Abstract
Background
Akabane virus (AKAV) is an important insect-borne virus which is widely distributed throughout the world except the Europe and is considered as a great threat to herbivore health.
Results
An AKAV strain defined as TJ2016 was firstly isolated from the bovine sera in China in 2016. Sequence analysis of the S and M segments suggested that the isolated AKAV strain was closely related to the AKAV strains JaGAr39 and JaLAB39, which belonged to AKAV genogroup II. To further study the pathogenic mechanism of AKAV, the full-length cDNA clone of TJ2016 S, M, and L segment was constructed separately into the TVT7R plasmid at the downsteam of T7 promoter and named as TVT7R-S, TVT7R-M, and TVT7R-L, respectively. The above three plasmids were further transfected into the BSR-T7/5 cells simultaneously with a ratio of 1:1:1 to produce the rescued virus AKAV. Compared with the parental wild type AKAV (wtAKAV), the rescued virus (rAKAV) was proved to be with similar cytopathic effects (CPE), plaque sizes and growth kinetics in BHK-21 cells.
Conclusion
We successfully isolated a AKAV strain TJ2016 from the sera of cattle and established a reverse genetic platform for AKAV genome manipulation. The established reverse genetic system is also a powerful tool for further research on AKAV pathogenesis and even vaccine studies.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12917-021-03054-x.
Keywords: Akabane virus, Isolate, Phylogenetic analysis, Reverse genetic system
Background
Akabane disease (AKA) is an important arthropod-borne disease of cattle and sheep, which is characterized by abortion, premature birth, stillbirth and congenital arthrogryposis hydranencephaly (AH) syndrome [1, 2]. To date, AKA is widely distributed throughout the world except the Europe and has caused serious economic losses to animal husbandry, which poses a great threat to the cattle and sheep breeding industry [3–5].
As the pathogen of AKA, Akabane virus (AKAV) is an orthobunyavirus which is biological transmitted between susceptible vertebrate hosts primarily by hematophagous arthropods [1]. Since AKAV was firstly isolated in Japan from the mosquitoes Aedes vexans and Culex tritaeniorhynchus in 1959, it has been widely detected in Australia, Asia, and Africa [6]. AKAV is an enveloped virus with three segments (S, M, and L) of single-stranded negative-sense RNA genome and encodes four structural proteins: two virion glycoproteins (Gn and Gc) on the M segment, and two internal virion components, the nucleocapsid (N) protein on the S segment and the viral RNA-dependent RNA-polymerase (L protein) on the L segment [7]. In addition, two non-structural proteins NSm and NSs are encoded by the M and S segment, respectively. According to the phylogenetic analysis of S segment, AKAVs are divided into four genetically distinct groups (genogroups I-IV) and genogroup I is further subdivided into two subgroups (Ia and Ib) [8]. In China, a serological survey of AKAVs in Xinjiang province indicated that the neutralizing antibody positive rate of AKAV in cattle and sheep was 20.32 and 18.15%, respectively [9]. A large-scale serological survey of AKAV from 2006 to 2015 in 24 provinces of China indicated that the overall seroprevalence rate for AKAV antibodies was 21.3% in cattle and 12.0% in sheep or goats [10]. Furthermore, some AKAV isolates have also been reported in China. In July to August of 2010 and in August of 2011, six AKAVs were isolated from culex quinquefasciatus and anopheles sinensis in Hunan province [11]. In 2013-2016, five novel AKAVs were isolated from bamboo rats in Guangxi, China [12]. Moreover, a AKAV was isolated from a sentinel goat in Guangxi province of China in 2016 [13]. However, there has never been a report of direct isolation of AKAV from cattle in China so far. In the present study, we described the first cattle-derived AKAV isolate TJ2016 in China and investigated the genetic diversities of the current isolate with the previously reported AKAV isolates. Then, we established the reverse genetic system based on cattle-derived AKAV isolate, which was a useful tool for studying the basic mechanism of AKAV pathogenesis.
