Skip to main content
PLOS One logoLink to PLOS One
. 2021 Nov 4;16(11):e0254914. doi: 10.1371/journal.pone.0254914

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

Yan Shi 1,2, Lin-Yu Li 1, Qin-Peng Liu 1, Muhammad Yasir Ali 1, Zhong-Lin Yuan 1, Guy Smagghe 2,3,*, Tong-Xian Liu 1,*
Editor: Ben J Mans4
PMCID: PMC8568281  PMID: 34735444

Abstract

Praying mantises are distributed all over the world. Though some Mantodea mitogenomes have been reported, an evolutionary genomic and phylogenetic analysis study lacks the latest taxonomic system. In the present study, four new mitogenomes were sequenced and annotated. Deroplatys truncate, D. lobate, Amorphoscelis chinensis and Macromantis sp. belong to Deroplatyidae, Amorphoscelidae and Photinaidae family, respectively. Our results indicated that the ATP8 gene may be lost in D. truncate and D. lobata mt genome, and four tRNA genes have not been found in D. truncate, D. lobata and Macromantis sp. A dN/dS pair analysis was conducted and it was found that all genes have evolved under purifying selection. Furthermore, we tested the phylogenetic relationships between the eight families of the Mantodea, including 35 species of praying Mantis. Based on the complete mitochondrial genome data, it was also suggested as sister to Deroplatyidae + Mantidae, Metallyticus sp., the only representative of Metallyticidae, is sister to the remaining mantises. Our results support the taxonomic system of Schwarz and Roy and are consistent with previous studies.

1. Introduction

The praying mantis comprises up to 2,300 species having diversified morphological and ecological characteristics. These insects colonize at wider range of habitats, including arid and tropical rainforests, temperate regions and engaged in multiple hunting tactics [1, 2]. Praying mantises have significant applied importance in biological research such as agronomy, pharmacy and visualization. Many studies mainly focused on their biological properties, like the distribution, taxonomy, captive breeding behavior and the foodstuffs applications [3, 4].

The mitochondrial genome (mitogenome), as a robust molecular marker [5], has recently been utilized in the initial study of phylogenetic linkage among closely related species from Mantodea [6]. The typical insect mitogenome encodes a conserved set of 37 genes for 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes and 22 transfer RNA (tRNA) genes, having genome-level features, such as gene order, gene content and genome size, and some lineages exhibit great diversity [6, 7].

As per Schwarz’s taxonomic system, Mantodea inheres 29 recognized families [8]. Amorphoscelidae comprises two subfamilies: Amorphoscelinae and Perlamantinae. Amorphoscelis belongs to the subfamily Amorphoscelinae, which can be distinguished from all other mantis through some characters such as: small, dorsoventrally flattened body, and adapted to a bark-living lifestyle [8]. Photinaidae comprises four subfamilies: Macromantinae, Photiomantinae, Cardiopterinae and Photinainae; Macromantis belongs to the Macromantinae subfamily [8]. Rivera & Svenson gave the Photinaidae morphological characters that they characterize [9]. Furthermore, Deroplatyidae is a lineage of primarily stick-like genera integrated due to genital morphology; widely oppressed [10, 11], the type genus of this family is Deroplatys. However, the phylogenetic relationships of Amorphoscelidae, Photinaidae and Deroplatyidae are also in doubt in the latest taxonomic system.

These four species belong to three families and inhabit quite different niches. Deroplatys’ habitat environments are rainforest with high humidity. They perch in the thin branches and mimic dead leaves (S1A and S1D Fig). Amorphoscelis generally inhabits trunks, capturing small active insects such as ants or springtails (S1B Fig). Macromantis inhabits the dense broad leaves, and it requires high humidity and high temperature (S1C Fig). In this study, four new mitogenomes were described from different families (Amorphoscelidae, Photinaidae and Deroplatyidae), and a relative analysis of all available mitogenomes was conducted. These studies embodied a comprehensive analysis to elucidate the characteristics of protein-coding genes (PCGs), structural features in transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs), the rate of evolution of PCGs, and the phylogenetic interrelation of these species based on 35 concatenated mitochondrial genes. Also, we discussed the possible reasons for ATP8 gene loss in D. truncate and D. lobata. The results will lay the foundation for the study of Amorphoscelidae, Photinaidae and Deroplatyidae in the latest taxonomic system.

2. Results and discussion

The Illumina Hiseq 2500 platform with a PE150 strategy (150 base paired-end reads) was used to acquire four entire mitogenome sequences. A library having two indexes was constructed and sequenced by Genesky Biotechnologies (Shanghai, China). The four complete mitogenomes were assembled, and analyzed. Hence, the accuracy of the second-generation sequencing was confirmed by long-PCR.

2.1. Live habitus and mitogenome general features of newly sequenced Mantodea

We acquired 35 complete mantis mitogenomes in 8 families. Mt genomes of four species, D. truncate (MT370514), D. lobate (MT370513), A. chinensis (MT370512) and Macromantis sp. (MT370515), were sequenced and assembled from this study. Sampling and GenBank information are given in Table 1. The mt genomes of D. truncate, D. lobate, A. chinensis and Macromantis sp. have one typical annular chromosome (Fig 1). In A. chinensis and mt genome, 37 genes were identified that typically includes 13 protein-coding genes (atp6, atp8, cob, cox1-cox3, nad4L, nad1-nad6), two rRNA genes (rrnL, rrnS) and 22 tRNA genes (Fig 2 and S2 Table). However, in D. truncate and D. lobate mt genome, 32 of the 37 genes were identified including 12 protein-coding genes (atp6, cob, cox1-cox3, nad4L, nad1-nad6), two rRNA genes (rrnS, rrnL) and 18 tRNA genes (S8 and S9 Figs). In Macromantis sp. mt genome, 33 of the 37 genes were identified including 13 protein-coding genes (atp6, atp8, cob, cox1-cox3, nad1-nad6, nad4L), two rRNA genes (rrnS, rrnL) and 18 tRNA genes (S10 Fig). Generally, bilaterian Mt genomes comprise two rRNA, 22 tRNA and 13 protein-coding genes (PCGs) on a single circular chromosome, with ~16kb in size [12, 13]. However, in many bilateral animals a diversion from the typical organization of the mt genome has obtained. For example, atp8 gene is lost in most nematodes and thus only have 36 mitochondrial genes. In a species of tree frog (Polypedates megacephalus), the nad5 gene is missing, and similarly, in many insects and other animals, some PCGs have also not been identified [7, 14–19]. In our study, the atp8 gene is also absent in the D. truncate and D. lobate mt genome. There are several probabilities for lacking mitochondrial genes. First, it may be caused by the sequencing techniques and method, a mini-chromosome comprised the atp8 gene, which is not identified. For example, the architecture of the mt genome in thrips (Scirtothrips dorsalis) exhibits an extreme asymmetry in chromosome size that only tRNA-Cys and nad6 are on the 0.92 kb mini-annular chromosome [20]. Secondly, these lost genes are resulting exchanged by nuclear genes or generally relocate to the nuclear genome. Illustratively, mitochondrial cox2 introgression has been reported into the nuclear genome [21]. Thirdly, the lost genes have been gone in the long cycle of evolution. Since some protein-coding genes of mitochondrial genes are necessary in mitochondrial respiration and the production of adenosine triphosphate, the deprivation of these genes would exhibit critical metabolism challenges to cells. For the undiscovered tRNA genes in the D. truncate, D. lobate and Macromantis sp., four tRNA genes were not found. The lack of tRNA genes additionally assorted. Illustratively, two species of gekkonids (Uroplatus fimbriatus and U. ebenaui), one species of Caecilian amphibian (Siphonopidae: Microcaecilia), an isopod crustacean (Ligia oceanica) and one booklouse species (Liposcelis sculptilis) are reported [7, 22–24]. Furthermore, among underneath metazoans, a huge loss of tRNA was described in cnidarians [25]. Overall, it is unclear whether in these cases the loss of genes is due to gene transfer to the nuclear genome or reflects the loss of the protein function.

Table 1. The information of samples used in this study.

Species Family Subfamily Accession number Reference
Tropidomantis tenera Nanomantidae Tropidomantinae KY689127 [26]
Eomantis_yunnanensis Nanomantidae Tropidomantinae KY689138 [26]
Sceptuchus_simplex Nanomantidae Nanomantinae KY689133 [26]
Sphodromantis lineola Mantidae Tenoderinae KY689123 [26]
Tenodera_sinensis Mantidae Tenoderinae KY689132 [26]
Hierodulella_sp. Mantidae Hierodulinae KY689136 [26]
Hierodula_formosana Mantidae Hierodulinae KR703238 [27]
Rhombodera_valida Mantidae Hierodulinae KX611804 [2]
Tamolanica_tamolana Mantidae Hierodulinae DQ241797 [28]
Rhombomantis_brachynota Mantidae Hierodulinae KX611802 [2]
Hierodula_patellifera Mantidae Hierodulinae KX611803 [2]
Mekongomantis_quinquespinosa Mantidae Hierodulinae MN267041 [29]
Mantidea_sp Mantidae / KY689120 [26]
Mantis_religiosa Mantidae Mantinae KU201317 [6]
Statilia_sp. Mantidae Mantinae KU201316 [6]
Asiadodis_yunnanensis Mantidae Choeradodinae MN037794 [30]
Amantis_nawai Mantidae Iridopteryginae KY689114 [26]
Humbertiella_nada Gonypetidae Gonypetinae KU201315 [6]
Theopompa_sp.-HN Gonypetidae Gonypetinae KU201313 [6]
Deroplatys_lobata Deroplatyidae Deroplatyinae MT370513 This study
Deroplatys_truncata Deroplatyidae Deroplatyinae MT370514 This study
Deroplatys_desiccata Deroplatyidae Deroplatyinae KY689113 [26]
Metallyticus sp. Metallyticidae / KX434837 [31]
Hestiasula sp. Hymenopodidae Oxypilinae KY689115 [26]
Creobroter jiangxiensis Hymenopodidae Hymenopodinae KY689134 [26]
Odontomantis_sp. Hymenopodidae Hymenopodinae KY689121 [26]
Anaxarcha_zhengi Hymenopodidae Hymenopodinae KU201320 [6]
Creobroter_gemmatus Hymenopodidae Hymenopodinae KU201319 [6]
Theopropus_elegans Hymenopodidae Hymenopodinae KY689125 [26]
Creobroter_urbanus Hymenopodidae Hymenopodinae KY689137 [26]
Parablepharis_kuhlii_asiatica Hymenopodidae Phyllothelyinae KY689117 [26]
Phyllothelys_sp.2 Hymenopodidae Phyllotheliynae KY689129 [26]
Phyllothelys_sp.1 Hymenopodidae Phyllotheliynae KY689119 [26]
Amorphoscelis_chinensis Amorphoscelidae Amorphoscelinae MT370512 This study
Macromantis_sp Photinaidae Macromantinae MT370515 This study
Cryptocercus kyebangensis Blattoidea Cryptocercidae NC_030191 [32]

Fig 1. Mitochondrial genomes of Deroplatys truncate, Amorphoscelis chinensis, Macromantis sp. and Deroplatys lobata.

