate at one end and a 3′ two-nucleotides’ overhang at the other end, the dicer cleavage makes one phosphate at the 5′ end of each new strand, and a two-nucleotides’ overhang at the 3′ end of each new strand. Afterward, the miRNA* duplex will be incorporated into the Argonaute protein (Ago) which is a part of the RNA-induced silencing complex (RISC) and one strand will be removed. The remaining strand that is connected to RISC will attach partially to target mRNAs and repress their translation or induce degradation (Fig. 1). One miRNA can bind to myriads of target mRNAs [56, 60, 61].

Fig. 1.

Fig. 1

MiRNA synthesis pathway. Biogenesis of miRNA begins with transcription of a miRNA gene (Canonical pathway) or the intron region of a protein-coding gene (Mirtron pathway) mainly by RNA polymerase II, and sometimes by RNA polymerase III in the nucleus. Canonical pathway: The sequences from miRNA genes transcription self-anneal and make hairpin-like structures called primary miRNAs (pri-miRNAs). Pri-miRNAs are being cut by DGCR8/Drosha complex and become pre-miRNAs. Mirtron pathway: Pre-miRNAs which are the result of intron regions of protein-coding genes are not dependent on Drosha complex. They are divided by spliceosome from the primary transcript of mRNAs. Then, they will self-anneal and become pre-miRNAs directly. All Pre-miRNAs from both pathways leave the nucleus and enter the cytoplasm by Exportin-5. There, the pre-miRNAs are cleaved by the Dicer/TRBP complex, yielding an about 22 nucleotides long miRNA: miRNA* duplex molecule. Then, this molecule will be loaded into the Argonaute (Ago) part of RNA-induced silencing complex (RISC). After discarding one of the strands, the other one will remain in the RISC and binds to 3’ untranslated regions of target mRNAs. miRNAs binding to target mRNAs lead to their translational repression, deadenylation and cleavage

miRNA nomenclature is based on an annotation system which was introduced by Ambros et al. [62]. In brief, miRNA genes are numbered by the sequence of their discovery. Identical or nearly identical miRNAs from different species get the same number. A miRNA number is always accompanied by a prefix: mir or miR. The pre-miRNA is shown by “mir” prefix and the mature miRNA is preceded by “miR.” They are followed by a dash and then the number comes (e.g., mir-25 and miR-25). Identical mature miRNAs with one or two different nucleotides in their sequences are distinct by a lower case letter (e.g., miR-36a and miR-36b). A dash and a number suffix will be added to the names of pre-miRNAs that make identical mature miRNAs despite locating on different loci of the genome (e.g., mir-42a-1 and mir-42a-2 produce an identical mature miRNA, miR-42a). In the miRNA formation process, a miRNA duplex will be cleaved to two different mature miRNA strands: the one that comes from the 5′ arm is shown by 5p (e.g., miR-146b-5p) and the one from the 3′ arm by 3p (e.g., miR-146b-3p). Having said that, if the relative level of cell abundance of same miRNAs’ two strands is known, the arm with the lower expression will get an asterisk following the number (for instance miR-9 is more abundant than miR-9*). miRNA names can also indicate the species of origin by a three-letter prefix: for example, “hsa” stands for Homo sapiens in hsa-miR-132 and “rno” for Rattus norvegicus in rno-miR-125 [62, 63].

Defects in miRNAs synthesis can make serious problems in the development process and is related to pathologies including inherited genetic disorders, diabetes, cancers, heart failure and neurodegenerative diseases. miRNAs maintain the healthy condition of gene networks and modulate the ups and downs of gene expression in developed tissues [56]. As well as other tissues, miRNAs play important roles in retina and some of them are more enriched in retinal cells (Fig. 2) [64]. Many studies showed their role in the function and survival of different retinal cells such as photoreceptors or Müller glias [65, 66]. Here, we discuss retinal cell miRNAs (Table 1) similarities with MSCs-EVs’ miRNAs (Table 2) and their possible therapeutic effects on retinal diseases.

Fig. 2.

Fig. 2

MiRNAs enriched in retinal cells which are also present in MSC-EVs

Table 1.

miRNAs of retina

Retina miRNAs References Retina miRNAs References
miR-204 [60, 64–66, 90–107] miR-142b [66, 108, 109]
miR-124a [64, 90, 93, 95, 98, 99, 101, 104, 105, 110, 111] miR-7a [66, 107–109, 112]
miR-9 [65, 66, 90, 92, 94, 95, 99, 101, 103, 105, 107, 108, 111, 113–117] miR-27c [66, 108, 109]
miR-9* [66, 90, 99, 107, 108] miR-25 [97, 107, 108]
miR-29 [90, 95] miR-133 [95]
miR-181a [60, 90, 94, 95, 98–101, 105–107, 118–120] miR-1 [95]
miR-182 [60, 64, 65, 90, 93–95, 97–101, 103–107, 111, 120–122] miR-185 [95, 97]
miR-183 [60, 64, 65, 90, 93–95, 97–101, 104, 106, 107, 111, 120–122] miR-219 [95]
miR-183* [106, 107] miR-124a-1 [65]
miR-125b [90, 92, 98, 99, 107, 113, 123, 124] miR-132 [65, 99, 101, 107]
miR-26a [90, 98, 107, 120, 123] miR-23a [65, 66, 101, 107, 123, 125]
miR-181 [90] miR-449a [126]
miR-96 [60, 64, 65, 90, 93–95, 97, 99–101, 104, 106, 107, 121, 122] miR-449b-5p [126]
let-7 [65, 66, 90, 93, 94, 98, 113–115, 117] miR-9–1 [97]
let-7i [90, 107, 125] miR-181b-1 [97]
miR-106b [90, 97, 101, 107, 127] miR-181a-1 [97]
miR-30b [90, 92, 101] miR-181a-1* [107]
miR-139 [90, 125] miR-29c [64, 97, 99, 101, 105, 107]
miR-126 [90, 128] miR-194–1 [97]
miR-107 [90] miR-194–2 [97]
miR-103 [90, 107] miR-7–2 [97]
miR-422a [90] miR-9–3 [97]
miR-422b [90] miR-181-c [97]
miR-335 [90, 95, 97] miR-181-d [97]
miR-31 [66, 90, 97, 101, 108, 109] miR-7–3 [97]
miR-106 [66, 90] miR-216b [97]
miR-129-3p [90, 100, 101, 107, 129] miR-217 [97, 99]
miR-691 [90, 107] miR-9–2 [97]
miR-26b [90, 107, 123] miR-219–1 [97]
miR-35 [90] miR-30c [98, 101]
miR-886-5p [91] miR-213 [99]
miR-184 [65, 91, 94, 97, 99, 101, 126, 130] miR-454a [99]
miR-146a [66, 91, 108, 109, 131] let-7d [95, 99, 101, 103, 107, 123]
miR-10a [91] miR-205 [99]
miR-203 [66, 91, 132] let-7b [64, 99, 100, 107, 123]
miR-194 [91, 95] miR-130a-3p [133]
miR-200b [128, 134] miR-20a-5p [124, 133]
miR-200b* [107] miR-93-5p [133]
miR-34a [65, 107, 135] miR-9-3p [133]
miR-182-5p [136] miR-709 [107, 133]
miR-183-5p [136] let-7a [66, 107, 123, 124]
miR-26a-5p [124, 136] miR-16 [107, 123, 137]
miR-181a-5p [124, 136] miR-320 [107, 123]
miR-204-5p [124, 136] let-7e [101, 107, 123]
miR-22-3p [136] miR-7 [65, 138]
let-7a-5p [124, 136] miR-200c [101]
miR-191-5p [136] miR-221 [101]
miR-124-3p [136] miR-33 [101, 107]
miR-9-5p [133, 136] miR-342-3p [101]
miR-127-3p [136] miR-365 [101]
miR-192-5p [136] miR-467a [101]
let-7f-5p [124, 136] miR-470 [101]
miR-27b-3p [124, 136] miR-542-3p [101]
miR-96-5p [136] miR-652 [101]
miR-26b-5p [136] miR-695 [101]
miR-30b-5p [124, 136] miR-774 [101]
miR-92a-3p [133, 136] miR-375 [101]
miR-99b-5p [136] miR-465c-5p [101]
miR-125b-5p [66, 124, 136] miR-30a [101, 107]
miR-151a-5p [136] miR-15a [101, 107]
miR-211-5p [124, 136] miR-223 [101]
miR-126-5p [136] miR-290-5p [101, 107]
miR-143-3p [136] miR-29b [101, 107, 139, 140]
miR-16-5p [124, 136] miR-379 [101]
let-7 g-5p [124, 136] miR-380-3p [101]
miR-148a-3p [136] miR-384-5p [101]
miR-181b-5p [136] miR-409-5p [101]
miR-125a-5p [107, 124, 136] miR-433 [101]
miR-92b-3p [136] miR-497 [101]
miR-181a-2-3p [136] miR-541 [101]
miR-181c-5p [136] miR-551b [101, 107]
miR-30d-5p [124, 136] miR-676 [101]
miR-100-5p [136] miR-713 [101, 107]
let-7c-5p [136] miR-742 [101]
miR-103a-3p [124, 136] miR-875-3p [101]
miR-29b-3p [136] miR-378 [101]
miR-151a-3p [136] miR-465b-5p [101]
miR-186-5p [136] miR-28 [60, 141]
miR-21-5p [124, 136] miR-145 [66, 101, 111, 142]
miR-30a-5p [99, 124, 136] miR-149 [101]
miR-146a-5p [136] miR-188-5p [101]
miR-101-3p [124, 136] miR-339-5p [101]
miR-126-3p [101, 136] miR-130a [101, 107]
miR-146b-5p [136] miR-883b-5p [101]
miR-266-5p [136] miR-490 [101]
miR-486-5p [136] miR-381 [101]
miR-99a-5p [136] miR-680 [101]
miR-23b-3p [124, 136] miR-882 [101]
miR-30e-5p [136] miR-500 [101]
let-7b-5p [136] miR-495 [101]
miR-10a-5p [136] miR-335-5p [101]
miR-27a-3p [124, 136] miR-296-5p [101]
miR-29a-3p [136] miR-328 [101]
miR-181a-3p [136] miR-294 [101]
miR-142-5p [136] miR-467e [101]
miR-145-5p [136] miR-329 [101]
miR-451a [136] miR-466d-3p [101]
miR-23a-3p [124, 136] miR-34c [101]
miR-124 [60, 66, 92–94, 107, 108, 114, 133, 143] miR-484 [101]
miR-125a [92, 125] miR-191 [101, 107, 120]
miR-762 [144] miR-382 [101]
miR-24a [93, 104, 114, 145] miR-468 [101]
miR-133b [93] miR-681 [101]
miR-218 [93, 101] miR-455 [101]
miR-196a [93] miR-99a [66]
miR-129 [93, 104, 117, 144] miR-135a [66, 107]
miR-222 [93, 104, 117, 125, 144] miR-21 [66, 128]
miR-214 [93, 104, 111, 117, 125, 128, 144] miR-29a [66, 107, 111, 146]
miR-155 [93, 99, 104, 117, 144, 147] miR-143 [66, 107, 111]
miR-210 [94, 97, 106, 107] miR-199a-3p [66]
miR-140 [94, 106, 107] miR-199a-5p [66]
miR-211 [60, 64, 65, 94, 96, 100, 102] miR-199b [66]
miR-181b [60, 94, 95, 99, 101, 106, 107, 118, 120] miR-199b* [66]
let-7f [94, 107, 120] miR-17-5p [128]
miR-22 [66, 94, 107, 125] let-7e-5p [124]
miR-26 [94] miR-19b-3p [124]
miR-30 [94] miR-19a-3p [124]
miR-92 [94, 95] miR-106b-5p [124]
miR-125 [65, 66, 94, 114, 115, 117] miR-15a-5p [124]
miR-34 [132] miR-455-3p [124]
miR-350 [101, 132] miR-34a-5p [124]
miR-410 [101, 132] miR-24-3p [124]
miR-216 [99, 132] miR-30c-5p [124]
miR-212 [107, 132] miR-301b [111]
miR-181c [95, 101, 111, 129] miR-199 [111]
miR-181c* [129] miR-27b [107]
miR-129-5p [129] miR-338-3p [107]
miR-99b [101, 107, 129] miR-138 [107]
miR-23b [98, 107, 123, 129] miR-127 [107]
miR-24 [101, 107, 123, 129] miR-151-5p [107]
miR-30d [101, 129] miR-193 [107]
miR-503 [101, 129] miR-136 [107]
miR-27a [101, 107, 129] miR-195 [107]
miR-135 [148] miR-148a [106, 107]
miR-18a [107, 127, 128, 149] miR-452 [107]
miR-130b [127] miR-542 [107]
miR-20a [107, 127, 128] miR-292-5p [107]
miR-34b-5p [127] miR-744 [107]
miR-216a [66, 97, 127] miR-689 [107]
miR-20b [107, 127] miR-423-5p [107]
miR-17 [66, 101, 107, 127, 150] miR-677 [107]
miR-18b [127] miR-301a [107]
miR-106a [101, 107, 127] miR-130b [107]
miR-19a [99, 107, 127] miR-374 [107]
miR-93 [107, 127] miR-32 [107]
miR-15b [101, 107, 123, 127, 137] miR-146b [107]
let-7a-2 [125] miR-153 [107]
let-7c [107, 125] miR-19b [107]
let-7f-2 [125] miR-207 [107]
miR-100 [66, 125, 129] miR-489 [107]
miR-125b-1 [125] miR-700 [107]
miR-125b-2 [125] miR-92b [99, 107]
miR-151b [125] miR-101a [107]
miR-152 [101, 125] miR-690 [107]
miR-181d [101, 125] miR-720 [107]
miR-26a-1 [125] miR-7b [107]
miR-26a-2 [125] miR-361 [97]
miR-3120 [125] miR-181a-2 [97]
miR-4521 [125] miR-181b-2 [97]
miR-98 [95, 107, 125] miR-219–2 [97]
miR-206 [90] miR-7–1 [97]
miR-150 [151] – –

Table 2.

miRNAs of MSC-EVs

MSCs’ EVs miRNAs References MSCs’ EVs miRNAs References
miR-146a [21, 61, 152–161] miR-494 [156–158, 162]
miR-155 [152, 158] miR-140-5p [162]
miR-21 [21, 40, 152–154, 156, 158–160, 163–165] miR-196a [61]
miR-27b [152, 158] miR-27a [61]
let-7 [152] miR-206 [61, 166]
miR-126 [61, 152, 156, 160, 167, 168] miR-199a [61, 156, 165]
miR-886 [152] miR-302a [61, 159]
miR-22 [21, 40, 42, 61, 70, 154, 156, 164, 169, 170] miR-133 [61, 70]
miR-133b [40, 42, 61, 156, 157, 163, 164, 166, 169, 171] miR-155-5p [61]
miR-19a [21, 40, 70, 156, 169] miR-16-5p [61, 83, 172, 173]
miR-100 [153, 154, 156, 159, 165, 174] miR-223-3p [61]
miR-143 [42, 153, 154, 158, 163] miR-15a [61]
miR-181 [70, 153, 160, 161] miR-15b [61]
miR-221 [40, 153, 154, 156, 157, 165, 174] miR-125a-3p [61]
miR-145-5p [70, 83, 153, 172, 175] miR-142-3p [61, 83, 173, 174]
miR-16 [61, 156, 157, 165, 170, 174] miR-223 [61, 70, 156, 158, 174]
miR-17 [21, 156] miR-630 [155]
miR-130a [156, 160, 167] miR-204 [166]
miR-132 [154, 156, 160, 167] miR-328 [166]
let-7b [21, 154, 156, 158, 160, 161, 167, 168] miR-210 [40, 156, 159]
let-7c [21, 70, 154, 156, 160, 167] miR-23a-3p [70, 83, 88, 173, 175]
miR-486-5p [3, 70, 82, 88] miR-1260b [70, 165, 175]
miR-10a-5p [70, 82] miR-1246 [3, 70, 83]
miR-10b-5p [70, 82, 88] miR-451a [70, 83]
miR-191-5p [70, 82] miR-4454 [70, 83]
miR-222-3p [70, 82, 83, 173] miR-21a-5p [70]
miR-143-3p [70, 82, 83, 88] miR-486b-5p [70]
miR-22-3p [70, 82, 83, 88] miR-486a-3p [70]
miR-21-5p [3, 21, 61, 70, 82, 83, 88, 156, 172, 173, 175] miR-486a-5p [70]
let-7a-5p [3, 70, 82, 83, 172, 173, 175] miR-486b-3p [70]
miR-127-3p [21, 82, 83] miR-125a [156, 174]
miR-99b-5p [82] miR-1792 [156]
miR-100-5p [70, 82, 83, 88, 172, 173, 175] miR-1587 [156]
miR-92a-3p [3, 70, 82, 172] miR-124a [156]
miR-26a-5p [82, 156] miR-101-3p [156]
miR-146a-5p [82] miR-23b-5p [156]
miR-4485 [82] miR-339-3p [156]
miR-146b-5p [82] miR-425-5p [156]
miR-151a-3p [82] miR-34a [156]
let-7f-5p [70, 82, 88, 175] miR-210-3p [156]
miR-92b-3p [82] miR-294 [156]
miR-423-5p [3, 82] miR-133b-3p [156]
miR-27b-3p [82, 83] miR-200b [156]
let-7i-5p [82] miR-99a [174]
miR-28-3p [82] miR-627 [174]
miR-125b-5p [21, 61, 70, 82, 83, 88, 159, 172, 173, 175] miR-142-5p [174]
miR-19b [174] miR-383 [174]
miR-124 [154, 163] miR-501 [174]
miR-233 [21] miR-601 [174]
miR-181-5p [21] miR-17-3p [174]
miR-145 [21, 154, 156, 159, 161, 164, 165] miR-497 [176]
miR-223-5p [21] miR-486 [174]
miR-30 [21, 61, 70] miR-451 [174]
miR-92a [154] miR-564 [174]
miR-146 [21] miR-30a [158]
miR-30b [156, 168] miR-410 [159, 161]
miR-181c [158, 159, 161, 168] miR-181b [161]
miR-126-3p [61, 168] miR-181d [161]
miR-4484 [168] miR-1252 [161]
miR-619-5p [168] miR-4434 [161]
miR-6879-5p [168] miR-4669 [161]
miR-291a-3p [168] miR-199b-3p [83]
miR-23b [42, 70, 154, 156, 158, 164] miR-7975 [83]
miR-122 [40, 70, 154] let-7b-5p [83]
miR-1224-5p [154] miR-29a-3p [83]
miR-1228 [154] miR-144-3p [83]
miR-1234 [154] miR-29b-3p [83]
miR-1237 [154] miR-630 [83]
miR-1238 [154] miR-221-3p [3, 83, 173]
miR-150* [154] let-7i-5p [83]
let-7b* [154] miR-424-5p [83]
let-7d* [154] miR-191-5p [83]
miR-198 [154] miR-25-3p [83, 172]
miR-296-5p [154] miR-130a-3p [83]
miR-572 [154] miR-376a-3p [83]
miR-765 [154] miR-4286 [83]
miR-933 [154] miR-15a-5p [83]
miR-149 [154] miR-24-3p [83, 172, 173]
miR-149* [154] miR-34a-5p [83]
miR-191 [154, 165] miR-122-5p [3, 83]
miR-191* [154] miR-181a-5p [83]
miR-425* [154] miR-199a-5p [83]
miR-574-5p [154] miR-495-3p [83]
miR-575 [154] miR-196a-5p [83]
miR-638 [154] miR-320e [83]
miR-663 [154] miR-148a-3p [83]
miR-671-5p [154] miR-93-5p [83]
miR-923 [154] miR-377-3p [83]
miR-940 [154] miR-382-5p [83]
let-7a [154, 156, 158, 165] miR-15b-5p [83]
let-7d [154] miR-376c-3p [83]
let-7e [154, 156] miR-374a-5p [83]
let-7f [154, 156, 165] let-7e-5p [83]
let-7i [154] miR-379-5p [83]
miR-103 [154] let-7c-5p [83]
miR-107 [154] miR-1260a [165, 175]
miR-125a-5p [83, 154] miR-320a [3]
miR-125b [40, 154, 156, 159, 164, 165, 174] miR-195 [165]
miR-151-5p [154, 156] miR-106a-5p [172]
miR-181a [154, 158, 161] miR-19b-3p [172]
miR-199a-3p [70, 83, 154, 161, 175] miR-320 [154]
miR-214 [154] miR-361-5p [154]
miR-222 [154, 165, 174] miR-574-3p [154]
miR-23a [154, 156, 159, 165] miR-26a [154]
miR-24 [154, 174] miR-17–92 cluster: (miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a) [12, 21, 40, 70, 177]
miR-31 [154, 174] miR-23b-3p [178]

miRNAs of EVs

Literatures have shown different procedures of loading miRNAs into EVs. Some studies demonstrated that when MVBs bind to plasma membrane and EVs are made, RISC complex is associated with them [67, 68]. Other studies which concluded that RISC or Argonaute2 (Ago2) is not present in EVs indicated that packing miRNAs takes place by a type of ubiquitous proteins called heterogeneous nuclear ribonucleoproteins (hnRNP) [69]. Some motifs of miRNAs either alone or associated with proteins such as Ago2, Alix and MEX3C can be detected by and attached to hnRNP [70]. For instance, the loading of GGAG motif of miRNAs into EVs is controlled by the attached nuclear hnRNPA2B1 (ribonucleoprotein A2B1) [71].

Other proteins such as synaptotagmin-binding cytoplasmic RNA-interacting protein (SYNCRIP) detect miRNAs’ motifs which bind to the GGCU motif [72]. As a study showed that the mutation in Alix protein diminishes miRNAs levels in EVs, it can be concluded that this protein is also important in packing miRNAs into EVs [61, 73].

EVs inner cargos enter the target cells by two methods: endocytosis and fusion [70]. EVs are mainly taken up by endocytosis, according to previous studies [74–77]. Clathrin-dependent endocytosis and clathrin-independent pathways that are mediated by caveolin, phagocytosis, macropinocytosis and lipid raft-mediated uptake are different types of this mechanism [74]. Considering the cell types and components of EVs, a group of them may be absorbed by more than one mechanism[78]. The direct fusion of EVs’ membrane with cell membrane is the second mechanism of EVs entering into the target cells [79]. It was reported that spontaneous transfer of EVs took place between dendritic cells by fusion and release of the inner cargo into the cytoplasmic matrix [75].

Many literatures demonstrated that EVs miRNAs may affect target cells. Valadi et al. made the first report on evident transfer and function of mRNAs and miRNAs of EVs. They found new mouse proteins in the target cells after conveying the cargo of mouse EVs to human mast cells [44].

In addition, Song et al. indicated the transfer of functional miRNAs of MSC-EVs. After treating MSCs with IL-1β, the expression of miR-146a increased. Then, miR-146a was packaged into EVs selectively. As a result of co-culturing the MSC-EVs with macrophages, the level of miR-146a in macrophages had been raised which led to M2 polarization [80].

Many studies have shown the differences of miRNAs between EVs and their parental MSCs. A research showed that the expression of mir-15 and mir-21 was significantly higher in MSCs than their EVs [81]. Baglio et al. manifested that the miR-34a-5p, miR-34c-5p, miR-15a-5p and miR-136-3p are more represented in MSCs than their EVs and miR-4485, miR-150-5p, miR-6087 and miR-486-5p are enriched in MSC-EVs compared to MSCs [82].