Results
Phylogenetic analysis of the S and M segments
For the phylogenetic analysis of the isolated AKAV TJ2016, nine pairs of primers were designed based on the published genome sequence of AKAV strain DHL10M110 (KY284023.1, KY284022.1, KY284021.1) and were used to amplify the whole genome of AKAV isolate (Table 1, Number 1 to 18). After sequencing, the S, M, and L segment of TJ2016 was 856, 4309, and 6868 bp in length, respectively. The sequences of S, M, and L segment were submitted to the GenBank (GenBank No. MT755621, MT761688 and MT761689). Then, the phylogenetic trees were constructed to clarify the genetic relationships between TJ2016 and the AKAV strains reported previously. In this assay, the intact open reading frames (ORFs) of S and M segments alignment were performed by Clustal W method using MEGA5.0 software, and the phylogenetic trees were generated for each segment by the Neighbor-Joining (NJ) method. As shown in Fig. 1A, the phylogenetic itree based on the sequences of S ORF revealed that AKAV isolates were segregated into four distinct genogroups (I, II, III and IV). Among them, genogroup I was further divided into subgroup Ia and Ib. The isolated AKAV TJ2016 was most closely related with two Japanese and Australian strains isolated in 1959, and all belonged to genogroup II. The identities of the TJ2016 isolate to the JaGAr39 and JaLAB39 were both 99.95% at nucleotide level. On the other hand, the phylogenetic tree based on M ORF revealed that AKAV TJ2016 also belonged to genogroup II together with the Japanese and Australian JaGAr39 and JaLAB39 strains (Fig. 1B), and the identities were both 99.96% at nucleotide level.
Table 1.
Primers used in this study
| Number | Name | Sequences | Located sites (bp) |
|---|---|---|---|
| 1 | AKAV-S-F | AGTAGTGAACTCCACTATTAACTACGC | 1-27 |
| 2 | AKAV-S-R | AGTAGTGTGCTCCACTAATTAACTATAAAC | 827-856 |
| 3 | AKAV-M1-F | AGTAGTGAACTACCACAACAAAATGATT | 1-28 |
| 4 | AKAV-M1-R | CTTGTATGCAAGCACTAAAAGC | 1409-1432 |
| 5 | AKAV-M2-F | CTAGATAATTTCACATCTCATTGCC | 1253-1277 |
| 6 | AKAV-M2-R | TTTACTCTGGAAATAACTGTTGCTTC | 3182-3207 |
| 7 | AKAV-M3-F | CAAGATTCAAGACAGCTACATAAC | 2830-2853 |
| 8 | AKAV-M3-R | AGTAGTGTTCTACCACAACAAATAATTATT | 4280-4309 |
| 9 | AKAV-L1-F | AGTAGTGTACCCCTAAATACAACATAC | 1-27 |
| 10 | AKAV-L1-R | CATATTTGGCTTTGATAATATCTTGTCAAC | 1399-1428 |
| 11 | AKAV-L2-F | CGAAGCTATAAAAATTGGTACCTC | 1167-1190 |
| 12 | AKAV-L2-R | CCATCTCCAGGTTCGCTAATCATCTCATCTG | 2975-3005 |
| 13 | AKAV-L3-F | CGAGCATATACTCCAAGTCATGAAAAATC | 2808-2836 |
| 14 | AKAV-L3-R | TCATTCCGTTACGATCCATTTG | 4777-4798 |
| 15 | AKAV-L4-F | GAAGACCTTTGTTGAGACGTATCGACAG | 4520-4647 |
| 16 | AKAV-L4-R | GCATCAATTTTGAAAGATCTATACCCCC | 6040-6097 |
| 17 | AKAV-L5-F | GGATAGAATAGAAATGCTCAATATCG | 5937-5962- |
| 18 | AKAV-L5-R | AGTAGTGTGCCCCTAAATGCAATAATATAC | 6839-6868 |
| 19 | rAKAV-S-F | GGGGTACCCGTCTCATATAGAGTAGTGAACTCCACTATTAACTACGC | 1-27 |
| 20 | rAKAV-S-R | GCTCTAGACGTCTCTACCCAGTAGTGTGCTCCACTAATTAAC | 834-856 |
| 21 | rAKAV-M-F | GGGGTACCCGTCTCATATAGAGTAGTGAACTACCACAACAAAATG | 1-25 |
| 22 | rAKAV-M-R | GCTCTAGACGTCTCTACCCAGTAGTGTTCTACCACAACAAATAATT | 4283-4309 |
| 23 | rAKAV-L-F | GGGGTACCCGTCTCATATAGAGTAGTGTACCCCTAAATACAACATAC | 1-27 |
| 24 | rAKAV-L-R | GCTCTAGACGTCTCTACCCAGTAGTGTGCCCCTAAATGCAATAATATAC | 6838-6868 |
Fig. 1.