Fig 1

Circular maps were drawn with CGView. Arrows indicate the orientation of gene transcription. Protein-coding genes are shown as blue arrows, rRNA genes as purple arrows, tRNA genes as brown arrows and non-coding regions as grey rectangle. Abbreviations of gene names are: atp6 and atp8 for ATP synthase subunits 6 and 8, cox1-3 for cytochrome oxidase subunits 1–3, cob for cytochrome b, nad1-6 for NADH dehydrogenase subunits 1–6, rrnL and rrnS for large and small rRNA subunits. The GC content is plotted using a black sliding window, as the deviation from the average GC content of the entire sequence. GC-skew is plotted as the deviation from the average GC-skew of the entire sequence. The inner cycle indicates the location of genes in the mitochondrial genome.

Fig 2. Inferred secondary structures of 20 transfer RNAs (tRNAs) identified in Amorphoscelis chinensis.

Fig 2

Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

2.2. Mitochondrial gene codon usage

Like other insects [19, 33], most PCGs use T or TAA as termination codons, whereas D. truncate and D. lobate COII and ND4L, A. chinensis ATP6 and ATP8, Macromantis sp. CYTB stops with TAG. The highest A+T content was present in all expanse, both non-coding and genes regions. Ala (A), Gly (G), Leu (L), Pro (P), Arg (R), Ser (S) Thr (T) and Val (V) are the most used and the frequency used for the codons of an amino acid was consistent in the four newly sequenced praying mantises (Fig 3). Furthermore, the difference in A+T content was also demonstrated further in the usage of codon (Table 2). Relative Synonymous Codon Usages (RSCU) presented that the four newly sequenced praying mantises used more NNT and NNA codon than NNC and NNG (Fig 3). These results are consistent with other published mantis mitogenomes [2, 19, 31, 34].

Fig 3. Relative synonymous codon usage (RSCU) for protein coding genes of five booklice.

Fig 3

Abbreviations of tRNA genes are according to the single letter according to the IPUC-IUB one-letter amino acid codes.

Table 2. A+T (%) composition of four mantodean mitochondrial genomes.

Species Whole genome A+T-rich region PCGs
D. truncate 75.8 82.3 76.0
D. lobate 75.6 80.7 77.9
A. chinensis 77.2 79.8 75.8
Macromantis sp. 76.5 81.2 73.0

2.3. The secondary structure of ribosomal RNAs

The rrnS of A. chinensis included three structural domains (I-III) (Fig 4). The preserved sites were highlighted and analyzed within the 35 Mantodea species. The H47 was the most insecure among the eight helices of domain I (H9-H511). Domain II, comprising five helices (H567-H885), was extremely variable domain, specifically for helices H567, H577 and H673. In domain III, most of the helices were comparatively stable, except for H1068-H1113 and H1303. The rrnL of A. chinensis harbored five canonical structural domains (I-II, IV-VI) (Fig 5). The sites preserved in rrnL of the 35 Mantodea species were also analyzed. H563 was identically stable (74.6%). Domain II contained 14 helices (H579-H1196), and the degree of conservation was elevated in H671, H777, and H1087 (>76.0%). All helices belonging to Domains IV and V were comparatively conserved, apart from the helices H1648, H1764, H2077, H2259, H2395 and H2520 (<40.0%). Although the nucleotides including variable helices were greatly contrasting at the subfamily and family levels, and mainly molecules share certain alike secondary structures between species and are compensatory base changes (S2–S7 Figs). Our predicted secondary structure was consistent with the results of a previously published study [2].

Fig 4. Inferred secondary structure of rrnS of Amorphoscelis chinensis.

Fig 4

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

Fig 5. Inferred secondary structure of rrnL of Amorphoscelis chinensis.

Fig 5

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

2.4. Evolutionary rate and nucleotide diversity analysis

The non-synonymous/synonymous (dN/dS) exchange ratio can be utilized to evaluate whether a sequence is undergoing neutral, purifying or positive selection (dN/dS >1 is evidence for positive selection, <1 for purifying selection, and = 1 for neutral). For these eight mitogenomes, dN/dS pairwise analysis was performed. We found that all genes evolved under a free selection: cox1 revealed the most robust refined selection (0.028), while genes from the nad family (especially nad6) revealed a slightly relaxed purifying selection; ATP8 was an outlier with a relatively low purification (0.31) (Fig 6). Nucleotide diversity analyses can be used to design species-specific markers, particularly in taxa, where identification of morphological characters is complicated and ambiguous [6, 34], and it is also important for functional studies [6, 34, 35]. dN/dS pairwise analysis showed that cox1 is undergoing a robust purifying selection. The cox1 gene is constantly used as a universal barcode for species distinguishing in animals [36, 37], including insects [38–40]. Its low variability applied as barcode for the entire Mantidae, which must be intently tested and revised, assumes that its resolution power turns out to be too low. In that case, we suggest that genes exhibit an optimal amalgamation of rapid evolution and enough for large size, notably nad6 and nad4, which should be estimated as potential DNA markers for the identification of population and species.

Fig 6. Evolutionary rates of 13 PCGs in the mitogenomes of fifteen Mantodea species.

Fig 6

PCGs: protein-coding genes. The ratio of Ka/Ks (Ks: synonymous nucleotide substitutions; Ka: nonsynonymous nucleotide substitutions).

2.5. Phylogenetic analyses on Mantodea

We evaluated the phylogenetic linkage among the prime lines of the Mantodea including 35 praying mantis species (Fig 7). Derived from the two contrasting datasets (a concatenated amino acid dataset and a concatenated nucleotide dataset), the phylogenetic link concluded from BI analyses shared the alike topologies (Fig 7). Metallyticus sp., the sole paradigmatic of Metallyticidae, is a sister to the other mantises, which are frequently studied as the primitive groups of the mantodean phylogeny [1, 10, 29–31, 41, 42]. For the determination of the level of the Deroplatyidae family, due to the head (without vertex process, highly developed juxta-ocular bulges), pronotal (tubercles, foliaceous expansion) and genital characteristic, Schwarz and Roy’s studies strongly indicate that Deroplatyidae is in unstable phylogenetic position and represents a well-differentiated clade by multiple morphological data. Previous studies suggested that Deroplatyidae should correspond to a family rank [8, 10]. Based on the complete data of the mitochondrial genome, it was suggested that there should be a classification between Mantoidea as a sister to Deroplatyidae + Mantidae (Fig 7). In the latest classification system, Macromantis belongs to the subfamily Macromantinae, family Photinaidae, and Amorphoscelis chinensis belongs to the subfamily Amorphoscelinae, family Amorphoscelidae [8]. Interestingly, two species (Mantidae sp. + Amantis nawai) of Mantidae + Photinaidae (Macromantis sp.) are a sister group. In the future, more Photinaidae species are needed to confirm the phylogenetic status of this family rank. Furthermore, our results suggest that Amorphoscelidae and Nanomantidae are closely related. However, there are only one representative species of Amorphoscelidae, and molecular data from more species will be needed to determine the phylogenetic relationship in the future.

Fig 7. Phylogenetic relationships of the Mantodea inferred from mitochondrial genome.

Fig 7

The black square implies that ML bootstrap support values and Bayesian posterior probabilities in percentages are greater than 90.

3. Materials and methods

3.1. Taxon sampling

The latest Mantodea taxonomic system, Schwarz’s system [8], was used. Thirty-one complete mt genomes represented five families (Hymenopodidae, Mantidae, Gonypetidae, Nanomantidae, and Metallyticidae) on GenBank before this study. The complete mitogenomes of D. truncate, D. lobate, A. chinensis, and Macromantis sp., belonging to Deroplatyidae, Amorphoscelidae, and Photinaidae, respectively, were amplified and sequenced. Thirty-five mantis species, including 8 families were sampled: Hymenopodidae, Photinaidae, Amorphoscelidae, Mantidae, Deroplatyidae, Gonypetidae, Nanomantidae, and Metallyticidae. Four species of them (belonging to Deroplatyidae, Amorphoscelidae and Photinaidae) are from sequencing, while the others are from Genbank databases (Table 1). The samples were stored in 100% ethanol at −80°C before use.

3.2. Mitochondrial genome sequencing, assembly, and annotation and analysis

Up to 2GB of raw reads were obtained individually from every sample and then trimmed of adapter contamination with the aid of NGS-Toolkit [43], while short reads and low standards were eliminated [44]. Velvet 1.2.10 was used to accumulate the fine readings according to the following criterion: Overlap Identity = 80–100 bp, Mismatches per Reading = 5%, Minimum Overlap = 30–50 bp, Maximum Gap Size = 3 bp [45]. The four complete mitogenomes were used to scrutinize the precision of the assembly.

Four overlapping nucleotide sequences were assembled by using DNAMAN software, which confirmed through manual inspection. In order to confirm the accuracy of the next-generation sequencing, we redesigned the primers to run PCR to confirm the sequencing results (S1 Table). Long-PCR reactions were run with the following cycling conditions: an initial denaturation for 2 min at 95°C, followed by 35 cycles of 30 s at 92°C, 30 s at 60°C, 10 min at 72°C, and final extension of 10 min at 68°C using LA Taq (5 U/μ L, Takara). All PCR products were sequenced in both directions by the primer-walking method in Biotech Company. We also used ORF Finder and BLAST search engines against the GenBank database to identify protein-coding and rRNA genes. Furthermore, homologous genes from other Mantodea species were aligned with targets to further recognize these genes. ARWEN was used for the identification of transfer RNA genes by their cloverleaf secondary structure with standard parameters and tRNAscan-SE 1.21 with Search Mode = EufindtRNA-Cove, Genetic Code = Invertebrate Mito and Cove score cutoff = 0.1. MEGA 5 was used to analyze base composition [46–48]. Non-synonymous (dN) / synonymous (dS) mutation rate ratios of these four mitogenomes were calculated with DnaSP v5 among the 13 PCGs [49]. GenBank was used to recovered the sequences of conserved mt genomes of other Mantodea species.

Our data have been submitted to the NCBI database. In detail, The NCBI accession numbers are D. truncate (MT370514), D. lobate (MT370513), A. chinensis (MT370512) and Macromantis sp. (MT370515).

3.3. Sequence alignment and phylogenetic analysis

In our phylogenetic analysis a total of thirty-five insect species were involved (Table 1). One species of Blattaria, Cryptocercus kyebangensis, was chosen as an outgroup [26, 32]. Sequences of all mitochondrial protein-coding genes and rRNA genes except nad4L, ATP6 and ATP8 were exploited in the phylogenetic analysis. Nad4L is too short to align among the Mantodea species. ATP8 was not identified in D. truncate and D. lobate. So nad4L and atp8 were excluded in the phylogenetic analysis. Alignment was made for phylogenetic analysis: a concatenated nucleotide sequence that includes two rRNA genes and ten protein-coding genes. MEGA 5 program used to execute the alignment of nucleotide sequences of all rRNA genes with protein-coding genes by following the standard criterion in ClustalW [46]. Poorly aligned sites were removed in the Gbocks server [50]. The Gblocks server (http://molevol.cmima.csic.es/castresana/Gblocks_server.html) was applied with the ‘protein’ mode for PCG amino acid sequences, and with all options for a stringent selection were chosen.