There are differences among MSC-EVs’ miRNAs from various sources. Baglio et al. compared the miRNA contents of EVs derived from bone marrow and adipose MSCs. Most abundant miRNAs of bone marrow-derived MSC-EVs were miR-143-3p, miR-10b-5p, miR-486-5p, miR-22-3p and miR-21-5p, whereas, miR-486-5p, miR-10a-5p, miR-10b-5p, miR-191-5p and miR-222-3p were the most frequent miRNAs of adipose-derived MSC-EVs [82]. 171 miRNAs of hBMSC-EVs were disclosed in another research. While 148 miRNAs constitute 0.03 to 0.7% of the total reads, the 23 most abundant miRNAs made up 79.1% of them [83]. Luther et al. showed that the highest expressed EVs miRNA of mouse bone marrow-derived MSCs is miR-21a-5p which is responsible for MSCs cardioprotection [84]. The variety of miRNA profile among MSC-EVs may suggest that the expression of miRNAs is due to multiple factors and the effects of MSC-EVs may be the result of each miRNA synergistical activity with other elements [70]. MSC-EVs’ miRNAs are provided in Table 2.

MSCs’ miRNAs potential therapeutic effects

Over the last years, the effects of many miRNAs on retinal cells development and function have been revealed and the expression of miRNAs in normal and pathological conditions have been investigated. MSC-EVs contain some miRNAs which their roles in retinal cells’ function and development have been proved, so studying them as therapeutic agents for retinal neurodegenerative diseases has not been overlooked.

Therapeutic effects of a number of MSC-EVs’ miRNAs on retinal degenerative diseases have been assessed (Fig. 3). For example, Mead and Tomarev showed that by knocking down the Ago2 which plays a critical role in regulating the biological function of miRNA and the consequent reduction of miRNA abundance in exosomes, the BMSC-derived exosomes (BMSC-Exos) had lost their effects in advancing RGC neuroprotection, axon viability/regeneration and RGC functional maintenance [12]. They concluded that while knocking down Ago2 does not have an influence on exosomes’ protein content, the above results demonstrated the dependency of RGC treatment on miRNA in comparison to the protein. BMSC-derived exosomes contain miR-17-92 which can downregulate phosphatase and tensin homolog (PTEN) expression [85]. As PTEN expression is a major suppressor of RGC axonal growth and survival [86, 87], RGC neuroprotection was done probably by miR-17-92 [12]. miR-21 and miR-146a which were identified in exosomes of umbilical cord MSCs and BMSCs, respectively, may be another candidates of RGC protection and survival [12, 88]. In another study, Zhang et al. showed that MSC exosomes containing miR-126 ameliorate the inflammation and promote vascular repair in diabetic retinopathy (DR). They indicated that miR-126 reduces the inflammation in diabetic rats by inhibiting HMGB1 signaling pathway [89].

Fig. 3.

Fig. 3

MSC-EVs’ miRNAs with studied effects on retinal cells. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment of photoreceptors; OS, outer segment of photoreceptors; RPE, retinal pigment epithelium. General effects of miRNAs on retinal cells: 1differentiaition, 2function, 3survival & apoptosis reduction, 4development & growth, 5reprogramming, 6maturation, 7proliferation, 8protection & maintenance, 9dedifferentiation

Having knowledge of the similarities between miRNAs that have an effect on retinal cells development and function and the miRNA content of MSC-EVs, we can design research and therapies more effectively and specifically for retinal degenerative diseases. Functions of miRNAs in retina can be divided into different categories. Many of them take part in differentiation process (e.g., miR-204, miR-124, miR-30b, miR-133b, …), a remarkable number in development (e.g., miR-181, miR-126, miR-155, miR-17, …), and a group of them in cell proliferation (e.g., miR-103, miR-124, miR-34a, miR-15b, …). Some of them will decrease cell apoptosis and contribute to cell survival and maintenance (e.g., miR-30, miR-124, miR-22, miR-29a, …) while a few participate in neurons’ connectivity and plasticity (miR-124, miR-133b, miR-132). Moreover, therapeutic effects of a number of miRNAs have been discovered in some of retinal diseases. miR-200b, miR-148a-3p and miR-15a act against DR while miR-361, miR-497 and miR-140 are retinoblastoma tumor suppressors. It had also been reported that miR-222 can prevent the progression of retinal degeneration and miR-124 has therapeutic effects on it. A few miRNAs have various proven functions in retina: for instance, miR-204 plays roles in differentiation, development and decreasing apoptosis whereas miR-124 has effects on differentiation, proliferation, survival of photoreceptors, plasticity and connectivity of neurons and a studied positive effect on retinal degeneration. The data are presented in detail in Table 3.

Table 3.

MSC-EVs and retina common miRNAs; their expression, sequences and effects

miRNA Retina expression patterns Sample miRNA sequence, miRBase accession number Effect Retina ref EV ref
miR-204 RPE, amacrine cells, INL, ONL, GCL (adult), Müller glia, mature retina Human, mouse, medaka fish, zebrafish, rat

 > hsa-miR-204-5p MIMAT0000265: UUCCCUUUGUCAUCCUAUGCCU

 > mmu-miR-204-5p MIMAT0000237: UUCCCUUUGUCAUCCUAUGCCU

 > ola-miR-204 MIMAT0022589: UUCCCUUUGUCAUCCUAUGC

 > dre-miR-204-5p MIMAT0001279

UUCCCUUUGUCAUCCUAUGCCU

 > rno-miR-204-5p MIMAT0000877

UUCCCUUUGUCAUCCUAUGCCU

 > hsa-miR-204-3p MIMAT0022693: GCUGGGAAGGCAAAGGGACGU

 > mmu-miR-204-3p MIMAT0017002: GCUGGGAAGGCAAAGGGACGU

 > dre-miR-204-3p MIMAT0031924

GGCUGGGAAGUCAAAGGGACGC

 > rno-miR-204-3p MIMAT0004739

GCUGGGAAGGCAAAGGGACGUU

Differentiation and death of retinal progenitor cells (RPCs). Retinal development. RPE differentiation. Play an important role in the differentiation and function of RPE and retina. Increasing expression from young to adult Müller glia. Expressed in the developing retina during rod photoreceptor differentiation. Inhibition in the medaka fish results gross deficiencies in eye development. Upregulated in light adapted condition. Decreased photoreceptor apoptosis and microglia activation in mouse models of inherited retinal diseases [60, 64–66, 90, 93, 95, 96, 100, 102–104, 107, 179] [166]
miR-124 Adult retina, cone, rod, RPE, ONL, INL except Müller glia, GCL (adult) ARPE-19, Mouse

 > hsa-miR-124-5p MIMAT0004591

CGUGUUCACAGCGGACCUUGAU

 > mmu-miR-124-5p MIMAT0004527

CGUGUUCACAGCGGACCUUGAU

 > hsa-miR-124-3p MIMAT0000422

UAAGGCACGCGGUGAAUGCCAA

 > mmu-miR-124-3p MIMAT0000134

UAAGGCACGCGGUGAAUGCC

Proliferation, differentiation and death of RPCs. Connectivity and plasticity of retinal cells. Controlling the sensitivity of retinal growth cones to the guidance cue Sema3A. Regulating the survival of rod photoreceptors. Stimulating the conversion of cultured murine Müller cells into Müller glia-derived progenitor cells (MGDP). In vitro mouse Müller glia reprogramming into neural progenitors. Survival of cone photoreceptors. Exogenous supplement could be a therapeutic approach for the prevention or treatment of proliferative vitreoretinopathy. Participate in retinal cell maturation and Müller glia reprogramming. MGDP differentiation to retinal neurons. Müller glia to retinal neurons reprogramming. Decrease retinal inflammation and photoreceptor cell death and improve retinal function. Its anti-inflammatory properties have an impact as a therapeutic in treatment of retinal degenerative diseases. Promoting axon growth of RGCs differentiated from RSCs [60, 66, 92–94, 108, 114, 143, 179–181] [154, 163]
miR-124a All layers except RPE, cone, all differentiated neurons, MGDP Mouse, zebra fish

 > hsa-miR-124-5p MIMAT0004591

CGUGUUCACAGCGGACCUUGAU

 > mmu-miR-124-5p MIMAT0004527

CGUGUUCACAGCGGACCUUGAU

 > dre-miR-124-5p MIMAT0031960

CGUGUUCACAGCGGACCUUGAU

 > hsa-miR-124-3p MIMAT0000422

UAAGGCACGCGGUGAAUGCCAA

 > mmu-miR-124-3p MIMAT0000134

UAAGGCACGCGGUGAAUGCC

 > dre-miR-124-3p MIMAT0001819

UAAGGCACGCGGUGAAUGCCAA

Controlling the maturation and survival of retinal cone photoreceptors. Expressed in all neuronal subtypes of the adult retina. Higher levels of expression in photoreceptor cells. Loss of the dominant source of miR-124a triggered death of cone photoreceptors amid retinal development. Essential for the maturation and survival of retinal cones. Knockout of one of the miR-124a genes (miR-124a-1) results in the apoptosis of newly differentiated cone photoreceptors in mice. In MGDPs committed to early neuronal lineages, upregulated during MGDP acquisition of rod phenotypes [65, 90, 93, 99, 104, 110] [156]
miR-181 Retina (GCL, INL), inner plexiform layer Mouse, zebrafish – Retinal axon specification and growth [90, 182] [21, 70, 153, 160, 161]
miR-181a Cone, amacrine cells, GCL, INL, adult retina Mouse, zebra fish, medaka fish

 > hsa-miR-181a-5p MIMAT0000256

AACAUUCAACGCUGUCGGUGAGU

 > mmu-miR-181a-5p MIMAT0000210

AACAUUCAACGCUGUCGGUGAGU

 > dre-miR-181a-5p MIMAT0001623

AACAUUCAACGCUGUCGGUGAGU

 > ola-miR-181a-5p MIMAT0022586

AACAUUCAACGCUGUCGGU

 > hsa-miR-181a-2-3p MIMAT0004558

ACCACUGACCGUUGACUGUACC

 > mmu-miR-181a-2-3p MIMAT0005443

ACCACCGACCGUUGACUGUACC

 > dre-miR-181a-2-3p MIMAT0032007

ACCAUCGACCGUUGACUGUACC

 > ola-miR-181a-3p MIMAT0022587

ACCAUCGACCGUUGACUGUAC

Control the assembly of visual circuitry by regulating retinal axon specification and growth. Regulate proper neuritogenesis in amacrine cells and RGCs. Expressed in amacrine cells during growth and in adult retinas. Present in both GABAergic and glycinergic amacrine cells [60, 90, 94, 95, 99, 100, 118, 119] [154, 158, 161]
miR-181a-5p Retina, RPE Human, in vitro hESC

 > hsa-miR-181a-5p MIMAT0000256

AACAUUCAACGCUGUCGGUGAGU

 > mmu-miR-181a-5p MIMAT0000210

AACAUUCAACGCUGUCGGUGAGU

 > dre-miR-181a-5p MIMAT0001623

AACAUUCAACGCUGUCGGUGAGU

 > ola-miR-181a-5p MIMAT0022586

AACAUUCAACGCUGUCGGU

hESC differentiation into RPE cells [124, 136] [83]
miR-181b Cone, amacrine cells, GCL, ciliary margin zone (CMZ), INL, mature retina Mouse, zebra fish, medaka fish,

 > hsa-miR-181b-5p MIMAT0000257

AACAUUCAUUGCUGUCGGUGGGU

 > mmu-miR-181b-5p MIMAT0000673

AACAUUCAUUGCUGUCGGUGGGUU

 > dre-miR-181b-5p MIMAT0001270

AACAUUCAUUGCUGUCGGUGGG

 > ola-miR-181b-5p MIMAT0022540

AACAUUCAUUGCUGUCGGUGGGUU

 > hsa-miR-181b-3p MIMAT0022692

CUCACUGAACAAUGAAUGCAA

 > mmu-miR-181b-1-3p MIMAT0017067

CUCACUGAACAAUGAAUGCAA

 > dre-miR-181b-3-3p MIMAT0048656

CUCACUGAACAAUGAAUGCAA

 > ola-miR-181b-3p MIMAT0022541

CUCACUGAACGAUGAAUGCA

Control the assembly of visual circuitry by regulating retinal axon specification and growth. Takes part in the specification of later RPCs and mature retinal neurons. Regulate proper neuritogenesis in amacrine cells and RGCs [60, 94, 95, 99, 101, 107, 118] [161]
miR-181c RPE, amacrine cells, GCL, INL, MGDP Human, mouse, zebra fish

 > hsa-miR-181c-5p MIMAT0000258

AACAUUCAACCUGUCGGUGAGU

 > mmu-miR-181c-5p MIMAT0000674

AACAUUCAACCUGUCGGUGAGU

 > dre-miR-181c-5p MIMAT0001852

CACAUUCAUUGCUGUCGGUGGG

 > hsa-miR-181c-3p MIMAT0004559

AACCAUCGACCGUUGAGUGGAC

 > mmu-miR-181c-3p MIMAT0017068

ACCAUCGACCGUUGAGUGGACC

 > dre-miR-181c-3p MIMAT0031980

CUCGCCGGACAAUGAAUGAGAA

Promoting RPE differentiation. Upregulated during MGDP acquisition of rod phenotypes [95, 101, 111, 129] [158, 159, 161, 168]
miR-181d RPE, GCL, INL Human, mouse

 > hsa-miR-181d-5p MIMAT0002821

AACAUUCAUUGUUGUCGGUGGGU

 > mmu-miR-181d-5p MIMAT0004324

AACAUUCAUUGUUGUCGGUGGGU

 > hsa-miR-181d-3p MIMAT0026608

CCACCGGGGGAUGAAUGUCAC

 > mmu-miR-181d-3p MIMAT0017264

CCCACCGGGGGAUGAAUGUCA

Upregulated miRNA in RPE during ESC differentiation [101, 125] [161]
miR-9 Müller Glia, strongly expressed in neonatal retina, CMZ maturing cells and mature amacrine cells, RPE, INL, MGDP, developing retina ARPE-19, mouse, zebrafish

 > hsa-miR-9-5p MIMAT0000441

UCUUUGGUUAUCUAGCUGUAUGA

 > mmu-miR-9-5p MIMAT0000142

UCUUUGGUUAUCUAGCUGUAUGA

 > dre-miR-9-5p MIMAT0001769

UCUUUGGUUAUCUAGCUGUAUGA

 > hsa-miR-9-3p MIMAT0000442

AUAAAGCUAGAUAACCGAAAGU

 > mmu-miR-9-3p MIMAT0000143

AUAAAGCUAGAUAACCGAAAGU

 > dre-miR-9-3p MIMAT0003156

UAAAGCUAGAUAACCGAAAGU

Stimulating the conversion of cultured murine Müller cells into MGDP cells. Play a significant role in orchestrating progenitor competence. Participates in the specification of later progenitor cells and mature retinal neurons. Regulate RPE cell growth, differentiation or development. Increasing expression from young to adult Müller glia. Müller glia to retinal neurons reprogramming. Rescue the effects of Dicer1 deletion on the Müller glia phenotype. Highly expressed in neonatal retina. Upregulated during MGDP acquisition of rod phenotypes (9*). Overexpression leads to decreased RPC proliferation and increased neuronal and glial differentiation. Regulate the transition between early RPCs and late RPCs. Promoted the differentiation of neuronal cells from RSCs [66, 90, 94, 95, 99, 101, 103, 107, 108, 111, 116, 123, 183–186] [187]
miR-182 Rod/cone/bipolar, INL (Not as vigorous as miR-183), GCL, ONL, mature retina Mouse, Zebrafish

 > hsa-miR-182-5p MIMAT0000259

UUUGGCAAUGGUAGAACUCACACU

 > mmu-miR-182-5p MIMAT0000211

UUUGGCAAUGGUAGAACUCACACCG

 > dre-miR-182-5p MIMAT0001271

UUUGGCAAUGGUAGAACUCACA

 > hsa-miR-182-3p MIMAT0000260

UGGUUCUAGACUUGCCAACUA

 > dre-miR-182-3p MIMAT0001272

UGGUUCUAGACUUGCCAACUA

 > mmu-miR-182-3p MIMAT0016995

GUGGUUCUAGACUUGCCAACU

May play crucial roles in the photoreceptors and bipolar cells. Maintain adult cone photoreceptor outer segments and visual function. Maintaining retinal function. Preservation of retinal nerve fiber layer thickness and preservation of RGC function. Tetramethylpyrazine protects primary RGCs against H2O2‑induced damage by suppressing apoptosis and oxidative stress via the miR‑182/mitochondrial apoptotic pathway [90, 99, 101, 107, 120, 188, 189] [190]
miR-183 Rod/cone/bipolar, INL (May have peripheral-to-central gradient), GCL, ONL, mature retina Mouse, zebrafish

 > hsa-miR-183-5p MIMAT0000261

UAUGGCACUGGUAGAAUUCACU

 > mmu-miR-183-5p MIMAT0000212

UAUGGCACUGGUAGAAUUCACU

 > dre-miR-183-5p MIMAT0001273

UAUGGCACUGGUAGAAUUCACUG

 > hsa-miR-183-3p MIMAT0004560

GUGAAUUACCGAAGGGCCAUAA

 > mmu-miR-183-3p MIMAT0004539

GUGAAUUACCGAAGGGCCAUAA

 > dre-miR-183-3p MIMAT0031921

UGAAUUACCAAAGGGCCAUAA

May play important roles in the photoreceptors and bipolar cells. Maintain adult cone photoreceptor outer segments and visual function [99, 101, 107, 120] [70]
miR-96 Rod/cone/bipolar, INL (Not as robust as miR-183), ONL, mature retina Mouse, zebrafish

 > hsa-miR-96-5p MIMAT0000095

UUUGGCACUAGCACAUUUUUGCU

 > mmu-miR-96-5p MIMAT0000541

UUUGGCACUAGCACAUUUUUGCU

 > dre-miR-96-5p MIMAT0001811

UUUGGCACUAGCACAUUUUUGCU

 > hsa-miR-96-3p MIMAT0004510

AAUCAUGUGCAGUGCCAAUAUG

 > mmu-miR-96-3p MIMAT0017021

CAAUCAUGUGUAGUGCCAAUAU

 > dre-miR-96-3p MIMAT0031956

CAAUUAUGUGUAGUGCCAAUAU

May play crucial roles in the photoreceptors and bipolar cells [99, 101, 107] [191]
miR-125b CMZ, INL, GCL, developing retina ARPE-19, in vitro hESC, mouse, zebrafish, Rat,

 > hsa-miR-125b-5p MIMAT0000423

UCCCUGAGACCCUAACUUGUGA

 > mmu-miR-125b-5p MIMAT0000136

UCCCUGAGACCCUAACUUGUGA

 > rno-miR-125b-5p MIMAT0000830

UCCCUGAGACCCUAACUUGUGA

 > dre-miR-125b-5p MIMAT0001821

UCCCUGAGACCCUAACUUGUGA

 > hsa-miR-125b-2-3p MIMAT0004603

UCACAAGUCAGGCUCUUGGGAC

 > mmu-miR-125b-2-3p MIMAT0004529

ACAAGUCAGGUUCUUGGGACCU

 > rno-miR-125b-2-3p MIMAT0026467

ACAAGUCAGGCUCUUGGGACCU

 > dre-miR-125b-2-3p MIMAT0031964

CGGGUUGGGUUCUCGGGAGCU

 > hsa-miR-125b-1-3p MIMAT0004592

ACGGGUUAGGCUCUUGGGAGCU

 > mmu-miR-125b-1-3p MIMAT0004669

ACGGGUUAGGCUCUUGGGAGCU

 > rno-miR-125b-1-3p MIMAT0004730

ACGGGUUAGGCUCUUGGGAGCU

 > dre-miR-125b-1-3p MIMAT0031963

ACGGGUUAGGUUCUUGGGAGCU

Play a significant role in orchestrating progenitor competence. Regulate cell growth, differentiation or development. Important functions during human RPE cell differentiation [90, 99, 107, 124, 125, 183] [40, 154, 156, 159, 164, 165, 174]
miR-125b-5p Retina, Müller glia Human, in vitro hESC

 > hsa-miR-125b-5p MIMAT0000423

UCCCUGAGACCCUAACUUGUGA

 > mmu-miR-125b-5p MIMAT0000136

UCCCUGAGACCCUAACUUGUGA

Increasing expression from young to adult Müller glia. hESC differentiation into RPE cells [66, 124, 136] [21, 61, 82, 83, 88, 159, 172, 173, 175]
miR-26 Rod Mouse

 > hsa-miR-26a-5p MIMAT0000082

UUCAAGUAAUCCAGGAUAGGCU

 > mmu-miR-26a-5p MIMAT0000533

UUCAAGUAAUCCAGGAUAGGCU

 > hsa-miR-26a-1-3p MIMAT0004499

CCUAUUCUUGGUUACUUGCACG

 > mmu-miR-26a-1-3p MIMAT0017020

CCUAUUCUUGGUUACUUGCACG

 > hsa-miR-26b-5p MIMAT0000083

UUCAAGUAAUUCAGGAUAGGU

 > mmu-miR-26b-5p MIMAT0000534

UUCAAGUAAUUCAGGAUAGGU

 > hsa-miR-26b-3p MIMAT0004500

CCUGUUCUCCAUUACUUGGCU

 > mmu-miR-26b-3p MIMAT0004630

CCUGUUCUCCAUUACUUGGCUC

Regulating the survival of rod photoreceptors [94, 192] [193]
miR-26a RPE, Cone, Retina Human, mouse

 > hsa-miR-26a-5p MIMAT0000082

UUCAAGUAAUCCAGGAUAGGCU

 > mmu-miR-26a-5p MIMAT0000533

UUCAAGUAAUCCAGGAUAGGCU

 > hsa-miR-26a-2-3p MIMAT0004681

CCUAUUCUUGAUUACUUGUUUC

 > mmu-miR-26a-2-3p MIMAT0017058

CCUGUUCUUGAUUACUUGUUUC

 > hsa-miR-26a-1-3p MIMAT0004499

CCUAUUCUUGGUUACUUGCACG

 > mmu-miR-26a-1-3p MIMAT0017020

CCUAUUCUUGGUUACUUGCACG

Upregulated miRNA in RPE during ESC differentiation [90, 107, 120, 125] [154]
miR-26a-5p Retina, RPE Human, in vitro hESC