Phylogenetic tree of AKAV based on the CDS of the S (A) and M (B) segments. Sequence of the AKAV TJ2016 was indicated by red triangles (
). The nucleotide sequences of other AKAV strains used in this study were obtained from GenBank and given in Table 2
Reverse genetic rescue of AKAV TJ2016
The simplified scheme for the construction of plasmids containing full-length of AKAV cDNA was shown in Fig. 2. The plasmid TVT7R which serves as a basis for reconstruction of AKAV cDNA could be cleaved between the T7 promoter and the Hepatitis delta virus (HDV) antigenome ribozyme with the endonuclease BbsI, generating noncompatible sticky ends, which were used to insert the S, M, and L segments. The full-lengths of AKAV TJ2016 S, M, and L segments were amplified by KOD Fx Neo polymerase (ToYoBo, Osaka, Japan) using the gene-specific primers in Table 1 (Number 19 to 24) and digested using endonuclease BsmBI. Then, the generated compatible sticky ends with TVT7R plasmid were integrated through T4 ligase. After transcription and self-cleaving in the BSR-T7/5 cells, the exact 3′ end of the RNA was specially cleaved by HDV antigenome ribozyme and the genome of AKAV TJ2016 is generated with an excess G nucleotide at the 5′ end. To distinguish the rescued AKAV (rAKAV) with wild type AKAV (wtAKAV), a synonymous mutation (A702G) was generated in S segment and retained as a genetic marker. We transfected the plasmids TVT7R-AKAV-S, TVT7R-AKAV-M and TVT7R-AKAV-L (1:1:1) into BSR-T7/5 cells at a confluency of 80-90% in six-well plates. After three times of plaque purification, AKAV RNA was extracted and amplified using the primers AKAV-S-F and AKAV-S-R in Table 1. As shown in Fig. 3A, the fragment of approximately 850 bp was amplified successfully in both rAKAV and wtAKAV, and the nucleic acid sequencing proved that a synonymous mutation (A702G) was found in the S segment of rAKAV distinguished from wtAKAV (Fig. 3B). In addition, the full-length sequencing of rAKAV proved that no other nucleic acid mutation besides the synonymous mutation existed in the S segment.
Fig. 2.
Simplified scheme for the construction of TVT7R series. The upper part of the figures shows the sequence around BbsI restriction sites of TVT7R that is used to insert AKAV S, M or L segment. RNA transcripts produced by bacteriophage T7 RNA polymerase would contain one G residues, derived from the cloning site, before the authentic AKAV 5′ terminal sequence. The exact 3′ end of the transcript RNA was specified self-cleavage by the hepatitis delta virus (HDV) antigenome ribozyme. The conserved terminal bases of all three AKAV segments are shown. T7, T7 promoter; T7 term, T7 transcription termination sequence
Fig. 3.
PCR amplification and sequencing identification of rAKAV
Cytopathic effect (CPE) and indirect immunofluorescence identification
To further prove that AKAV TJ2016 was successfully rescued, the CPE of rAKAV and wtAKAV were observed 48 h post-infection. As shown in Fig. 4, compared with the blank control cells, both rAKAV and wtAKAV infected cells became round, winkled and even shattered. Then, the indirect immunofluorescence assay (IFA) was carried out using the monoclonal antibody against AKAV N protein. As shown in Fig. 4, the similar green fluorescence signals were observed in both rAKAV and wtAKAV infected cells, which means that we have successfully rescued AKAV TJ2016 strain and established the AKAV reverse genetic system.
Fig. 4.
CPE and IFA identification of rAKAV. Indirect immunofluorescence staining of rAKAV and wtAKAV with mouse monoclonal antibody 2D3 to AKAV N protein
Growth kinetics of rAKAV and wtAKAV in BHK-21 cells
The growth properties of the rAKAV and wtAKAV were investigated by the multi-step growth assay with a multiplicity (MOI) of 0.01. As shown in Fig. 5A, rAKAV exhibited a similar growth kinetic to wtAKAV. The maximum titer of rAKAV and wtAKAV was 3.55 × 106 and 3.2 × 106 TCID50/ml, respectively, at 48 h post-infection. Essentially no significant difference in growth kinetics was observed between the wtAKAV and rAKAV. Then, BHK-21 cells were infected with 0.01 MOI of rAKAV and wtAKAV respectively, and the plaque sizes and shapes were confirmed 72 h post-infection. Similar with their growth kinetics, the plaque shape and size of rAKAV also had no significant differences from that of wtAKAV (Fig. 5B).
Fig. 5.
Multi-step growth curves and plaque sizes of rAKAV and wtAKAV on BHK-21 cells
Discussion
AKAV is widely prevalent in tropical and temperate climate zones in Africa, Asia, Middle East and Australia [14], and it has caused serious economic losses to animal husbandry and posed a great threat to cattle, sheep and goat breeding. In China, the first detection of the virus could be traced back to 1990s by the Animal Quarantine Institute of Ministry of Agriculture using the neutralization assay. The goat or cattle sera derived from several provinces including Shandong, Hebei, Shaanxi, Gansu, Hunan were detected to be AKAV positive [15]. Since then, many studies proved that in many provinces of China, the neutralizing antibody positive rate of AKAVs in cattle, goats and sheep was higher than 10% [9, 10]. Meanwhile, several AKAV strains have been isolated from various species including mosquitoes, bamboo rat and goat [11–13, 16]. Phylogenetic trees based on the S and M segments sequences revealed that all the above isolates belong to AKAV genogroup I. In our study, phylogenetic analysis based on the S and M segments indicates that the isolated TJ2016 belongs to genogroup II.