Successive analyses were executed on the fused dataset using Bayesian inference (BI) and Maximum likelihood (ML), which were carried out with the aid of MrBayes 3.2 and RAxML 7.7.1, respectively. The GTRGAMMA model was chosen for the two datasets, with 1000 bootstrap replicas from the ML. The best-fitting nucleotides models were selected using Partition Finder V1.1.1 [51–53] from the BI as follows: TIM+I+G: rrnL, rrnS; GTR+I+G: cox1, cob, cox2, cox3, nad1, nad5 and nad3; HKY+I+G: nad6; the best-fitting amino acids models were chosen as follows: MtArt+I+G+F: nad1, nad4, nad5; MtMam+I+G cox1; MtRev+I+G+F: cox2, cox3, cob, nad3, nad6 and nad4L. Two individualistic sets of Markov chains were programmed, each of them having one cold and three heated chains for 1×107 generations, and every 1000th generation was evaluated. Convergence was concluded when a standard deviation of cleave frequencies <0.01 was accomplished. Sump and sumt burning arc were adjust to 25% and contype was adjust to all compat.

In summary, four species of Mantidae, belonging to Amorphoscelidae, Photinaidae, and Deroplatyidae families, were sequenced and annotated. These mitogenomes allocated the identical gene order and gene content alongside most of the known Mantodea mitogenomes. We demonstrated an inclusive comparative examines of the Mantodea mitogenomes and got the mitogenome characteristics and evolutionary patterns as an outcome. Most species presented alike usage bias in codons and nucleotides. The relatively variable and conserved regions were diversely diversified in the secondary structures of rRNAs and tRNAs. Also, based on the minimal classification system, phylogenetic analyses between 35 Mantodea species propose that the mitogenome is an effective marker for tagging family rank phylogenetic linkage among Mantodea.

Supporting information

S1 Fig. Live habitus images of Deroplatys truncate, Amorphoscelis chinensis, Macromantis sp. and Deroplatys lobata.

(A) Deroplatys truncate (B) Amorphoscelis chinensis; (C) Macromantis sp. (D) Deroplatys lobata.

(DOCX)

S2 Fig. Inferred secondary structure of rrnS of Deroplatys lobate.

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

(DOCX)

S3 Fig. Inferred secondary structure of rrnL of Deroplatys lobate.

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

(DOCX)

S4 Fig. Inferred secondary structure of rrnS of Deroplatys truncate.

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

(DOCX)

S5 Fig. Inferred secondary structure of rrnL of Deroplatys truncate.

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

(DOCX)

S6 Fig. Inferred secondary structure of rrnS of Macromantis sp.

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

(DOCX)

S7 Fig. Inferred secondary structure of rrnL of Macromantis sp.

Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

(DOCX)

S8 Fig. Inferred secondary structures of 18 transfer RNAs (tRNAs) identified in Deroplatys lobata.

Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

(DOCX)

S9 Fig. Inferred secondary structures of 19 transfer RNAs (tRNAs) identified in Deroplatys truncate.

Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

(DOCX)

S10 Fig. Inferred secondary structures of 17 transfer RNAs (tRNAs) identified in Macromantis sp.

Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

(DOCX)

S1 Table. Verification PCR primers used for amplification of the mitochondrial genome of Amorphoscelis chinensis, Deroplatys truncate, D. lobate and Macromantis sp.

(DOCX)

S2 Table. Genes order and ORF features of the complete mitogenomes of Deroplatys truncate, D. lobate, A. chinensis, and Macromantis sp.

(DOCX)

Acknowledgments

We greatly thank Zeyi Lyu and Xianting Zhou provided the praying mantises specimens and ecology pictures.

Abbreviations

ATP6 and ATP8 genes

ATPase subunits 6 and 8

COI

COIII genes for cytochrome coxidase subunits I-III

CYTB

apocytochrome b

ND1-ND6 and ND4L

NADH dehydrogenase subunits 1–6 and 4L

rrnL and rrnS

large rRNA subunit and small rRNA subunit

PCGs

protein coding genes

mt

mitochondrial

BI

Bayesian inference

ML

maximum likelihood

Data Availability

Our data have been submitted to the NCBI database. In detail, The NCBI accession numbers are D. truncate (MT370514), D. lobate (MT370513), A. chinensis (MT370512), and Macromantis sp. (MT370515).

Funding Statement

We greatly thank Zeyi Lyu and Xianting Zhou provided the praying mantises specimens and ecology pictures. This study was supported by the National Nature Science Foundation of China Youth Fund (32001907). This study was also supported in part by Qingdao Agricultural University High-level Talent Fund (665-1117002; 663-1119002).