 > hsa-miR-26a-5p MIMAT0000082

UUCAAGUAAUCCAGGAUAGGCU

 > mmu-miR-26a-5p MIMAT0000533

UUCAAGUAAUCCAGGAUAGGCU

hESC differentiation into RPE cells [124, 136] [82, 156]
miR-30 Rod Mouse

 > hsa-miR-30a-5p MIMAT0000087

UGUAAACAUCCUCGACUGGAAG

 > mmu-miR-30a-5p MIMAT0000128

UGUAAACAUCCUCGACUGGAAG

 > hsa-miR-30a-3p MIMAT0000088

CUUUCAGUCGGAUGUUUGCAGC

 > mmu-miR-30a-3p MIMAT0000129

CUUUCAGUCGGAUGUUUGCAGC

 > hsa-miR-30e-5p MIMAT0000692

UGUAAACAUCCUUGACUGGAAG

 > mmu-miR-30e-5p MIMAT0000248

UGUAAACAUCCUUGACUGGAAG

 > hsa-miR-30e-3p MIMAT0000693

CUUUCAGUCGGAUGUUUACAGC

 > mmu-miR-30e-3p MIMAT0000249

CUUUCAGUCGGAUGUUUACAGC

 > hsa-miR-30c-5p MIMAT0000244

UGUAAACAUCCUACACUCUCAGC

 > mmu-miR-30c-5p MIMAT0000514

UGUAAACAUCCUACACUCUCAGC

 > mmu-miR-30c-5p MIMAT0000514

UGUAAACAUCCUACACUCUCAGC

 > hsa-miR-30c-2-3p MIMAT0004550

CUGGGAGAAGGCUGUUUACUCU

 > mmu-miR-30c-2-3p MIMAT0005438

CUGGGAGAAGGCUGUUUACUCU

 > mmu-miR-30c-1-3p MIMAT0004616

CUGGGAGAGGGUUGUUUACUCC

 > hsa-miR-30d-5p MIMAT0000245

UGUAAACAUCCCCGACUGGAAG

 > mmu-miR-30d-5p MIMAT0000515

UGUAAACAUCCCCGACUGGAAG

 > hsa-miR-30d-3p MIMAT0004551

CUUUCAGUCAGAUGUUUGCUGC

 > mmu-miR-30d-3p MIMAT0017011

CUUUCAGUCAGAUGUUUGCUGC

 > hsa-miR-30b-5p MIMAT0000420

UGUAAACAUCCUACACUCAGCU

 > mmu-miR-30b-5p MIMAT0000130

UGUAAACAUCCUACACUCAGCU

 > hsa-miR-30b-3p MIMAT0004589

CUGGGAGGUGGAUGUUUACUUC

 > mmu-miR-30b-3p MIMAT0004524

CUGGGAUGUGGAUGUUUACGUC

 > mmu-miR-30f MIMAT0025179

GUAAACAUCCGACUGAAAGCUC

Regulating the survival of rod photoreceptors. Preservation of retinal nerve fiber layer thickness and preservation of RGC function [94, 189, 192] [21, 61, 70]
miR-30a GCL, INL Mouse

 > hsa-miR-30a-5p MIMAT0000087

UGUAAACAUCCUCGACUGGAAG

 > mmu-miR-30a-5p MIMAT0000128

UGUAAACAUCCUCGACUGGAAG

 > hsa-miR-30a-3p MIMAT0000088

CUUUCAGUCGGAUGUUUGCAGC

 > mmu-miR-30a-3p MIMAT0000129

CUUUCAGUCGGAUGUUUGCAGC

ND [101, 107] [158]
miR-30b RGC, GCL, INL, RPE In vitro hESC, mouse, rat

 > hsa-miR-30b-5p MIMAT0000420

UGUAAACAUCCUACACUCAGCU

 > mmu-miR-30b-5p MIMAT0000130

UGUAAACAUCCUACACUCAGCU

 > rno-miR-30b-5p MIMAT0000806

UGUAAACAUCCUACACUCAGCU

 > hsa-miR-30b-3p MIMAT0004589

CUGGGAGGUGGAUGUUUACUUC

 > mmu-miR-30b-3p MIMAT0004524

CUGGGAUGUGGAUGUUUACGUC

 > rno-miR-30b-3p MIMAT0004721

CUGGGAUGUGGAUGUUUACGUC

Upregulated in dark adaptation. Promotes axon outgrowth of RGCs. hESC differentiation into RPE cells [90, 124, 194] [156, 168]
miR-126 Retina Mouse

 > hsa-miR-126-5p MIMAT0000444

CAUUAUUACUUUUGGUACGCG

 > mmu-miR-126a-5p MIMAT0000137

CAUUAUUACUUUUGGUACGCG

 > hsa-miR-126-3p MIMAT0000445

UCGUACCGUGAGUAAUAAUGCG

 > mmu-miR-126a-3p MIMAT0000138

UCGUACCGUGAGUAAUAAUGCG

Upregulated in dark adaptation. Vascularization of the retina was severely impaired in mice that survived the miR-126 deletion. Required for the development of different retinal vascular layers. miR-126-5p is expressed in endothelial cells but also by retinal ganglion cells (RGCs) of the mouse postnatal retina and takes part in protecting endothelial cells from apoptosis during the development of the retinal vasculature. Survival of Müller cells in a mouse model using vimentin fluorescence staining. A potential therapeutic agent to keep the stability of the Blood Retina Barrier (BRB) in ischemic retinopathy. Reduces hyperglycemia-induced retinal inflammation by downregulating the HMGB1 signaling pathway [90, 128, 195–197] [61, 89, 152, 156, 160, 167, 168]
miR-126-3p RPE Human, mouse

 > hsa-miR-126-3p MIMAT0000445

UCGUACCGUGAGUAAUAAUGCG

 > mmu-miR-126a-3p MIMAT0000138

UCGUACCGUGAGUAAUAAUGCG

 > mmu-miR-126b-3p MIMAT0029895

CGCGUACCAAAAGUAAUAAUGUG

Repress vascular endothelial growth factor (VEGF-A) expression in RPE cells [101, 136, 195] [61, 168]
miR-107 Retina Mouse

 > hsa-miR-107 MIMAT0000104

AGCAGCAUUGUACAGGGCUAUCA

 > mmu-miR-107-3p MIMAT0000647

AGCAGCAUUGUACAGGGCUAUCA

Upregulated in dark adaptation [90] [154]
miR-103 Developing retina Mouse

 > hsa-miR-103a-2-5p MIMAT0009196

AGCUUCUUUACAGUGCUGCCUUG

 > mmu-miR-103–2-5p MIMAT0017025

AGCUUCUUUACAGUGCUGCCUUG

 > hsa-miR-103a-3p MIMAT0000101

AGCAGCAUUGUACAGGGCUAUGA

 > mmu-miR-103-3p MIMAT0000546

AGCAGCAUUGUACAGGGCUAUGA

 > hsa-miR-103a-1-5p MIMAT0037306

GGCUUCUUUACAGUGCUGCCUUG

 > mmu-miR-103–1-5p MIMAT0017024

GGCUUCUUUACAGUGCUGCCUUG

Upregulated in dark adaptation. Regulates mitotic proliferation [90, 107] [154]
miR-31 MGDP cells, RPE Mouse, zebra fish

 > hsa-miR-31-5p MIMAT0000089

AGGCAAGAUGCUGGCAUAGCU

 > mmu-miR-31-5p MIMAT0000538

AGGCAAGAUGCUGGCAUAGCUG

 > hsa-miR-31-3p MIMAT0004504

UGCUAUGCCAACAUAUUGCCAU

 > mmu-miR-31-3p MIMAT0004634

UGCUAUGCCAACAUAUUGCCAUC

 > dre-miR-31 MIMAT0003347

UGGCAAGAUGUUGGCAUAGCUG

Proliferation of MGDP cells. Knockdown reduces INL proliferation at 72 h of constant light. MGDP’s proliferation [66, 90, 101, 108, 109] [154, 174]
Let-7 INL / GCL, rod Mouse – Differentiation and death of RPCs. Regulating the survival of rod photoreceptors. Play a significant role in orchestrating progenitor competence. Participates in retinal cell maturation and Müller glia reprogramming. Influence the neuronal versus glial decision and the final differentiation of Müller glia. Critically involved in Wnt/Lin28-regulated Müller glia proliferation. May link cell proliferation to developmental time and regulate the ongoing cell cycle elongation that takes place during development. Expression maintains the differentiated state of Müller glia cells. Regulate the transition between early RPCs and late RPCs [66, 90, 93, 94, 183, 185, 198–200] [152]
Let-7a RPE, retina, developing retina Human, ARPE-19, in vitro hESC, mouse

 > hsa-let-7a-5p MIMAT0000062

UGAGGUAGUAGGUUGUAUAGUU

 > mmu-let-7a-5p MIMAT0000521

UGAGGUAGUAGGUUGUAUAGUU

 > hsa-let-7a-3p MIMAT0004481

CUAUACAAUCUACUGUCUUUC

 > mmu-let-7a-1-3p MIMAT0004620

CUAUACAAUCUACUGUCUUUCC

 > hsa-let-7a-2-3p MIMAT0010195

CUGUACAGCCUCCUAGCUUUCC

 > mmu-let-7a-2-3p MIMAT0017015

CUGUACAGCCUCCUAGCUUUC

Upregulated miRNA in RPE during ESC Differentiation. Regulate RPE cell growth, differentiation or development. Müller glia dedifferentiation. Important functions during human RPE cell differentiation [66, 107, 123–125] [154, 156, 165]
Let-7a-5p Retina Human, in vitro hESC

 > hsa-let-7a-5p MIMAT0000062

UGAGGUAGUAGGUUGUAUAGUU

 > mmu-let-7a-5p MIMAT0000521

UGAGGUAGUAGGUUGUAUAGUU

hESC differentiation into RPE cells [124, 136] [3, 82, 83, 172, 173, 175]
Let-7b Retina, CMZ, INL, RPE, developing retina ARPE-19, mouse, zebrafish

 > hsa-let-7b-5p MIMAT0000063

UGAGGUAGUAGGUUGUGUGGUU

 > mmu-let-7b-5p MIMAT0000522

UGAGGUAGUAGGUUGUGUGGUU

 > dre-let-7b MIMAT0001760

UGAGGUAGUAGGUUGUGUGGUU

 > hsa-let-7b-3p MIMAT0004482

CUAUACAACCUACUGCCUUCCC

 > mmu-let-7b-3p MIMAT0004621

CUAUACAACCUACUGCCUUCCC

Participates in the functions of RSCs or early RPCs. Regulate RPE cell growth, differentiation or development. RPC differentiation enhancement [90, 99, 100, 107, 123, 201] [21, 154, 156, 158, 160, 161, 167, 168]
Let-7b-5p RPE Human

 > hsa-let-7b-5p MIMAT0000063

UGAGGUAGUAGGUUGUGUGGUU

 > mmu-let-7b-5p MIMAT0000522

UGAGGUAGUAGGUUGUGUGGUU

ND [136] [83]
Let-7c RPE, retina Human, mouse

 > hsa-let-7c-5p MIMAT0000064

UGAGGUAGUAGGUUGUAUGGUU

 > mmu-let-7c-5p MIMAT0000523

UGAGGUAGUAGGUUGUAUGGUU

 > hsa-let-7c-3p MIMAT0026472

CUGUACAACCUUCUAGCUUUCC

 > mmu-let-7c-1-3p MIMAT0004622

CUGUACAACCUUCUAGCUUUCC

Upregulated in RPE during ESC differentiation [107, 125] [21, 70, 154, 156, 160, 167]
Let-7c-5p Retina Human

 > hsa-let-7c-5p MIMAT0000064

UGAGGUAGUAGGUUGUAUGGUU

 > mmu-let-7c-5p MIMAT0000523

UGAGGUAGUAGGUUGUAUGGUU

ND [136] [83]
Let-7d INL (amacrine, bipolar), RPE, retina ARPE-19, mouse

 > hsa-let-7d-5p MIMAT0000065

AGAGGUAGUAGGUUGCAUAGUU

 > mmu-let-7d-5p MIMAT0000383

AGAGGUAGUAGGUUGCAUAGUU

 > hsa-let-7d-3p MIMAT0004484

CUAUACGACCUGCUGCCUUUCU

 > mmu-let-7d-3p MIMAT0000384

CUAUACGACCUGCUGCCUUUCU

Regulate RPE cell growth, differentiation or development. Plays crucial roles in neural fate specification with foreseeable function in RPC differentiation [99, 103, 107, 123] [154]
Let-7e GCL, INL, photoreceptors, retina Mouse

 > hsa-let-7e-5p MIMAT0000066

UGAGGUAGGAGGUUGUAUAGUU

 > mmu-let-7e-5p MIMAT0000524

UGAGGUAGGAGGUUGUAUAGUU

 > hsa-let-7e-3p MIMAT0004485

CUAUACGGCCUCCUAGCUUUCC

 > mmu-let-7e-3p MIMAT0017016

CUAUACGGCCUCCUAGCUUUCC

Regulate RPE cell growth, differentiation or development. hESC differentiation into RPE cells [101, 107, 123] [83, 154, 156]
Let-7f RPE, cone, developing retina Human, Mouse

 > hsa-let-7f-5p MIMAT0000067

UGAGGUAGUAGAUUGUAUAGUU

 > mmu-let-7f-5p MIMAT0000525

UGAGGUAGUAGAUUGUAUAGUU

 > hsa-let-7f-1-3p MIMAT0004486

CUAUACAAUCUAUUGCCUUCCC

 > mmu-let-7f-1-3p MIMAT0004623

CUAUACAAUCUAUUGCCUUCCC

 > hsa-let-7f-2-3p MIMAT0004487

CUAUACAGUCUACUGUCUUUCC

 > mmu-let-7f-2-3p MIMAT0017017

CUAUACAGUCUACUGUCUUUC

Upregulated in dark adaptation. Upregulated miRNA in RPE during ESC Differentiation [90, 94, 107, 125] [154, 156, 165]
Let-7f-5p Retina, RPE Human, in vitro hESC

 > hsa-let-7f-5p MIMAT0000067

UGAGGUAGUAGAUUGUAUAGUU

 > mmu-let-7f-5p MIMAT0000525

UGAGGUAGUAGAUUGUAUAGUU

hESC differentiation into RPE cells [124, 136] [82, 88, 175]
Let-7i RPE, retina Human, mouse

 > hsa-let-7i-5p MIMAT0000415

UGAGGUAGUAGUUUGUGCUGUU

 > mmu-let-7i-5p MIMAT0000122

UGAGGUAGUAGUUUGUGCUGUU

 > hsa-let-7i-3p MIMAT0004585

CUGCGCAAGCUACUGCCUUGCU

 > mmu-let-7i-3p MIMAT0004520

CUGCGCAAGCUACUGCCUUGCU

Upregulated in dark adaptation. Upregulated miRNA in RPE during ESC differentiation [90, 107, 125] [82, 83, 154]
miR-23a RPE, GCL, Müller glia, retina Human, ARPE-19, in vitro Müller glia, mouse

 > hsa-miR-23a-5p MIMAT0004496

GGGGUUCCUGGGGAUGGGAUUU

 > mmu-miR-23a-5p MIMAT0017019

GGGGUUCCUGGGGAUGGGAUUU

 > hsa-miR-23a-3p MIMAT0000078

AUCACAUUGCCAGGGAUUUCC

 > mmu-miR-23a-3p MIMAT0000532

AUCACAUUGCCAGGGAUUUCC

Upregulated miRNA in RPE during ESC differentiation. Downregulated in the RPE derived from patients with AMD, manipulation of this miRNA modulated the susceptibility to apoptosis of RPE-derived cell lines. Increasing expression from young to adult Müller glia. Increased expression in in vitro Müller glia. Müller glia dedifferentiation. miR‐374 can work with miR‐23a to cooperatively regulate the expression of Brn3b, thereby influencing RGC development [65, 66, 90, 101, 107, 123, 125, 202] [154, 156, 159, 165]
miR-23a-3p RPE, retina Human, in vitro hESC

 > hsa-miR-23a-3p MIMAT0000078

AUCACAUUGCCAGGGAUUUCC

 > mmu-miR-23a-3p MIMAT0000532

AUCACAUUGCCAGGGAUUUCC

hESC differentiation into RPE cells [124, 136] [83, 88, 173, 175, 203]
miR-106 Retina Mouse

 > hsa-miR-106a-5p MIMAT0000103

AAAAGUGCUUACAGUGCAGGUAG

 > mmu-miR-106a-5p MIMAT0000385

CAAAGUGCUAACAGUGCAGGUAG

 > hsa-miR-106a-3p MIMAT0004517

CUGCAAUGUAAGCACUUCUUAC

 > mmu-miR-106a-3p MIMAT0017009

ACUGCAGUGCCAGCACUUCUUAC

 > hsa-miR-106b-5p MIMAT0000680

UAAAGUGCUGACAGUGCAGAU

 > mmu-miR-106b-5p MIMAT0000386

UAAAGUGCUGACAGUGCAGAU

 > hsa-miR-106b-3p MIMAT0004672

CCGCACUGUGGGUACUUGCUGC

 > mmu-miR-106b-3p MIMAT0004582

CCGCACUGUGGGUACUUGCUGC

Key regulators of the neurogenic-to-gliogenic transition in neural progenitor cells [66, 90] [203]
miR-106a GCL, INL, RPE, developing retina Mouse

 > hsa-miR-106a-5p MIMAT0000103

AAAAGUGCUUACAGUGCAGGUAG

 > mmu-miR-106a-5p MIMAT0000385

CAAAGUGCUAACAGUGCAGGUAG

 > hsa-miR-106a-3p MIMAT0004517

CUGCAAUGUAAGCACUUCUUAC

 > mmu-miR-106a-3p MIMAT0017009

ACUGCAGUGCCAGCACUUCUUAC

Regulates mitotic proliferation [101, 107] [172]
miR-143 Retina, Müller glia In vitro Müller glia, mouse

 > hsa-miR-143-5p MIMAT0004599

GGUGCAGUGCUGCAUCUCUGGU

 > mmu-miR-143-5p MIMAT0017006

GGUGCAGUGCUGCAUCUCUGG

 > hsa-miR-143-3p MIMAT0000435

UGAGAUGAAGCACUGUAGCUC

 > mmu-miR-143-3p MIMAT0000247

UGAGAUGAAGCACUGUAGCUC

Increased expression in in vitro Müller glia. Alleviates retinal neovascularization [66, 90, 107, 204] [42, 153, 154, 163]
miR-142-5p Retina, RPE Human

 > hsa-miR-142-5p MIMAT0000433

CAUAAAGUAGAAAGCACUACU

 > mmu-miR-142a-5p MIMAT0000154

CAUAAAGUAGAAAGCACUACU

ND [136] [174]
miR-143-3p Retina Human

 > hsa-miR-143-3p MIMAT0000435

UGAGAUGAAGCACUGUAGCUC

 > mmu-miR-143-3p MIMAT0000247

UGAGAUGAAGCACUGUAGCUC

ND [136] [82–84, 88]
miR-200b Retina, developing retina, ganglion cell, Müller glia cell, human Müller cell line Mouse, rat

 > hsa-miR-200b-5p MIMAT0004571

CAUCUUACUGGGCAGCAUUGGA

 > mmu-miR-200b-5p MIMAT0004545

CAUCUUACUGGGCAGCAUUGGA

 > rno-miR-200b-5p MIMAT0017152

CAUCUUACUGGGCAGCAUUGGA

 > hsa-miR-200b-3p MIMAT0000318

UAAUACUGCCUGGUAAUGAUGA

 > mmu-miR-200b-3p MIMAT0000233

UAAUACUGCCUGGUAAUGAUGA

 > rno-miR-200b-3p MIMAT0000875

UAAUACUGCCUGGUAAUGAUGAC

The regulation of miR-200b in retinal neovascular diseases may prohibit the deviating expression of critical factors associated with pathological angiogenesis. Therapeutic effect on DR [90, 107, 128, 134, 205] [156]
miR-206 Retina Human, rat

 > hsa-miR-206 MIMAT0000462

UGGAAUGUAAGGAAGUGUGUGG

 > rno-miR-206-3p MIMAT0000879

UGGAAUGUAAGGAAGUGUGUGG

ND [90] [61, 166]
miR-146a Müller glia Human, zebra fish, rat

 > hsa-miR-146a-5p MIMAT0000449

UGAGAACUGAAUUCCAUGGGUU

 > rno-miR-146a-5p MIMAT0000852

UGAGAACUGAAUUCCAUGGGUU

 > dre-miR-146a MIMAT0001843

UGAGAACUGAAUUCCAUAGAUGG

 > hsa-miR-146a-3p MIMAT0004608

CCUCUGAAAUUCAGUUCUUCAG

 > rno-miR-146a-3p MIMAT0017132

ACCUGUGAAGUUCAGUUCUUU

Proliferation of MGDP cells. Play roles in Müller glia dedifferentiation and proliferation, along with neuronal progenitor cell proliferation and migration. Its reduction reduces INL proliferation at 51 h of light treatment. The rhythmicity of miR-146a expression in the diabetic retina may proceed to mediate rhythmicity of the inflammatory response in retinal cells and provide a new approach to regulation of inflammation in DR. A potential therapeutic target for reducing inflammation in retinal microvascular endothelial cells through inhibition of TLR4/NF-κB and TNFα. Differentiation process of human parthenogenetic embryonic stem cell (hPESC)-derived RPE cells [91, 108, 109, 131, 206] [21, 61, 152–156, 158–161]
miR-146a-5p RPE Human

 > hsa-miR-146a-5p MIMAT0000449

UGAGAACUGAAUUCCAUGGGUU

 > mmu-miR-146a-5p MIMAT0000158

UGAGAACUGAAUUCCAUGGGUU

ND [136] [82]
miR-886 RPE Human

 > hsa-mir-886 MI0005527

CACUCCUACCCGGGUCGGAGUUAGCUCAAGCGGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUUAUGCAAUAA

Differentiation process of hPESC-derived RPE cells [91] [152]
miR-10a RPE Human

 > hsa-miR-10a-5p MIMAT0000253

UACCCUGUAGAUCCGAAUUUGUG

 > mmu-miR-10a-5p MIMAT0000648

UACCCUGUAGAUCCGAAUUUGUG

 > hsa-miR-10a-3p MIMAT0004555

CAAAUUCGUAUCUAGGGGAAUA

 > mmu-miR-10a-3p MIMAT0004659

CAAAUUCGUAUCUAGGGGAAUA

Differentiation process of hPESC-derived RPE cells [91] [193]
miR-10a-5p RPE Human

 > hsa-miR-10a-5p MIMAT0000253

UACCCUGUAGAUCCGAAUUUGUG

 > mmu-miR-10a-5p MIMAT0000648

UACCCUGUAGAUCCGAAUUUGUG

ND [136] [82]
miR-34a RPE, retina ARPE-19, in vitro hESC, mouse

 > hsa-miR-34a-5p MIMAT0000255

UGGCAGUGUCUUAGCUGGUUGU

 > mmu-miR-34a-5p MIMAT0000542

UGGCAGUGUCUUAGCUGGUUGU

 > hsa-miR-34a-3p MIMAT0004557

CAAUCAGCAAGUAUACUGCCCU

 > mmu-miR-34a-3p MIMAT0017022

AAUCAGCAAGUAUACUGCCCU

Inhibit the proliferation and migration of RPE cells. Modulated the proliferation and migration of cultured RPE cell lines. hESC differentiation into RPE cells [65, 107, 124, 135] [83, 156]
miR-22 Rod, RPE, Müller glia, retina Human, in vitro Müller glia, mouse

 > hsa-miR-22-5p MIMAT0004495

AGUUCUUCAGUGGCAAGCUUUA

 > mmu-miR-22-5p MIMAT0004629

AGUUCUUCAGUGGCAAGCUUUA

 > hsa-miR-22-3p MIMAT0000077

AAGCUGCCAGUUGAAGAACUGU

 > mmu-miR-22-3p MIMAT0000531

AAGCUGCCAGUUGAAGAACUGU

Regulating the survival of rod photoreceptors. Upregulated miRNA in RPE during ESC differentiation. Increased expression in in vitro Müller glia [66, 94, 107, 125, 192] [21, 40, 42, 61, 70, 154, 156, 164, 169, 170]
miR-22-3p Retina Human

 > hsa-miR-22-3p MIMAT0000077

AAGCUGCCAGUUGAAGAACUGU

 > mmu-miR-22-3p MIMAT0000531

AAGCUGCCAGUUGAAGAACUGU

A suppressive task in RPE damage by targeting NLRP3, which provides novel insights into the upcoming intervention to retinopathy [136, 207] [82–84, 88]
miR-191 GCL, INL, ONL, cone, developing retina Mouse

 > hsa-miR-191-5p MIMAT0000440

CAACGGAAUCCCAAAAGCAGCUG

 > mmu-miR-191-5p MIMAT0000221

CAACGGAAUCCCAAAAGCAGCUG

 > hsa-miR-191-3p MIMAT0001618

GCUGCGCUUGGAUUUCGUCCCC

 > mmu-miR-191-3p MIMAT0004542

GCUGCACUUGGAUUUCGUUCCC

ND [101, 107, 120] [154, 165]
miR-191-5p Retina Human

 > hsa-miR-191-5p MIMAT0000440

CAACGGAAUCCCAAAAGCAGCUG

 > mmu-miR-191-5p MIMAT0000221

CAACGGAAUCCCAAAAGCAGCUG

ND [136] [82, 83]
miR-127-3p Retina Human

 > hsa-miR-127-3p MIMAT0000446

UCGGAUCCGUCUGAGCUUGGCU

 > mmu-miR-127-3p MIMAT0000139

UCGGAUCCGUCUGAGCUUGGCU

ND [136] [21, 82, 83]
miR-27b-3p Retina, RPE Human, in vitro hESC

 > hsa-miR-27b-3p MIMAT0000419

UUCACAGUGGCUAAGUUCUGC

 > mmu-miR-27b-3p MIMAT0000126

UUCACAGUGGCUAAGUUCUGC

hESC differentiation into RPE cells [124, 136] [82, 83, 152]
miR-92 Rod, strongly expressed in neonatal retina Mouse

 > hsa-miR-92a-2-5p MIMAT0004508

GGGUGGGGAUUUGUUGCAUUAC

 > mmu-miR-92a-2-5p MIMAT0004635

AGGUGGGGAUUGGUGGCAUUAC

 > hsa-miR-92a-3p MIMAT0000092

UAUUGCACUUGUCCCGGCCUGU

 > mmu-miR-92a-3p MIMAT0000539

UAUUGCACUUGUCCCGGCCUG

 > hsa-miR-92a-1-5p MIMAT0004507

AGGUUGGGAUCGGUUGCAAUGCU

 > mmu-miR-92a-1-5p MIMAT0017066

AGGUUGGGAUUUGUCGCAAUGCU

 > hsa-miR-92b-5p MIMAT0004792

AGGGACGGGACGCGGUGCAGUG

 > mmu-miR-92b-5p MIMAT0017278

AGGGACGGGACGUGGUGCAGUGUU

 > hsa-miR-92b-3p MIMAT0003218

UAUUGCACUCGUCCCGGCCUCC

 > mmu-miR-92b-3p MIMAT0004899

UAUUGCACUCGUCCCGGCCUCC

Regulating the survival of rod photoreceptors. Preservation of retinal nerve fiber layer thickness and preservation of RGC function [94, 95, 189, 192] [12, 21, 85]
miR-92a-3p Retina Human, mouse

 > hsa-miR-92a-3p MIMAT0000092

UAUUGCACUUGUCCCGGCCUGU

 > mmu-miR-92a-3p MIMAT0000539

UAUUGCACUUGUCCCGGCCUG

Retinal development [133, 136] [3, 82, 84, 172]
miR-92b-3p Retina Human

 > hsa-miR-92b-3p MIMAT0003218

UAUUGCACUCGUCCCGGCCUCC

 > mmu-miR-92b-3p MIMAT0004899

UAUUGCACUCGUCCCGGCCUCC

Photoreceptor development and differentiation. RGC development and differentiation [136, 208] [82]
miR-99b RPE, INL, photoreceptors, developing retina Human, mouse

 > hsa-miR-99b-5p MIMAT0000689

CACCCGUAGAACCGACCUUGCG

 > mmu-miR-99b-5p MIMAT0000132

CACCCGUAGAACCGACCUUGCG

 > hsa-miR-99b-3p MIMAT0004678

CAAGCUCGUGUCUGUGGGUCCG

 > mmu-miR-99b-3p MIMAT0004525

CAAGCUCGUGUCUGUGGGUCCG

Promoting RPE differentiation [101, 107, 129] [193]
miR-99b-5p Retina Human

 > hsa-miR-99b-5p MIMAT0000689

CACCCGUAGAACCGACCUUGCG

 > mmu-miR-99b-5p MIMAT0000132

CACCCGUAGAACCGACCUUGCG

ND [136] [82]
miR-16 Retina, RPE, developing retina ARPE-19, rabbit, mouse

 > hsa-miR-16-5p MIMAT0000069

UAGCAGCACGUAAAUAUUGGCG

 > mmu-miR-16-5p MIMAT0000527

UAGCAGCACGUAAAUAUUGGCG

 > ocu-miR-16b-5p MIMAT0048107

UAGCAGCACGUAAAUAUUGGCGU

 > ocu-miR-16a-5p MIMAT0048105

UAGCAGCACGUAAAUACUGGCG

 > hsa-miR-16–1-3p MIMAT0004489

CCAGUAUUAACUGUGCUGCUGA

 > mmu-miR-16–1-3p MIMAT0004625

CCAGUAUUGACUGUGCUGCUGA

 > ocu-miR-16a-3p MIMAT0048106

CCAGUAUUAACUGUGCUGCUGAA

 > hsa-miR-16–2-3p MIMAT0004518

CCAAUAUUACUGUGCUGCUUUA

 > mmu-miR-16–2-3p MIMAT0017018

ACCAAUAUUAUUGUGCUGCUUU

 > ocu-miR-16b-3p MIMAT0048108

ACCAAUAUUAUUGUGCUGCUUUA

Play a role in retinal development. Regulate RPE cell growth, differentiation. Inhibition of insulin resistance in diabetic retina [107, 123, 127, 137] [61, 156, 165, 170, 174]
miR-16-5p Retina, RPE Human, in vitro hESC

 > hsa-miR-16-5p MIMAT0000069

UAGCAGCACGUAAAUAUUGGCG

 > mmu-miR-16-5p MIMAT0000527

UAGCAGCACGUAAAUAUUGGCG

hESC differentiation into RPE cells [124, 136] [61, 83, 172, 173]
miR-148a Retina Mouse

 > hsa-miR-148a-5p MIMAT0004549

AAAGUUCUGAGACACUCCGACU

 > mmu-miR-148a-5p MIMAT0004617

AAAGUUCUGAGACACUCCGACU

 > hsa-miR-148a-3p MIMAT0000243

UCAGUGCACUACAGAACUUUGU

 > mmu-miR-148a-3p MIMAT0000516

UCAGUGCACUACAGAACUUUGU

ND [106, 107] [193]
miR-148a-3p Retina Human

 > hsa-miR-148a-3p MIMAT0000243

UCAGUGCACUACAGAACUUUGU

 > mmu-miR-148a-3p MIMAT0000516

UCAGUGCACUACAGAACUUUGU

Moderates high glucose-induced DR by targeting TGFB2 and FGF2 [136, 209] [83]
miR-125a Retina Mouse

 > hsa-miR-125a-5p MIMAT0000443

UCCCUGAGACCCUUUAACCUGUGA

 > mmu-miR-125a-5p MIMAT0000135

UCCCUGAGACCCUUUAACCUGUGA

 > hsa-miR-125a-3p MIMAT0004602

ACAGGUGAGGUUCUUGGGAGCC

 > mmu-miR-125a-3p MIMAT0004528

ACAGGUGAGGUUCUUGGGAGCC

Regulate the transition between early RPCs and late RPCs [92, 125, 185] [61, 156, 174]
miR-125a-5p Retina, RPE, developing retina Human, in vitro hESC, mouse

 > hsa-miR-125a-5p MIMAT0000443

UCCCUGAGACCCUUUAACCUGUGA

 > mmu-miR-125a-5p MIMAT0000135

UCCCUGAGACCCUUUAACCUGUGA

hESC differentiation into RPE cells [107, 124, 136] [83, 154]
miR-100 RPE, Müller glia, developing retina Human, mouse

 > hsa-miR-100-5p MIMAT0000098

AACCCGUAGAUCCGAACUUGUG

 > mmu-miR-100-5p MIMAT0000655

AACCCGUAGAUCCGAACUUGUG

 > hsa-miR-100-3p MIMAT0004512

CAAGCUUGUAUCUAUAGGUAUG

 > mmu-miR-100-3p MIMAT0017051

ACAAGCUUGUGUCUAUAGGUAU

Promoting RPE differentiation. Upregulated miRNA in RPE during ESC differentiation. Increasing expression from young to adult Müller glia. Regulates mitotic proliferation [66, 107, 125, 129] [153, 154, 156, 159, 165, 174]
miR-100-5p Retina Human

 > hsa-miR-100-5p MIMAT0000098

AACCCGUAGAUCCGAACUUGUG

 > mmu-miR-100-5p MIMAT0000655

AACCCGUAGAUCCGAACUUGUG

Upregulated during the differentiation of human embryonic stem cells into RPE Cell [136, 210] [82, 83, 88, 172, 173, 175]
miR-29 Neural retina, ONL Mouse

hsa-miR-29a-5p MIMAT0004503

ACUGAUUUCUUUUGGUGUUCAG

 > mmu-miR-29a-5p MIMAT0004631

ACUGAUUUCUUUUGGUGUUCAG

 > hsa-miR-29a-3p MIMAT0000086

UAGCACCAUCUGAAAUCGGUUA

 > mmu-miR-29a-3p MIMAT0000535

UAGCACCAUCUGAAAUCGGUUA

 > hsa-miR-29b-1-5p MIMAT0004514

GCUGGUUUCAUAUGGUGGUUUAGA

 > mmu-miR-29b-1-5p MIMAT0004523

GCUGGUUUCAUAUGGUGGUUUA

 > hsa-miR-29b-3p MIMAT0000100

UAGCACCAUUUGAAAUCAGUGUU

 > mmu-miR-29b-3p MIMAT0000127

UAGCACCAUUUGAAAUCAGUGUU

 > hsa-miR-29c-5p MIMAT0004673

UGACCGAUUUCUCCUGGUGUUC

 > mmu-miR-29c-5p MIMAT0004632

UGACCGAUUUCUCCUGGUGUUC

 > hsa-miR-29c-3p MIMAT0000681

UAGCACCAUUUGAAAUCGGUUA

 > mmu-miR-29c-3p MIMAT0000536

UAGCACCAUUUGAAAUCGGUUA

ND [90, 95] [193]
miR-29a RPCs, Müller glia, MGDP, retina In vivo mouse RPC, in vitro Müller glia, mouse, rat

 > hsa-miR-29a-5p MIMAT0004503

ACUGAUUUCUUUUGGUGUUCAG

 > mmu-miR-29a-5p MIMAT0004631

ACUGAUUUCUUUUGGUGUUCAG

 > rno-miR-29a-5p MIMAT0004718

ACUGAUUUCUUUUGGUGUUCAG

 > hsa-miR-29a-3p MIMAT0000086

UAGCACCAUCUGAAAUCGGUUA

 > mmu-miR-29a-3p MIMAT0000535

UAGCACCAUCUGAAAUCGGUUA

 > rno-miR-29a-3p MIMAT0000802

UAGCACCAUCUGAAAUCGGUUA

Regulates the proliferation and differentiation of RPCs. Increased expression in in vitro Müller glia. Increased in MGDPs. Protect RGCs against oxidative injury [66, 107, 111, 146, 211] [193]
miR-29a-3p RPE Human

 > hsa-miR-29a-3p MIMAT0000086

UAGCACCAUCUGAAAUCGGUUA

 > mmu-miR-29a-3p MIMAT0000535

UAGCACCAUCUGAAAUCGGUUA

ND [136] [83]
miR-29b RPE, RGC, INL, retina ARPE-19, mouse, rat

 > hsa-miR-29b-1-5p MIMAT0004514

GCUGGUUUCAUAUGGUGGUUUAGA

 > mmu-miR-29b-1-5p MIMAT0004523

GCUGGUUUCAUAUGGUGGUUUA

 > rno-miR-29b-1-5p MIMAT0005445

UUUCAUAUGGUGGUUUAGAUUU

 > hsa-miR-29b-3p MIMAT0000100

UAGCACCAUUUGAAAUCAGUGUU

 > mmu-miR-29b-3p MIMAT0000127

UAGCACCAUUUGAAAUCAGUGUU

 > rno-miR-29b-3p MIMAT0000801

UAGCACCAUUUGAAAUCAGUGUU

Regulates TGF-β1-mediated epithelial–mesenchymal transition of RPE cells. Protective effect against the apoptosis of RGCs and cells of the INL [107, 139, 140] [193]
miR-29b-3p Retina Human

 > hsa-miR-29b-3p MIMAT0000100

UAGCACCAUUUGAAAUCAGUGUU

 > mmu-miR-29b-3p MIMAT0000127

UAGCACCAUUUGAAAUCAGUGUU

Inhibits cell proliferation and angiogenesis by targeting VEGF-A and PDGFB in retinal microvascular endothelial cells [136, 212] [83]
miR-29c GCL, INL, photoreceptors, retina Human, mouse, rat

 > hsa-miR-29c-5p MIMAT0004673

UGACCGAUUUCUCCUGGUGUUC

 > mmu-miR-29c-5p MIMAT0004632

UGACCGAUUUCUCCUGGUGUUC

 > rno-miR-29c-5p MIMAT0003154

UGACCGAUUUCUCCUGGUGUUC

 > hsa-miR-29c-3p MIMAT0000681

UAGCACCAUUUGAAAUCGGUUA

 > mmu-miR-29c-3p MIMAT0000536

UAGCACCAUUUGAAAUCGGUUA

 > rno-miR-29c-3p MIMAT0000803

UAGCACCAUUUGAAAUCGGUUA

May influence neurogliogenic decision in the developing retina [97, 101, 107, 213] [214]
miR-151a-3p Retina Human

 > hsa-miR-151a-3p MIMAT0000757

CUAGACUGAAGCUCCUUGAGG

ND [136] [82]
miR-21 Müller glia, RGC In vitro Müller glia, in vitro Retinal microvascular endothelial cells isolated from bovine retina

 > hsa-miR-21-5p MIMAT0000076

UAGCUUAUCAGACUGAUGUUGA

 > mmu-miR-21a-5p MIMAT0000530

UAGCUUAUCAGACUGAUGUUGA

 > bta-miR-21-5p MIMAT0003528

UAGCUUAUCAGACUGAUGUUGACU

 > hsa-miR-21-3p MIMAT0004494

CAACACCAGUCGAUGGGCUGU

 > mmu-miR-21a-3p MIMAT0004628

CAACAGCAGUCGAUGGGCUGUC

 > bta-miR-21-3p MIMAT0003745

AACAGCAGUCGAUGGGCUGUCU

 > mmu-miR-21b MIMAT0025121

UAGUUUAUCAGACUGAUAUUUCC

 > mmu-miR-21c MIMAT0025148

UAGCUUAUCAGACUGGUACAA

Increased expression in in vitro Müller glia. Pro-angiogenic role in the retinal microvasculature. Protect RGC-5 cells against oxygen glucose deprivation (OGD-induced) cells injury. Photoreceptor protection [66, 128, 215–217] [21, 40, 152–154, 156, 159, 160, 163–165, 174]
miR-21-5p Retina, RPE Human, in vitro hESC

 > hsa-miR-21-5p MIMAT0000076

UAGCUUAUCAGACUGAUGUUGA

 > mmu-miR-21a-5p MIMAT0000530

UAGCUUAUCAGACUGAUGUUGA

hESC differentiation into RPE cells [124, 136] [3, 21, 61, 82–84, 88, 172, 173, 175]
miR-101-3p RPE Human, in vitro hESC

 > hsa-miR-101-3p MIMAT0000099

UACAGUACUGUGAUAACUGAA

hESC differentiation into RPE cells [124, 136] [156]
miR-146b Developing retina Mouse

 > hsa-miR-146b-5p MIMAT0002809

UGAGAACUGAAUUCCAUAGGCUG

 > mmu-miR-146b-5p MIMAT0003475

UGAGAACUGAAUUCCAUAGGCU

 > hsa-miR-146b-3p MIMAT0004766

GCCCUGUGGACUCAGUUCUGGU

 > mmu-miR-146b-3p MIMAT0004826

GCCCUAGGGACUCAGUUCUGGU

Regulates mitotic proliferation. Regulatory role of miR-146b-3p in diabetes related retinal inflammation by suppressing adenosine deaminase (ADA2) [107, 218] [21]
miR-146b-5p RPE Human

 > hsa-miR-146b-5p MIMAT0002809

UGAGAACUGAAUUCCAUAGGCUG

 > mmu-miR-146b-5p MIMAT0003475

UGAGAACUGAAUUCCAUAGGCU

ND [136] [82]
miR-486-5p RPE Human

 > hsa-miR-486-5p MIMAT0002177

UCCUGUACUGAGCUGCCCCGAG

 > mmu-miR-486a-5p MIMAT0003130

UCCUGUACUGAGCUGCCCCGAG

 > mmu-miR-486b-5p MIMAT0014943

UCCUGUACUGAGCUGCCCCGAG

ND [136] [3, 82, 84, 88]
miR-23b RPE, retina Human, ARPE-19, mouse

 > hsa-miR-23b-5p MIMAT0004587

UGGGUUCCUGGCAUGCUGAUUU

 > mmu-miR-23b-5p MIMAT0016980

GGGUUCCUGGCAUGCUGAUUU

 > hsa-miR-23b-3p MIMAT0000418

AUCACAUUGCCAGGGAUUACCAC

 > mmu-miR-23b-3p MIMAT0000125

AUCACAUUGCCAGGGAUUACC

Promoting RPE differentiation. Regulate RPE cell growth, differentiation or development [107, 123, 129] [70, 154, 156, 164]
miR-23b-3p RPE Human, in vitro hESC

 > hsa-miR-23b-3p MIMAT0000418

AUCACAUUGCCAGGGAUUACCAC

 > mmu-miR-23b-3p MIMAT0000125

AUCACAUUGCCAGGGAUUACC

hESC differentiation into RPE cells [124, 136] [178]
miR-145 GCL, INL, RPE, Müller glia, retinal endothelial cells In vitro human retinal endothelial cells, in vitro Müller glia, mouse

 > hsa-miR-145-5p MIMAT0000437

GUCCAGUUUUCCCAGGAAUCCCU

 > mmu-miR-145a-5p MIMAT0000157

GUCCAGUUUUCCCAGGAAUCCCU

 > mmu-miR-145b MIMAT0025105

GUCCAGUUUUCCCAGGAGACU

 > hsa-miR-145-3p MIMAT0004601

GGAUUCCUGGAAAUACUGUUCU

 > mmu-miR-145a-3p MIMAT0004534

AUUCCUGGAAAUACUGUUCUUG

Reduces high glucose-induced oxidative stress and inflammation in retinal endothelial cells. Increased expression in in vitro Müller glia. Müller glia dedifferentiation [66, 101, 142] [21, 154, 156, 159, 161, 164, 165]
miR-145-5p RPE, retina Human

 > hsa-miR-145-5p MIMAT0000437

GUCCAGUUUUCCCAGGAAUCCCU

 > mmu-miR-145a-5p MIMAT0000157

GUCCAGUUUUCCCAGGAAUCCCU

ND [136] [83, 153, 172, 175]
miR-451a RPE, retina Human

 > hsa-miR-451a MIMAT0001631

AAACCGUUACCAUUACUGAGUU

 > mmu-miR-451a MIMAT0001632

AAACCGUUACCAUUACUGAGUU

miR-451a/ATF2 plays a critical role in the regulation of proliferation and migration in RPE cells via regulation of mitochondrial function [136, 219] [83, 174]
miR-150 Retina Mouse

 > hsa-miR-150-5p MIMAT0000451

UCUCCCAACCCUUGUACCAGUG

 > mmu-miR-150-5p MIMAT0000160

UCUCCCAACCCUUGUACCAGUG

 > hsa-miR-150-3p MIMAT0004610

CUGGUACAGGCCUGGGGGACAG

 > mmu-miR-150-3p MIMAT0004535

CUGGUACAGGCCUGGGGGAUAG

Suppression of pathological retinal neovascularization [151] [154, 160]
miR-133b Retina, amacrine cells Rat

 > hsa-miR-133b MIMAT0000770

UUUGGUCCCCUUCAACCAGCUA

 > mmu-miR-133b-3p MIMAT0000769

UUUGGUCCCCUUCAACCAGCUA

 > rno-miR-133b-3p MIMAT0003126

UUUGGUCCCCUUCAACCAGCUA

 > mmu-miR-133b-5p MIMAT0017083

GCUGGUCAAACGGAACCAAGUC

 > rno-miR-133b-5p MIMAT0017205

GCUGGUCAAACGGAACCAAGU

Differentiation and death of RPCs. Connectivity and plasticity of retinal cells. Control of the maturation and function of dopaminergic amacrine cells. Plays an important protective role in RGCs apoptosis through MAPK/Erk2 signaling pathway [93, 220, 221] [40, 42, 61, 156, 157, 163, 164, 166, 169, 171]
miR-196a RPCs Xenopus laevis

196a: there is no information about this Xenopus laevis miRNA in miRBase

 > hsa-miR-196a-5p MIMAT0000226

UAGGUAGUUUCAUGUUGUUGGG

 > hsa-miR-196a-1-3p MIMAT0037307

CAACAACAUUAAACCACCCGA

Proliferation, differentiation and death of RPCs [93] [61, 83, 174]
miR-222 RPCs, RPE Human, Xenopus laevis, rabbit

 > hsa-miR-222-5p MIMAT0004569

CUCAGUAGCCAGUGUAGAUCCU

 > mmu-miR-222-5p MIMAT0017061

CUCAGUAGCCAGUGUAGAUCC

 > xla-miR-222-5p MIMAT0046544

GCUCAGUAAUCAGUGUAGAUCC

 > hsa-miR-222-3p MIMAT0000279

AGCUACAUCUGGCUACUGGGU

 > mmu-miR-222-3p MIMAT0000670

AGCUACAUCUGGCUACUGGGUCU

 > xla-miR-222-3p MIMAT0046545

AGCUACAUCUGGCUACUGGGUCU

Differentiation and death of RPCs. Highly expressed at early developmental stages in the embryonic retina. Upregulated miRNA in RPE during ESC differentiation. Prevent the progression of retinal degeneration [16, 93, 125, 144, 222] [82, 83, 154, 165, 173, 174]
miR-214 RPCs, RPE, Müller glia Human, Xenopus laevis, in vitro Müller glia, mouse

 > hsa-miR-214-5p MIMAT0004564

UGCCUGUCUACACUUGCUGUGC

 > mmu-miR-214-5p MIMAT0004664

UGCCUGUCUACACUUGCUGUGC

 > xla-miR-214-5p MIMAT0046534

GCCUGUCUACACUUGCUGUGC

 > hsa-miR-214-3p MIMAT0000271

ACAGCAGGCACAGACAGGCAGU

 > mmu-miR-214-3p MIMAT0000661

ACAGCAGGCACAGACAGGCAGU

 > xla-miR-214-3p MIMAT0046535

ACAGCAGGCACAGACAGGCAG

 > hsa-miR-24–2-5p MIMAT0004497

UGCCUACUGAGCUGAAACACAG

 > mmu-miR-24–1-5p MIMAT0000218

GUGCCUACUGAGCUGAUAUCAGU

 > xla-miR-24a-5p MIMAT0046550

GUGCCUACUGAACUGAUAUCAGU

Differentiation and death of RPCs. Highly expressed at early developmental stages in the embryonic retina. Upregulated miRNA in RPE during ESC differentiation. Increased expression in in vitro Müller glia. May act directly to either block pathological neovascularization or prevent hyperoxia-induced vaso-obliteration [66, 93, 125, 128, 144, 223] [154]
miR-24 RPE, GCL,INL, retina Human, ARPE-19, in vitro hESC, mouse, rat

 > hsa-miR-24–2-5p MIMAT0004497

UGCCUACUGAGCUGAAACACAG

 > mmu-miR-24–2-5p MIMAT0005440

GUGCCUACUGAGCUGAAACAGU

 > hsa-miR-24-3p MIMAT0000080

UGGCUCAGUUCAGCAGGAACAG

 > mmu-miR-24-3p MIMAT0000219

UGGCUCAGUUCAGCAGGAACAG

 > hsa-miR-24–1-5p MIMAT0000079

UGCCUACUGAGCUGAUAUCAGU

 > mmu-miR-24–1-5p MIMAT0000218

GUGCCUACUGAGCUGAUAUCAGU

Promoting RPE differentiation. hESC differentiation into RPE cells. Functions as an important regulator of cell death during retinal development by repressing an apoptotic program. Preserve retina from degeneration in rats by downregulating chitinase-3-like protein 1 [101, 107, 123, 124, 129, 224, 225] [83, 154, 172–174]
miR-24a RPCs, RPE Xenopus laevis,

 > hsa-miR-24-3p MIMAT0000080

UGGCUCAGUUCAGCAGGAACAG

 > mmu-miR-24-3p MIMAT0000219

UGGCUCAGUUCAGCAGGAACAG

 > xla-miR-24a-3p MIMAT0046551

UGGCUCAGUUCAGCAGGAACAG

 > xla-miR-24b-3p MIMAT0011146

UGGCUCAGUUCAGCAGGAC

Repression of apoptosis in the developing neural retina. Differentiation and death of RPCs. Inhibition during development makes a reduction in eye size due to a serious increase in apoptosis in the retina, whereas overexpression is adequate to prevent apoptosis. Regulate RPE cell growth, differentiation or development. Morpholino-induced inhibition in Xenopus leads to apoptosis of RPCs [93, 104, 145] [193]
miR-155 RPCs, retina Mouse, Xenopus laevis, zebrafish

 > hsa-miR-155-5p MIMAT0000646

UUAAUGCUAAUCGUGAUAGGGGUU

 > mmu-miR-155-5p MIMAT0000165

UUAAUGCUAAUUGUGAUAGGGGU

 > dre-miR-155 MIMAT0001851

UUAAUGCUAAUCGUGAUAGGGG

 > hsa-miR-155-3p MIMAT0004658

CUCCUACAUAUUAGCAUUAACA

 > mmu-miR-155-3p MIMAT0016993

CUCCUACCUGUUAGCAUUAAC

155: there is no information about this Xenopus laevis miRNA in miRBase

Differentiation and death of RPCs. Highly expressed at early developmental stages in the embryonic retina. Potentially beneficial in retinal neovascularization therapy [93, 99, 144, 147] [61, 152, 158]
miR-210 Retina Mouse

 > hsa-miR-210-5p MIMAT0026475

AGCCCCUGCCCACCGCACACUG

 > mmu-miR-210-5p MIMAT0017052

AGCCACUGCCCACCGCACACUG

 > hsa-miR-210-3p MIMAT0000267

CUGUGCGUGUGACAGCGGCUGA

 > mmu-miR-210-3p MIMAT0000658

CUGUGCGUGUGACAGCGGCUGA

Function during retinal development [94, 226] [40, 156, 159]
miR-17 Retina, GCL,INL, developing retina Mouse, rabbit

 > hsa-miR-17-5p MIMAT0000070

CAAAGUGCUUACAGUGCAGGUAG

 > mmu-miR-17-5p MIMAT0000649

CAAAGUGCUUACAGUGCAGGUAG

 > ocu-miR-17-5p MIMAT0048109

CAAAGUGCUUACAGUGCAGGUAG

 > hsa-miR-17-3p MIMAT0000071

ACUGCAGUGAAGGCACUUGUAG

 > mmu-miR-17-3p MIMAT0000650

ACUGCAGUGAGGGCACUUGUAG

 > ocu-miR-17-3p MIMAT0048110

ACUGCAGUGAAGGCACUUGUAG

Acts in retinal development. Works as a key regulator of the neurogenic-to-gliogenic transition in neural progenitor cells. Regulates the proliferation and differentiation of RPCs. Regulates mitotic proliferation [66, 101, 107, 127, 150] [12, 21, 85, 156, 163, 174]
miR-410 Retina, GCL, INL Mouse

 > hsa-miR-410-5p MIMAT0026558

AGGUUGUCUGUGAUGAGUUCG

 > mmu-miR-410-5p MIMAT0017172

AGGUUGUCUGUGAUGAGUUCG

 > hsa-miR-410-3p MIMAT0002171

AAUAUAACACAGAUGGCCUGU

 > mmu-miR-410-3p MIMAT0001091

AAUAUAACACAGAUGGCCUGU

Efficiently downregulate VEGF-A expression. Prevent retinal angiogenesis and effectively treat Retinal Neovascularization [101, 227] [159, 161]
miR-27a RPE, GCL, INL, retina Human, in vitro hESC, mouse

 > hsa-miR-27a-5p MIMAT0004501

AGGGCUUAGCUGCUUGUGAGCA

 > mmu-miR-27a-5p MIMAT0004633

AGGGCUUAGCUGCUUGUGAGCA

 > hsa-miR-27a-3p MIMAT0000084

UUCACAGUGGCUAAGUUCCGC

 > mmu-miR-27a-3p MIMAT0000537

UUCACAGUGGCUAAGUUCCGC

Promoting RPE differentiation. hESC differentiation into RPE cells [101, 107, 124, 129] [61]
miR-18a Retina, developing retina Human, rabbit, zebrafish, mouse

 > hsa-miR-18a-5p MIMAT0000072

UAAGGUGCAUCUAGUGCAGAUAG

 > mmu-miR-18a-5p MIMAT0000528

UAAGGUGCAUCUAGUGCAGAUAG

 > ocu-miR-18a-5p MIMAT0048111

UAAGGUGCAUCUAGUGCAGAUAG

 > dre-miR-18a MIMAT0001779

UAAGGUGCAUCUAGUGCAGAUA

 > hsa-miR-18a-3p MIMAT0002891

ACUGCCCUAAGUGCUCCUUCUGG

 > mmu-miR-18a-3p MIMAT0004626

ACUGCCCUAAGUGCUCCUUCUG

 > ocu-miR-18a-3p MIMAT0048112

ACUGCCCUAAGUGCUCCUUCUGGC

Sensory perception of light. Rhodopsin-like receptor activity. Regulates NeuroD and photoreceptor differentiation in the Retina. Regulates mitotic proliferation [107, 127, 149] [12, 85]
miR-130b Retina, developing retina Rabbit, mouse

 > hsa-miR-130b-5p MIMAT0004680

ACUCUUUCCCUGUUGCACUAC

 > mmu-miR-130b-5p MIMAT0004583

ACUCUUUCCCUGUUGCACUACU

 > ocu-miR-130b-5p MIMAT0048219

ACUCUUUCCCUGUUGCACUACU

 > hsa-miR-130b-3p MIMAT0000691

CAGUGCAAUGAUGAAAGGGCAU

 > mmu-miR-130b-3p MIMAT0000387

CAGUGCAAUGAUGAAAGGGCAU

 > ocu-miR-130b-3p MIMAT0048220

CAGUGCAAUGAUGAAAGGGCAU

Play a role in retinal development [107, 127] [193]
miR-20a Retina, RPE, developing retina In vitro hESC, mouse, rabbit

 > hsa-miR-20a-5p MIMAT0000075

UAAAGUGCUUAUAGUGCAGGUAG

 > mmu-miR-20a-5p MIMAT0000529

UAAAGUGCUUAUAGUGCAGGUAG

 > ocu-miR-20a-5p MIMAT0048120

UAAAGUGCUUAUAGUGCAGGUAG

 > hsa-miR-20a-3p MIMAT0004493

ACUGCAUUAUGAGCACUUAAAG

 > mmu-miR-20a-3p MIMAT0004627

ACUGCAUUACGAGCACUUAAAG

 > ocu-miR-20a-3p MIMAT0048121

ACUGCAUUAUGAGCACUUAAAGU

Play a role in retinal development. hESC differentiation into RPE cells. Regulates mitotic proliferation [107, 124, 127] [12, 85, 163]
miR-19a Retina, INL, GCL, RPE, developing retina In vitro hESC, rabbit, zebrafish, mouse

 > hsa-miR-19a-5p MIMAT0004490

AGUUUUGCAUAGUUGCACUACA

 > mmu-miR-19a-5p MIMAT0004660

UAGUUUUGCAUAGUUGCACUAC

 > ocu-miR-19a-5p MIMAT0048115

AGUUUUGCAUAGUUGCACUAC

 > dre-miR-19a-5p MIMAT0003398

CUAGUUUUGCAUAGUUGCACUA

 > hsa-miR-19a-3p MIMAT0000073

UGUGCAAAUCUAUGCAAAACUGA

 > mmu-miR-19a-3p MIMAT0000651

UGUGCAAAUCUAUGCAAAACUGA

 > ocu-miR-19a-3p MIMAT0048116

UGUGCAAAUCUAUGCAAAACUGA

 > dre-miR-19a-3p MIMAT0001782

UGUGCAAAUCUAUGCAAAACUGA

Play a role in retinal development. Regulates mitotic proliferation. hESC differentiation into RPE cells. Its intravitreal injection advances axon regeneration after optic nerve crush in adult mice, and it increases axon extension in RGCs isolated from aged human donors [99, 107, 124, 127, 228] [12, 21, 40, 70, 85, 156, 163, 169]
miR-93 Retina, developing retina Rabbit, mouse

 > hsa-miR-93-5p MIMAT0000093

CAAAGUGCUGUUCGUGCAGGUAG

 > mmu-miR-93-5p MIMAT0000540

CAAAGUGCUGUUCGUGCAGGUAG

 > ocu-miR-93-5p MIMAT0048176

CAAAGUGCUGUUCGUGCAGGUAG

 > hsa-miR-93-3p MIMAT0004509

ACUGCUGAGCUAGCACUUCCCG

 > mmu-miR-93-3p MIMAT0004636

ACUGCUGAGCUAGCACUUCCCG

 > ocu-miR-93-3p MIMAT0048177

ACUGCUGAGCUAGCACUUCCCGA

Play a role in retinal development. Regulates mitotic proliferation. Overexpression significantly diminished microglial proliferation migration and cytokine release which was associated with a decrease in loss of RGCs [107, 127, 229] [193]
miR-93-5p RGC Mouse, rat

 > hsa-miR-93-5p MIMAT0000093

CAAAGUGCUGUUCGUGCAGGUAG

 > mmu-miR-93-5p MIMAT0000540

CAAAGUGCUGUUCGUGCAGGUAG

 > rno-miR-93-5p MIMAT0000817

CAAAGUGCUGUUCGUGCAGGUAG

Retinal development, (Axon guidance). Upregulation of miR-93-5p binding with PTEN suppressed the autophagy of RGCs through AKT/mTOR pathway in NMDA-induced glaucoma [133, 230] [83]
miR-15b Retina, GCL, INL, RPE, developing retina ARPE-19, mouse, rabbit

 > hsa-miR-15b-5p MIMAT0000417

UAGCAGCACAUCAUGGUUUACA

 > mmu-miR-15b-5p MIMAT0000124

UAGCAGCACAUCAUGGUUUACA

 > ocu-miR-15b-5p MIMAT0048103

UAGCAGCACAUCAUGGUUUACA

 > hsa-miR-15b-3p MIMAT0004586

CGAAUCAUUAUUUGCUGCUCUA

 > mmu-miR-15b-3p MIMAT0004521

CGAAUCAUUAUUUGCUGCUCUA

 > ocu-miR-15b-3p MIMAT0048104

CGAAUCAUAAUUUGCUGCUCUA

Play a role in retinal development. Participates in the inhibition of insulin resistance in diabetic retina. Regulates mitotic proliferation [101, 107, 127, 137] [61, 83]
miR-19b Retina, developing retina Mouse, rabbit

 > hsa-miR-19b-2-5p MIMAT0004492

AGUUUUGCAGGUUUGCAUUUCA

 > mmu-miR-19b-2-5p MIMAT0017010

AGUUUUGCAGAUUUGCAGUUCAGC

 > ocu-miR-19b-2-5p MIMAT0048119

AGUUUUGCAGGUUUGCAUUUC

 > hsa-miR-19b-3p MIMAT0000074

UGUGCAAAUCCAUGCAAAACUGA

 > mmu-miR-19b-3p MIMAT0000513

UGUGCAAAUCCAUGCAAAACUGA

 > ocu-miR-19b-3p MIMAT0048118

UGUGCAAAUCCAUGCAAAACUGA

 > hsa-miR-19b-1-5p MIMAT0004491

AGUUUUGCAGGUUUGCAUCCAGC

 > mmu-miR-19b-1-5p MIMAT0017065

AGUUUUGCAGGUUUGCAUCCAGC

 > ocu-miR-19b-5p MIMAT0048117

AGUUUUGCAGGUUUGCAUCCAGC

Play a role in retinal development. Regulates mitotic proliferation [107, 127] [12, 85, 163, 174]
miR-19b-3p RPE In vitro hESC

 > hsa-miR-19b-3p MIMAT0000074

UGUGCAAAUCCAUGCAAAACUGA

 > mmu-miR-19b-3p MIMAT0000513

UGUGCAAAUCCAUGCAAAACUGA

hESC differentiation into RPE cells [124] [83, 172]
miR-151b RPE Human

 > hsa-miR-151b MIMAT0010214

UCGAGGAGCUCACAGUCU

Upregulated in RPE during ESC differentiation [125] [231]
miR-25 MGDP cells, developing retina Mouse

 > hsa-miR-25-5p MIMAT0004498

AGGCGGAGACUUGGGCAAUUG

 > mmu-miR-25-5p MIMAT0017049

AGGCGGAGACUUGGGCAAUUGC

 > hsa-miR-25-3p MIMAT0000081

CAUUGCACUUGUCUCGGUCUGA

 > mmu-miR-25-3p MIMAT0000652

CAUUGCACUUGUCUCGGUCUGA

Reprogram mouse Müller glia into neural progenitors in vitro. Regulates mitotic proliferation [107, 108] [83, 172]
miR-132 RGC, CMZ, INL, GCL, RPE, retina Mouse, zebrafish

 > hsa-miR-132-5p MIMAT0004594

ACCGUGGCUUUCGAUUGUUACU

 > mmu-miR-132-5p MIMAT0016984

AACCGUGGCUUUCGAUUGUUAC

 > dre-miR-132-5p MIMAT0003403

ACCGUGGCAUUAGAUUGUUACU

 > hsa-miR-132-3p MIMAT0000426

UAACAGUCUACAGCCAUGGUCG

 > mmu-miR-132-3p MIMAT0000144

UAACAGUCUACAGCCAUGGUCG

 > dre-miR-132-3p MIMAT0001829

UAACAGUCUACAGCCAUGGUCG

Branching of RGC axons [65, 99, 101, 107, 232] [154, 156, 160, 167]
miR-449 RPE Zebrafish

449: there is no information about this zebrafish miRNA in miRBase

 > hsa-miR-449a MIMAT0001541

UGGCAGUGUAUUGUUAGCUGGU

 > hsa-miR-449c-5p MIMAT0010251

UAGGCAGUGUAUUGCUAGCGGCUGU

 > hsa-miR-449c-3p MIMAT0013771

UUGCUAGUUGCACUCCUCUCUGU

 > hsa-miR-449b-5p MIMAT0003327

AGGCAGUGUAUUGUUAGCUGGC

 > hsa-miR-449b-3p MIMAT0009203

CAGCCACAACUACCCUGCCACU

Consistently upregulated along with the RPE differentiation [126] [174]
miR-361 Retina Human

 > hsa-miR-361-5p MIMAT0000703

UUAUCAGAAUCUCCAGGGGUAC

 > mmu-miR-361-5p MIMAT0000704

UUAUCAGAAUCUCCAGGGGUAC

 > hsa-miR-361-3p MIMAT0004682

UCCCCCAGGUGUGAUUCUGAUUU

 > mmu-miR-361-3p MIMAT0017075

UCCCCCAGGUGUGAUUCUGAUUUGU

Overexpression of miR-361-5p might act as a suppressor in retinoblastoma. miR-361-3p functions as a tumor suppressor in the carcinogenesis and progression of retinoblastoma [97, 233, 234] [154]
miR-130a GCL, INL, RPE, developing retina Mouse

 > hsa-miR-130a-5p MIMAT0004593

GCUCUUUUCACAUUGUGCUACU

 > mmu-miR-130a-5p MIMAT0016983

GCUCUUUUCACAUUGUGCUACU

 > hsa-miR-130a-3p MIMAT0000425

CAGUGCAAUGUUAAAAGGGCAU

 > mmu-miR-130a-3p MIMAT0000141

CAGUGCAAUGUUAAAAGGGCAU

Regulates mitotic proliferation [101, 107] [156, 160, 167]
miR-130a-3p Retina Mouse

 > hsa-miR-130a-3p MIMAT0000425

CAGUGCAAUGUUAAAAGGGCAU

 > mmu-miR-130a-3p MIMAT0000141

CAGUGCAAUGUUAAAAGGGCAU

Retinal development [133] [83]
miR-320 RPE, developing retina ARPE-19, mouse

 > hsa-miR-320a-5p MIMAT0037311

GCCUUCUCUUCCCGGUUCUUCC

 > mmu-miR-320-5p MIMAT0017057

GCCUUCUCUUCCCGGUUCUUCC

 > hsa-miR-320a-3p MIMAT0000510

AAAAGCUGGGUUGAGAGGGCGA

 > mmu-miR-320-3p MIMAT0000666

AAAAGCUGGGUUGAGAGGGCGA

 > hsa-miR-320b MIMAT0005792

AAAAGCUGGGUUGAGAGGGCAA

 > hsa-miR-320d MIMAT0006764

AAAAGCUGGGUUGAGAGGA

 > hsa-miR-320e MIMAT0015072

AAAGCUGGGUUGAGAAGG

 > hsa-miR-320c MIMAT0005793

AAAAGCUGGGUUGAGAGGGU

Regulate RPE cell growth, differentiation or development [107, 123] [3, 83, 154]
miR-149 GCL, INL, RPE Mouse

 > hsa-miR-149-5p MIMAT0000450

UCUGGCUCCGUGUCUUCACUCCC

 > mmu-miR-149-5p MIMAT0000159

UCUGGCUCCGUGUCUUCACUCCC

 > hsa-miR-149-3p MIMAT0004609

AGGGAGGGACGGGGGCUGUGC

 > mmu-miR-149-3p MIMAT0016990

GAGGGAGGGACGGGGGCGGUGC

ND [101] [154]
miR-296-5p GCL, INL, RPE Mouse

 > hsa-miR-296-5p MIMAT0000690

AGGGCCCCCCCUCAAUCCUGU

 > mmu-miR-296-5p MIMAT0000374

AGGGCCCCCCCUCAAUCCUGU

ND [101] [154]
miR-328 GCL, INL, RPE Mouse

 > hsa-miR-328-5p MIMAT0026486

GGGGGGGCAGGAGGGGCUCAGGG

 > mmu-miR-328-5p MIMAT0017030

GGGGGGCAGGAGGGGCUCAGGG

 > hsa-miR-328-3p MIMAT0000752

CUGGCCCUCUCUGCCCUUCCGU

 > mmu-miR-328-3p MIMAT0000565

CUGGCCCUCUCUGCCCUUCCGU

Promotion of RPE proliferation [101, 235] [166]
miR-294 GCL, INL, RPE Mouse

 > mmu-miR-294-5p MIMAT0004574

ACUCAAAAUGGAGGCCCUAUCU

 > mmu-miR-294-3p MIMAT0000372

AAAGUGCUUCCCUUUUGUGUGU

294: there is no information about this human miRNA in miRBase

May keep Müller cells pluripotency [101, 236] [156]
miR-221 GCL, INL Mouse

 > hsa-miR-221-5p MIMAT0004568

ACCUGGCAUACAAUGUAGAUUU

 > mmu-miR-221-5p MIMAT0017060

ACCUGGCAUACAAUGUAGAUUUCUGU

 > hsa-miR-221-3p MIMAT0000278

AGCUACAUUGUCUGCUGGGUUUC

 > mmu-miR-221-3p MIMAT0000669

AGCUACAUUGUCUGCUGGGUUUC

ND [101] [3, 40, 83, 153, 154, 156, 157, 165, 173, 174]
miR-15a GCL, developing retina Mouse

 > hsa-miR-15a-5p MIMAT0000068

UAGCAGCACAUAAUGGUUUGUG

 > mmu-miR-15a-5p MIMAT0000526

UAGCAGCACAUAAUGGUUUGUG

 > hsa-miR-15a-3p MIMAT0004488

CAGGCCAUAUUGUGCUGCCUCA

 > mmu-miR-15a-3p MIMAT0004624

CAGGCCAUACUGUGCUGCCUCA

Anti-inflammatory and anti-angiogenic action of miR-15a in DR [101, 107, 237] [61]
miR-15a-5p RPE In vitro hESC

 > hsa-miR-15a-5p MIMAT0000068

UAGCAGCACAUAAUGGUUUGUG

 > mmu-miR-15a-5p MIMAT0000526

UAGCAGCACAUAAUGGUUUGUG

hESC differentiation into RPE cells [124] [83]
miR-223 GCL, INL Mouse, zebrafish

 > hsa-miR-223-5p MIMAT0004570

CGUGUAUUUGACAAGCUGAGUU

 > mmu-miR-223-5p MIMAT0017056

CGUGUAUUUGACAAGCUGAGUUG

 > hsa-miR-223-3p MIMAT0000280

UGUCAGUUUGUCAAAUACCCCA

 > mmu-miR-223-3p MIMAT0000665

UGUCAGUUUGUCAAAUACCCCA

 > dre-miR-223 MIMAT0001290

UGUCAGUUUGUCAAAUACCCC

Necessary for maintaining normal retinal function as well as regulating inflammation in microglia and macrophages. Key role in zebrafish optic nerve regeneration. Upregulation of miR-223 in RGCs via intravitreal injection protected RGC axons in the optic nerve from degeneration [101, 238–241] [21, 61, 70, 156, 158, 174]
miR-497 GCL, INL Mouse

 > hsa-miR-497-5p MIMAT0002820

CAGCAGCACACUGUGGUUUGU

 > mmu-miR-497a-5p MIMAT0003453

CAGCAGCACACUGUGGUUUGUA

 > mmu-miR-497b MIMAT0031404

CACCACAGUGUGGUUUGGACGUGG

 > hsa-miR-497-3p MIMAT0004768

CAAACCACACUGUGGUGUUAGA

 > mmu-miR-497a-3p MIMAT0017247

CAAACCACACUGUGGUGUUAG

Functions as a tumor suppressor in the carcinogenesis and progression of retinoblastoma via targeting VEGF-A. Metformin may obstruct the VEGF-A protein translation via inducing a VEGF-A-targeting microRNA, microRNA-497a-5p, resulting in reduced retina neovascularization [101, 242, 243] [176]
miR-28 Retina Mouse

 > hsa-miR-28-5p MIMAT0000085

AAGGAGCUCACAGUCUAUUGAG

 > mmu-miR-28a-5p MIMAT0000653

AAGGAGCUCACAGUCUAUUGAG

 > mmu-miR-28c MIMAT0019339

AGGAGCUCACAGUCUAUUGA

 > mmu-miR-28b MIMAT0019354

AGGAGCUCACAAUCUAUUUAG

 > hsa-miR-28-3p MIMAT0004502

CACUAGAUUGUGAGCUCCUGGA

 > mmu-miR-28a-3p MIMAT0004661

CACUAGAUUGUGAGCUGCUGGA

Inhibits differentiation of MGDPs toward a photoreceptor lineage fate. Potentially regulates the photoreceptor lineage commitment of MGDPs [60, 141] [82]
miR-99a Müller glia Mouse

 > hsa-miR-99a-5p MIMAT0000097

AACCCGUAGAUCCGAUCUUGUG

 > mmu-miR-99a-5p MIMAT0000131

AACCCGUAGAUCCGAUCUUGUG

 > hsa-miR-99a-3p MIMAT0004511

CAAGCUCGCUUCUAUGGGUCUG

 > mmu-miR-99a-3p MIMAT0016981

CAAGCUCGUUUCUAUGGGUCU

Increasing expression from young to adult Müller glia [66] [174]
miR-199a Müller glia In vitro Müller glia

 > hsa-miR-199a-5p MIMAT0000231

CCCAGUGUUCAGACUACCUGUUC

 > mmu-miR-199a-5p MIMAT0000229

CCCAGUGUUCAGACUACCUGUUC

 > hsa-miR-199a-3p MIMAT0000232

ACAGUAGUCUGCACAUUGGUUA

 > mmu-miR-199a-3p MIMAT0000230

ACAGUAGUCUGCACAUUGGUUA

Increased expression in in vitro Müller glia [66] [61, 83, 154, 156, 161, 165, 175]
miR-140 Retina Mouse

 > hsa-miR-140-5p MIMAT0000431

CAGUGGUUUUACCCUAUGGUAG

 > mmu-miR-140-5p MIMAT0000151

CAGUGGUUUUACCCUAUGGUAG

 > hsa-miR-140-3p MIMAT0004597

UACCACAGGGUAGAACCACGG

 > mmu-miR-140-3p MIMAT0000152

UACCACAGGGUAGAACCACGG

MiR-140-5p suppresses retinoblastoma cell growth by inhibiting c-Met/AKT/mTOR pathway. Intravitreal delivery offers protection in preventing oxidative stress mediated retinal ischemia–reperfusion injury [106, 107, 244, 245] [162]
miR-151-5p Retina Mouse

 > hsa-miR-151a-5p MIMAT0004697

UCGAGGAGCUCACAGUCUAGU

 > mmu-miR-151-5p MIMAT0004536

UCGAGGAGCUCACAGUCUAGU

ND [107] [154, 156]
miR-195 Mature retina Mouse

 > hsa-miR-195-5p MIMAT0000461

UAGCAGCACAGAAAUAUUGGC

 > mmu-miR-195a-5p MIMAT0000225

UAGCAGCACAGAAAUAUUGGC

 > hsa-miR-195-3p MIMAT0004615

CCAAUAUUGGCUGUGCUGCUCC

 > mmu-miR-195a-3p MIMAT0017000

CCAAUAUUGGCUGUGCUGCUCC

 > mmu-miR-195b MIMAT0025076

UAGCAGCACAGAAAUAGUAGAA

ND [107] [83, 165]
miR-423-5p Developing retina Mouse

 > hsa-miR-423-5p MIMAT0004748

UGAGGGGCAGAGAGCGAGACUUU

 > mmu-miR-423-5p MIMAT0004825

UGAGGGGCAGAGAGCGAGACUUU

ND [107] [3, 82]
miR-374 Developing retina Mouse

 > hsa-miR-374a-5p MIMAT0000727

UUAUAAUACAACCUGAUAAGUG

 > hsa-miR-374a-3p MIMAT0004688

CUUAUCAGAUUGUAUUGUAAUU

 > hsa-miR-374b-5p MIMAT0004955

AUAUAAUACAACCUGCUAAGUG

 > mmu-miR-374b-5p MIMAT0003727

AUAUAAUACAACCUGCUAAGUG

 > hsa-miR-374b-3p MIMAT0004956

CUUAGCAGGUUGUAUUAUCAUU

 > mmu-miR-374b-3p MIMAT0003728

GGUUGUAUUAUCAUUGUCCGAG

 > hsa-miR-374c-5p MIMAT0018443

AUAAUACAACCUGCUAAGUGCU

 > mmu-miR-374c-5p MIMAT0014953

AUAAUACAACCUGCUAAGUG

 > hsa-miR-374c-3p MIMAT0022735

CACUUAGCAGGUUGUAUUAUAU

 > mmu-miR-374c-3p MIMAT0014954

ACUUAGCAGGUUGUAUUAU

miR‐374 can work with miR‐23a to cooperatively regulate the expression of Brn3b, thereby influencing RGC development. miR‐374a is a negative regulator of Fas death receptor which is able to enhance the cell survival and protect RPE cells against oxidative conditions [107, 202, 246, 247] [83]

ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment of photoreceptors; OS, outer segment of photoreceptors; RPE, retinal pigment epithelium; MGDP, Müller glia-derived progenitor cells; CMZ, ciliary margin zone; RPC, retinal progenitor cells; RSC, retinal stem cells; ESC, embryonic stem cells; hESC, human embryonic stem cells; hPESC, human parthenogenetic embryonic stem cells; AMD, age-related macular degeneration; DR, diabetic retinopathy; ND, not defined. Human: Homo sapiens (hsa); Medaka fish: Oryzias latipes (ola); Mouse: Mus musculus (mmu); Rabbit: Oryctolagus cuniculus (ocu); Rat: Rattus norvegicus (rno); Xenopus laevis (xla); Zebrafish: Danio rerio (dre). All miRNA sequences are taken from www.mirbase.org

Conclusions

miRNAs have complicated functions in retinal health and disease which most of them are yet to be understood. Each miRNA can regulate the whole genetic program of a cell, so knowing their specific effects on different types of cells could be helpful for designing more beneficent studies and therapies. Owing to the fact that a miRNA has many mRNA targets, we should consider that we still don’t know many functions of miRNAs and the procedures of their actions. Although multifunctional miRNAs such as miR-204, miR-124 seem more promising, the timing of their application should be planned more precisely to avoid undesired effects. Besides having other therapeutic agents, MSC-EVs are a great source of miRNAs which make them a good choice for a multifactorial therapy.

Identifying miRNAs that are common between retinal cells and MSC-EVs, with due attention to the role of miRNAs as master regulators, could help us to preserve or restore the state of retinal cells in a more accurate way in retinal degenerative diseases.

Acknowledgements

Not applicable.

Abbreviations

Ago

Argonaute

Ago2

Argonaute2

AMD

Age-related macular degeneration

ARPE-19

A human retinal pigment epithelial cell line

BMSC

Bone marrow mesenchymal stem cells

BRB

Blood retina barrier

CMZ

Ciliary margin zone

CNS

Central nervous system

DR

Diabetic retinopathy

ESC

Embryonic stem cells

EV

Extracellular vesicles

GCL

Ganglionic cell layer

hBMSC

Human bone marrow mesenchymal stem cells

hESC

Human embryonic stem cells

hnRNP

Heterogeneous nuclear ribonucleoproteins

hPESC

Human parthenogenetic embryonic stem cell

hRPE

Human retinal pigment epithelium

IBD

Inflammatory bowel disease

INL

Inner nuclear layer

IPF

Idiopathic pulmonary fibrosis

IPL

Inner plexiform layer

iPSCs

Induced pluripotent stem cells

ISCT

International Society for Cellular Therapy

MG

Müller glia

MGDP

Müller glia-derived progenitor cells

miRNA

MicroRNA

mRNA

Messenger RNA

MSCs

Mesenchymal stem cells

MSC-EVs

Mesenchymal stem cells extracellular vesicles

MSC-Exos

Mesenchymal stem cells exosomes

MVB

Multivesicular bodies

ONL

Outer nuclear layer

OS

Outer segments

PTEN

Phosphatase and tensin homolog

RBVS

Retinoblastoma vitreous seeding

RISC

RNA-induced silencing complex

RPC

Retinal progenitor cells

RSC

Retinal stem cells

RPE

Retinal pigment epithelium

siRNA

Short interfering RNA

SYNCRIP

Synaptotagmin-binding cytoplasmic RNA-interacting protein

VEGF-A

: Vascular endothelial growth factor

WJ-MSC

Wharton’s jelly mesenchymal stem cell

Authors' contributions

ARD, AS and HS contributed to conceptualization and writing—review and editing; ARD and AS contributed to writing—original draft preparation and visualization; HS contributed to supervision. All authors have read and agreed to the published version of the manuscript.

Funding

Not applicable.

Availability of data and material

Not applicable.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Ali Rajool Dezfuly and Azadeh Safaee have contributed equally to this work.

References

  • 1.Salehi H, et al. Overview of retinal differentiation potential of mesenchymal stem cells: a promising approach for retinal cell therapy. Ann Anat Anat Anz. 2017;210:52–63. doi: 10.1016/j.aanat.2016.11.010. [DOI] [PubMed] [Google Scholar]
  • 2.Hoffman LM, Carpenter MK. Characterization and culture of human embryonic stem cells. Nat Biotechnol. 2005;23(6):699–708. doi: 10.1038/nbt1102. [DOI] [PubMed] [Google Scholar]
  • 3.Mead B, Tomarev S. Extracellular vesicle therapy for retinal diseases. Prog Retin Eye Res. 2020;79:100849. doi: 10.1016/j.preteyeres.2020.100849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sahni JN, et al. Therapeutic challenges to retinitis pigmentosa: from neuroprotection to gene therapy. Curr Genomics. 2011;12(4):276–284. doi: 10.2174/138920211795860062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Berry M, Ahmed Z, Logan A. Return of function after CNS axon regeneration: lessons from injury-responsive intrinsically photosensitive and alpha retinal ganglion cells. Prog Retin Eye Res. 2019;71:57–67. doi: 10.1016/j.preteyeres.2018.11.006. [DOI] [PubMed] [Google Scholar]
  • 6.Berry M, et al. Regeneration of axons in the visual system. Restor Neurol Neurosci. 2008;26(2, 3):147–174. [PubMed] [Google Scholar]
  • 7.Zhang M, et al. The condition medium of mesenchymal stem cells promotes proliferation, adhesion and neuronal differentiation of retinal progenitor cells. Neurosci Lett. 2017;657:62–68. doi: 10.1016/j.neulet.2017.07.053. [DOI] [PubMed] [Google Scholar]
  • 8.Rabesandratana O, Goureau O, Orieux G. Pluripotent stem cell-based approaches to explore and treat optic neuropathies. Front Neurosci. 2018;12:651. doi: 10.3389/fnins.2018.00651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Djojosubroto MW, Arsenijevic Y. Retinal stem cells: promising candidates for retina transplantation. Cell Tissue Res. 2008;331(1):347–357. doi: 10.1007/s00441-007-0501-8. [DOI] [PubMed] [Google Scholar]
  • 10.Ding SLS, Kumar S, Mok PL. Cellular reparative mechanisms of mesenchymal stem cells for retinal diseases. Int J Mol Sci. 2017;18(8):1406. doi: 10.3390/ijms18081406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Flower T, Pulsipher V, Moreno A. A new tool in regenerative medicine: mesenchymal stem cell secretome. J Stem Cell Res Ther. 2015;1(1):10–12. [Google Scholar]
  • 12.Mead B, Tomarev S. Bone marrow-derived mesenchymal stem cells-derived exosomes promote survival of retinal ganglion cells through miRNA-dependent mechanisms. Stem Cells Transl Med. 2017;6(4):1273–1285. doi: 10.1002/sctm.16-0428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Johnson TV, et al. Neuroprotective effects of intravitreal mesenchymal stem cell transplantation in experimental glaucoma. Investig Ophthalmol Vis Sci. 2010;51(4):2051–2059. doi: 10.1167/iovs.09-4509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mead B, et al. Intravitreally transplanted dental pulp stem cells promote neuroprotection and axon regeneration of retinal ganglion cells after optic nerve injury. Investig Ophthalmol Vis Sci. 2013;54(12):7544–7556. doi: 10.1167/iovs.13-13045. [DOI] [PubMed] [Google Scholar]
  • 15.van der Merwe Y, Steketee MB. Extracellular vesicles: biomarkers, therapeutics, and vehicles in the visual system. Curr Ophthalmol Rep. 2017;5(4):276–282. doi: 10.1007/s40135-017-0153-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Safwat A, et al. Adipose mesenchymal stem cells–derived exosomes attenuate retina degeneration of streptozotocin-induced diabetes in rabbits. J Circ Biomark. 2018;7:1849454418807827. doi: 10.1177/1849454418807827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yu B, Li X-R, Zhang X-M. Mesenchymal stem cell-derived extracellular vesicles as a new therapeutic strategy for ocular diseases. World J Stem Cells. 2020;12(3):178. doi: 10.4252/wjsc.v12.i3.178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fatima F, et al. Non-coding RNAs in mesenchymal stem cell-derived extracellular vesicles: deciphering regulatory roles in stem cell potency, inflammatory resolve, and tissue regeneration. Front Genet. 2017;8:161. doi: 10.3389/fgene.2017.00161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Özmert E, Arslan U. Management of retinitis pigmentosa by Wharton’s jelly-derived mesenchymal stem cells: prospective analysis of 1-year results. Stem Cell Res Ther. 2020;11(1):1–17. doi: 10.1186/s13287-019-1471-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Harrell CR, et al. Therapeutic potential of mesenchymal stem cell-derived exosomes in the treatment of eye diseases. Cell Biol Transl Med. 2018;2:47–57. doi: 10.1007/5584_2018_219. [DOI] [PubMed] [Google Scholar]
  • 21.Harrell CR, et al. Mesenchymal stem cell-derived exosomes and other extracellular vesicles as new remedies in the therapy of inflammatory diseases. Cells. 2019;8(12):1605. doi: 10.3390/cells8121605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Johnson TV, Bull ND, Martin KR. Identification of barriers to retinal engraftment of transplanted stem cells. Investig Ophthalmol Vis Sci. 2010;51(2):960–970. doi: 10.1167/iovs.09-3884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Teixeira FG, et al. Mesenchymal stem cells secretome: a new paradigm for central nervous system regeneration? Cell Mol Life Sci. 2013;70(20):3871–3882. doi: 10.1007/s00018-013-1290-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Camussi G, et al. Exosomes/microvesicles as a mechanism of cell-to-cell communication. Kidney Int. 2010;78(9):838–848. doi: 10.1038/ki.2010.278. [DOI] [PubMed] [Google Scholar]
  • 25.Greening DW, et al. A protocol for exosome isolation and characterization: evaluation of ultracentrifugation, density-gradient separation, and immunoaffinity capture methods. In: Proteomic profiling. Springer; 2015, p. 179–209. [DOI] [PubMed]
  • 26.Shariati Najafabadi S, et al. Human adipose derived stem cell exosomes enhance the neural differentiation of PC12 cells. Mol Biol Rep. 2021;48(6):5033–5043. doi: 10.1007/s11033-021-06497-5. [DOI] [PubMed] [Google Scholar]
  • 27.Nuzzi R, Caselgrandi P, Vercelli A. Effect of mesenchymal stem cell-derived exosomes on retinal injury: a review of current findings. Stem Cells Int. 2020;2020:1–9. doi: 10.1155/2020/8883616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Soung YH, et al. Exosomes in cancer diagnostics. Cancers. 2017;9(1):8. doi: 10.3390/cancers9010008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Galardi A, et al. Proteomic profiling of retinoblastoma-derived exosomes reveals potential biomarkers of vitreous seeding. Cancers. 2020;12(6):1555. doi: 10.3390/cancers12061555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Patil SM, Sawant SS, Kunda NK. Exosomes as drug delivery systems: a brief overview and progress update. Eur J Pharm Biopharm. 2020;154:259–269. doi: 10.1016/j.ejpb.2020.07.026. [DOI] [PubMed] [Google Scholar]
  • 31.Schindler C, et al. Exosomal delivery of doxorubicin enables rapid cell entry and enhanced in vitro potency. PLoS ONE. 2019;14(3):e0214545. doi: 10.1371/journal.pone.0214545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tricarico C, Clancy J, D'Souza-Schorey C. Biology and biogenesis of shed microvesicles. Small GTPases. 2017;8(4):220–232. doi: 10.1080/21541248.2016.1215283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kanada M, et al. Differential fates of biomolecules delivered to target cells via extracellular vesicles. Proc Natl Acad Sci. 2015;112(12):E1433–E1442. doi: 10.1073/pnas.1418401112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Quesenberry PJ, Dooner MS, Aliotta JM. Stem cell plasticity revisited: the continuum marrow model and phenotypic changes mediated by microvesicles. Exp Hematol. 2010;38(7):581–592. doi: 10.1016/j.exphem.2010.03.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Martins VR, Dias MS, Hainaut P. Tumor-cell-derived microvesicles as carriers of molecular information in cancer. Curr Opin Oncol. 2013;25(1):66–75. doi: 10.1097/CCO.0b013e32835b7c81. [DOI] [PubMed] [Google Scholar]
  • 36.Al-Nedawi K, Meehan B, Rak J. Microvesicles: messengers and mediators of tumor progression. Cell Cycle. 2009;8(13):2014–2018. doi: 10.4161/cc.8.13.8988. [DOI] [PubMed] [Google Scholar]
  • 37.Zhang W, Chen S, Liu M-L. Pathogenic roles of microvesicles in diabetic retinopathy. Acta Pharmacol Sin. 2018;39(1):1–11. doi: 10.1038/aps.2017.77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hulsmans M, Holvoet P. MicroRNA-containing microvesicles regulating inflammation in association with atherosclerotic disease. Cardiovasc Res. 2013;100(1):7–18. doi: 10.1093/cvr/cvt161. [DOI] [PubMed] [Google Scholar]
  • 39.Battistelli M, Falcieri E. Apoptotic bodies: particular extracellular vesicles involved in intercellular communication. Biology. 2020;9(1):21. doi: 10.3390/biology9010021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Keshtkar S, Azarpira N, Ghahremani MH. Mesenchymal stem cell-derived extracellular vesicles: novel frontiers in regenerative medicine. Stem Cell Res Ther. 2018;9(1):1–9. doi: 10.1186/s13287-018-0791-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sun G, et al. hucMSC derived exosomes promote functional recovery in spinal cord injury mice via attenuating inflammation. Mater Sci Eng C. 2018;89:194–204. doi: 10.1016/j.msec.2018.04.006. [DOI] [PubMed] [Google Scholar]
  • 42.Xin H, Li Y, Chopp M. Exosomes/miRNAs as mediating cell-based therapy of stroke. Front Cell Neurosci. 2014;8:377. doi: 10.3389/fncel.2014.00377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ratajczak J, et al. Embryonic stem cell-derived microvesicles reprogram hematopoietic progenitors: evidence for horizontal transfer of mRNA and protein delivery. Leukemia. 2006;20(5):847–856. doi: 10.1038/sj.leu.2404132. [DOI] [PubMed] [Google Scholar]
  • 44.Valadi H, et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol. 2007;9(6):654–659. doi: 10.1038/ncb1596. [DOI] [PubMed] [Google Scholar]
  • 45.Venugopal C, et al. Dosage and passage dependent neuroprotective effects of exosomes derived from rat bone marrow mesenchymal stem cells: an in vitro analysis. Curr Gene Ther. 2017;17(5):379–390. doi: 10.2174/1566523218666180125091952. [DOI] [PubMed] [Google Scholar]
  • 46.Xu J-F, et al. Altered microRNA expression profile in exosomes during osteogenic differentiation of human bone marrow-derived mesenchymal stem cells. PLoS ONE. 2014;9(12):e114627. doi: 10.1371/journal.pone.0114627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Eirin A, et al. Comparative proteomic analysis of extracellular vesicles isolated from porcine adipose tissue-derived mesenchymal stem/stromal cells. Sci Rep. 2016;6(1):1–12. doi: 10.1038/srep36120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Eirin A, et al. Integrated transcriptomic and proteomic analysis of the molecular cargo of extracellular vesicles derived from porcine adipose tissue-derived mesenchymal stem cells. PLoS ONE. 2017;12(3):e0174303. doi: 10.1371/journal.pone.0174303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Chiou N-T, Kageyama R, Ansel KM. Selective export into extracellular vesicles and function of tRNA fragments during T cell activation. Cell Rep. 2018;25(12):3356–3370.e4. doi: 10.1016/j.celrep.2018.11.073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kuriyan AE, et al. Vision loss after intravitreal injection of autologous “stem cells” for AMD. N Engl J Med. 2017;376(11):1047–1053. doi: 10.1056/NEJMoa1609583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yang S, et al. Mechanisms of epithelial-mesenchymal transition in proliferative vitreoretinopathy. Discov Med. 2015;20(110):207–217. [PubMed] [Google Scholar]
  • 52.Mead B, et al. Mesenchymal stromal cell-mediated neuroprotection and functional preservation of retinal ganglion cells in a rodent model of glaucoma. Cytotherapy. 2016;18(4):487–496. doi: 10.1016/j.jcyt.2015.12.002. [DOI] [PubMed] [Google Scholar]
  • 53.Kim JY, et al. Epiretinal membrane formation after intravitreal autologous stem cell implantation in a retinitis pigmentosa patient. Retinal Cases Brief Rep. 2017;11(3):227–231. doi: 10.1097/ICB.0000000000000327. [DOI] [PubMed] [Google Scholar]
  • 54.Mead B, et al. Paracrine-mediated neuroprotection and neuritogenesis of axotomised retinal ganglion cells by human dental pulp stem cells: comparison with human bone marrow and adipose-derived mesenchymal stem cells. PLoS ONE. 2014;9(10):e109305. doi: 10.1371/journal.pone.0109305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Emre E, et al. Neuroprotective effects of intravitreally transplanted adipose tissue and bone marrow–derived mesenchymal stem cells in an experimental ocular hypertension model. Cytotherapy. 2015;17(5):543–559. doi: 10.1016/j.jcyt.2014.12.005. [DOI] [PubMed] [Google Scholar]
  • 56.Zuzic M, et al. Retinal miRNA functions in health and disease. Genes. 2019;10(5):377. doi: 10.3390/genes10050377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.MacFarlane L-A, Murphy PR. MicroRNA: biogenesis, function and role in cancer. Curr Genomics. 2010;11(7):537–561. doi: 10.2174/138920210793175895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mirzaei H, et al. MicroRNA: relevance to stroke diagnosis, prognosis, and therapy. J Cell Physiol. 2018;233(2):856–865. doi: 10.1002/jcp.25787. [DOI] [PubMed] [Google Scholar]
  • 59.Ha M, Kim VN. Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol. 2014;15(8):509–524. doi: 10.1038/nrm3838. [DOI] [PubMed] [Google Scholar]
  • 60.Karali M, Banfi S. Non-coding RNAs in retinal development and function. Hum Genet. 2019;138(8):957–971. doi: 10.1007/s00439-018-1931-y. [DOI] [PubMed] [Google Scholar]
  • 61.Eleuteri S, Fierabracci A. Insights into the secretome of mesenchymal stem cells and its potential applications. Int J Mol Sci. 2019;20(18):4597. doi: 10.3390/ijms20184597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Ambros V, et al. A uniform system for microRNA annotation. RNA. 2003;9(3):277–279. doi: 10.1261/rna.2183803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.de Lucia C, et al. microRNA in cardiovascular aging and age-related cardiovascular diseases. Front Med. 2017;4:74. doi: 10.3389/fmed.2017.00074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Krol J, et al. Characterizing light-regulated retinal microRNAs reveals rapid turnover as a common property of neuronal microRNAs. Cell. 2010;141(4):618–631. doi: 10.1016/j.cell.2010.03.039. [DOI] [PubMed] [Google Scholar]
  • 65.Sundermeier TR, Palczewski K. The impact of microRNA gene regulation on the survival and function of mature cell types in the eye. FASEB J. 2016;30(1):23–33. doi: 10.1096/fj.15-279745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Quintero H, Lamas M. microRNA expression in the neural retina: Focus on Müller glia. J Neurosci Res. 2018;96(3):362–370. doi: 10.1002/jnr.24181. [DOI] [PubMed] [Google Scholar]
  • 67.Li L, et al. Argonaute 2 complexes selectively protect the circulating microRNAs in cell-secreted microvesicles. PLoS ONE. 2012;7(10):e46957. doi: 10.1371/journal.pone.0046957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Gibbings DJ, et al. Multivesicular bodies associate with components of miRNA effector complexes and modulate miRNA activity. Nat Cell Biol. 2009;11(9):1143–1149. doi: 10.1038/ncb1929. [DOI] [PubMed] [Google Scholar]
  • 69.Jeppesen DK, et al. Quantitative proteomics of fractionated membrane and lumen exosome proteins from isogenic metastatic and nonmetastatic bladder cancer cells reveal differential expression of EMT factors. Proteomics. 2014;14(6):699–712. doi: 10.1002/pmic.201300452. [DOI] [PubMed] [Google Scholar]
  • 70.Qiu G, et al. Mesenchymal stem cell-derived extracellular vesicles affect disease outcomes via transfer of microRNAs. Stem Cell Res Ther. 2018;9(1):1–9. doi: 10.1186/s13287-017-0735-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Villarroya-Beltri C, et al. Sumoylated hnRNPA2B1 controls the sorting of miRNAs into exosomes through binding to specific motifs. Nat Commun. 2013;4(1):1–10. doi: 10.1038/ncomms3980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Santangelo L, et al. The RNA-binding protein SYNCRIP is a component of the hepatocyte exosomal machinery controlling microRNA sorting. Cell Rep. 2016;17(3):799–808. doi: 10.1016/j.celrep.2016.09.031. [DOI] [PubMed] [Google Scholar]
  • 73.Iavello A, et al. Role of Alix in miRNA packaging during extracellular vesicle biogenesis. Int J Mol Med. 2016;37(4):958–966. doi: 10.3892/ijmm.2016.2488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Mulcahy LA, Pink RC, Carter DRF. Routes and mechanisms of extracellular vesicle uptake. J Extracell Vesicles. 2014;3(1):24641. doi: 10.3402/jev.v3.24641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Montecalvo A, et al. Mechanism of transfer of functional microRNAs between mouse dendritic cells via exosomes. Blood. 2012;119(3):756–766. doi: 10.1182/blood-2011-02-338004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Morelli AE, et al. Endocytosis, intracellular sorting, and processing of exosomes by dendritic cells. Blood. 2004;104(10):3257–3266. doi: 10.1182/blood-2004-03-0824. [DOI] [PubMed] [Google Scholar]
  • 77.Escrevente C, et al. Interaction and uptake of exosomes by ovarian cancer cells. BMC Cancer. 2011;11(1):1–10. doi: 10.1186/1471-2407-11-108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.French KC, Antonyak MA, Cerione RA. Extracellular vesicle docking at the cellular port: Extracellular vesicle binding and uptake. Semin Cell Dev Biol. 2017;67:48–55. doi: 10.1016/j.semcdb.2017.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Parolini I, et al. Microenvironmental pH is a key factor for exosome traffic in tumor cells. J Biol Chem. 2009;284(49):34211–34222. doi: 10.1074/jbc.M109.041152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Song Y, et al. Exosomal miR-146a contributes to the enhanced therapeutic efficacy of interleukin-1β-primed mesenchymal stem cells against sepsis. Stem Cells. 2017;35(5):1208–1221. doi: 10.1002/stem.2564. [DOI] [PubMed] [Google Scholar]
  • 81.Shao L, et al. MiRNA-sequence indicates that mesenchymal stem cells and exosomes have similar mechanism to enhance cardiac repair. BioMed Res Int. 2017;2017:1–9. doi: 10.1155/2017/4150705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Baglio SR, et al. Human bone marrow-and adipose-mesenchymal stem cells secrete exosomes enriched in distinctive miRNA and tRNA species. Stem Cell Res Ther. 2015;6(1):1–20. doi: 10.1186/s13287-015-0116-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Ferguson SW, et al. The microRNA regulatory landscape of MSC-derived exosomes: a systems view. Sci Rep. 2018;8(1):1–12. doi: 10.1038/s41598-018-19581-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Luther KM, et al. Exosomal miR-21a-5p mediates cardioprotection by mesenchymal stem cells. J Mol Cell Cardiol. 2018;119:125–137. doi: 10.1016/j.yjmcc.2018.04.012. [DOI] [PubMed] [Google Scholar]
  • 85.Zhang Y, et al. Exosomes derived from mesenchymal stromal cells promote axonal growth of cortical neurons. Mol Neurobiol. 2017;54(4):2659–2673. doi: 10.1007/s12035-016-9851-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Park KK, et al. Promoting axon regeneration in the adult CNS by modulation of the PTEN/mTOR pathway. Science. 2008;322(5903):963–966. doi: 10.1126/science.1161566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Berry M, et al. Prospects for mTOR-mediated functional repair after central nervous system trauma. Neurobiol Dis. 2016;85:99–110. doi: 10.1016/j.nbd.2015.10.002. [DOI] [PubMed] [Google Scholar]
  • 88.Pan D, et al. UMSC-derived exosomes promote retinal ganglion cells survival in a rat model of optic nerve crush. J Chem Neuroanat. 2019;96:134–139. doi: 10.1016/j.jchemneu.2019.01.006. [DOI] [PubMed] [Google Scholar]
  • 89.Zhang W, Wang Y, Kong Y. Exosomes derived from mesenchymal stem cells modulate miR-126 to ameliorate hyperglycemia-induced retinal inflammation via targeting HMGB1. Investig Ophthalmol Vis Sci. 2019;60(1):294–303. doi: 10.1167/iovs.18-25617. [DOI] [PubMed] [Google Scholar]
  • 90.Huang KM, Dentchev T, Stambolian D. MiRNA expression in the eye. Mamm Genome. 2008;19(7):510–516. doi: 10.1007/s00335-008-9127-8. [DOI] [PubMed] [Google Scholar]
  • 91.Li W-B, et al. Development of retinal pigment epithelium from human parthenogenetic embryonic stem cells and microRNA signature. Investig Ophthalmol Vis Sci. 2012;53(9):5334–5343. doi: 10.1167/iovs.12-8303. [DOI] [PubMed] [Google Scholar]
  • 92.Arora A, et al. Prediction of microRNAs affecting mRNA expression during retinal development. BMC Dev Biol. 2010;10(1):1–15. doi: 10.1186/1471-213X-10-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Conte I, Banfi S, Bovolenta P. Non-coding RNAs in the development of sensory organs and related diseases. Cell Mol Life Sci. 2013;70(21):4141–4155. doi: 10.1007/s00018-013-1335-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Sun LF, Chen XJ, Jin ZB. Emerging roles of non-coding RNAs in retinal diseases: a review. Clin Exp Ophthalmol. 2020;48(8):1085–1101. doi: 10.1111/ceo.13806. [DOI] [PubMed] [Google Scholar]
  • 95.Rapicavoli NA, Blackshaw S. New meaning in the message: noncoding RNAs and their role in retinal development. Dev Dyn. 2009;238(9):2103–2114. doi: 10.1002/dvdy.21844. [DOI] [PubMed] [Google Scholar]
  • 96.Fuhrmann S, Zou C, Levine EM. Retinal pigment epithelium development, plasticity, and tissue homeostasis. Exp Eye Res. 2014;123:141–150. doi: 10.1016/j.exer.2013.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Huang X-F, et al. Retinal miRNAs variations in a large cohort of inherited retinal disease. Ophthalmic Genet. 2018;39(2):175–179. doi: 10.1080/13816810.2017.1329448. [DOI] [PubMed] [Google Scholar]
  • 98.Ryan DG, Oliveira-Fernandes M, Lavker RM. MicroRNAs of the mammalian eye display distinct and overlapping tissue specificity. Mol Vis. 2006;12(134–135):1175–1184. [PubMed] [Google Scholar]
  • 99.Xu S. microRNA expression in the eyes and their significance in relation to functions. Prog Retin Eye Res. 2009;28(2):87–116. doi: 10.1016/j.preteyeres.2008.11.003. [DOI] [PubMed] [Google Scholar]
  • 100.Maiorano NA, Hindges R. Chapter 19 - MicroRNAs in the Retina and in Visual Connectivity. In: Sen CK, editor. MicroRNA in Regenerative Medicine. Oxford: Academic Press; 2015. pp. 489–514. [Google Scholar]
  • 101.Karali M, et al. miRNeye: a microRNA expression atlas of the mouse eye. BMC Genomics. 2010;11(1):1–14. doi: 10.1186/1471-2164-11-715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Jun S, et al. The impact of lipids, lipid oxidation, and inflammation on AMD, and the potential role of miRNAs on lipid metabolism in the RPE. Exp Eye Res. 2019;181:346–355. doi: 10.1016/j.exer.2018.09.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Zhou J, et al. Retinal progenitor cells release extracellular vesicles containing developmental transcription factors, microRNA and membrane proteins. Sci Rep. 2018;8(1):1–15. doi: 10.1038/s41598-018-20421-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Sundermeier TR, Palczewski K. The physiological impact of microRNA gene regulation in the retina. Cell Mol Life Sci. 2012;69(16):2739–2750. doi: 10.1007/s00018-012-0976-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Karali M, et al. Identification and characterization of microRNAs expressed in the mouse eye. Investig Ophthalmol Vis Sci. 2007;48(2):509–515. doi: 10.1167/iovs.06-0866. [DOI] [PubMed] [Google Scholar]
  • 106.Hackler L, et al. MicroRNA profile of the developing mouse retina. Investig Ophthalmol Vis Sci. 2010;51(4):1823–1831. doi: 10.1167/iovs.09-4657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Reh TA, Hindges R. MicroRNAs in retinal development. Annu Rev Vis Sci. 2018;4:25–44. doi: 10.1146/annurev-vision-091517-034357. [DOI] [PubMed] [Google Scholar]
  • 108.García-García D, Locker M, Perron M. Update on Müller glia regenerative potential for retinal repair. Curr Opin Genet Dev. 2020;64:52–59. doi: 10.1016/j.gde.2020.05.025. [DOI] [PubMed] [Google Scholar]
  • 109.Rajaram K, et al. Dynamic miRNA expression patterns during retinal regeneration in zebrafish: reduced dicer or miRNA expression suppresses proliferation of Müller Glia-derived neuronal progenitor cells. Dev Dyn. 2014;243(12):1591–1605. doi: 10.1002/dvdy.24188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110.Sanuki R, et al. miR-124a is required for hippocampal axogenesis and retinal cone survival through Lhx2 suppression. Nat Neurosci. 2011;14(9):1125–1134. doi: 10.1038/nn.2897. [DOI] [PubMed] [Google Scholar]
  • 111.Quintero H, Gomez-Montalvo A, Lamas M. MicroRNA changes through Müller glia dedifferentiation and early/late rod photoreceptor differentiation. Neuroscience. 2016;316:109–121. doi: 10.1016/j.neuroscience.2015.12.025. [DOI] [PubMed] [Google Scholar]
  • 112.Baba Y, Aihara Y, Watanabe S. MicroRNA-7a regulates Müller glia differentiation by attenuating Notch3 expression. Exp Eye Res. 2015;138:59–65. doi: 10.1016/j.exer.2015.06.022. [DOI] [PubMed] [Google Scholar]
  • 113.La Torre A, Georgi S, Reh TA. Conserved microRNA pathway regulates developmental timing of retinal neurogenesis. Proc Natl Acad Sci. 2013;110(26):E2362–E2370. doi: 10.1073/pnas.1301837110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Cremisi F. MicroRNAs and cell fate in cortical and retinal development. Front Cell Neurosci. 2013;7:141. doi: 10.3389/fncel.2013.00141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Tao Z, et al. Lin28B promotes müller glial cell de-differentiation and proliferation in the regenerative rat retinas. Oncotarget. 2016;7(31):49368. doi: 10.18632/oncotarget.10343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116.Wohl SG, et al. Müller glial microRNAs are required for the maintenance of glial homeostasis and retinal architecture. Nat Commun. 2017;8(1):1–15. doi: 10.1038/s41467-017-01624-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Stappert L, Roese-Koerner B, Brüstle O. The role of microRNAs in human neural stem cells, neuronal differentiation and subtype specification. Cell Tissue Res. 2015;359(1):47–64. doi: 10.1007/s00441-014-1981-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118.Carrella S, et al. miR-181a/b control the assembly of visual circuitry by regulating retinal axon specification and growth. Dev Neurobiol. 2015;75(11):1252–1267. doi: 10.1002/dneu.22282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Zhuang P, et al. Combined microRNA and mRNA detection in mammalian retinas by in situ hybridization chain reaction. Sci Rep. 2020;10(1):1–10. doi: 10.1038/s41598-019-56847-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Busskamp V, et al. miRNAs 182 and 183 are necessary to maintain adult cone photoreceptor outer segments and visual function. Neuron. 2014;83(3):586–600. doi: 10.1016/j.neuron.2014.06.020. [DOI] [PubMed] [Google Scholar]
  • 121.Peskova L, et al. miR-183/96/182 cluster is an important morphogenetic factor targeting PAX6 expression in differentiating human retinal organoids. Stem Cells. 2020;38(12):1557–1567. doi: 10.1002/stem.3272. [DOI] [PubMed] [Google Scholar]
  • 122.Li H, et al. Brain-derived neurotrophic factor is a novel target gene of the hsa-miR-183/96/182 cluster in retinal pigment epithelial cells following visible light exposure. Mol Med Rep. 2015;12(2):2793–2799. doi: 10.3892/mmr.2015.3736. [DOI] [PubMed] [Google Scholar]
  • 123.Kutty RK, et al. MicroRNA expression in human retinal pigment epithelial (ARPE-19) cells: increased expression of microRNA-9 by N-(4-hydroxyphenyl) retinamide. Mol Vis. 2010;16:1475. [PMC free article] [PubMed] [Google Scholar]
  • 124.Shahriari F, et al. MicroRNA profiling reveals important functions of miR-125b and let-7a during human retinal pigment epithelial cell differentiation. Exp Eye Res. 2020;190:107883. doi: 10.1016/j.exer.2019.107883. [DOI] [PubMed] [Google Scholar]
  • 125.Hu G, et al. Identification of miRNA signatures during the differentiation of hESCs into retinal pigment epithelial cells. PLoS ONE. 2012;7(7):e37224. doi: 10.1371/journal.pone.0037224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126.Jiang C, et al. MicroRNA-184 promotes differentiation of the retinal pigment epithelium by targeting the AKT2/mTOR signaling pathway. Oncotarget. 2016;7(32):52340. doi: 10.18632/oncotarget.10566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127.Yan, N., et al., Profiling MicroRNAs Differentially Expressed in Rabbit Retina, in Retinal Degenerative Diseases: Laboratory and Therapeutic Investigations, R.E. Anderson, J.G. Hollyfield, and M.M. LaVail, Editors. 2010, Springer New York: New York, NY. p. 203-209. [DOI] [PubMed]
  • 128.Agrawal S, Chaqour B. MicroRNA signature and function in retinal neovascularization. World J Biol Chem. 2014;5(1):1. doi: 10.4331/wjbc.v5.i1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.Wang H-C, et al. Profiling the microRNA expression in human iPS and iPS-derived retinal pigment epithelium. Cancer Inform. 2014;13:CIN. S14074. doi: 10.4137/CIN.S14074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 130.Murad N, et al. miR-184 regulates ezrin, LAMP-1 expression, affects phagocytosis in human retinal pigment epithelium and is downregulated in age-related macular degeneration. FEBS J. 2014;281(23):5251–5264. doi: 10.1111/febs.13066. [DOI] [PubMed] [Google Scholar]
  • 131.Wang Q, et al. Regulation of retinal inflammation by rhythmic expression of MiR-146a in diabetic retina. Investig Ophthalmol Vis Sci. 2014;55(6):3986–3994. doi: 10.1167/iovs.13-13076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 132.Xiong F, et al. Altered retinal microRNA expression profiles in early diabetic retinopathy: an in silico analysis. Curr Eye Res. 2014;39(7):720–729. doi: 10.3109/02713683.2013.872280. [DOI] [PubMed] [Google Scholar]
  • 133.Wang Y, et al. Identification of key miRNAs and genes for mouse retinal development using a linear model. Mol Med Rep. 2020;22(1):494–506. doi: 10.3892/mmr.2020.11082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 134.Murray AR, et al. MicroRNA-200b downregulates oxidation resistance 1 (Oxr1) expression in the retina of type 1 diabetes model. Investig Ophthalmol Vis Sci. 2013;54(3):1689–1697. doi: 10.1167/iovs.12-10921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 135.Hou Q, et al. Inhibitory effect of microRNA-34a on retinal pigment epithelial cell proliferation and migration. Investig Ophthalmol Vis Sci. 2013;54(10):6481–6488. doi: 10.1167/iovs.13-11873. [DOI] [PubMed] [Google Scholar]
  • 136.Karali M, et al. High-resolution analysis of the human retina miRNome reveals isomiR variations and novel microRNAs. Nucleic Acids Res. 2016;44(4):1525–1540. doi: 10.1093/nar/gkw039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 137.Ye E-A, Steinle JJ. miR-15b/16 protects primary human retinal microvascular endothelial cells against hyperglycemia-induced increases in tumor necrosis factor alpha and suppressor of cytokine signaling 3. J Neuroinflamm. 2015;12(1):1–8. doi: 10.1186/s12974-015-0265-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 138.Li X, Jin P. Roles of small regulatory RNAs in determining neuronal identity. Nat Rev Neurosci. 2010;11(5):329–338. doi: 10.1038/nrn2739. [DOI] [PubMed] [Google Scholar]
  • 139.Li M, et al. MicroRNA-29b regulates TGF-β1-mediated epithelial–mesenchymal transition of retinal pigment epithelial cells by targeting AKT2. Exp Cell Res. 2016;345(2):115–124. doi: 10.1016/j.yexcr.2014.09.026. [DOI] [PubMed] [Google Scholar]
  • 140.Silva VA, et al. Expression and cellular localization of microRNA-29b and RAX, an activator of the RNA-dependent protein kinase (PKR), in the retina of streptozotocin-induced diabetic rats. Mol Vis. 2011;17:2228. [PMC free article] [PubMed] [Google Scholar]
  • 141.Ji H-P, et al. MicroRNA-28 potentially regulates the photoreceptor lineage commitment of Müller glia-derived progenitors. Sci Rep. 2017;7(1):1–9. doi: 10.1038/s41598-016-0028-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 142.Hui Y, Yin Y. MicroRNA-145 attenuates high glucose-induced oxidative stress and inflammation in retinal endothelial cells through regulating TLR4/NF-κB signaling. Life Sci. 2018;207:212–218. doi: 10.1016/j.lfs.2018.06.005. [DOI] [PubMed] [Google Scholar]
  • 143.Jun JH, Joo C-K. MicroRNA-124 controls transforming growth factor β1-induced epithelial-mesenchymal transition in the retinal pigment epithelium by targeting RHOG. Investig Ophthalmol Vis Sci. 2016;57(1):12–22. doi: 10.1167/iovs.15-17111. [DOI] [PubMed] [Google Scholar]
  • 144.Decembrini S, et al. MicroRNAs couple cell fate and developmental timing in retina. Proc Natl Acad Sci. 2009;106(50):21179–21184. doi: 10.1073/pnas.0909167106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 145.Walker JC, Harland RM. microRNA-24a is required to repress apoptosis in the developing neural retina. Genes Dev. 2009;23(9):1046–1051. doi: 10.1101/gad.1777709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 146.Zhang Y, et al. miR-29a regulates the proliferation and differentiation of retinal progenitors by targeting Rbm8a. Oncotarget. 2017;8(19):31993. doi: 10.18632/oncotarget.16669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 147.Yan L, et al. Single and compound knock-outs of MicroRNA (miRNA)-155 and its angiogenic gene target CCN1 in mice alter vascular and neovascular growth in the retina via resident microglia. J Biol Chem. 2015;290(38):23264–23281. doi: 10.1074/jbc.M115.646950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 148.Van Battum EY, et al. An image-based miRNA screen identifies miRNA-135s as regulators of CNS axon growth and regeneration by targeting Krüppel-like factor 4. J Neurosci. 2018;38(3):613–630. doi: 10.1523/JNEUROSCI.0662-17.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 149.Taylor SM, et al. The MicroRNA, miR-18a, regulates NeuroD and photoreceptor differentiation in the retina of zebrafish. Dev Neurobiol. 2019;79(2):202–219. doi: 10.1002/dneu.22666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 150.Sun N, et al. miR-17 regulates the proliferation and differentiation of retinal progenitor cells by targeting CHMP1A. Biochem Biophys Res Commun. 2020;523(2):493–499. doi: 10.1016/j.bbrc.2019.11.108. [DOI] [PubMed] [Google Scholar]
  • 151.Liu C-H, et al. Endothelial microRNA-150 is an intrinsic suppressor of pathologic ocular neovascularization. Proc Natl Acad Sci. 2015;112(39):12163–12168. doi: 10.1073/pnas.1508426112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 152.Heldring N, et al. Therapeutic potential of multipotent mesenchymal stromal cells and their extracellular vesicles. Hum Gene Ther. 2015;26(8):506–517. doi: 10.1089/hum.2015.072. [DOI] [PubMed] [Google Scholar]
  • 153.Yaghoubi Y, et al. Human umbilical cord mesenchymal stem cells derived-exosomes in diseases treatment. Life Sci. 2019;233:116733. doi: 10.1016/j.lfs.2019.116733. [DOI] [PubMed] [Google Scholar]
  • 154.Chen TS, et al. Mesenchymal stem cell secretes microparticles enriched in pre-microRNAs. Nucleic Acids Res. 2010;38(1):215–224. doi: 10.1093/nar/gkp857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 155.Fujita Y, et al. Clinical application of mesenchymal stem cell-derived extracellular vesicle-based therapeutics for inflammatory lung diseases. J Clin Med. 2018;7(10):355. doi: 10.3390/jcm7100355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 156.Park K-S, et al. Enhancement of therapeutic potential of mesenchymal stem cell-derived extracellular vesicles. Stem Cell Res Ther. 2019;10(1):1–15. doi: 10.1186/s13287-018-1105-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 157.Quesenberry PJ, et al. Role of extracellular RNA-carrying vesicles in cell differentiation and reprogramming. Stem Cell Res Ther. 2015;6(1):1–10. doi: 10.1186/s13287-015-0150-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 158.Pers Y-M, et al. Contribution of microRNAs to the immunosuppressive function of mesenchymal stem cells. Biochimie. 2018;155:109–118. doi: 10.1016/j.biochi.2018.07.001. [DOI] [PubMed] [Google Scholar]
  • 159.Abbaszadeh H, et al. Human umbilical cord mesenchymal stem cell-derived extracellular vesicles: a novel therapeutic paradigm. J Cell Physiol. 2020;235(2):706–717. doi: 10.1002/jcp.29004. [DOI] [PubMed] [Google Scholar]
  • 160.Rad F, et al. Mesenchymal stem cell-based therapy for autoimmune diseases: emerging roles of extracellular vesicles. Mol Biol Rep. 2019;46(1):1533–1549. doi: 10.1007/s11033-019-04588-y. [DOI] [PubMed] [Google Scholar]
  • 161.Ngadiono E, Hardiany NS. Advancing towards effective glioma therapy: MicroRNA derived from umbilical cord mesenchymal stem cells’ extracellular vesicles. Malays J Med Sci MJMS. 2019;26(4):5. doi: 10.21315/mjms2019.26.4.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 162.He L, Zhang H. MicroRNAs in the migration of mesenchymal stem cells. Stem Cell Rev Rep. 2019;15(1):3–12. doi: 10.1007/s12015-018-9852-7. [DOI] [PubMed] [Google Scholar]
  • 163.Vilaça-Faria H, Salgado AJ, Teixeira FG. Mesenchymal stem cells-derived exosomes: a new possible therapeutic strategy for Parkinson’s disease? Cells. 2019;8(2):118. doi: 10.3390/cells8020118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 164.Phinney DG, Pittenger MF. Concise review: MSC-derived exosomes for cell-free therapy. Stem Cells. 2017;35(4):851–858. doi: 10.1002/stem.2575. [DOI] [PubMed] [Google Scholar]
  • 165.Qian X, et al. Exosomal microRNAs derived from umbilical mesenchymal stem cells inhibit hepatitis C virus infection. Stem Cells Transl Med. 2016;5(9):1190–1203. doi: 10.5966/sctm.2015-0348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 166.Zhu Z, et al. MicroRNAs and mesenchymal stem cells: hope for pulmonary hypertension. Braz J Cardiovasc Surg. 2015;30(3):380–385. doi: 10.5935/1678-9741.20150033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 167.Zhu L, et al. Transplantation of adipose tissue-derived stem cell-derived exosomes ameliorates erectile function in diabetic rats. Andrologia. 2018;50(2):e12871. doi: 10.1111/and.12871. [DOI] [PubMed] [Google Scholar]
  • 168.Casado-Díaz A, Quesada-Gómez JM, Dorado G. Extracellular vesicles derived from mesenchymal stem cells (MSC) in regenerative medicine: applications in skin wound healing. Front Bioeng Biotechnol. 2020 doi: 10.3389/fbioe.2020.00146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 169.Katsuda T, Ochiya T. Molecular signatures of mesenchymal stem cell-derived extracellular vesicle-mediated tissue repair. Stem Cell Res Ther. 2015;6(1):1–8. doi: 10.1186/s13287-015-0214-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 170.Konala VBR, et al. The current landscape of the mesenchymal stromal cell secretome: a new paradigm for cell-free regeneration. Cytotherapy. 2016;18(1):13–24. doi: 10.1016/j.jcyt.2015.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 171.Chang Y-H, et al. Exosomes and stem cells in degenerative disease diagnosis and therapy. Cell Transplant. 2018;27(3):349–363. doi: 10.1177/0963689717723636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 172.Sun L, et al. Exosomes derived from human umbilical cord mesenchymal stem cells protect against cisplatin-induced ovarian granulosa cell stress and apoptosis in vitro. Sci Rep. 2017;7(1):1–13. doi: 10.1038/s41598-016-0028-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 173.Wang X, et al. Mesenchymal stem cell-derived exosomes have altered microRNA profiles and induce osteogenic differentiation depending on the stage of differentiation. PLoS ONE. 2018;13(2):e0193059. doi: 10.1371/journal.pone.0193059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 174.Collino F, et al. Microvesicles derived from adult human bone marrow and tissue specific mesenchymal stem cells shuttle selected pattern of miRNAs. PLoS ONE. 2010;5(7):e11803. doi: 10.1371/journal.pone.0011803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 175.Fang S, et al. Umbilical cord-derived mesenchymal stem cell-derived exosomal microRNAs suppress myofibroblast differentiation by inhibiting the transforming growth factor-β/SMAD2 pathway during wound healing. Stem Cells Transl Med. 2016;5(10):1425–1439. doi: 10.5966/sctm.2015-0367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 176.Chen X, et al. Bone marrow mesenchymal stem cell-derived extracellular vesicles containing miR-497-5p inhibit RSPO2 and accelerate OPLL. Life Sci. 2021;279:119481. doi: 10.1016/j.lfs.2021.119481. [DOI] [PubMed] [Google Scholar]
  • 177.Xin H, et al. MicroRNA-17–92 cluster in exosomes enhance neuroplasticity and functional recovery after stroke in rats. Stroke. 2017;48(3):747–753. doi: 10.1161/STROKEAHA.116.015204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 178.Sun X, et al. Exosomal microRNA-23b-3p from bone marrow mesenchymal stem cells maintains T helper/Treg balance by downregulating the PI3k/Akt/NF-κB signaling pathway in intracranial aneurysm. Brain Res Bull. 2020;165:305–315. doi: 10.1016/j.brainresbull.2020.09.003. [DOI] [PubMed] [Google Scholar]
  • 179.Pawlick JS, et al. MiRNA regulatory functions in photoreceptors. Front Cell Dev Biol. 2021;8:1913. doi: 10.3389/fcell.2020.620249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 180.Chu-Tan JA, et al. MicroRNA-124 Dysregulation is associated with retinal inflammation and photoreceptor death in the degenerating retina. Investig Ophthalmol Vis Sci. 2018;59(10):4094–4105. doi: 10.1167/iovs.18-24623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 181.He Y, et al. MiR-124 promotes the growth of retinal ganglion cells derived from Müller cells. Cell Physiol Biochem. 2018;45(3):973–983. doi: 10.1159/000487292. [DOI] [PubMed] [Google Scholar]
  • 182.Indrieri A, et al. The pervasive role of the miR-181 family in development, neurodegeneration, and cancer. Int J Mol Sci. 2020;21(6):2092. doi: 10.3390/ijms21062092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 183.Miltner AM, La Torre A. Retinal ganglion cell replacement: current status and challenges ahead. Dev Dyn. 2019;248(1):118–128. doi: 10.1002/dvdy.24672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 184.Hu Y, et al. Reciprocal actions of microRNA-9 and TLX in the proliferation and differentiation of retinal progenitor cells. Stem Cells Dev. 2014;23(22):2771–2781. doi: 10.1089/scd.2014.0021. [DOI] [PubMed] [Google Scholar]
  • 185.Nguyen-Ba-Charvet KT, Rebsam A. Neurogenesis and specification of retinal ganglion cells. Int J Mol Sci. 2020;21(2):451. doi: 10.3390/ijms21020451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 186.Qi X. The role of miR-9 during neuron differentiation of mouse retinal stem cells. Artif Cells Nanomed Biotechnol. 2016;44(8):1883–1890. doi: 10.3109/21691401.2015.1111231. [DOI] [PubMed] [Google Scholar]
  • 187.Jin Z, Ren J, Qi S. Exosomal miR-9-5p secreted by bone marrow–derived mesenchymal stem cells alleviates osteoarthritis by inhibiting syndecan-1. Cell Tissue Res. 2020;381:99–114. doi: 10.1007/s00441-020-03193-x. [DOI] [PubMed] [Google Scholar]
  • 188.Wu K-C, et al. Deletion of miR-182 leads to retinal dysfunction in mice. Investig Ophthalmol Vis Sci. 2019;60(4):1265–1274. doi: 10.1167/iovs.18-24166. [DOI] [PubMed] [Google Scholar]
  • 189.Mead B, et al. Viral delivery of multiple miRNAs promotes retinal ganglion cell survival and functional preservation after optic nerve crush injury. Exp Eye Res. 2020;197:108071. doi: 10.1016/j.exer.2020.108071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 190.Zhao J, et al. Mesenchymal stromal cell-derived exosomes attenuate myocardial ischaemia-reperfusion injury through miR-182-regulated macrophage polarization. Cardiovasc Res. 2019;115(7):1205–1216. doi: 10.1093/cvr/cvz040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 191.Laine SK, et al. MicroRNAs miR-96, miR-124, and miR-199a regulate gene expression in human bone marrow-derived mesenchymal stem cells. J Cell Biochem. 2012;113(8):2687–2695. doi: 10.1002/jcb.24144. [DOI] [PubMed] [Google Scholar]
  • 192.Sundermeier TR, et al. DICER1 is essential for survival of postmitotic rod photoreceptor cells in mice. FASEB J. 2014;28(8):3780–3791. doi: 10.1096/fj.14-254292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 193.Collino F, et al. Exosome and microvesicle-enriched fractions isolated from mesenchymal stem cells by gradient separation showed different molecular signatures and functions on renal tubular epithelial cells. Stem Cell Rev Rep. 2017;13(2):226–243. doi: 10.1007/s12015-016-9713-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 194.Han F, et al. MicroRNA-30b promotes axon outgrowth of retinal ganglion cells by inhibiting Semaphorin3A expression. Brain Res. 2015;1611:65–73. doi: 10.1016/j.brainres.2015.03.014. [DOI] [PubMed] [Google Scholar]
  • 195.Zhou Q, et al. Strand and cell type-specific function of microRNA-126 in angiogenesis. Mol Ther. 2016;24(10):1823–1835. doi: 10.1038/mt.2016.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 196.Villain G, et al. miR-126-5p promotes retinal endothelial cell survival through SetD5 regulation in neurons. Development. 2018;145(1):dev156232. doi: 10.1242/dev.156232. [DOI] [PubMed] [Google Scholar]
  • 197.Bai X, et al. MicroRNA-126 reduces blood-retina barrier breakdown via the regulation of VCAM-1 and BCL2L11 in ischemic retinopathy. Ophthalmic Res. 2017;57(3):173–185. doi: 10.1159/000454716. [DOI] [PubMed] [Google Scholar]
  • 198.Yao K, et al. Wnt regulates proliferation and neurogenic potential of Müller glial cells via a Lin28/let-7 miRNA-dependent pathway in adult mammalian retinas. Cell Rep. 2016;17(1):165–178. doi: 10.1016/j.celrep.2016.08.078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 199.Fairchild CL, et al. Let-7 regulates cell cycle dynamics in the developing cerebral cortex and retina. Sci Rep. 2019;9(1):1–21. doi: 10.1038/s41598-019-51703-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 200.Konar GJ, et al. miRNAs and Müller glia reprogramming during retina regeneration. Front Cell Dev Biol. 2021;8:1851. doi: 10.3389/fcell.2020.632632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 201.Ni N, et al. Effects of let-7b and TLX on the proliferation and differentiation of retinal progenitor cells in vitro. Sci Rep. 2014;4(1):1–10. doi: 10.1038/srep06671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 202.Rasheed VA, et al. Developmental wave of Brn3b expression leading to RGC fate specification is synergistically maintained by miR-23a and miR-374. Dev Neurobiol. 2014;74(12):1155–1171. doi: 10.1002/dneu.22191. [DOI] [PubMed] [Google Scholar]
  • 203.Chang W, Wang J. Exosomes and their noncoding RNA cargo are emerging as new modulators for diabetes mellitus. Cells. 2019;8(8):853. doi: 10.3390/cells8080853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 204.Wang J-H, et al. MicroRNA-143 plays a protective role in ischemia-induced retinal neovascularization. bioRxiv. 2019;53:548297. [Google Scholar]
  • 205.McArthur K, et al. MicroRNA-200b regulates vascular endothelial growth factor–mediated alterations in diabetic retinopathy. Diabetes. 2011;60(4):1314–1323. doi: 10.2337/db10-1557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 206.Ye E-A, Steinle JJ. miR-146a attenuates inflammatory pathways mediated by TLR4/NF-κB and TNFα to protect primary human retinal microvascular endothelial cells grown in high glucose. Mediators Inflamm. 2016;2016:1–9. doi: 10.1155/2016/3958453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 207.Hu Z, et al. Protective effects of microRNA-22-3p against retinal pigment epithelial inflammatory damage by targeting NLRP3 inflammasome. J Cell Physiol. 2019;234(10):18849–18857. doi: 10.1002/jcp.28523. [DOI] [PubMed] [Google Scholar]
  • 208.Zhou J, et al. Human retinal organoids release extracellular vesicles that regulate gene expression in target human retinal progenitors. bioRxiv. 2021;3:1. doi: 10.1038/s41598-021-00542-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 209.Wang J, et al. MicroRNA-148a-3p alleviates high glucose-induced diabetic retinopathy by targeting TGFB2 and FGF2. Acta Diabetol. 2020;57(12):1435–1443. doi: 10.1007/s00592-020-01569-7. [DOI] [PubMed] [Google Scholar]
  • 210.Yuan Z, et al. Variability of miRNA expression during the differentiation of human embryonic stem cells into retinal pigment epithelial cells. Gene. 2015;569(2):239–249. doi: 10.1016/j.gene.2015.05.060. [DOI] [PubMed] [Google Scholar]
  • 211.Zhao W, et al. Arbutin attenuates hydrogen peroxide-induced oxidative injury through regulation of microRNA-29a in retinal ganglion cells. Biomed Pharmacother. 2019;112:108729. doi: 10.1016/j.biopha.2019.108729. [DOI] [PubMed] [Google Scholar]
  • 212.Tang W, et al. MicroRNA-29b-3p inhibits cell proliferation and angiogenesis by targeting VEGFA and PDGFB in retinal microvascular endothelial cells. Mol Vis. 2020;26:64. [PMC free article] [PubMed] [Google Scholar]
  • 213.Xia X, Teotia P, Ahmad I. miR-29c regulates neurogliogenesis in the mammalian retina through REST. Dev Biol. 2019;450(2):90–100. doi: 10.1016/j.ydbio.2019.03.013. [DOI] [PubMed] [Google Scholar]
  • 214.Li T, et al. Bone marrow mesenchymal stem cell-derived exosomal miRNA-29c decreases cardiac ischemia/reperfusion injury through inhibition of excessive autophagy via the PTEN/Akt/mTOR signaling pathway. Circ J. 2020;84(8):1304–1311. doi: 10.1253/circj.CJ-19-1060. [DOI] [PubMed] [Google Scholar]
  • 215.Guduric-Fuchs J, et al. Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells. J Cell Biochem. 2012;113(6):2098–2111. doi: 10.1002/jcb.24084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 216.Bao H, et al. Astragaloside protects oxygen and glucose deprivation induced injury by regulation of microRNA-21 in retinal ganglion cell line RGC-5. Biomed Pharmacother. 2019;109:1826–1833. doi: 10.1016/j.biopha.2018.11.024. [DOI] [PubMed] [Google Scholar]
  • 217.Deng C-L, et al. Photoreceptor protection by mesenchymal stem cell transplantation identifies exosomal MiR-21 as a therapeutic for retinal degeneration. Cell Death Differ. 2021;28(3):1041–1061. doi: 10.1038/s41418-020-00636-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 218.Fulzele S, et al. MicroRNA-146b-3p regulates retinal inflammation by suppressing adenosine deaminase-2 in diabetes. BioMed Res Int. 2015;2015:1–8. doi: 10.1155/2015/846501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 219.Shao Y, et al. miRNA-451a regulates RPE function through promoting mitochondrial function in proliferative diabetic retinopathy. Am J Physiol Endocrinol Metab. 2019;316(3):E443–E452. doi: 10.1152/ajpendo.00360.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 220.Li Y, et al. A microRNA, mir133b, suppresses melanopsin expression mediated by failure dopaminergic amacrine cells in RCS rats. Cell Signal. 2012;24(3):685–698. doi: 10.1016/j.cellsig.2011.10.017. [DOI] [PubMed] [Google Scholar]
  • 221.Li Z, et al. Protective effects on retinal ganglion cells by miR-133 via MAPK/Erk2 signaling pathway in the N-methyl-D-aspartate-induced apoptosis model. Nanosci Nanotechnol Lett. 2018;10(12):1726–1731. doi: 10.1166/nnl.2018.2836. [DOI] [Google Scholar]
  • 222.Wang Y, Tang Z, Gu P. Stem/progenitor cell-based transplantation for retinal degeneration: a review of clinical trials. Cell Death Dis. 2020;11(9):1–14. doi: 10.1038/s41419-020-02955-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 223.van Mil A, et al. MicroRNA-214 inhibits angiogenesis by targeting Quaking and reducing angiogenic growth factor release. Cardiovasc Res. 2012;93(4):655–665. doi: 10.1093/cvr/cvs003. [DOI] [PubMed] [Google Scholar]
  • 224.Maiorano NA, Hindges R. Non-coding RNAs in retinal development. Int J Mol Sci. 2012;13(1):558–578. doi: 10.3390/ijms13010558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 225.Lian C, et al. MicroRNA-24 protects retina from degeneration in rats by down-regulating chitinase-3-like protein 1. Exp Eye Res. 2019;188:107791. doi: 10.1016/j.exer.2019.107791. [DOI] [PubMed] [Google Scholar]
  • 226.Xu S, et al. MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster. J Biol Chem. 2007;282(34):25053–25066. doi: 10.1074/jbc.M700501200. [DOI] [PubMed] [Google Scholar]
  • 227.Chen N, et al. MicroRNA-410 reduces the expression of vascular endothelial growth factor and inhibits oxygen-induced retinal neovascularization. PLoS ONE. 2014;9(4):e95665. doi: 10.1371/journal.pone.0095665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 228.Mak HK, et al. MicroRNA-19a-PTEN axis is involved in the developmental decline of axon regenerative capacity in retinal ganglion cells. Mol Ther Nucleic Acids. 2020;21:251–263. doi: 10.1016/j.omtn.2020.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 229.Wang Y, et al. MicroRNA-93/STAT3 signalling pathway mediates retinal microglial activation and protects retinal ganglion cells in an acute ocular hypertension model. Cell Death Dis. 2021;12(1):1–12. doi: 10.1038/s41419-020-03229-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 230.Li R, et al. MiR-93-5p targeting PTEN regulates the NMDA-induced autophagy of retinal ganglion cells via AKT/mTOR pathway in glaucoma. Biomed Pharmacother. 2018;100:1–7. doi: 10.1016/j.biopha.2018.01.044. [DOI] [PubMed] [Google Scholar]
  • 231.Bruno S, et al. Renal regenerative potential of different extracellular vesicle populations derived from bone marrow mesenchymal stromal cells. Tissue Eng Part A. 2017;23(21–22):1262–1273. doi: 10.1089/ten.tea.2017.0069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 232.Marler KJ, et al. BDNF promotes axon branching of retinal ganglion cells via miRNA-132 and p250GAP. J Neurosci. 2014;34(3):969–979. doi: 10.1523/JNEUROSCI.1910-13.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 233.Liu B, et al. MiR-361-5p inhibits cell proliferation and induces cell apoptosis in retinoblastoma by negatively regulating CLDN8. Childs Nerv Syst. 2019;35(8):1303–1311. doi: 10.1007/s00381-019-04199-9. [DOI] [PubMed] [Google Scholar]
  • 234.Zhao D, Cui Z. MicroRNA-361-3p regulates retinoblastoma cell proliferation and stemness by targeting hedgehog signaling. Exp Ther Med. 2019;17(2):1154–1162. doi: 10.3892/etm.2018.7062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 235.Intartaglia D, Giamundo G, Conte I. The impact of miRNAs in health and disease of retinal pigment epithelium. Front Cell Dev Biol. 2021;8:1811. doi: 10.3389/fcell.2020.589985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 236.Katsman D, et al. Embryonic stem cell-derived microvesicles induce gene expression changes in Müller cells of the retina. PLoS ONE. 2012;7(11):e50417. doi: 10.1371/journal.pone.0050417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 237.Wang Q, et al. Dual anti-inflammatory and anti-angiogenic action of miR-15a in diabetic retinopathy. EBioMedicine. 2016;11:138–150. doi: 10.1016/j.ebiom.2016.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 238.Fernando N, et al. MicroRNA-223 regulates retinal function and inflammation in the healthy and degenerating retina. Front Cell Dev Biol. 2020;8:516. doi: 10.3389/fcell.2020.00516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 239.Fuller-Carter PI, et al. Integrated analyses of zebrafish miRNA and mRNA expression profiles identify miR-29b and miR-223 as potential regulators of optic nerve regeneration. BMC Genomics. 2015;16(1):1–19. doi: 10.1186/s12864-015-1772-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 240.Mak HK, Leung CK. MicroRNA-based therapeutics for optic neuropathy: opportunities and challenges. Neural Regen Res. 2021;16(10):1996. doi: 10.4103/1673-5374.308081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 241.Morquette B, et al. MicroRNA-223 protects neurons from degeneration in experimental autoimmune encephalomyelitis. Brain. 2019;142(10):2979–2995. doi: 10.1093/brain/awz245. [DOI] [PubMed] [Google Scholar]
  • 242.Li J, et al. microRNA-497 overexpression decreases proliferation, migration and invasion of human retinoblastoma cells via targeting vascular endothelial growth factor A. Oncol Lett. 2017;13(6):5021–5027. doi: 10.3892/ol.2017.6083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 243.Zhang Y, Chen F, Wang L. Metformin inhibits development of diabetic retinopathy through microRNA-497a-5p. Am J Transl Res. 2017;9(12):5558. [PMC free article] [PubMed] [Google Scholar]
  • 244.Liao Y, 2018. MiR-140–5p suppresses retinoblastoma cell growth via inhibiting c-Met/AKT/mTOR pathway. Biosci Rep. [DOI] [PMC free article] [PubMed] [Retracted]
  • 245.Chan AS, et al. The protective role of MicroRNA-140 in retinal ischemia. Investig Ophthalmol Vis Sci. 2011;52(14):517–517. [Google Scholar]
  • 246.Bian H, et al. The latest progress on miR-374 and its functional implications in physiological and pathological processes. J Cell Mol Med. 2019;23(5):3063–3076. doi: 10.1111/jcmm.14219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 247.Tasharrofi N, et al. Survival improvement in human retinal pigment epithelial cells via Fas receptor targeting by miR-374a. J Cell Biochem. 2017;118(12):4854–4861. doi: 10.1002/jcb.26160. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

  1. Liao Y, 2018. MiR-140–5p suppresses retinoblastoma cell growth via inhibiting c-Met/AKT/mTOR pathway. Biosci Rep. [DOI] [PMC free article] [PubMed] [Retracted]

Data Availability Statement

Not applicable.


Articles from Stem Cell Research & Therapy are provided here courtesy of BMC

RESOURCES