AKAV belongs to the Simbu serogroup of Orthobunyaviruses [17]. Because of its segmented viral genome, closely related viruses within the order Bunyavirales can undergo genetic reassortment, with exchange of segments, to produce recombinant genotypes that remain infectious. Phylogenetic studies also suggested that genetic reassortments often occured among viruses of Bunyaviridae [18, 19]. This theoretically mostly occured in vertebrate hosts infected simultaneously with two or more Bunyaviruses, in a manner akin to that documented for influenza viruses [20, 21]. A previous phylogenetic analysis of Schamllenberg virus (SBV), member of the Simbu serogroup, revealed that SBV might be a reassortant virus with the M RNA-segment from Sathuperi virus (SATV) and the S and L RNA-segments from Shamonda virus (SHAV), since SBV sequence shared an 81.8 to 82.2% identity with the SATV M-RNA-segment, 96.4 to 96.7% and 89.5 to 94.1% identities with the SATV S-RNA-segment and L-RNA-segment, respectively [19]. In China, both AKAV genogroup I and genogroup II exist in the clinical goat or cattle farms, which rise the possibility of the reassortant of AKAV.
Reverse genetic systems are useful for studying basic mechanisms as well as practical applications for many kinds of viruses. Previously, the RNA polymerase I was employed to develop the reverse genetic system of OBE-1 strain for AKAV [22]. However, its efficiency for virus rescue was substandard, lack of robust. While, T7 RNA polymerase-based reverse-genetics system has proved to be more effective in rescuing other bunyaviruses [23–25]. In our study, we successfully rescued the AKAV strain TJ2016 using the T7 RNA polymerase-based reverse genetic system. In this system, only three plasmids (TVT7R-S, TVT7R-M, and TVT7R-L) needed and we successfully rescued the TJ2016 strain in all of the three plasmid proportions (1: 1: 1, 0.5: 1: 2 and 0.5: 2: 4) which means that the proportion of TVT7R-S, TVT7R-M, and TVT7R-L plasmids is not severely restricted.
Conclusions
We successfully isolated a genogroup II AKAV strain TJ2016 and established its T7 RNA polymerase-based rescue genetic system, which could be served as a powerful tool for further AKAV recombination strategies, pathogenesis mechanism and even vaccine studies.
Methods
Cells and viruses
Baby hamster Syrian kidney (BHK-21) cells and BSR-T7/5 cells (a BHK-21 derivative cell that stably expresses T7 RNA polymerase) used in this study were stored at the Institute of Animal Inspection and Quarantine, Chinese Academy of Inspection and Quarantine (CAIQ) and maintained on Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) [26]. AKAV strain TJ2016 used in the present study was isolated from the bovine sera stored at our lab which were sent for animal health monitoring before.
PCR amplification, sequencing and phylogenetic analysis
To define the relationships of the isolated bovine AKAV TJ2016 with other AKAV isolates, phylogenetic trees were constructed based on the S and M ORF of AKAV TJ2016 and the deposited AKAV sequences in the GenBank. Briefly, the viral RNA of TJ2016 was extracted from virus-containing cell culture supernatant using the viral RNA min kit (Qiagen, Hilden, Germany) and stored at − 80 °C. The RT-PCR procedure was performed in a one-tube system for sequencing using the EasyScript All-in-one First-strand cDNA Synthesis SuperMix (TransGen Biotec, Beijing, China) and the primers used for the amplification of AKAV S, M, and L segments were shown in Table 1 (Number 1 to 18). The amplified DNA fragments were purified using an Agarose Gel DNA Extraction Kit (TransGen Biotec) and sequenced by TSINGKE Biological Technology (Nanjing, China). The S and M segment sequences of the Akabane virus strains used for sequence alignment in this study were listed in Table 2. The alignments and the neighbor-joining (NJ) phylogenetic trees were constructed using the MEGA 5.0 software [27]. The branching pattern was statistically evaluated by bootstrap analysis of 1000 replicates.
Table 2.