References

  • 1.Svenson GJ, Whiting MF. Phylogeny of Mantodea based on molecular data: evolution of a charismatic predator. Syst. Entomol. 2004; 29: 359–70. [Google Scholar]
  • 2.Zhang HL, Ye F. Comparative mitogenomic analyses of praying mantises (Dictyoptera, Mantodea): origin and evolution of unusual intergenic gaps. Int J Biol Sci. 2017; 13: 367–381. doi: 10.7150/ijbs.17035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ramsay GW. Mantodea (Insecta), with a review of aspects of functional morphology and biology, Fauna NZ. 1990; 19: 1–96 [Google Scholar]
  • 4.Srikumar KK, Vanitha K, Bhat PS. Srikumar, Biology and behaviour of Ephestiasula pictipes (Wood-Mason) (Hymenopodidae: Mantodea) under captive breeding, Int J Pest Manag. 2016; 62: 308–18 [Google Scholar]
  • 5.Hirase S, Takeshima H, Nishida M, Iwasaki W. Parallel mitogenome sequencing alleviates random rooting effect in phylogeography, Genome Biol Evol. 2016; 8: 1267–78. doi: 10.1093/gbe/evw063 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ye F, Lan XE. Zhu WB, You P. Mitochondrial genomes of praying mantises (Dictyoptera, Mantodea): rearrangement, duplication, and reassignment of tRNA genes, Sci Rep. 2016; 6: 25634. doi: 10.1038/srep25634 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shi Y, Chu Q, Wei DD, Qiu YJ, Shang F, Dou W, et al. The mitochondrial genome of booklouse, Liposcelis sculptilis (Psocoptera: Liposcelididae) and the evolutionary timescale of Liposcelis, Sci Rep. 2016; 6: 30660. doi: 10.1038/srep30660 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Schwarz C J, Roy R. The systematics of Mantodea revisited: an updated classification incorporating multiple data sources (Insecta: Dictyoptera). Ann Soc Entomol. Fr. 2019; 55: 101–196. [Google Scholar]
  • 9.Rivera J, Svenson GJ. The neotropical ‘polymorphic earless praying mantises’–part I: molecular phylogeny and revised higher-level systematics (Insecta: Mantodea, Acanthopoidea). Syst Entomol. 2016; 41: 607–649. [Google Scholar]
  • 10.Svenson GJ, Whiting MF. Reconstructing the origins of praying mantises (Dictyoptera, Mantodea): the roles of Gondwanan vicariance and morphological convergence, Cladistics 2009; 25: 468–514 [DOI] [PubMed] [Google Scholar]
  • 11.Wieland F. The Phylogenetic System of Mantodea (Insecta: Dictyoptera), Verlag Göttingen Press, Germany; 2013 [Google Scholar]
  • 12.Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999; 27:1767–1780. doi: 10.1093/nar/27.8.1767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lavrov DV. Key transitions in animal evolution: a mitochondrial DNA perspective. Integr Comp Biol. 2007; 47: 734–743. doi: 10.1093/icb/icm045 [DOI] [PubMed] [Google Scholar]
  • 14.Gissi C, Iannelli F, Pesole G. Pesole, Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species. Heredity 2008; 101: 301–320. doi: 10.1038/hdy.2008.62 [DOI] [PubMed] [Google Scholar]
  • 15.Sophie B, Stewart DT, Hoeh WR. Characterization of a mitochondrial ORF from the gender-associated mtDNAs of Mytilus spp. (Bivalvia: Mytilidae): identification of the “missing” ATPase 8 gene. Mar Genomics. 2010; 3: 11–18. doi: 10.1016/j.margen.2010.01.001 [DOI] [PubMed] [Google Scholar]
  • 16.Zhang P, Zhou H, Liang D, Liu YF, Chen YQ, Qu LH. The complete mitochondrial genome of a tree frog, Polypedates megacephalus (Amphibia: Anura: Rhacophoridae), and a novel gene organization in living amphibians. Gene 2005; 346:133–143. doi: 10.1016/j.gene.2004.10.012 [DOI] [PubMed] [Google Scholar]
  • 17.Shao R, Zhu XQ, Barker SC, Herd K. Evolution of extensively fragmented mitochondrial genomes in the lice of humans. Genome Biol Evol. 2012; 4: 1088–1101. doi: 10.1093/gbe/evs088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chen SC, Wei DD, Shao R, Shi JX, Dou W, Wang JJ. Evolution of multipartite mitochondrial genomes in the booklice of the genus Liposcelis (Psocoptera). BMC Genomics 2014; 15: 861. doi: 10.1186/1471-2164-15-861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang LP, Ma Y, Yu DN, Storey KB, Zhang JY. The mitochondrial genomes of Statilia maculata and S. nemoralis (Mantidae: Mantinae) with different duplications of trnR genes. Int J Biol Macromol. 2019; 121: 839–845. doi: 10.1016/j.ijbiomac.2018.10.038 [DOI] [PubMed] [Google Scholar]
  • 20.Aaron M, Dickey Vivek Kumar J. et al. A novel mitochondrial genome architecture in thrips (Insecta: Thysanoptera): extreme size asymmetry among chromosomes and possible recent control region duplication. BMC Genomics 2015; 16: 1–7. doi: 10.1186/1471-2164-16-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chung WK, Steiper ME. Mitochondrial COII introgression into the nuclear genome of Gorilla gorilla. Int. J. Primatol. 2008; 29: 1341–1353. doi: 10.1007/s10764-008-9303-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kumazawa Y, Miura S, Yamada C, Hashiguchi Y. Gene rearrangements in gekkonid mitochondrial genomes with shuffling, loss, and reassignment of tRNA genes. BMC Genomics 2014; 15: 1–13. doi: 10.1186/1471-2164-15-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.San Mauro D, Gower D, Oommen OM, Zardoya R. Phylogeny of caecilian amphibians (Gymnophiona) based on complete mitochondrial genomes and nuclear RAG1. Mol Phylogenet Evol. 2004; 33: 413–427. doi: 10.1016/j.ympev.2004.05.014 [DOI] [PubMed] [Google Scholar]
  • 24.Kilpert F, Podsiadlowski L. The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda) bears a novel gene order and unusual control region features. BMC Genomics 2006; 7: 1–18. doi: 10.1186/1471-2164-7-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mónica M, Collins AG, Takaoka TL, Kuehl JV, Boore JL. Naked corals: skeleton loss in Scleractinia. Proc Natl Acad Sci. USA 2006; 103:9096–9100. doi: 10.1073/pnas.0602444103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhang LP, Yu DN, Storey KB, Cheng HY, Zhang JY. Higher tRNA gene duplication in mitogenomes of praying mantises (Dictyoptera, Mantodea) and the phylogeny within Mantodea. Int. J. Biol. Macromol. 2018; 111: 787–795. doi: 10.1016/j.ijbiomac.2018.01.016 [DOI] [PubMed] [Google Scholar]
  • 27.Tian XX, Liu J, Cui Y, Dong PZ, Zhu Y. Mitochondrial genome of one kind of giant Asian mantis, Hierodula formosana (Mantodea: Mantidae), Mitochondrial DNA 2017; 28: 11–12. doi: 10.3109/19401736.2015.1106519 [DOI] [PubMed] [Google Scholar]
  • 28.Cameron SL, Barker SC, Whiting MF. Mitochondrial genomics and the new insect order Mantophasmatodea, Mol. Phylogenet Evol. 2006; 38: 274–279. doi: 10.1016/j.ympev.2005.09.020 [DOI] [PubMed] [Google Scholar]
  • 29.Shi Y, Yuan ZL. Characterization of the complete mitochondrial genome of the praying mantis Mekongomantis quinquespinosa (Mantodea: Mantidae). Mitochondrial DNA B 2019; 4: 3280–3281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shi Y, Liu QP, Luo L, Yuan ZL. Characterization of the complete mitochondrial genome sequence of Asiadodis yunnanensis (Mantidae: Choeradodinae) and phylogenetic analysis. Mitochondrial DNA B 2019; 4: 2826–2827 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang LP, Cai YY, Yu DN, Storey KB, Zhang JY. Gene characteristics of the complete mitochondrial genomes of Paratoxodera polyacantha and Toxodera hauseri (Mantodea: Toxoderidae). PeerJ, 2018; 6: e4595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Jeon MG, Park YC. The complete mitogenome of the wood-feeding cockroach Cryptocercus kyebangensis (Blattodea: Cryptocercidae) and phylogenetic relations among cockroach families. Anim. Cells Syst. 2015; 19: 432–438. [Google Scholar]
  • 33.Ma Y, He K, Yu PP, Cheng XF, Zhang JY. The complete mitochondrial genomes of three bristletails (Insecta: Archaeognatha): the paraphyly of Machilidae and insights into Archaeognathan phylogeny, PLoS One 2015; 10: e0117669. doi: 10.1371/journal.pone.0117669 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jia WZ, Yan HB, Guo AJ, Zhu XQ, Wang YC, Shi W G. et al. Complete mitochondrial genomes of Taenia multiceps, T. hydatigena and T. pisiformis: additional molecular markers for a tapeworm genus of human and animal health significance, BMC Genomics 2010; 11: 447. doi: 10.1186/1471-2164-11-447 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yue X, Zhihe Z, Lili N, Qiang W, Chengdong W. Jingchao L. et al. The mitochondrial genome of Baylisascaris procyonis, PLoS One 2011; 6: e27066. doi: 10.1371/journal.pone.0027066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ye F, Easy RH, King SD, Cone DK, You P. Comparative analyses within Gyrodactylus (Platyhelminthes: Monogenea) mitochondrial genomes and conserved polymerase chain reaction primers for gyrodactylid mitochondrial DNA, J Fish Dis. 2017; 40: 541–555. doi: 10.1111/jfd.12539 [DOI] [PubMed] [Google Scholar]
  • 37.Hebert PDN, Cywinska A, Ball SL. Biological identifications through DNA barcodes, Proc R Soc Lond B Biol Sci. 2003; 270: 313–321. doi: 10.1098/rspb.2002.2218 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Brabec J, Kostadinova A, Scholz T, Littlewood DTJ. Littlewood, Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens, Parasit Vectors 2015; 8: 336. doi: 10.1186/s13071-015-0949-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Demari-Silva B, Foster PG, de Oliveira TMP, Bergo ES, Sanabani SS, Pessôa R, et al. Mitochondrial genomes and comparative analyses of Culex camposi, Culex coronator, Culex usquatus and Culex usquatissimus (Diptera: Culicidae), members of the coronator group, BMC Genomics 2015; 16: 831. doi: 10.1186/s12864-015-1951-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Du Y, Dai W, Dietrich CH. Mitochondrial genomic variation and phylogenetic relationships of three groups in the genus Scaphoideus (Hemiptera: Cicadellidae: Deltocephalinae), Sci. Rep. 2017; 7: 16908. doi: 10.1038/s41598-017-17145-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Grimaldi DA. Revision of cretaceous mantises and their relationships, including new taxa (Insecta: Dictyoptera: Mantodea), Am Mus Novit. 2003; 3412: 1–47. [Google Scholar]
  • 42.Yager DD, Svenson GJ. Patterns of praying mantis auditory system evolution based on morphological, molecular, neurophysiological, and behavioural data, Biol J Linn Soc. 2008; 94: 541–568 [Google Scholar]
  • 43.Patel RK, Jain M. NGS QC toolkit: a toolkit for quality control of next generation sequencing data, PLoS One 2012; 7: e30619. doi: 10.1371/journal.pone.0030619 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Schmieder R, Edwards R. Quality control and preprocessing of metagenomic datasets, Bioinformatics 2011; 27: 863–864. doi: 10.1093/bioinformatics/btr026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zerbino DR, Birney E. Velvet: algorithms for de novo short read assembly using de Bruijn graphs, Genome Res. 2008; 18: 821–829. doi: 10.1101/gr.074492.107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tamura K. et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods, Mol Biol Evol. 2011; 28: 2731–2739. doi: 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Laslett D, Canback B. ARWEN: a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 2008; 24: 172–175. doi: 10.1093/bioinformatics/btm573 [DOI] [PubMed] [Google Scholar]
  • 48.Lowe TM, Eddy SR. A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997; 25: 955–964 doi: 10.1093/nar/25.5.955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Librado P, Rozas R. DnaSP ver. 5: A software for comprehensive analyses of DNA polymorphism data. Bioinformatics. 2009; 25: 1451–1452 doi: 10.1093/bioinformatics/btp187 [DOI] [PubMed] [Google Scholar]
  • 50.Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000; 17: 540–552. doi: 10.1093/oxfordjournals.molbev.a026334 [DOI] [PubMed] [Google Scholar]
  • 51.Ronquist F, Teslenko M, Mark PV D, Ayres DL, Darling A, Hhna S. et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space, Syst Biol. 2012; 61: 539–542. doi: 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies, Bioinformatics 2014; 30: 1312–1313. doi: 10.1093/bioinformatics/btu033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lanfear R, Calcott B, Ho SY, Guindon S. Partition Finder: combined selection of partitioning schemes and substitution models for phylogenetic analyses, Mol Biol Evol. 2012; 29: 1695–1701 doi: 10.1093/molbev/mss020 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Ben J Mans

15 Apr 2021

PONE-D-21-03889

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

PLOS ONE

Dear Dr. Smagghe,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

One reviewer identify some minor editorial issues that would improve the grammar and presentation of the study and is worth addressing since this would improve the manuscript overall. The other reviewer identify a number of methodological issues, notably that some genes that was missing might be present in the genome. I suggest that the authors look at all of these methodological issues and address them since they will all improve the manuscript significantly and prevent unnecessary errors that might detract from the study.

Please submit your revised manuscript by May 28 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ben J Mans, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

  1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

  1. In your Methods, please state the source of all insect samples used in your study. If any were collected directly from the field, please include details of the geographical provenance and any permits obtained for these collections.

  1. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. 

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

●             The name of the colleague or the details of the professional service that edited your manuscript

●             A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

●             A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

  1. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files

  1. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In the manuscript titled 'Complete mitochondrial genomes of four species of praying mantises (Dictyoptera,

Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses' the author present the complete mitochondrial genome of four species of mantid. Overall the study is good and should be published but some revisions need to be addressed before publishing.

1) The authors need to have a native English speaker review the document for grammar. It is not unintelligible but there are many spots where it is difficult to follow or does not sound scientific.

2) Throughout the document, the species D. truncata and D. lobata are converted to truncate and lobate due to autcorrect from their word processor (it actually just did it now in this response portal). It is annoying but an easy fix.

3) I would like to see a table or tables that list the gene order and position for all ORFs for each species, this generally is a useful reference for other readers.

Reviewer #2: The authors sequence and annotate the mitogenomes of four mantises species and combine this new data with existing mantis data to estimate phylogenetic relationships in the group. They find a few missing genes in some of the four new mitogenomes, but tRNA secondary structure and codon usage was similar to other mantises. The phylogeny also tended to agree with current taxonomy.

I think the study is definitely a worthwhile addition to insect mitogenomics. I particularly appreciate that you discuss your findings in the context of insect and mantis mitogenomics. However, I do have several issues that should be addressed, some more major then others:

1. You need to re-work some of the structure in the Introduction. For example, the second paragraph introduced mitogenomes and then abruptly switches to introducing the taxonomy of mantises. I would separate these.

2. Because the Methods comes last, I would include some brief methodological details in the Results and Discussion section.

3. Please include more specific results. For example, you vaguely state that there is a high A+T% and list the most-used codons. Please provide specific values in the text.

4. You begin discussing the utility of using cox1 as a barcoding gene (starting line 151), but this discussion appears abruptly. Why is this relevant? Is it related to your nucleotide diversity results? Please explain.

5. I’m a little confused by your sampling strategy. Did you sample the 35 mantis species mentioned in lines 189-190? Or were these taken from GenBank?

6. I am not convinced you are actually missing the atp8 genes. In my experience, it can be difficult to annotate this gene, and you often have to look for it manually based on ORFs, etc. It also seems like there is a non-coding region on the 5’ end of your atp6 genes when a “missing” atp8 is reported. I would bet that is the atp8 gene. Also, were your missing genes confirmed with your PCR step? Finally, it looks like both atp6 and atp8 are missing from one species (bottom left in Fig 1), but I didn’t see any discussion of this. Please elaborate.

7. Did you confirm that these assembled mitogenomes are in fact complete and circular? I recommend doing this, especially since you report missing genes.

8. Please provide more methodological details. For example, how did you calculate Ka/KS? What were your PCR conditions? What GBlocks parameters did you use?

9. There are several portions of the manuscript that are difficult to read. I recommend going through the text and again and edit for grammar, awkward phrasing, etc.

Some minor comments:

Line 25: There is no context for referencing the “Schwarz and Roy (2019) taxonomic system.” Perhaps just say “the latest taxonomy.”

Line 31: No need to say “respectively.” Same in line 82.

Line 42: Be careful about using “bugs” when you mean “insects.” Entomologists will strongly object to this usage…

Lines 74-78 should be in the Introduction

Line 100: Why do you rule out this second possibility? Please elaborate.

Line 144: Please provide a brief overview of dN/dS ratio (i.e., dN/dS > 1 is evidence for positive selection, < 1 for purifying selection, and =1 for neutral).

Line 217: Confusing phrasing. Please re-write. It’s not clear what “miniscule to align means.”

Figure 1: It’s not clear which mitogenomes go with each species. Please add names to the figure.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Nov 4;16(11):e0254914. doi: 10.1371/journal.pone.0254914.r002

Author response to Decision Letter 0


24 May 2021

4/5/2021

Dear Editor,

Thank you very much for your email message regarding our manuscript. We appreciated much the valuable comments from the reviewers for revising and improving our manuscript. Generally, we have incorporated all suggestions and comments of yours into this revision. More specifically, our corrections are as follows here under.

We hope you can now accept this revised version.

Most sincerely,

All authors

Reviewer #1: In the manuscript titled 'Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses' the author present the complete mitochondrial genome of four species of mantid. Overall the study is good and should be published but some revisions need to be addressed before publishing.

1) The authors need to have a native English speaker review the document for grammar. It is not unintelligible but there are many spots where it is difficult to follow or does not sound scientific.

Reply: We thank this referee for his/her suggestions. We have polished the full text and further revised the corresponding parts.

2) Throughout the document, the species D. truncata and D. lobata are converted to truncate and lobate due to autcorrect from their word processor (it actually just did it now in this response portal). It is annoying but an easy fix.

Reply: Thank you.

3) I would like to see a table or tables that list the gene order and position for all ORFs for each species, this generally is a useful reference for other readers.

Reply: We agree and have added the related information on the position of all ORFs. See Table S2. For the gene order, we refer to Figure 1 with the mitochondrial gene structure.

Reviewer #2: The authors sequence and annotate the mitogenomes of four mantises species and combine this new data with existing mantis data to estimate phylogenetic relationships in the group. They find a few missing genes in some of the four new mitogenomes, but tRNA secondary structure and codon usage was similar to other mantises. The phylogeny also tended to agree with current taxonomy.

I think the study is definitely a worthwhile addition to insect mitogenomics. I particularly appreciate that you discuss your findings in the context of insect and mantis mitogenomics. However, I do have several issues that should be addressed, some more major then others:

1. You need to re-work some of the structure in the Introduction. For example, the second paragraph introduced mitogenomes and then abruptly switches to introducing the taxonomy of mantises. I would separate these.

Reply: Agree. We have separated the two parts. Please check the line 53.

2. Because the Methods comes last, I would include some brief methodological details in the Results and Discussion section.

Reply: Thank you. We have added the brief methodological details in the Results and Discussion section. Please check lines 78-83.

3. Please include more specific results. For example, you vaguely state that there is a high A+T% and list the most-used codons. Please provide specific values in the text.

Reply: Agree. We have added the whole genome, A+T-rich region and PCGs specific values of four mitochondrial genomes. Please check Table S2.

4. You begin discussing the utility of using cox1 as a barcoding gene (starting line 151), but this discussion appears abruptly. Why is this relevant? Is it related to your nucleotide diversity results? Please explain.

Reply: Thank you. The dN/dS pairwise analysis showed that cox1 is undergoing a robust purifying selection (0.028). That is why cox1 can be used as a molecular marker of barcoding entire Mantidae. We also reorganized the writing of this part. Please check lines 152-153.

5. I’m a little confused by your sampling strategy. Did you sample the 35 mantis species mentioned in lines 189-190? Or were these taken from GenBank?

Reply: We have reorganized the writing of this part. Please check lines 189-193 and Table 1.

6. I am not convinced you are actually missing the atp8 genes. In my experience, it can be difficult to annotate this gene, and you often have to look for it manually based on ORFs, etc. It also seems like there is a non-coding region on the 5’ end of your atp6 genes when a “missing” atp8 is reported. I would bet that is the atp8 gene. Also, were your missing genes confirmed with your PCR step? Finally, it looks like both atp6 and atp8 are missing from one species (bottom left in Fig 1), but I didn’t see any discussion of this. Please elaborate.

Reply: Thank you for this advice. We know ATP8 which is difficult to annotate. We repeated to analysis the sequence for annotation of ATP8, and in addition we ran the PCR to amplify the corresponding part of about 1000bp to confirm the sequence. Unfortunately, we could not annotate the relevant homologous sequences. For the ATP6 of Macromantis sp. species, we have added this annotation name in Figure 1 (bottom left in Fig 1) and the Table S2. Please check Figure 1 and Table S2.

7. Did you confirm that these assembled mitogenomes are in fact complete and circular? I recommend doing this, especially since you report missing genes.

Reply: We thank this referee for his/her comment. We received the assembled mitogenomes sequence and this was confirmed by PCR technology. The starting and the ending of sequence overlapped with 184bp, so we are sure that this is a complete and circular structure. We redesigned the primers for PCR and sequenced the PCR product to confirm the sequencing results. The primers are listed in Table S1. We also used ORF Finder and BLAST search engines against the GenBank database to identify protein-coding and rRNA genes. Please check the lines 206-208.

8. Please provide more methodological details. For example, how did you calculate Ka/KS? What were your PCR conditions? What GBlocks parameters did you use?

Reply: We agree and have added the methods of calculating Ka/KS. Please check lines 219-221. We also added the conditions of long PCR reactions. Please check lines 213-217. Also the GBlocks parameters were added in lines 237-239.

9. There are several portions of the manuscript that are difficult to read. I recommend going through the text and again and edit for grammar, awkward phrasing, etc.

Reply: Thanks for your suggestion. We polished the text and revised the corresponding parts.

Some minor comments:

Line 25: There is no context for referencing the “Schwarz and Roy (2019) taxonomic system.” Perhaps just say “the latest taxonomy.”

Reply: Done; please check lines 26-27

Line 31: No need to say “respectively.” Same in line 82.

Reply: Done; please check lines 31, 84

Line 42: Be careful about using “bugs” when you mean “insects.” Entomologists will strongly object to this usage…

Reply: Done, please check line 42.

Lines 74-78 should be in the Introduction

Reply: Agree. We have moved this text to the Introduction. Please check line 64-68.

Line 100: Why do you rule out this second possibility? Please elaborate.

Reply: We apologize for this. Indeed the second possibility is also very likely. So, we have reorganized this text part. We have deleted our conclusion: “We concluded that a lack of the atp8 gene in D. truncate and D. lobate is most likely because of the former or the later reason.” Please check lines 112-113. Thank you.

Line 144: Please provide a brief overview of dN/dS ratio (i.e., dN/dS > 1 is evidence for positive selection, < 1 for purifying selection, and =1 for neutral).

Reply: Agree. Please check lines 151-152.

Line 217: Confusing phrasing. Please re-write. It’s not clear what “miniscule to align means.”

Reply: We thank this referee and have rephrased this part text, which means Nad4L is too short to align among the Mantodea species. ATP8 was not identified in D. truncate and D. lobate. So nad4L and atp8 were excluded in the phylogenetic analysis. Please check lines 238-241.

Figure 1: It’s not clear which mitogenomes go with each species. Please add names to the figure.

Reply: Thanks and done.

Attachment

Submitted filename: R1-rebuttal letter-final.docx

Decision Letter 1

Ben J Mans

25 Jun 2021

PONE-D-21-03889R1

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

PLOS ONE

Dear Dr. Smagghe,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Minor issues were raised which can be considered since they will improve the manuscript somewhat.

Please submit your revised manuscript by Aug 09 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ben J Mans, PhD

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: Thank you for your thorough responses and edits to your manuscript based on my comments. I think the manuscript has been improved. I do have a few comments that still should be addressed, based on my first round of comments:

1. I still think the paragraphs in the Introduction are a little disconnected. Perhaps switch paragraph #2 (on the utility of mitogenomes for mantid phylogenetics) and paragraph #3 (on mantid taxonomy).

2. I think you should add the AT% to the main text, not just in a supplement.

3. I’m still somewhat skeptical that the atp8 gene is actually missing, but your combination of NGS and PCR results are more convincing. It is difficult for me to fully evaluate this claim without access to the sequence data; but as is stated in the manuscript, atp8 and other genes are missing from other taxa. Is this the first case of missing mt genes in mantises?

4. I recommend one more round of editing for writing clarity. For example, Lines 50-51 are a little confusing, and should probably be split up into two sentences.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Nov 4;16(11):e0254914. doi: 10.1371/journal.pone.0254914.r004

Author response to Decision Letter 1


27 Jun 2021

26/06/2021

Dear Editor,

Thank you very much for your email message regarding our manuscript entitled “Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses”.

We appreciated the valuable comments from the reviewers and editor to revise and improving our manuscript. Generally, we have incorporated all suggestions and comments into this revision. More specifically, our adjustments are stated below in a point-by-point manner.

We hope that this revised version can be accepted for publication.

Most sincerely,

All authors

Reviewer #2:

Thank you for your thorough responses and edits to your manuscript based on my comments. I think the manuscript has been improved. I do have a few comments that still should be addressed, based on my first round of comments:

1. I still think the paragraphs in the Introduction are a little disconnected. Perhaps switch paragraph #2 (on the utility of mitogenomes for mantid phylogenetics) and paragraph #3 (on mantid taxonomy).

Reply: We agree and have switched the paragraph #2 and paragraph #3. See lines 46-68.

2. I think you should add the AT% to the main text, not just in a supplement.

Reply: Indeed, we have added the AT% information to the main text; see in Table 2.

3. I’m still somewhat skeptical that the atp8 gene is actually missing, but your combination of NGS and PCR results are more convincing. It is difficult for me to fully evaluate this claim without access to the sequence data; but as is stated in the manuscript, atp8 and other genes are missing from other taxa. Is this the first case of missing mt genes in mantises?

Reply: Thanks for your suggestion. Here we attach mitochondrial sequencing results for D. truncate species, and we really did not identify the atp8 gene. So, we imply that atp8 gene may have been lost. Yes, from our sequence of D. truncate and D. lobata, we can confirm the atp8 is lost. This is the first case of missing Mt gene in mantises.