Summary of Akabane virus field isolates used in this study
| Strain Name | Year | Country | Source | Genogroup | Accession No. | |
|---|---|---|---|---|---|---|
| S CDS | M CDS | |||||
| GXLCH02 | 2016 | China | Rhizomys pruinosus | Ia | KY381272.1 | |
| NM/BS/1 | 2016 | China | Bovine serum | Ia | KU375444.1 | KU375443.1 |
| GXLCH01 | 2016 | China | Rhizomys pruinosus | Ia | KY385908.1 | KY381277.1 |
| GXLCH04 | 2016 | China | Rhizomys pruinosus | Ia | KY381273.1 | KY381279.1 |
| GXLCH16-70 | 2016 | China | Rhizomys pruinosus | Ia | KY381274.1 | KY381280.1 |
| GXLCH70N | 2016 | China | Rhizomys pruinosus | Ia | KY381275.1 | KY381281.1 |
| KM-1/Br/06 | 2006 | Japan | Bovine brain | Ib | AB426271.1 | AB436954.1 |
| KM-2/Br/06 | 2006 | Japan | Bovine brain | Ib | LC552047.1 | LC552048.1 |
| KS-2/Mo/06 | 2006 | Japan | Bovine brain | Ib | AB373232.1 | AB373233.1 |
| KSB-3/P/06 | 2006 | Japan | Bovine plasma | Ib | AB426280.1 | AB426282.1 |
| AKAV-7/SKR/2010 | 2010 | South Korea | Cattle | Ib | JQ308771.1 | JQ308775.1 |
| AKAV-32/SKR/2010 | 2010 | South Korea | Cattle | Ib | JQ308773.1 | JQ308777.1 |
| AKAV-17/SKR/2010 | 2010 | South Korea | Cattle | Ib | JQ308772.1 | JQ308776.1 |
| Okayama2001 | 2001 | Japan | Bovine plasma | Ib | AB289319.1 | AB289322.1 |
| Iriki | 1984 | Japan | Calf cerebellum | II | AB289321.1 | AB297820.1 |
| CY-77 | 1993 | Taiwan | Bovine erythrocyte | II | AB232319.1 | AB297851.1 |
| PT-17 | 1997 | Taiwan | Bovine blood | II | AF034940.1 | |
| NT-14 | 2000 | Taiwan | Pig | II | AF529883.1 | |
| FO-90-3 | 1990 | Japan | Culicoides spp | II | AB232198.1 | AB297831.1 |
| KT3377 | 1977 | Japan | Bovine blood | II | AB000857.1 | AB297819.1 |
| AK7 | 2006 | South Korea | Bovine | II | FJ498795.1 | FJ498801.1 |
| K0505 | 2005 | South Korea | Bovine | II | FJ498796.1 | FJ498800.1 |
| 93FMX | 1993 | South Korea | Bovine | II | FJ498797.1 | FJ498799.1 |
| OBE-1 | 1974 | Japan | Aborted fetus brain | II | AB000851.1 | AB100604.1 |
| YG-88-2 | 1988 | Japan | Bovine erythrocyte | II | AB232196.1 | AB297827.1 |
| ON-89-2 | 1989 | Japan | Bovine erythrocyte | II | AB000864.1 | AB29297828.1 |
| NS-88-1 | 1988 | Japan | Bovine erythrocyte | II | AB000864.1 | AB297825.1 |
| JaGAr39 | 1959 | Japan | Aedes vexans | II | AB000852.1 | AB297818.1 |
| JaLAB39 | 1959 | Australia | Aedes vexans | II | KR260714.1 | KR260715.1 |
| R7949 | 1968 | Australia | Bos taurus | III | MH734959.1 | MH735016.1 |
| B8935 | 1968 | Australia | Bos taurus | III | MH734940.1 | AB297848.1 |
| MP496 | 1972 | Kenya | Anopheles funestus | IV | AB232320.1 | AB297850.1 |
Plasmid construction and the generation of rescued virus rAKAV
For the establishment of AKAV reverse genetic system, the full-length sequences of S, M, and L segments were amplified using the primers listed in Table 1 (Number 19 to 24) and the amplified DNA products were cloned into the plasmid TVT7R as described previously [28], which could transcribe the antigenome-sense RNA by T7 RNA polymerase. Briefly, viral RNA was first extracted from virons cultured in the BHK-21 cells using the viral RNA min kit (Qiagen). Then, the viral RNA was reverse-transcribed using the EasyScript All-in-one First-strand cDNA Synthesis SuperMix (TransGen Biotech.) and the full-length sequences of S, M, and L segments were amplified by the KOD Fx Neo polymerase. The plasmid TVT7R and the amplified PCR products were digested by the endonucleases BbsI and BsmBI, respectively, and subsequently ligated using the T4 ligase (TaKaRa Bio.). The concentrations of the successfully constructed S, M, and L recombinant plasmids were measured by the Nanodrop microspectrophotometer (Thermo Fisher Scientific, MA, USA) and then used in a three-plasmid rescue system by transfecting into the T7 RNA polymerase-expressing BSR-T7/5 cells [29]. Briefly, BSR-T7/5 cells were seeded into the six-well plate until the cells covered 80-90% area of the plate, S, M, and L segments (1:1:1) were transfected to the cells by using the Lipofectamine™ 3000 transfection reagent (Thermo Fisher Scientific). Three to 4 days after transfection, the cell supernatants were harvested and added into BHK-21 cells. Then, viruses were plaque purified three times from BHK-21 cells and stored at − 80 °C until used [30].
Indirect immunofluorescence assay
For the immunofluorescence imaging of AKAV virons, BHK-21 cells were grown in six-well plates to 80-90% confluence, then were infected with wtAKAV or rAKAV for 48 h at 37 °C. The supernatants were removed and cells were fixed with 3.7% paraformaldehyde for 10 min and permeabilized with 0.1% Triton X-100 in phosphate buffer saline (PBS) containing 2% bovine serum albumin (BSA) for 10 min followed by blocking with 2% BSA in PBS for 30 min. Then the cells were incubated with AKAV anti-N monoclonal antibody (diluted by 1:1000, produced by our lab) as the primary antibody at 37 °C for 1 h and then washed with PBS for three times. Stained with FITC-conjugated goat anti-mouse antibody (diluted by 1: 500, TransGen Biotech.) as the secondary antibody at 37 °C for 1 h, the cell-cultured plates were washed with PBS for 3 times and were observed under the Invitrogen EVOS FL cell fluorescence imaging system (Thermo Fisher Scientific).
Viral plaque assay
BHK-21 cells in six-well plates were infected with rAKAV or wtAKAV at MOI of 0.01. for 1 h at 37 °C. The medium containing the unbound viruses were removed, and the plates were washed three times with PBS before being overlaid with DMEM containing 0.5% methylcellulose. At 72 h post-infection, the medium was removed and the plaques were stained with 3.7% paraformaldehyde containing 0.1% crystal violet.
Growth kinetics of wtAKAV and rAKAV
To compare the growth kinetics of wtAKAV and rAKAV, BHK-21 cell monolayer was infected with AKAVs at a MOI of 0.01. After 1 h at 37 °C incubation, the unbound viruses were removed and washed with PBS for three times, and serum-free DMEM was added. At different times post-infection, cells were harvested and titrated using tissue culture infectious dose 50 (TCID50) with BHK-21 cells [31].
Statistical analysis
All data was processed with GraphPad Prism 6 (GraphPad Software Inc.). A student t-test was used to analyze the difference between the values of two groups. A value of p < 0.05 was considered statistically significant.
Supplementary Information
Additional file 1: Figure S1. Sequence aligment of rAKAV and wtAKAV. Figure S2. The sequence of rAKAV S segment. Figure S3. The plague of rAKAV and wtAKAV. Figure S4. The PCR result of rAKAV and wtAKAV.
Acknowledgements
This study was supported by the Research Program of Chinese Academy of Inspection and Quarantine (grant 2018JK013, 2020JK021) and the National Key Research and Development Program of China (grant 2016YFD0501102).
Disclosure of potential conflicts of interest
We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work; there is no professional or other personal interest of any nature or kind in any product, service, and/or company that could be construed as influencing the position presented in, or the review of, this article.
Research involving human participants and/or animals
This article does not contain any studies with humans or animals.
Abbreviations
- AH
Arthrogryposis hydranencephaly
- AKA
Akabane disease
- AKAV
Akabane disease virus
- ORF
Open reading frame
- CPE
Cytopathic effect
- MOI
Multiplicity
- TCID50
Tissue culture infectious dose 50
- BSA
Bovine serum albumin
- SBV
Schmallenberg virus
- FBS
Fetal bovine serum
- DMEM
Dulbecco’s modified eagle medium
- PBS
Phosphate-buffered saline
- IFA
Indirect immunofluorescence assay
- BHK
Baby hamster syrian kidney
- RT-PCR
Reverse transcription polymerase chain reaction
Authors’ contributions
Shaoqiang Wu conducted and designed the experiment. Dongjie Chen and Di Wang performed research and drafted the first version of the manuscript. Fang Wei, Yufang Kong and Junhua Deng provided reagents and analyzed data. Xiangmei Lin conducted the experiment. The authors read and approved the final manuscript.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Dongjie Chen, Email: chendongjie1212@163.com.
Di Wang, Email: sdau_dw@163.com.
Fang Wei, Email: 18713595632@163.com.
Yufang Kong, Email: yufangdali@163.com.
Junhua Deng, Email: dengqifei-198825@163.com.
Xiangmei Lin, Email: linxm@caiq.org.cn.
Shaoqiang Wu, Email: sqwu@sina.com.
References
- 1.Charles JA. Akabane virus. Vet clin North Am Food Animl Prac. 1994;10(3):525–546. doi: 10.1016/S0749-0720(15)30537-5. [DOI] [PubMed] [Google Scholar]
- 2.Inaba Y, Kurogi H, Omori T. Letter: Akabane disease: epizootic abortion, premature birth, stillbirth and congenital arthrogryposis-hydranencephaly in cattle, sheep and goats caused by Akabane virus. Aust Vet J. 1975;51(12):584–585. doi: 10.1111/j.1751-0813.1975.tb09397.x. [DOI] [PubMed] [Google Scholar]
- 3.Kurogi H, Inaba Y, Goto Y, Miura Y, Takahashi H. Serologic evidence for etiologic role of Akabane virus in epizootic abortion-arthrogryposis-hydranencephaly in cattle in Japan, 1972-1974. Arch Virol. 1975;47(1):71–83. doi: 10.1007/BF01315594. [DOI] [PubMed] [Google Scholar]
- 4.Kurogi H, Inaba Y, Takahashi E, Sato K, Satoda K. Congenital abnormalities in newborn calves after inoculation of pregnant cows with Akabane virus. Infect Immun. 1977;17(2):338–343. doi: 10.1128/iai.17.2.338-343.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yang DK, Kim BH, Kweon CH, Nah JJ, Kim HJ, Lee KW, Yang YJ, Mun KW. Serosurveillance for Japanese encephalitis, Akabane, and Aino viruses for thoroughbred horses in Korea. J Vet Sci. 2008;9(4):381–385. doi: 10.4142/jvs.2008.9.4.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Oya A, Okuno T, Ogata T, Kobayashii, Matsuyama T. Akabane, a new arbor virus isolated in Japan. Jpn J Med Sci Biol. 1961;14:101–108. doi: 10.7883/yoken1952.14.101. [DOI] [PubMed] [Google Scholar]
- 7.Parsonson IM, McPhee DA. Bunyavirus pathogenesis. Adv Virus Res. 1985;30:279–316. doi: 10.1016/S0065-3527(08)60453-4. [DOI] [PubMed] [Google Scholar]
- 8.Akashi H, Kaku Y, Kong XG, Pang H. Sequence determination and phylogenetic analysis of the Akabane bunyavirus S RNA genome segment. J Gen Virol. 1997;78(Pt 11):2847–2851. doi: 10.1099/0022-1317-78-11-2847. [DOI] [PubMed] [Google Scholar]
- 9.Jun Q, Qingling M, Zaichao Z, Kuojun C, Jingsheng Z, Minxing M, Chuangfu C. A serological survey of Akabane virus infection in cattle and sheep in Northwest China. Trop Anim Health Prod. 2012;44(8):1817–1820. doi: 10.1007/s11250-012-0168-3. [DOI] [PubMed] [Google Scholar]
- 10.Wang J, Blasdell KR, Yin H, Walker PJ. A large-scale serological survey of Akabane virus infection in cattle, yak, sheep and goats in China. Vet Microbiol. 2017;207:7–12. doi: 10.1016/j.vetmic.2017.05.014. [DOI] [PubMed] [Google Scholar]
- 11.Cao YX, Fu SH, Song S, Cai L, Zhang H, Gao LD, Cao L, Li MH, Gao XY, He Y, Wang HY, Liang GD. Isolation and genome phylogenetic analysis of arthropod-borne viruses, including Akabane virus, from mosquitoes collected in Hunan province, China. Vector borne Zoonotic Dis. 2019;19(1):62–72. doi: 10.1089/vbz.2018.2267. [DOI] [PubMed] [Google Scholar]
- 12.Tang HB, Chen FL, Rao GB, Bai AB, Jiang JJ, Du YC, Ren PF, Liu JF, Qin SM, Yang L, Wu JM. Characterization of Akabane virus from domestic bamboo rat, Southern China. Vet Microbiol. 2017;207:280–285. doi: 10.1016/j.vetmic.2017.06.018. [DOI] [PubMed] [Google Scholar]
- 13.Tang HB, Ren P, Qin S, Lin J, Bai A, Qin S, Chen F, Liu J, Wu J. Isolation, genetic analysis of the first Akabane virus from goat in China. J Vet Med Sci. 2019;81(10):1445–1449. doi: 10.1292/jvms.18-0602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Taylor WP, Mellor PS. The distribution of Akabane virus in the Middle East. Epidemiol Infect. 1994;113(1):175–185. doi: 10.1017/S0950268800051591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.First room of Anima Quarantine Institute, Ministry of Agriculture Detection of antibody against Akabane disease in the cattle and goat sera in several provinces of China. Ani Qua. 1990;6:50. [Google Scholar]
- 16.Li QP, Zhou LQ, Yao LT, Cai YS, Chen XQ, Wei LX, Li CL, Wang X, Ding J, Li JP. Isolation and preliminary identification of Akabane virus. China Ani Heal Inspec. 2000;7:27–29. [Google Scholar]
- 17.De Regge N. Akabane, Aino and Schmallenberg virus-where do we stand and what do we know about the role of domestic ruminant hosts and Culicoides vectors in virus transmission and overwintering? Curr Opin Virol. 2017;27:15–30. doi: 10.1016/j.coviro.2017.10.004. [DOI] [PubMed] [Google Scholar]
- 18.Yanase T, Yoshida K, Ohashi S, Kato T, Tsuda T. Sequence analysis of the medium RNA segment of three Simbu serogroup viruses, Akabane, Aino, and Peaton viruses. Virus Res. 2003;93(1):63–69. doi: 10.1016/S0168-1702(03)00066-2. [DOI] [PubMed] [Google Scholar]
- 19.Yanase T, Kato T, Aizawa M, Shuto Y, Shirafuji H, Yamakawa M, Tsuda T. Genetic reassortment between Sathuperi and Shamonda viruses of the genus Orthobunyavirus in nature: implications for their genetic relationship to Schmallenberg virus. Arch Virol. 2012;157(8):1611–1616. doi: 10.1007/s00705-012-1341-8. [DOI] [PubMed] [Google Scholar]
- 20.Pleschka S. Overview of influenza viruses. Curr Top Microbiol Immunol. 2013;370:1–20. doi: 10.1007/82_2012_272. [DOI] [PubMed] [Google Scholar]
- 21.Briese T, Calisher CH, Higgs S. Viruses of the family Bunyaviridae: are all available isolates reassortants? Virology. 2013;446(1-2):207–216. doi: 10.1016/j.virol.2013.07.030. [DOI] [PubMed] [Google Scholar]
- 22.Ogawa Y, Sugiura K, Kato K, Tohya Y, Akashi H. Rescue of Akabane virus (family Bunyaviridae) entirely from cloned cDNAs by using RNA polymerase I. J Gen Virol. 2007;88(Pt 12):3385–3390. doi: 10.1099/vir.0.83173-0. [DOI] [PubMed] [Google Scholar]
- 23.Blakqori G, Weber F. Efficient cDNA-based rescue of La Crosse bunyaviruses expressing or lacking the nonstructural protein NSs. J Virol. 2005;79(16):10420–10428. doi: 10.1128/JVI.79.16.10420-10428.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Bridgen A, Elliott RM. Rescue of a segmented negative-strand RNA virus entirely from cloned complementary DNAs. Proc Natl Acad Sci U S A. 1996;93(26):15400–15404. doi: 10.1073/pnas.93.26.15400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ikegami T, Won S, Peters CJ, Makino S. Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene. J Virol. 2006;80(6):2933–2940. doi: 10.1128/JVI.80.6.2933-2940.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Buchholz UJ, Finke S, Conzelmann KK. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J Virol. 1999;73(1):251–259. doi: 10.1128/JVI.73.1.251-259.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28(10):2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Takenaka-Uema A, Sugiura K, Bangphoomi N, Shioda C, Uchida K, Kato K, Haga T, Murakami S, Akashi H, Horimoto T. Development of an improved reverse genetics system for Akabane bunyavirus. J Virol Methods. 2016;232:16–20. doi: 10.1016/j.jviromet.2015.12.014. [DOI] [PubMed] [Google Scholar]
- 29.Lowen AC, Noonan C, McLees A, Elliott RM. Efficient bunyavirus rescue from cloned cDNA. Virology. 2004;330(2):493–500. doi: 10.1016/j.virol.2004.10.009. [DOI] [PubMed] [Google Scholar]
- 30.Watret GE, Pringle CR, Elliott RM. Synthesis of bunyavirus-specific proteins in a continuous cell line (XTC-2) derived from Xenopus laevis. J Gen Virol. 1985;66(Pt 3):473–482. doi: 10.1099/0022-1317-66-3-473. [DOI] [PubMed] [Google Scholar]
- 31.Smither SJ, Lear-Rooney C, Biggins J, Pettitt J, Lever MS, Olinger GG., Jr Comparison of the plaque assay and 50% tissue culture infectious dose assay as methods for measuring filovirus infectivity. J Virol Methods. 2013;193(2):565–571. doi: 10.1016/j.jviromet.2013.05.015. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: Figure S1. Sequence aligment of rAKAV and wtAKAV. Figure S2. The sequence of rAKAV S segment. Figure S3. The plague of rAKAV and wtAKAV. Figure S4. The PCR result of rAKAV and wtAKAV.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.