TAATTATCCCATGAAAGATTAGTATTAAACCAATAACTCTAAATTTATTTTAAATAATAGAGTAAAATGCCTGATTTAAAAGGAATATCATGATAGGATAAAATATGTAAATTAATTACTTTTACTAATATTATCATTACACATAACAGAGTTAAACTGTTTCCTAAAATATCAAAAATTTTTGTGCATCCTACACTAAAATATAGAAAAGTAAGCTAAATTTAAGCTAATGGGTTCATACCCCATATATAGAGTTTACACTCTCTTTTCTAGTGCCCAACAATTCGATAAAAATCCTCTTTTTAATAACTTTAATTAGAGGTGTGTTAATTTCATTATGTGCTAATTCATGAATAGGAGCATGAATAGGATTAGAAATTAACTTACTCTCCTTCATTCCTTTACTTTCTTCCAGAAAAAACTTGTTCTCAACTGAAGCTTCACTTAAATATTTTCTTATTCAAGCTATTTCATCATCTACATTTCTATTTCTAATTATGATAAAAATTAATATCCAAGAAATGTTTTATCTAATAAAATTTAATAATTGAAACACCTTAATTACAATTCCTATTCTAATGAAAATTGCATCTGCACCTTTTCATTGATGATTACCTTCCGTGATAGAAGGTTTATCTTGAATAAATTGTTTTATTATTCTGTCAATTCAAAAAGTAGCCCCATTAATATTCATTTCCTACTTAATCACTAATAACTTCTTTATTCAAATCATCATTACAATTTCTGCAATTATAGGAGCTATTGGAGGTCTCAATCAAATTTCTCTACGAAAAATTTTATCATTTTCATCTATCAACCATATTGGATGAATATTAACAACCATAATTATAGGTTCTAACTTTTGAATAACATACTTTATCATTTATACGGTAAATATTATCCCTATTATTTTTATGGTAAACAAAATAAACCTATCTTTTATTCCTCAGACCTTTAATTCCTTCAATAACAAAAAAATTATTAAATTCATTCTATTTATCTCCCTCCTTTCTTTAGGGGGCCTCCCTCCTTTTATTGGTTTTTTCCCAAAATGAATTATCATTCAAATTATAATCCAAAATTTAATAATTCTTACATCAATAACCCTAATTATATCCTCCCTTTTAACCCTTTATTATTATCTACGAATTATTTACACAACATTAATAATCACAAATTCAGAAATAACTTGAATAGCAATCTACTCAAATAACAACTTAGGAAAAAGAACATTTCTTTTCTTATTCATTCTTATTTTTGGTTTATCAATCTGTACACTTATCTTAACAATCTATTAAGATTTTAAGTTAACCAAACTAATATCCTTCAAAGTTATAAATAAAGTGATTCATCTTTAAGTCTTAGTATTACTTACACCTTTAGAATTGCATTCTAATATCATCTCCATGAATATAAAACTTTAGTAAAAGAGATAATAATCTCATTAATAAATTTACAATTTATTACCTAATATCAGCCATTTTACTTTTTTTTTTGCAACGATGATTATTCTCAACAAATCATAAGGATATTGGAACATTATATTTTATTTTTGGTGCATGGGCAAGTATATTAGGAACATCTTTAAGAATTTTAATTCGAACAGAGTTAAGACAACCCGGATCTTTAATTGGAGATGATCAAATTTATAATGTCATTGTAACAGCTCACGCTTTTATTATAATCTTCTTTATAGTTATACCCATTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATACTTGGAGCTCCAGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTATTCTATTTCTTATTATCGGAAGAGTTGTAGAAAGAGGAGCTGGTACAGGATGAACAGTCTATCCCCCTCTTTCAGCCAGAATTGCTCACGCCGGCCCCGCAATTGATTTAACCATTTTTTCCTTACACTTAGCTGGAATATCAAGAATTATAGGAGCTGTAAATTTTATCACAACTATAATTAACATAAAATCAATTCATATAAATCATACTCAAATTCCTTTATTTGTTTGATCTGTAGGAATTACAGCAATTCTTCTTCTTTTATCTCTCCCTGTACTTGCTGGGGCAATCACTATACTTCTAACTGATCGAAACTTAAATACATCCTTTTTCGACCCTGCTGGAGGGGGGGATCCTATTCTCTATCAACATCTATTTTGATTTTTTGGACATCCTGAAGTATATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATGTCATTTCTCATGAAAGAGGAAAAAAAGAAGCTTTTGGAAATTATGGAATAATTTGAGCTATATCAGCCATTGGTTTTCTGGGGTTTATTGTATGAGCTCATCATATATTTACAGTAGGAATAGATGTAGATACACGAGCCTACTTTACAGGAGCTACTATAATTATTGCTGTTCCTACGGGTATTAAAATTTTTAGTTGACTCACAACTATATACGGAACAAAAATAATTTATAGTGTAGTATCTTTATGAGCATTAGGATTTATTTTTTTATTTACAGTTGGAGGTCTTACAGGAGTAATTTTAGCCAATTCAGCTATTGATATTATTCTTCATGACACTTATTATGTAGTAGCCCATTTTCACTATGTACTTTCAATAGGAGCCGTTTTTGCTATTATAGCAGGGTTCATTCATTGATATCCCTTATTCACTGGATTATCATTAAATCCTAATTGATTAAAAAGTCAATTTTTCACAATATTTGTAGGAGTTAATTTAACATTTTTTCCACAACATTTCTTAGGATTAGCTGGAATACCTCGACGCTATTCAGATTACCCTGACGCCTATAGATCATGAAACTTCTTATCATCTGTAGGAGCAATAATTTCTTTCGCTGCTGTTATCATATTCATTCTTATCTTATGAGAAAGAATTACCTTAAATCGATTTATATTATTTTCATCTCAAATAAATAGATCAATTGAATGAATTCATAATTTTCCCCCAGCTGAACACACCTACAATGAACTAACTCTAATTACAAATTAAAACCTAAATTGTTGATAATTTTCCTCATTTCTAATGTGGCAGAATAGTGCACTGGGTTTAAGCTCCAAAAATAAAGATAAACTTTTTTTAGAAGTTATTTTAATGGCTACAAATGCAAATTTAGGATTTCAAGATAGAGCCTCCCCCTTAATAGAACAACTCATGTATTTTCATGATCATTCCATATTTATTATTACTATAATTGTAATTACAGTAAGTTATATAATTATAGCTTTAATAGTAAATAAATTTTCTGATCGTCATGTTATAGATGGTCAATATTTAGAAATTTTTTGAACAGTTCTTCCAGCCATAGTTCTAGTCTTCATCGCTCTACCTTCTCTACGGATTTTATACCTAATTGATGAAAATACAAATCCAACATTAACCTTAAAAACAATTGGTCATCAATGGTATTGAAGTTACGAATATTCAGATTTTACCAATATTGAATTTAACTCTTACATAATTCCACAAAATGATTTAAATCTATTTAACATGCGTTCACTTGAAGTTGACAATCGAACATCATTACCCATAAATACCTTAACACGAATTTTAATCACCTCAGATGATGTTATTCATTCTTGAACAATTCCGAGAATTGGAGTAAAAGCTGATGCTACTCCGGGACGATTAAATCAAGCAACATTTTGATTTAATCGTCCCGGAGTATTTTATGGTCAATGTTCAGAAATTTGTGGAGCAAATCACAGATTTATACCTATTGTAATTGAAAGAACTTTGATTAATAATTTTCTTAGTTGAATCTTAAATTATATTGAATCACTAGATGACTGAAAATAAGTGATGGTCTCTTAAACCATATCATAGTAACATAATAACTACTTCTAGTGATTGACTAACAATTTATCAAGAAGTTAGTTAAAAAATAACATTAGTATGTCAAACTAAAGTCATTATCATTTAATACATCTTTATACCCCAAATAATACCCCTAAATTGGCTAATCCTATTTTACATTGTTTCTACTAGATTAATTTTTTTTAATGTAATAAATTTTTTTATATTTTCCCACAAAATCCCATTAACTTCAAATAAAATTTTACTAAAAACCCTAATTTGAAAATGATAACCAACCTATTTTCAATTTTTGATCCCTCTTCAAATTTTATAAACCTATCAATAAATTGACTTAGAATTTGAATCGGATTATTATTATTTCCTTCCTCGATATGGTTAATTTCATCACGAAATAAAACCCTTTGAAGTTTTATTTTAAGTAAACTTCATGAAGAATTTAAATTATTAATTGGTAAAAAAAAAATTAACAAAGGATCAACATTCATATTTATTTCAACATTTTTACTTATTATATATAATAATTGTATAGGATTATTTCCATATATTTTTACTGGGACAAGTCATATAGCTATAACTCTATCTTTTGCTTTACCTTTATGACTAAGATTTATACTCTTTGGTTGAATTAATAACTCTAATCACATATTTATTCATTTAGTTCCTCAAGGAACTCCAAATATATTAATACCTCTTATAGTTTGTATTGAAACAATTAGAAATTTAATTCGTCCCGGAACTTTAGCTATTCGACTCGCAGCAAATATAATTGCAGGACATTTATTAATAACCCTCCTAGGAAATTCTGGGAGAAACATTATAGATTCATTTTTACCCCTATTAATTTTAGTTCAAATTATACTTTTAACTCTAGAATCCGCAGTTGCTATTATCCAATCATATGTTTTTGCAGTATTAAGTACTTTATACTCTAGAGAAGTAAATTAATAATGATAATACACACTAATCACCCCTACCATTTAGTTACTTATAGTCCCTGACCTATTATAACTACTTTAAGAATCATAATCATAATATTAGGTTTTATTAAATTTTCTTATGAGTTTAGTGAAAAATTTATGCTATTAGGAACTTTAATTTTAATTTTAATTACTACTCAATGATGACGTGACGTTGTACGAGAAAGTACATATCAAGGATTACACACTAAAAAAGTAATCTTTGGACTACGATGAGGAATAATTTTATTTATTATTTCAGAAATTTTTTTCTTTGTATCTTTTTTTTGAACTTTTTATCATAGAAGCTTAACTCCTACTATTGAATTAGGGTCCTTTTGACCACCTCAAGGAATCTGACCCTTTAATGCTCTTCATGTTCCTCTTCTTAATACAACGGTACTTTTAGCATCAGGCATCACTATTACATGAAGTCACCATGGACTATTAATAAATAATTATAATCAAGCCACCCAAGGATTAATATTTACCATTATCCTTGGGATTTATTTTACCATCTTACAACTCTATGAATATTATGAAGCTCCGTTTACAATTGCGGATTCAGTTTTTGGGTCAATCTTTTTTATAGCAACTGGATTTCATGGACTTCATGTAATTATTGGAACTACATTCTTAGTTACATGCTTATTTCGAATAATTTATAAACATTTTACATCTATTCACCACTTTGGTTTCGAGGCAGCAGCCTGATATTGACATTTTGTGGACGTAGTATGATTATTCCTGTACATTTCTATTTATTGATGAGGGAGATAAATCCAATTTATTTAGTATAAAAGTACAATTGATTTCCAATCAAAAAGTCTATATTTAATTAGAATAAATAATTAAAATTTTAATTTTTATCTCATTCATTACTATATCAATTACCTTAACAATCATATTACTAACAAATTTCTTGTCAAAGAAAAAAATTGAAGACCGAGAAAAAAATTCACCTTTTGAATGTGGATTTGATCCGATTAGATCCTCGCGCCTTCCCTTTTCTTTACGTTTCTTTTTGATTGGAGTAATCTTTTTAATTTTTGATGTAGAAATCGCCTTTATCTTACCAATAATTATCATTCCTCTTACATCAAAAATAACATCTTGAATATCTACTAGAATTATATTCTTATTGATCTTAACAACTGGTTTATTTCATGAATGAAATCAAGGTTCTCTCGACTGAGCAACTTAACTTTATAAGGGTTATAGTTAAAAATAACATTTGACTTGCACTCAAAAAGTATTGAAATATCAATTTTCCTTATTATAAGTAAGAAGCAAATTCATTGTAATCAGTTTCGACCTGATAGTAAGATATTCATATCCTTATTTGTTGATTAATTGAAACCAAATAGAGGTATATCACTGTTAATGGTAAAATTGAAATTAATGCTTTCCAATTAAGAAAATGTGTAGATCGAATATAAGTTGCTAATTTATTATTCAAGTGGTTTAATCCCATTTACATTTTAATTTATATAGTTTAAATAAAACATTACATTTTCATTGTAAAAATAAATTTTTCAATTTTATTAATAGTAAGTACTCTATTTAAAGATAAATTAGTTATCTCAATAACAGCTTCAATGTTATACTCTCTATAAGATATTTAAATAAATACAAAATATTATTATAAGTAAAATACTAAAAAAAATCATTAAATAAGATTTTAAATCATTATATTGAAATCATTGATTAAAACATCTTAATTTTATCAAAATATAATATAAATTTTGTGCTCCAAAATATTCTCTTCAGCCTAAATCAATATATATCATTGAATTTAAACTAATAATTAAAGGTATTTTTCTTACTCCTTTAGTAAAAATTAAAGGTATATATCATATTGAAGCAAAAAAAATTGTCATTTTATAATACTTAAATGTTGAAAAATAATAATTTATTCTATACTTAAATATAATTCTTCCTAATCATAAACCTACAAATCTACCTAATAAAGGTATTATTTTCATTATTAATGTCATATAAATTATATAGGGAGTAAGAAAAATAATCCAATTTAATATCCCACCTCCAATAATTGCAAATAATATTAAACCTAATATTCCATATACTATTATTCAACTTTCATTTAATTTACATATTGATATTATATTAAAATCTCCTCATAATACATAATAGGATAAACGAAAAGAATAACTTACTGTTAAACCTGTTGAAAAAAAAAATAAAACATATATAAAGATATTTAAATTTCTTAAAGATAATATTTCTAAAATTATATCTTTTGAATAAAATCCTGCTAAAAAAGGTATACCACATAAAGCAAAATTTGATACTATAAAACAAGATGAAGTAAAAGGCATAAATATTACTAAATTTCCTATAAAACGAATATCCTGTAAATTTTTTATTCTATGGATTATTATTCCTGTACACATAAATAACAATGCCTTGAATAAAGCATGAGTTAATAAATGAAAAAAAGCCAAATCTGAAAAACCTAATGATAAAATTCTTATTATTAATCCTAATTGACTTAAAGTTGATAAAGCAACAATCTTTTTTAAATCATATTCAAAATTTGCTCCTAACCCTGATATAAACATTGTTAAAACAGATATTACTAGTAAAAACTTTAATAATCAATCCGGAAAAACCTTACAAAATCGGATTAATAAATAAACCCCAGCCGCAACCAAAGTTGATGAATGAACTAGGGCTGAGACAGGAGTTGGAGCAGCTATTGCTGCAGGCAATCAAGCTGAAAAGGGAATTTGTGCACTTTTTGTTATTCCTGCTAAAAGTACTAAAAATGAAATTAAATATATTTCAATTTCATTTAATGTACAATCTAAATAAAAAATATAATTTCATCTTCCAAAATTTAATATTCATGAAATTGCTATTAATAAAGCAACGTCCCCTACTCGATTAGATAAAGCTGTCAATATTCCAGCATTATAAGACTTAGTATTTTGATAATAAATTACAAGACAATAAGAAATTAAACCTAACCCATCTCAACCTAATAAAATTCTAATCAAATTTGGACTAATAATTAAAAACATTATAGACAATACAAATATTAATACTAAAAAAATAAACCGATTTAGTGATGAATCTCCAGTTATATAATCTTCTCTATATAAAATTACTAAGGATGAAATTAATAAAACAAAACTCATAAATATGAGAGACATTCAATCCAACAATATTGTTATAACAACTGAAGAAGTACTTAATCTAACAATTTCTCATTCAATAAAAATAATTAAATCATTTAAAATAAAAACCATTCTAGAAATAAATATTATTAAAGAAAATAATGCTAATAAAAAAAATCTAATAAAACATAATGATAAATAAACCATAACTTAAAATAACTATTCATTATATCCATGATACCACAAATCATAATTTTATGATAAACTATTTAAGTAAATTAACTTTTATTTAAAATCAAATTAAAACATAATCTCTCTTTAAAATTAATAAATTTAAGGGTAATCAATGAAGTATTATTAATAAATATTCACGTCTATACCCTCCAACTCTTCTATAAATGCCTGAATAATAAAATCCATGTTGACTATATGAATATAAATATAAAGTATAAGCAGCTCTAAAAAATGAAATTAATATAAGAAAAAATATAGATATTCATACCCAACTTACTATACTATTGAATAATCCAATTTCTCCTAATAAATTTAAAGTAGGGGGAGCAGCTATATTGCTAGATGAAAGTAAAAATCATCATAATGTTAAACTTGGCATCAAATTTAATAAACCCTTATTAATTAACAATCTTCGTCTTCCCAGACGCTCATAACTAATATTAGCTAAACAAAATAAACCAGATGAACATAAACCATGAGCAATTATTATTACAAAAGTTATATAAAACCCTCAAATATTTAATGTTATTAAGCCCCCAATAATTAAACCTATATGAACCACAGACGAATAGGCAATTAATGCTTTTACGTCTATTTGACGTAAACACATTAAACTAACTATAACCCCACCGATTAATCTAGTAGAAAATCAAAATACATTAACTAATATCCCAACTCTCTTCAAGAATTCATATACTCGTAATAAACCATAACCTCCTAACTTTAATAAAACTCCAGCTAAAATCATTGAACCTGAAACTGGAGCTTCAACATGAGCCTTAGGTAATCATAAATGCACTAAAAATATAGGCATCTTAATCAAAAAAGCTAAAATTATTCTAAAATATAAATATCAATTCAATAAATTATTTTTATAAACTAACGAAAAAACTAAATAGCCCATGTTGTTATAAAAATATATAATACCCATCAATAATGGTAATGAAGCTAAAAGAGTGTATAATAATAAATAAATACCAGCTTGCAATCGCTCAGGTTGATATCCTCACCCAAAAATTAAAAATAAAGTTGGAATCAAACTACCCTCAAAAAAAAAATAAAATGAAATGAAATTTATTCTACAAAAAGTACAAATTAATATCAATAACAATATTAAAATTATAAATATAAATAAATTATTATAAAATTTATATCGAATAACAGAATAACTAGCTAAGATTATTAAAACACAAATTCAAAATCTTAGCACAATAAGACCATATGATAAGTAATCATATCCAAATATATAACTCATTCTTATTCAATAAAAAAAATCCACTCCAATAAAAAATTTAAAAGATATAAAAAATAATAAATTCTGAATTAATAATCAATTTTTATTCATTAAACATAATGGAATCAAAAACATTAAACTTAAAATATATCTTAACATTGCAATAAGCTAAACGAATTAAAATAATCATTTCCATGAGTTCGAATTATAGAAACCAAAATTGATAATCCTAATACACCTTCACAAACTGCAAATGAAAGAAAAATTATAGTCATATATAACTCTCCTCTTATTATTAAATAAAAATACAAAATAATGAACAAAACTAAAACAATAAATTCTAAACTTAATAAAGTTACTAATAAATGTTTACGTCCAGAAGAAAAAACTCACAAACCACATAAAAATATAAAACAGAATATTATTAACATTTTTTAGTTTTAATAGTTTACTAAAAACACTGGTCTTGTAAACCAAAATTAAGAATAATTACTTTTAAAACTTCAAAGGAAAGAAACTCATCATTAATTCCCAAAATTAATATTTTATTATTAAACTACCCTTTGATATTTTATACTCATTATTAACTATAAGTTTAATTTTAAGAATTACTTTGATATTTTTAAATCATCCAATATCTATAGGTTTTATCCTTTTTATTCAAACGTTATGCTTATGTTTTATTAGAGGTTTTATATCACTAAGATTTTGATTCTCCTATGTATTATTATTAATTTATTTAGGAGGAATATTAATTTTATTTATATACATTACCAGATTAGCCTCAAACGAATTATTTTCTTATTCAAATAAAATCTTATTAATTATTTTTTTAGTACCCCTTATCTTAAGACTTATCCATTATACAAGTTTTTATCATCAAACAAACTTATATGAAAATATAGAAAATAGAATAAATTTCATCTTTATACCAAACAACTTTTTATTAAAGATATATAATTATCCTAATAACATTATTACAATCTTAATTGCCTGTTATTTATTTTTAGCTTTAATTGCAGTTGTTAAGATAACAAATATTTTCAAAGGACCCCTACGACAAATAAATTAATAATGTTTAAACCCTTACGAAAAACTCACCCTATCATCAAAATTTCCAATAATGCCTTAGCAGATTTACCTTCACCATCAAATATTAGATCATGATGAAATTTTGGTTCCCTTCTAGGCTTATGTTTAATTCTTCAAGTAATTACAGGACTATTTTTAGCTATACACTATTCAGCTCATATTGATTTAGCCTTCTCAAGAGTGATTCACATTTGTCGAGATGTAAATTATGGGTGACTTTTGCGAATTCTTCATGCTAATGGTGCTTCAATATTTTTTATTTGTATTTATCTCCATATTGGACGGGGGATATATTACGGATCATATAAATTTTATTATACATGAATAATTGGAGTAATAATTCTATTTTTATTAATAGCGACAGCATTTATAGGTTATGTATTACCATGAGGTCAAATATCATTTTGAGGTGCCACAGTAATTACTAATTTATTATCTACTATTCCCGGATTTGGAAATGAATTAGTTCAATGAGTTTGAGGGGGTTTTGCAGTAGATAATGCTACCCTAAACCGATTTTTCACATTTCATTTTATTTTACCATTTATTATTGTAGCAATAATTGCAACCCACTTATTATTTCTTCACCAAACTGGATCAAATAATCCCTTAGGTACTGATAGTAATATTGATAAAATTCCGTTTCACCCTTATTTCACATTTAAAGATATCTTAGGATTCATTATATTATTAACACTTCTATCCCTCTTATCTCTTAAAGAACCCTATATCCTAGGAGATCCTGATAATTTTATTCCTGCTAACCCTCTTGTTACTCCAGTCCACATTCAACCAGAATGATACTTTTTATTTGCTTATGCTATTTTACGCTCTATCCCTAACAAGCTAGGAGGGGTGATTGCTCTAGTAATATCTATTATAATTCTAATTATTATACCTTTCATAGATACTAACTTACGAAGATTTCAGTATCATCCTATTAATCAATTCATATTTTGATTTATAATTATAACTATTACACTTTTAACATGAATTGGAGCACGCCCTGTTGAAGACCCTTTTATCCTAGTAGGACAAATTCTCACCATTATATACTTCCTTTTCTATATCATAAACATTTTAATTATCAAGGTATGAGACCATATTATACAATAATAAATAAGTTATAAACTTAATGTTAAGATTATGTCTTGAAATCATAATAAAGGGGTTAAATTCCCTTATTAACTTTACTTCATCCAACCCTTAAAATAAAATTTTTAACCCTAAATAAAAAAACAAAAAATTTAAAGATAAAGGTAAAAAGCTTTTTCACGCTAAATATATTAATTTATCATATCGATATCGAGGAAGAGTTCCACGAACTCAAATATATATAAAAGCAATAAAAATCAACTTCAAATAAAATACAAATGAATCCAAATTAGAACCCAAAAAAATTACACATATTAACATTCTTATAAATAAAATTCTTGAATATTCTCCTAAGAATATTAATGCAAAGCCTCCCCCTCCATACTCAATATTAAAACCTGAAACTAATTCTGACTCTCCTTCAGCAAAATCAAAAGGTCTACGATTTGTTTCTGCTAAACATGACACTATTCACACATTACACAATGGTAAGTATAAAAATAAAAATCAAATATTCATCTGATAATAAAAAAAATCCATTAATGAATAACTTCCAATTAAAAAAACAAAAGATAATAAAATTAAGGCTAATCTTACCTCATAAGAAATTGTCTGAGCAATTGCTCGTAAACTCCCTAATAAAGCATAATTAGAATTTGAAGATCATCCAGCTAACATAACTGCATAAACACCTAAACTTGTACATACTAAAAAAAACAACAAACCCAAATTAAAAGTAAATAAACCTCTTATATAAGGAAATAATATTCATAAGATTAAAGATAAAAATAAAGTAAATATTGGACATACATAATATAATGAATAATTCGAAACTAAAGGATTTATATATTCCCTACAAAACAACTTTACAGCATCACTGAATGGTTGTAAAATACCAATAAATCCAATCTTATTAGGACCCTTACGAATATGAATGTATCCTAAAACCCTACGTTCTAATAAAGTAAAAAAAGCTACCCCAACTATAACAAAAATAACTAAAATTAACCCTACTAATATTATTAAAAGTACTTCACTAATTAACATTTACTATCTATAATTCAATTTATCTATTTAGGTTCTAAACCTATTACACTTTACTCTGCCAAAATAGTTTTATTAATAATATTCTTTTTCCTTCATAAAAATTATTTCAAATATTTGGTCCTTTCGTACTAAAATATTCTAATTAATTAAAGATAGAAACCAACCTGGCTCACGCCGGTTTAAACTCAGATCATGTAAGAATTTTAAGGTCGAACAGACCTAGTTATTAAACATCTACATTCAAAACTAATCTTAATCCAACATCGAGGTCATAATCTTTTTTTTCAATATGAACTTTCAAAAAAAATTATGCTGTTATCCCTAAGGTAATTTAATCTTCAAATCATTAACCATGGATCTTAAAACTTAATATAATATTAAACTCAAAAAAGAGTTCATTTTATCTTTTAATCACCCCAATTAAATATATTTCACATAGATAATAAATTCATTATTTTAACTTTATTAAATTCAAATATATATTAAACTCTATAGGGTCTTCTCGTCCCTTAATTTTATTTAAGTATTTTTACTTAAAATCTAAGTTAAATTAAATTATTATAAAATAGTCTTTACTTCATCCAACCCTTCATACTAGCCCTCAATTAAAAGACTAATGATTACGCTACCTTTGCACAGTCAATATACTGCGGCCCTTTAAACCACATTCAGTGGGCAGGTTAAATCTCTTATTTCCCCAAGAAACCATGTTTTTAATAAACAGGTGAGTAAATTATTTGCCTAATTCCTCATATTAACATTACATTTCATTCACAAAATAATCCAGACTTTACTAATTAAATCATACTTACTCACTTTTTTTTATTTAACTTAACATTTTAATATACATACTAAATAATAACTAAAAATTTTAAACAAAATAAGAATTAAATTTCAACATCCTTAAATTAATAACAAATTCTAAATTTATACAATTCTTCATTAATAAATTATTATAAATATTCTTCAAAAAGATTTTCCCTTTTAAAGTCAAGAAAACAAAATATTTAAATATTTAAATATTTAATAAATTATATTCTCTAAATTAAATCTATTTATTAAAAAACTAGATATTATTGAAAACGATTAACATTTCACTACTAATTAATAATTCTTAATATTTATAATACAATAATTAAAACTATTAATTAAATCTTTCAAATTCAAGAAAAAAAAAATTAATTATTAATTTCGATATACTCTGAAACACAAGATACAATAAAAAAAATCAACTTAAATTAATTATATAATATTAAACTTCTTTTACAATACTAATTTACTATAGTATTAATTATTATCTCAATTGATAATACAATAACAAAATTTTAATTAATTTATATTCTAAATAATATCAAATCAAAAACAATCTTATGAATTTCAAATTATATTGAATTGCACAATAATAATTTTCAATGTAAATGAAAATCCTTACCTTTAAGTTTAATTTGTTCAAGTGACTTTCTAGGCACACCTTCCGGTACGCCTACTTTGTTACGACTTATCTCATCTTAATATGAGAGTGACGGGCGATGTGTACATATTATAGAGCTATTAATCATTTTAACAAACTTCATAAAATTACAATTAAATCCACCTTTAAATTACTTTCCAATAATTATCCATAATAAATACAATTTATTGTAGTCCATCATCAAACTTACTTATTACTGCACCTTGACTTGAAATATTATATATTTTTATGCTCAGAAAATTATCTAAAAAAATATTCTCAAACAGCGGTATACAAAAATATAAAGTAAGTAAGGTCCAACGCGGATTATCAATTAAATAATAGACTCCTCTAAATAGGTTATAATACCGTCAAATTCTTTAAGTTTCAAGATCATATCTGCTAATACTTTAGTTTATTAATTTACCATAAAAATAATAGGGTATCTAATCCTAGTTTACCTTTTTAATCTCATAATCCATCATACTAACTAATAATTAATTAAAATATTTTAAAAACATTTCACCTTAAAATACTTTAATCATCATTTAACATTAATTAACATTAATTATTTAAAAACCAATATTATTTATTTAATTTCACTGTATCACCGCGGATGCTGGCACAATTTTTACCAAACTTTTATAACATTCACTAAATCTAAAATAATTTAATATCAATAAAATTACCTACTGCACAATTAACTTTATAAACCTCATTGAGAAAACTATAATATACACACATTCACATTCAGAATAACATTAAAACAAATAATCAAAGCAAGAATAAAACTAAATATTTTTTCCAAAAATCGAAGACCTGACATTGGAACACCTAACTTTTTTAATGATTTTTGTATACCTACAAATATTTGATTAAATTAATCATTGCTTCAATATATAAACTTTCAAAAAAAAAATCCACTTTACCCAAAAAATAAGTATGCTTTTTTTAAAACGTTTTCCTCCCTAGAAGTAGGAATTAAGTGCCCAATTCAATTCGATTTAATGTTTTTTTTTAAACATTGGTCTACTAAAGTATATTTAGTATATAATAAATTTAATTATATATATGTCTTATCAAAGATTAATAAAAAAAATATTCTCAAACAGCGGTATACAAAAATATAAAGTAAGTAAGGTCCAACGCGGATTATCAATTAAATAATAGACTCCTCTAAATA

4. I recommend one more round of editing for writing clarity. For example, Lines 50-51 are a little confusing, and should probably be split up into two sentences.

Reply: Thanks for your suggestion. Lines 50-51 have been split up into two sentences. Please check lines 56-57.

Attachment

Submitted filename: R2-Reply letter-GS2.docx

Decision Letter 2

Ben J Mans

7 Jul 2021

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

PONE-D-21-03889R2

Dear Dr. Smagghe,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ben J Mans, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Ben J Mans

21 Oct 2021

PONE-D-21-03889R2

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

Dear Dr. Smagghe:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ben J Mans

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Live habitus images of Deroplatys truncate, Amorphoscelis chinensis, Macromantis sp. and Deroplatys lobata.

    (A) Deroplatys truncate (B) Amorphoscelis chinensis; (C) Macromantis sp. (D) Deroplatys lobata.

    (DOCX)

    S2 Fig. Inferred secondary structure of rrnS of Deroplatys lobate.

    Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

    (DOCX)

    S3 Fig. Inferred secondary structure of rrnL of Deroplatys lobate.

    Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

    (DOCX)

    S4 Fig. Inferred secondary structure of rrnS of Deroplatys truncate.

    Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

    (DOCX)

    S5 Fig. Inferred secondary structure of rrnL of Deroplatys truncate.

    Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

    (DOCX)

    S6 Fig. Inferred secondary structure of rrnS of Macromantis sp.

    Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

    (DOCX)

    S7 Fig. Inferred secondary structure of rrnL of Macromantis sp.

    Inferred Watson-Crick bonds are illustrated by lines, whereas the noncanonical interactions are illustrated by dots.

    (DOCX)

    S8 Fig. Inferred secondary structures of 18 transfer RNAs (tRNAs) identified in Deroplatys lobata.

    Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

    (DOCX)

    S9 Fig. Inferred secondary structures of 19 transfer RNAs (tRNAs) identified in Deroplatys truncate.

    Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

    (DOCX)

    S10 Fig. Inferred secondary structures of 17 transfer RNAs (tRNAs) identified in Macromantis sp.

    Bars indicate Watson-Crick base pairings, and dots between G and U pairs mark canonical base pairings in RNA.

    (DOCX)

    S1 Table. Verification PCR primers used for amplification of the mitochondrial genome of Amorphoscelis chinensis, Deroplatys truncate, D. lobate and Macromantis sp.

    (DOCX)

    S2 Table. Genes order and ORF features of the complete mitogenomes of Deroplatys truncate, D. lobate, A. chinensis, and Macromantis sp.

    (DOCX)

    Attachment

    Submitted filename: R1-rebuttal letter-final.docx

    Attachment

    Submitted filename: R2-Reply letter-GS2.docx

    Data Availability Statement

    Our data have been submitted to the NCBI database. In detail, The NCBI accession numbers are D. truncate (MT370514), D. lobate (MT370513), A. chinensis (MT370512), and Macromantis sp. (MT370515).


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES