SUMMARY
Pseudomonas aeruginosa notoriously adapts to the airways of people with cystic fibrosis (CF), yet how infection-site biogeography and associated evolutionary processes vary as lifelong infections progress remains unclear. Here we test the hypothesis that early adaptations promoting aggregation influence evolutionary-genetic trajectories by examining longitudinal P. aeruginosa from the sinuses of six adults with CF. Highly host-adapted lineages harbored mutator genotypes displaying signatures of early genome degradation associated with recent host restriction. Using an advanced imaging technique (MiPACT-HCR [microbial identification after passive clarity technique]), we find population structure tracks with genome degradation, with the most host-adapted, genome-degraded P. aeruginosa (the mutators) residing in small, sparse aggregates. We propose that following initial adaptive evolution in larger populations under strong selection for aggregation, P. aeruginosa persists in small, fragmented populations that experience stronger effects of genetic drift. These conditions enrich for mutators and promote degenerative genome evolution. Our findings underscore the importance of infection-site biogeography to pathogen evolution.
In brief
Armbruster et al. find that infection-site biogeography impacts evolution of the opportunistic pathogen, Pseudomonas aeruginosa. In the sinuses of adults with cystic fibrosis, P. aeruginosa residing in large, dense aggregates adaptively evolves, whereas small, sparse aggregates experience greater effects of genetic drift and early stages of degenerative genome evolution.
Graphical abstract

INTRODUCTION
Chronic bacterial infections and the resulting robust but often ineffective host inflammatory response drivethe progression of cystic fibrosis (CF) airway disease, causing significant morbidity in people with CF and, in some cases, culminating in the need for a lung transplant and/or resulting in mortality as a result of respiratory failure (Ramsey, 1996). Although CF respiratory infections are often polymicrobial (Muhlebach et al., 2018), Pseudomonas aeruginosa most commonly dominates end-stage lung disease (Rudkjøbing et al., 2012). The typical progression of P. aeruginosa lung infections in CF includes an intermittent colonization period (typically during childhood), during which sputum is infrequently culture positive for P. aeruginosa and antibiotics can reduce the infection to levels that are undetectable clinically. Over time, this progresses to the chronic infection stage, during which sputum is consistently culture positive for P. aeruginosa that is no longer responsive to antibiotic therapy (typically during the late teenage years or early adulthood) (Lee et al., 2003;Heltshe et al., 2018). During the intermittent infection stage, people with CF may harbor multiple genetically distinct P. aeruginosa strains, but by the time the infection has reached the chronic stage, just one monophyletic lineage persists that is nonetheless phenotypically diverse (Winstanley et al., 2016).
Longitudinal studies of P. aeruginosa isolated from CF sputum have identified a suite of common evolved phenotypes associated with persistence (termed “pathoadaptation”). During the course of pathoadaptation, selection acts on mutations that inactivate genes important for acute infections (e.g., flagellar motility, pyoverdine siderophore production, and Las quorum sensing) and increase expression of genes promoting chronic infection (e.g., genes that promote biofilm matrix production and aggregation) (Huse et al., 2010; Diaz Caballero et al., 2015). These adaptations paint a picture of the selective pressures faced by P. aeruginosa at the site of infection, some of which may represent important therapeutic targets to prevent or delay the progression to chronic P. aeruginosa infection. However, a challenge to deciphering this information is that the biogeography of the infection site, including the size and structure of P. aeruginosa populations, is usually unknown. Selection prevails in large, dense populations, promoting adaptations that increase fitness, but small populations (especially those experiencing repeated bottlenecks imposed by antimicrobial treatment or the host immune response) are more sensitive to the random effects of genetic drift (Kirchberger et al., 2020). Knowledge of the infection-site biogeography is needed to determine whether selection remains the dominant evolutionary force acting on chronic P. aeruginosa populations or whether some portion of mutations fixed in highly pathoadapted populations could be a result of genetic drift rather than selection.
Chronic rhinosinusitis (CRS), chronic inflammation and bacterial infection of the paranasal sinuses, is a prominent manifestation of CF in the upper respiratory tract (URT), and the prevalence of CRS approaches 100% in people with CF (Gentile and Isaacson, 1996; Robertson et al., 2008). Several studies support a model in which bacteria (including P. aeruginosa; Robertson et al., 2008; Johansen et al., 2012; Ciofu et al., 2013; Cope et al., 2017; Lucas et al., 2018; Muhlebach et al., 2018; Pletcher et al., 2019) inhaled from the environment first colonize the sinonasal cavity (referred to as the URT), with the URT subsequently acting as the main reservoir of bacteria that seeds the lungs in CF (Walter et al., 1997; Robertson et al., 2008; Mainz et al., 2009, 2011; Bonestroo et al., 2010; Hansen et al., 2012; Folkesson et al., 2012; Johansen et al., 2012; Aanæs, 2013; Chaaban et al., 2013; Ciofu et al., 2013; Whiteson et al., 2014; Wilson et al., 2014; Purdy-Gibson et al., 2015; Alanin et al., 2016; Boutin and Dalpke, 2017; Bartell et al., 2019, 2021). Pathoadaptive phenotypes and/or mutations previously observed among CF sputum isolates are also present in the sinuses (Walter et al., 1997; Mainz et al., 2009, 2011; Hansen et al., 2012; Johansen et al., 2012; Ciofu et al., 2013; Boutin and Dalpke, 2017; Nelson et al., 2018; Bartell et al., 2019, 2021). Our laboratory recently characterized an adult CF CRS cohort and found that sinus exacerbation increases the odds of having a pulmonary exacerbation before the next study visit, suggesting a link between sinus and lung disease progression (Zemke et al., 2019). Finally, there are currently no standard of care guidelines for management of CF CRS, but the URT may become an important site for monitoring of P. aeruginosa colonization status as highly effective modulator therapy becomes more widespread and sputum is less frequently produced (De Boeck et al., 2020). Despite mounting evidence that the sinuses likely represent an important microbial niche in CF respiratory disease, the population biology and evolutionary genetics shaping P. aeruginosa pathogenesis during CF CRS remain unclear.
In the present study, we tested the hypothesis that infectionsite biogeography influences evolutionary-genetic trajectories of chronically infecting P. aeruginosa in CF sinus infections. We found that highly pathoadapted P. aeruginosa (especially mutators) reside in the smallest, most sparse aggregates, whereas less pathoadapted, non-mutator lineages resided in large, dense aggregates. Further examination of the consequences of these varying evolutionary genetic mechanisms and population structures revealed that the most pathoadapted lineages display early signatures of genome degradation, reminiscent of the degraded genomes of host-restricted pathogen or endosymbiont bacteria (McCutcheon et al., 2019; Kirchberger, Schmidt and Ochman, 2020). We introduce a re-envisioned, two-step model of how opportunistic pathogens evolve to establish chronic infections. During chronic CF respiratory infections, P. aeruginosa follows an evolutionary path toward host restriction that includes genomic erosion, whereby an initial pathoadaptive phase driven by strong selection in large, dense infecting populations is followed by increasing effects of genetic drift that is accelerated by mutator phenotypes in smaller, more sparse populations. Our findings underscore the importance of infection-site biogeography to pathogen evolution and the relevance of the sinuses to overall CF respiratory health.
RESULTS
Sinus P. aeruginosa lineages display a range of CF pathoadaptive phenotypes associated with persistence
We began with two potential models of P. aeruginosa population structure during CF CRS. Because the sinuses are proposed to serve as the first site of colonization by P. aeruginosa that is inhaled from the environment, one possibility is that the sinuses are infected by multiple genetically distinct strains of P. aeruginosa that display acute virulence traits. Alternatively, because our study participants were adults and may have been colonized by P. aeruginosa for multiple years prior to our study, participants could instead already harbor a single P. aeruginosa lineage that may have outcompeted others by gaining pathoadaptive traits such as loss of acute virulence factor production and increased biofilm formation. To test these two models, we sequenced the genomes of longitudinal P. aeruginosa isolates collected from the sinuses of six adults with CF and CRS (Table 1). Similar to reports of P. aeruginosa isolates from the sputum of adults with CF, all six participants were colonized by a single clonal lineage of P. aeruginosa in their sinuses (Figure 1A), with five of the six lineages belonging to the most common P. aeruginosa clade and the sixth lineage (from patient 33) belonging to the second most common clade (Figure 1B). We next asked whether sinus isolates displayed traits more consistent with acute virulence (e.g., motile, producing acute virulence factors) or, rather, traits associated with pathoadaptation to the respiratory tract, based on common phenotypes of isolates from sputum of CF adults (Winstanley et al., 2016). The six P. aeruginosa lineages displayed a range of pathoadaptative phenotypes (including the loss of acute virulence phenotypes and the presence of chronic infection phenotypes), with patient 33’s lineage exhibiting the most pathoadapted phenotypes and patient 32’s lineage displaying the fewest (Figure 1A). We assessed acute toxicity and immune induction by measuring transepithelial electrical resistance (TEER) and IL-8 secretion following P. aeruginosa exposure, respectively, in a polarized, human CF airway cell model (Hendricks et al., 2016). Isolates from patient 32 displayed similar cytotoxicity and induced similar levels of IL-8 secretion as the laboratory strain PAO1, which was isolated from an acute infection (burn wound; Holloway, 1955) (Figures 1C and 1D). Isolates from patients 9, 24, 41, and 52 displayed intermediate levels of cytotoxicity by 8 h in the TEER assay, whereas isolates from patient 33 did not induce an appreciable drop in TEER by this same time point. Based on their interactions with airway epithelial cells and consistent with the in vitro phenotyping of pathoadaptive traits described above, we hypothesize that the different P. aeruginosa lineages represent a spectrum of pathoadaptation, with patient 32’s being the least pathoadapted and patient 33’s lineage the most pathoadapted.
Table 1.
Clinical parameters of study participants
| Parameter | Cohort values |
|---|---|
| Cohort population (%) | 6/33 (18.2) |
| Average number of study visits per participant | 9 (8–11) |
| Length of follow-up, months | 30.0 (19.7–30.5) |
| Male (%) | 1/6 (17) |
| Median age, years | 27.3 (26.5–27.6) |
| Median enrolment BMI, kg/m2 | 22.3 (18.45–24.14) |
| CFTR mutation (%) | 4 (66.7) F508del homozygous |
| 2 (33.3) F508del/other | |
| 0 other/other | |
| CF-related diabetes (%) | 5/6 (83) |
| Baseline percent predicted FEV1 | 63 (32–98) |
| Topical sinus antibiotic use (%) | 6/6 (100) |
| Inhaled antibiotic use (%) | 6/6 (100) |
| CFTR corrector/modulator use (%) | 2/6 (33) |
| Documented P. aeruginosa in sputum during the 12 months prior to enrolment | 5/6 (1 missing) |
The six-participant cohort consists of individuals from a larger study of 33 people with CF and CRS (Zemke et al., 2019). Continuous variables are reported as median (25%–75% percentiles). Age, BMI, and percent predicted FEV1 (ppFEV1) are reported for the first visit. Drug use is reported for any time during the study.
Figure 1. Lineages of P. Aeruginosa from the paranasal sinuses of six people with CF display a spectrum of pathoadaptive traits.
(A) Sinus isolates display diverse pathoadaptedphenotypes, with patient 33’s lineage displaying the most phenotypes associated with chronic infection (most pathoadapted) and patient 32’s the most phenotypes associated with acute infection (the least pathoadapted). Between-study participant genetic diversity of whole-genome-sequenced P. aeruginosa isolates is greater than within an individual person, as expected if each study participant harbored their own clonal lineage. Reference strain PAO1 is included on the tree and does not display pathoadapted phenotypes. A filled-in square indicates that a particular isolate displays the phenotype (e.g., a filled-in square for “Swimming” means that isolate can swim). Auxotrophy refers to amino acid auxotrophy for all isolates except those in patient 52’s lineage (nucleotide auxotrophs).
(B) Sinus P. aeruginosa lineages belonged to two of the three major P. aeruginosa clades. The phylogenetic tree depicts relatedness of these six strains and select reference genomes (PAO1, LESB58, PAK, PA14, and PA7) based on single nucleotide polymorphisms (SNPs) in the core genome. The shaded branches on the tree belong to the three major P. aeruginosa clades (Freschi et al., 2015).
(C) Reduced cytotoxicity of sinus P. aeruginosa tracks with level of pathoadaptation. P. aeruginosa lineages display heterogeneity in cytotoxicity, but most are less cytotoxic than PAO1. Isolates from the most phenotypically pathoadapted lineage (Patient 33) are the least cytotoxic. Average transepithelial electrical resistance (TEER) of multiple isolates from each of the six P. aeruginosa lineages in an epithelial killing assay with polarized CFBE41o– cells (n = 7–15 biological replicates). Patient 32’s P. aeruginosa lineage (the least pathoadapted lineage) is the only lineage containing isolates that are as cytotoxic as PAO1.
(D) P. aeruginosa lineages display heterogeneity in IL-8 induction that tracks with TEER assay cytotoxicity and level of pathoadaptation. An ELISA was performed at the 4-h time point during the TEER assay, to measure IL-8 apically secreted by CFBE41o– cells (n = 7–15 biological replicates). Only PAO1 and isolates from patient 32’s lineage induced significant levels of IL-8. Line = median. ****p < 0.0001 by one-way ANOVA with Tukey’s post hoc test for multiple comparisons.
Three distinct patterns of mutation drive genome evolution in the sinuses
We next asked whether differences in levels of pathoadaptation among P. aeruginosa from different study participants could be attributed to different dominant mutational processes. We identified three distinct patterns of mutation shaping P. aeruginosa genomes during prolonged colonization of the sinuses, including (1) de novo nucleotide substitutions occurring in isolates with intact DNA repair mechanisms (P. aeruginosa lineages from patients 32, 41, and 52); (2) hypermutability caused by defects in DNA repair (patient 9 and 33’s lineages, and one isolate from patient 24); and (3) proliferative transposition of insertion sequences (IS elements), a previously underappreciated cause of genetic diversification in CF (patient 24’s lineage).
The first pattern of evolution involves selection on nonsynonymous mutations and small insertions or deletions (indels), including mutations that inactivate acute virulence factors and augment traits associated with chronic infection (e.g., biofilm matrix overproduction and antibiotic resistance). These adaptations involve mutations in specific virulence effectors themselves or in global regulatory proteins, which may increase the magnitude of some traits by disrupting negative regulators (D’Argenio et al., 2007; Starkey et al., 2009). P. aeruginosa isolates from the sinuses of patients 32, 41, and 52 fell into this first category, acquiring an average of 3–23 total mutations per isolate per year (Table 2), including mutations in predicted virulence factors that have been previously described as mutational targets among CF sputum isolates (Table S1). This mutation rate is similar to previous reports of non-mutator lineages of P. aeruginosa, which accumulate fewer than 50 mutations per year (Smith et al., 2006; Cramer et al., 2011; Marvig et al., 2013; Jorth et al., 2015). Based on in vitro phenotyping (Figure 1A), cytotoxicity and immunostimulatory behavior (Figures 1C and 1D), and antimicrobial resistance (Table S2), these three lineages represent low (patients 32 and 41) to intermediate (patient 52) levels of pathoadaptation.
Table 2.
Characteristics of the hybrid-assembled genomes sequenced for the first isolate from the six study participants chosen for P. aeruginosa whole-genome sequencing
| Patient no. | Pa reference isolate no. | Enrollment age (years) | Average no. of mutations per isolate, per year (range) | Hybrid genome assembly statistics | Predicted no. of pseudogenes | Coding density (% pseudogenes) | Total no. of transposases (no. of unique IS families) | |||
|---|---|---|---|---|---|---|---|---|---|---|
|
| ||||||||||
| Total length (no. of contigs) | % GC | No. of CDSs | No. of PAO1 orthologs (% of CDSs are PAO1 orthologs) | |||||||
| 9 | P9_14 | 25.8 | 95 (1–378) | 6.26 Mbp (3) | 66.5 | 5,677 | 5,375 (94.6) | 139 | 0.88 (2.5) | 13(6) |
| 24 | P24_18 | 27.6 | 7(0–138) | 6.81 Mbp (1) | 65.8 | 6,268 | 5,194 (82.9) | 81 | 0.88 (1.3) | 92 (22) |
| 32 | P32_8 | 26.5 | 3 (0–6) | 6.35 Mbp (1) | 66.5 | 5,789 | 5,346 (92.3) | 49 | 0.89 (0.8) | 16(8) |
| 33 | P33_22 | 27 | 48(23–109) | 6.9 Mbp (1) | 66 | 6,393 | 5,341 (83.5)a | 194a | 0.86 (3.1 )a | 28(14) |
| 41 | P41_29 | 27.6 | 23 (0–55) | 6.66 Mbp (2) | 66.1 | 6,125 | 5,233 (85.4) | 69 | 0.89 (1.1) | 23 (16) |
| 52 | P52_64 | 35.8 | 7(1–23) | 6.70 Mbp (1) | 66.2 | 6,120 | 5,440 (88.9) | 71 | 0.88 (1.2) | 31 (16) |
| - | PA01 | - | - | 6.26 Mbp | 66.6 | 5,586 | - | - | - | 15(5) |
| - | PA14 | - | - | 6.53 Mbp | 66.3 | 5,894 | 5,377(91.2) | - | - | 8(6) |
The average number of mutations per isolate per year was calculated based on all isolates from a participant’s P. aeruginosa lineage. The laboratory strains PAO1 and PA14, originally isolated from acute infections, are included as a reference for certain statistics. The number of pseudogenes is the number of unique genes that was predicted to be pseudogenized in any isolate from that study participant’s lineage. Pseudogenes were predicted relative to orthologs in PAO1 or PA14, using Pseudofinder (Syberg-Olsen et al., 2021). The coding density is the length in nucleotides of predicted coding sequences (CDSs; after subtracting the length of all predicted pseudogenes), normalized to the total length of the genome in nucleotides. The percent pseudogenes is the percentage of the total predicted CDS length that is pseudogenized. The number of unique IS element families is the number of transposases on that genome, excluding copies of the same transposase. See also Figure S2.
Ortholog counts, pseudogene, and coding density estimates were performed on P33_22 using PA14 as the reference instead of PAO1, because patient 33’s lineage shares a more recent common ancestor with PA14.
The second pattern involves the evolution of mutator lineages with increased genome-wide mutation rates. One P. aeruginosa lineage had already evolved the mutator phenotype prior to the start of our study (in patient 33; the most phenotypically pathoadapted lineage), and mutators evolved during our study in two additional study participants’ lineages (patients 9 and 24). The two lineages from which we recovered the most mutator isolates (patients 9 and 33) displayed a linear increase in fixed mutations over time (Figures S1A and S1D), suggesting the mutator phenotype is associated with accelerated fixation of mutations in CF P. aeruginosa populations. Mutators are most frequently associated with mutational inactivation of mutS or mutL, leading to defects in mismatch repair (Oliver et al., 2000; Ciofu et al., 2005; Hogardt et al., 2007; Montanari et al., 2007; Marvig et al., 2013; Colque et al., 2020). All isolates collected from patient 33, the most phenotypically pathoadapted lineage, contained a single-base deletion in mutS (1319del, 446*). The average rate of mutations accumulation among isolates from patient 33 was higher than all other lineages, except for the mutator isolates in patient 9’s lineage (Table 2). Mutators were isolated on the latter three of patient 9’s four study visits (Figure 2A). The emergence of mutators in this person was also followed by an increased relative abundance of P. aeruginosa relative to Staphylococcus spp. (Figure 2B). All four mutator isolates had nonsynonymous mutations in dnaQ and dinB, and three of the four mutators had an additional nonsynonymous mutation in recR. The dnaQ gene encodes the epsilon subunit of DNA polymerase III, the inactivation of which has been associated with a strong mutator phenotype in E. coli (Oliver, 2010). DinB (DNA polymerase IV) is an error-prone polymerase that leads to a mutator phenotype when overexpressed (Sanders et al., 2006). Whereas the three non-mutator isolates in patient 9’s lineage (P9_15, 53, and 54) differed from the reference isolate (first isolate collected; P9_14) by 1–3 non-synonymous mutations, the mutator isolates each had from 226 to 244 non-synonymous mutations and up to 378 total mutations relative to the first isolate from this lineage (Table 2). This mutation rate is similar to prior reports of mutator P. aeruginosa from the lungs of people with CF, which can accumulate more than 50 SNPs per year (Cramer et al., 2011; Feliziani et al., 2014; Jorth et al., 2015). Mutator isolates lost acute virulence traits, such as swimming motility (Figure 2C) and pyocyanin production (Figure 2D), and evolved an increased biofilm phenotype (Figure 2E). We also identified one additional mutator isolate with a disrupted DNA repair gene and a relative increase in mutation rate from patient 24 (described below).
Figure 2. Mutators in patient 9’s P. aeruginosa lineage are associated with shifts in the sinus microbiome, exacerbation, and rapid transition to phenotypes associated with chronic lung infection in CF.
(A) Phylogenetic tree based on core genome SNP distance, depicting the timing of mutations associated with the mutator phenotype. Isolates 55, 56, 129, and 136 are mutators. Numbers along tree branches are bootstrap values.
(B) Taxa bar plot depicting the timing of emergence of mutator P. aeruginosa isolates. The relative abundance of Staphylococcus spp. is depicted in red and Pseudomonadaceae in peach. Asterisk indicates a visit during which patient 9 experienced a sinus exacerbation (an acute increase in severity of sinus disease symptoms).
(C) Loss of swimming motility in the mutator isolates from patient 9. The dashed line marks the limit of detection for swimming activity (1 mm). *p < 0.0001 relative to the first isolate (one-way ANOVA with post hoc Dunnett’s test for multiple comparisons). Error bars = SD. n = 3 biological replicates. Relative to the reference isolate 14, the mutator isolates (55, 56, 129, and 136) all have reduced swimming motility, with complete loss of swimming motility in isolates from the last two time points (129 and 136). Representative swimming assay images above the plot show the gradual loss of swimming motility in patient 9’s mutator isolates. MPAO1 fliC::Tn is a mutant with a transposon inactivating a gene required for swimming motility.
(D) Loss of pyocyanin production over time in mutator isolates from patient 9’s P. aeruginosa lineage. *p < 0.0001 relative to wild-type (WT) MPAO1 (one-way ANOVA with post hoc Dunnett’s test for multiple comparisons). Error bars = SD. n = 3 biological replicates. MPAO1 phzM::Tn is a transposon mutant that cannot produce pyocyanin. Samples in tubes are representative pyocyanin extractions in HCl for each clinical isolate or control. Pyocyanin is pink in 0.1N HCl.
(E) An early stop codon in the hybrid diguanylate cyclase/phosphodiesterase PA5295 in the mutator isolate P9_56 leads to a hyper-biofilm phenotype in synthetic CF sputum media (SCFM).
The third pattern of evolution involved the expansion in copy number of IS elements, which inactivated acute virulence genes and led to genomic deletions in patient 24’s lineage. Pathogens can adapt to new hosts by mutations produced by transposition of IS elements, which disrupt one or more genes and catalyze genomic rearrangements (Vandecraen et al., 2017). Evolution of antibiotic resistance (Wolter et al., 2004; Kresse et al., 2006; Evans and Segal, 2007; Sentausa et al., 2020) and, less frequently, inactivation of acute virulence genes by IS have been reported among P. aeruginosa isolates from CF sputum and other human infections (Sentausa et al., 2020). Unlike in other lineages, most mutations that became fixed in patient 24’s lineage were insertion or deletion mutations (Figure S1B). Examination of accessory genomic contents revealed that patient 24’s lineage had the highest number of unique mobile genetic element genes compared with all other sequenced lineages (Figure S2). Whereas the reference isolates from five other lineages had between 13 and 31 copies of transposase genes, patient 24’s reference isolate had 92 copies (P24_18; Table 2). Remarkably, these transposases were encoded by IS elements that disrupted many genes that are commonly inactivated by SNPs or small indel mutations among P. aeruginosa isolated from chronic CF lung infections (Table S3), especially the IS4 family IS element ISPa45. For example, several IS-mediated single-gene disruptions persisted in all isolates in this lineage, including disruption of the quorum-sensing regulator RhlR (PA3477; Figure 3A) and the porin OprD (PA2700) (Table S3). Consistent with RhlR and OprD inactivation, respectively, none of the isolates in patient 24’s lineage produce rhamnolipid (Figure 1A), and all isolates are resistant to the carbapenem meropenem (Table S2). Because isolates in this lineage share synteny with PAO1, we could identify sites of large chromosomal deletions associated with the presence of an IS at the site of the deletion. For example, all isolates from patient 24 exhibited lysis and sheen colony phenotypes (Figure 1A), which is indicative of LasR inactivation (D’Argenio et al., 2007). The likely cause of this phenotype is a 118-gene deletion of the region, including LasR/PA1430, relative to the PAO1 genome mediated by the IS4 family transposase ISPa45 (Figure 3B). Finally, we observed new IS-mediated deletions in isolates from patient 24 relative to the reference isolate (Table S3). For example, isolate 38 has a multi-gene deletion spanning the DNA repair protein MutS. Whereas all other isolates have fewer than 15 SNPs or indels relative to P24_18, isolate P24_38 has 140 SNPs or indels (Figure 5C) likely because of a mutator phenotype caused by the IS-mediated loss of MutS. ISs have been previously shown to lead to a mutator phenotype and genomic diversification during long-term experimental evolution of E. coli (Papadopoulos et al., 1999; Tenaillon et al., 2016), and there is one report of a P. aeruginosa isolate from CF sputum harboring an IS element (IS6100) that disrupted mutS through a large inversion, leading to a mutator phenotype (Kresse et al., 2003). Our results suggest that in addition to hypermutation, IS elements play an important, but as yet understudied, role in accelerating the evolution of pathoadaptive phenotypes in CF.
Figure 3. IS elements mediate inactivation of genes involved in acute virulence and lead to a mutator phenotype by catalyzing deletion of a DNA repair gene.
(A) The transposase ISPa45, an IS element, disrupts the coding region of the transcriptional regulator RhlR in patient 24’s P. aeruginosa lineage. The top genome is PAO1, and the bottom is the hybrid-assembled first isolate (reference) from patient 24 (P24_18). Genes colored orange retained their synteny between PAO1 and P24_18, and RhlR (teal) was disrupted by the insertion of an IS element (red). Gray shading indicates the percent identity between PAO1 and P24_18. RhlR was disrupted at the 3′ end, and a small fragment with homology to the disrupted 3′ end of RhlR is located upstream of ISPa45 in P24_18.
(B) P24_18 has a 188-gene deletion relative to PAO1, including genes required for Las quorum sensing (lasR, lasI). The two PAO1 homologs flanking this large deletion in P24_18 (aprD and PA1435) are both truncated relative to PAO1. In P24_18, the 188 missing genes are replaced by the IS and two additional predicted ORFs without homologs in PAO1 (x_00643 and x_00644).
(C) An IS (ISPa45) catalyzed deletion of the DNA repair gene, mutS, in isolate 38 from patient 24’s lineage, leading to a mutator phenotype as depicted by the long branch length of this isolate on a phylogenetic tree. Dates of isolation are listed next to each isolate. Branches with bootstrap values < 50 are collapsed, and bootstrap values > 50 are listed for all branches.
See also Table S3.
More host-adapted P. aeruginosa resides as small, sparse aggregates in the sinuses
The variability in the mechanisms of genome evolution and levels of pathoadaptation between P. aeruginosa lineages from the sinuses of study participants led us to next ask whether the size and structure of these populations differed. As part of routine clinical care during study visits, sinus tissue and associated mucous plugs were surgically removed from the six study participants and immediately preserved in a fixative. We used MiPACT-HCR (microbial identification after passive clarity technique and hybridization chain reaction) (DePas et al., 2016) to image P. aeruginosa populations in situ without disrupting the architecture of the communities, quantifying the volume of P. aeruginosa aggregates and the average distance from each aggregate to the five closest aggregates. Populations in three of the six study participants’ sinuses (the least pathoadapted lineages [patients 32 and 41] and patient 24) were large and dense, with most P. aeruginosa aggregates’ volumes greater than 1,000 μm3 and arranged less than 10 μm apart from each other (Figure 4; Figure S3). In contrast, three study participants’ P. aeruginosa populations (patients 9, 33, and 52) were small and sparse, with most aggregates less than 50 μm3 in volume and arranged greater than 20 μm apart. Notably, the two most phenotypically pathoadapted lineages, both of which harbored mutator isolates (patients 33 and 9), were among the smallest, most sparse populations.
Figure 4. Pathoadapted, mutator P. aeruginosa resides in small, sparse aggregates compared with non-pathoadapted, non-mutator P. aeruginosa.
(A and B) Two representative fields of view from MiPACT imaging of explanted sinus tissue from patient 32 (A; lineage that retained the most acute virulence phenotypes) or patient 33 (B; most pathoadapted lineage). Red: P. aeruginosa-specific probe; teal: DAPI (mostly host cell nuclei); mask: regions of P. aeruginosa quantified for (C) and (D). Scale bar: 50 μm.
(C) P. aeruginosa population size is inversely related to the level of pathoadaptation. Patient 32’s sinuses harbor large P. aeruginosa populations that are mostly aggregates greater than 1,000 μm3 in volume, whereas patient 33’s P. aeruginosa population mostly contains single cells or small aggregates. n = 2 biological replicates (sinus samples from two study visits) per patient; 10 random fields of view were imaged per biological replicate.
(D) Small aggregates tend to be sparsely distributed (patient 33), whereas large aggregates are located close together. The histogram depicts the percentage ofobjects (aggregates) in a field of view where the average distance to the closest five aggregates was a certain distance. n = 2 biological replicates (sinus samples from two study visits) per patient; 10 random fields of view were imaged per biological replicate.
See also Figure S3.
P. aeruginosa evolves toward host restriction and displays early signatures of genome degradation in CF sinuses
Selection prevails in large populations, whereas small populations are more susceptible to genetic drift that allows for fixation of mutations that do not provide an adaptive benefit (Bobay and Ochman, 2018). Furthermore, two of the three evolutionary genetic modes we identified lead to accelerated rates of mutation (mutators and IS), with most mutations predicted to be inactivating. Therefore, we next sought to understand whether the genomes of pathoadapted P. aeruginosa lineages are becoming more streamlined or more eroded with an accumulation of inactivated genes. Genomes of host-restricted bacterial pathogens or symbionts are degraded relative to closely related free-living and non-host-restricted bacteria because of their small population sizes and the increased effect of drift relative to selection (McCutcheon and Moran, 2011; Kirchberger et al., 2020). Two genomic changes that occur upon host restriction owing to drift are (1) an increase in gene fragmentation and pseudogene formation, and (2) an increase in the number of IS elements present in the genome (Moran and Plague, 2004). Furthermore, nutritional auxotrophies evolve as genomes degrade, and the host-restricted bacterium relies on supplementation by the nutrient-rich host environment, which relaxes purifying selection on prototrophy (Yu et al., 2009; D’Souza et al., 2014). The lineage from patient 33 displays the most chronic, host-adapted phenotypes and resides in small, sparse aggregates, whereas the lineage from patient 32 appears the least host-adapted, based on cytotoxicity (Figures 1C and 1D) and in vitro phenotyping (Figure 1A), and its population size is large and dense. We predicted that patient 33’s lineage would display the most signatures of genome degradation, whereas patient 32’s would have the least.
We focused on enumerating pseudogenes, which are inactivated remnants of previously intact, functional genes (Lerat and Ochman, 2005). Pseudogenes commonly form when bacteria undergo an ecological shift that relaxes selection on genes that are no longer required for survival in their new environment (Lerat and Ochman, 2005). Inactivated genes are removed relatively quickly from the genomes of free-living bacteria but are abundant in recently host-restricted bacteria (Kuo and Ochman, 2010; Burke and Moran, 2011; Oakeson et al., 2014; Garber et al., 2021b; Renoz et al., 2021). Consistent with our hypothesis, we found that isolates from patient 33’s lineage (all mutators) had the lowest coding density and highest number of predicted pseudogenes, which included genes missing start codons, fragmented genes, and run-on open reading frames (Figures 5A and 5B; Table 2). Within lineages that harbored mutator and non-mutator isolates (patients 9 and 24), we saw that mutator isolates had more pseudogenes than non-mutators (Figure 5B). In contrast, isolates in patient 32’s lineage (large, dense populations observed by MiPACT) had the fewest predicted pseudogenes of all sinus lineages. The relatively high pseudogene load among isolates from patient 33 is consistent with the fact that this lineage resides in small, sparse populations and displays the most host-adapted and chronic phenotypes, presumably because of the inactivation and degradation of genes no longer required after long-term colonization of the CF respiratory tract. Of the 194 unique pseudogenized genes among isolates in patient 33’s lineage, 24 are annotated as virulence-associated genes in PAO1 or PA14 (Figure 5A), whereas none of the pseudogenized genes from patient 32’s lineage were predicted virulence factors. Isolates in patient 33’s lineage required amino acid supplementation when grown in chemically defined, minimal media, indicating that amino acid auxotrophy had evolved prior to the start of our study (Figure 5C). An additional auxotrophy, in the form of an inactivating mutation in a gene required for de novo purine biosynthesis, evolved in isolates from patient 52 (purH/PA4854; Figure 5D), which was one of the lineages with small populations visualized by MiPACT (Figure S3). In addition to having the fewest predicted pseudogenes, isolates from patient 32 had no evidence of defective amino acid or nucleotide biosynthesis, consistent with the fewer mutations in this lineage, further suggesting less pathoadaptation in this person’s lineage.
Figure 5. P. aeruginosa displays signatures of recent host restriction and early genome degradation that track with level of pathoadaptation and population size during long-term colonization of CF sinuses.
(A) Plot depicting counts of pseudogenes in each CF CRS lineage, along with two representative genome diagrams from the lineage with the fewest pseudogenes (patient 32; least pathoadapted lineage and resides in large, dense populations) and the most pseudogenes (patient 33; most pathoadapted lineage and resides in small, sparse populations). Bars on the bottom left show the total count of unique pseudogenes in each lineage, with the orange fraction of the bar proportional to the percentage of pseudogenes that are predicted virulence genes. The bars along the top depict counts of genes that were pseudogenized in the sets of lineages indicated by the dotted lines (i.e., shared among lineages or unique to one lineage). Red lines on the genome diagrams indicate locations of pseudogenes.
(B) The mutator phenotype leads to increased pseudogenes within lineages. Dots represent the pseudogene count for each isolate within a study participant’s lineage, with mutator isolates colored in blue and non-mutators in gray.
(C) Patient 33’s lineage is auxotrophic for biosynthesis of at least one amino acid. The lab strain MPAO1 is included as a control to show no change in growth at24 h, when casamino acids are supplemented. The plus (+) sign indicates the condition where casamino acids were added. *p < 0.05 by one-way ANOVA with post hoc Sidak’s test for multiple comparisons. Error bars = SD. N = 3 biological replicates.
(D) Nucleotide (purine) auxotrophy in patient 52’s P. aeruginosa lineage. Reference isolate 64 has a SNP in PA4854/purH, relative to P52_79 and to PAO1, resulting in an amino acid change (Y481S) and a defect in de novo purine biosynthesis. Growth of P52_64 is rescued upon the addition of adenosine (+ sign = adenosine added). *p < 0.001; nsp > 0.05 (one-way ANOVA with post hoc Tukey’s). Error bars = SD. N = 3 biological replicates.
During the transition from a free-living to host-restricted lifestyle, bacterial genomes become enriched with mobile genetic elements, especially IS elements that mediate genomic rearrangements and deletions (Burke and Moran, 2011; McCutcheon and Moran, 2011). The reference isolate from patient 24’s lineage harboured 92 transposases (Table 2), including 45 copies of the pro-liferative IS4 family transposase ISPa45 that inactivated numerous virulence-associated genes and brokered multi-gene deletions in later isolates collected from this person (Table S2). The IS density of P24_18 (number of ISs normalized to genome size in kilobases) was on par with reports of recent obligate host-associated bacteria (IS density of P24_18: 0.014) (Moran and Plague, 2004). The IS density of all other lineages ranged from 0.002 to 0.005, and select laboratory strains (PAO1 and PA14) ranged from 0.001 to 0.002. Together with the variation in size and structure of P. aeruginosa populations that tracks with level of pathoadaptation, the trend of increasing genomic erosion in the most highly pathoadapted P. aeruginosa lineages strongly suggests that, following an initial period of adaptive evolution in response to strong selective pressures in the host, persistent P. aeruginosa resides in small, fragmented populations that are subject to stronger effects of genetic drift. Mutator phenotypes are enriched under these conditions and lead to early stages of degenerative genome evolution as P. aeruginosa persists in the respiratory tract of adults with CF.
DISCUSSION
When opportunistic pathogens such as P. aeruginosa first colonize susceptible hosts, the population experiences strong selection by the prevailing factors at the colonization site. For people with CF, this site is thought to be the URT, which shares some features of the lungs that ultimately become infected but is also distinct. In addition to being an important reservoir of bacteria that can seed the lower respiratory tract, including post-transplant (Walter et al., 1997; Ciofu et al., 2013), there is growing interest in understanding CF microbiology in the sinuses as highly effective modulator therapy (e.g., Trikafta) becomes more widespread and many people with CF are no longer able to produce sputum for microbiological surveillance (De Boeck et al., 2020). We studied a longitudinal collection of P. aeruginosa from the sinuses of six adults with CF CRS and discovered that sinus populations display a range of pathoadaptive phenotypes and mutations long described to occur in CF lung populations (Winstanley et al., 2016). The genomes of these isolates enabled inference of the population genetic processes shaping these infections and delineated three distinct mechanisms by which P. aeruginosa evolves in the sinuses during CF CRS. These processes converged on selection to amplify a common set of traits, but over time, they led to further functional specialization caused by the beginnings of genome degradation. The genetic decay that occurred during this second stage of genome evolution was accelerated by high mutation rates, which were caused by defects in mismatch repair or rampant increases in IS transposition in some lineages. Genome degradation was enabled by genetic drift that was accelerated initially by population bottlenecks and effects of selective sweeps on linked, favored mutations and later by the sparse biogeography of chronic CF respiratory infections (Cooper et al., 2001; Bjarnsholt et al., 2013; Jorth et al., 2015).
Mutators are commonly isolated from the sputum of people with CF (Oliver et al., 2000). Although the accumulation of beneficial traits along with many neutral or deleterious ones may be the consequence of a higher mutation rate, the mutator phenotype itself is unseen by selection. Rather, mutators evolve by the indirect effects of selection on linked traits, such as loss of acute virulence in CF, increased biofilm formation, metabolic adaptations, and antibiotic resistance (Oliver et al., 2000; Giraud et al., 2001; Sanders et al., 2006; Boles and Singh, 2008; Waine et al., 2008; Hoboth et al., 2009; Colque et al., 2020). The probability of this linkage increases in small populations under strong selection that are limited for beneficial genetic variation or in populations undergoing repeated bottlenecks that drastically reduce the population size (a condition that amplifies the effects of drift relative to selection) (Raynes and Sniegowski, 2014). Both of these scenarios could occur when P. aeruginosa persists throughout the CF respiratory tract as small, isolated, usually clonal biofilm aggregates that are frequently exposed to antimicrobial therapies (Bjarnsholt et al., 2013; Jorth et al., 2015). Our study reveals two distinct pathways to a mutator phenotype: first, by more commonly recognized genetic defects in DNA repair like mutS and mutL (Oliver and Mena, 2010); and second, by increased rates of transposition of IS resulting from weakened selection to control their activity. One lineage in this study isolated from patient 24 combined both of these processes, where ISPa45 disrupted mutS and further accelerated the evolutionary rate. The evolution of a mutator phenotype catalyzed by an IS element inactivating mutS is unusual and has been reported only once previously for P. aeruginosa in CF (Kresse et al., 2003). However, a recent study by Chu et al. (2017) identified an IS element inserted into mutS in a marine bacterium, Vibrio splendidus, and predicted additional putative inactivations of mutS by IS elements in hundreds of diverse Betaproteobacteria and Gammaproteobacteria from human and environmental sources. Therefore, IS elements likely play an important role in the evolution of mutator phenotypes, in addition to their more well-known roles imparting antimicrobial resistance and reduced virulence phenotypes. We expect that the contribution of IS to genome evolution will be more commonly reported as the use of hybrid assemblies that can resolve repetitive IS (e.g., combined Illumina short reads and Oxford Nanopore long reads used in this study) becomes standard practice for de novo bacterial isolate genome assembly. Overall, the prevalence of mutators in three of our six whole-genome-sequenced lineages suggests that diverse mutator genotypes emerge as a result of linked selection on traits that confer an adaptive advantage to P. aeruginosa in the sinuses, as has previously been described in the lungs, and their long-term persistence is supported by the biogeography of the infection site, where they reside in small, sparse populations.
We observed genomic signatures consistent with P. aeruginosa undergoing the transition to a host-restricted lifestyle during long-term colonization of the sinuses, including proliferation of IS elements in patient 24’s lineage and elevated numbers of fragmented genes and pseudogenes in the most pathoadapted lineages (lineages of patients 9 and 33). Diverse host-restricted microbes, from intracellular human pathogens to insect endosymbionts, show evidence of genome degradation when compared with their closest free-living relatives (Merhej et al., 2009; Campbell et al., 2017). Although we do not know how long each of our study participants was infected by their respective P. aeruginosa lineage, it is clear that the evolutionary timescale of our study is very short compared with the timescales described in previous studies of genome degradation (Parkhill et al., 2003; Wei et al., 2003). There is a rich body of literature on highly degraded genomes of host-restricted bacteria (Oakeson et al., 2014; Garber et al., 2021b). Although fewer studies have examined the forces shaping genome evolution earlier along the route from initial host colonization toward host restriction (Burke and Moran, 2011; Renoz et al., 2021), it has been proposed that ancient host-beneficial endo-symbionts likely evolved from opportunistically pathogenic relationships (McCutcheonet al., 2019). Our observations of mutators accelerating pseudogene formation in small populations and IS expansion catalyzing genomic deletions among P. aeruginosa lineages provide new insight into the pace of early degenerative genome evolution, suggesting these first genomic signatures of host restriction can occur during the lifetime of a person with CF. Furthermore, that these lineages can accumulate inactivated genes and harbor proliferative IS and not be outcompeted by another P. aeruginosa strain or other bacteria in the sinuses reflects how the biogeography of CF sinus infections shapes ongoing evolution of persistent populations. A small population size and a protected niche would result in decreased efficiency of purifying selection, allowing for the inactivation of genes through genetic drift and the proliferation of IS elements, as has been described in host-restricted bacteria (Moran, 1996; Moran and Plague, 2004). Although CF sputum can contain up to 108 colony-forming units (CFUs) of P. aeruginosa per milliliter (Stressmann et al., 2011), in a study of explanted CF lungs, Jorth et al. (2015) found that P. aeruginosa populations become isolated within distinct regions of the lung, where they independently evolve. Furthermore, Bjarnsholt et al. (2013) showed that P. aeruginosa tends to reside in small, spatially organized aggregates consisting of between 101 and 104 cells, based on the approximate diameter of aggregates. Using quorum sensing as a model of microbial interactions, Darch et al. (2018) examined the working distance of aggregates of P. aeruginosa and found that aggregates had to be large and within 120–180 μm apart to sense diffusible signals from each other. If selection in the form of competition with other microbes shares a similar working distance in the CF sinuses, then in combination with our results from MiPACT-HCR imaging, these studies suggest that the effective population size of several P. aeruginosa populations in our study is relatively small (patients 9, 33, and 52 and potentially patient 24). This allows for small, isolated P. aeruginosa populations to evolve under similar rules to those governing small populations of host-restricted bacteria, with a greater contribution of genetic drift that enables the beginnings of degenerative genome evolution. Although our study focused on P. aeruginosa, chronic CF respiratory infections are frequently polymicrobial (Armbruster et al., 2020). Future work examining other CF microbes may uncover whether early signatures of degenerative genome evolution like increased pseudogene formation are unique to opportunists that likely originate from the environment (e.g., P. aeruginosa) or whether and how these genomic signatures may similarly accumulate during chronic CF respiratory infection by pathobionts like Staphylococcus aureus or Haemophilus influenzae (Bomar et al., 2018) that have probably co-evolved with a human host for a longer period of time.
Overall, we observed a combination of adaptive evolution and degenerate genome evolution as the forces shaping P. aeruginosa evolution in the sinuses of adults with CF. We propose that P. aeruginosa undergoes two distinct stages of evolution during chronic respiratory infections because of changing forces of selection and drift over time. In the first stage, free-living P. aeruginosa inhaled from the environment experiences strong selection on pathoadaptive mutations that promote persistence in the respiratory tract, including biofilm formation/aggregation and antibiotic resistance. During this time, P. aeruginosa survives despite aggressive antimicrobial treatment, competition for space and resources from diverse other bacteria, and a robust but ineffective host immune response. These selective pressures likely result in repeated population bottlenecks that reduce the effective population size over time. As the bacteria continue to evolve in small, isolated biofilm aggregates, conditions become favorable for mutator lineages to become common and IS elements to proliferate because of a decrease in the strength of purifying selection. Finally, during the host restriction stage, P. aeruginosa has evolved auxotrophies that make it unfit for life outside the host, as it begins to accumulate pseudogenes due to IS transposition and mutations in DNA repair mechanisms. During this final stage, the mutations that accumulate are increasingly a result of drift rather than purifying selection and occur in genes no longer required for life within the host. There are currently no standard of care guidelines for management of upper respiratory disease in CF. Our findings underscore the contribution of CF CRS to overall CF respiratory health and raise the question whether clinical management of URT disease could include interventions aimed at therapeutically relieving the selective pressures in the sinuses that drive evolution toward persistence.
Limitations of the study
Our study has several limitations. Regarding the model of evolution toward recent host restriction and early signatures of genome degradation, although we can infer that the most phenotypically pathoadapted isolates have evolved in the host longer than non-pathoadapted isolates based on prior studies of P. aeruginosa evolution in CF, we do not know how long each of the six study participants had been infected with the specific strains of P. aeruginosa that we sequenced. In addition, we obtained samples suitable for MiPACT-HCR imaging only when sinus surgery was clinically indicated; therefore, we were limited to imaging one or two time points per study participant for this analysis. Furthermore, we collected five or fewer P. aeruginosa isolates per study visit for each participant. This sampling strategy likely did not capture the full diversity of the P. aeruginosa populations, so the prevalence figures we report for pathoadaptive phenotypes and antibiotic resistance in the sinuses of people with CF are potentially underestimated. Finally, without sampling the lower respiratory tract, we are unable to discern whether the P. aeruginosa lineages displaying early signatures of genome degradation remain restricted to the sinuses and are potentially unable to spread elsewhere throughout the respiratory tract or, if they do reach other sites, whether and how they may continue to evolve. Studies are underway in our laboratories that aim to address these limitations in a larger cohort.
STAR*METHODS
Detailed methods are provided in the online version of this paper and include the following:
RESOURCE AVAILABILITY
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dr. Jennifer Bomberger (jbomb@pitt.edu).
Materials availability
This study did not generate new unique reagents.
Data and code availability
All genomic sequencing reads were deposited in NCBI’s SRA under BioProject PRJNA750353 and are publicly available as of the date of publication. Accession numbers are listed in the Key resources table.
KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial and virus strains | ||
|
| ||
| P. aeruginosa PAO1 | Matthew R. Parsek | N/A |
| P. aeruginosa FRD1 | Daniel J. Wozniak (Woolwine and Wozniak,1999) | N/A |
| P. aeruginosa FRD875 | Daniel J. Wozniak (Woolwine and Wozniak, 1999) | N/A |
| PAO1 ΔwspF | Caroline S. Harwood (Güvener and Harwood, 2007) | N/A |
| PAO1 ΔpilA | Matthew R. Parsek (Shrout et al., 2006) | N/A |
| P. aeruginosa MPAO1 | Colin Manoil (Held et al., 2012) | N/A |
| MPAO1 phzM::Tn | Colin Manoil (Held et al., 2012) | N/A |
| MPAO1 fliC::Tn | Colin Manoil (Held et al., 2012) | N/A |
|
| ||
| Critical commercial assays | ||
|
| ||
| Human IL-8/CXCL8 DuoSet ELISA | R&D Systems | DY208–05; RRID: AB_2892143 |
|
| ||
| Deposited data | ||
|
| ||
| Raw reads for 67 P. aeruginosa isolates from the paranasal sinuses of adults with CF and CRS | This study | SRA BioProject: PRJNA750353 |
| P. aeruginosa PAO1 genome | National Center for Biotechnology Information (NCBI) | BioSample Accession: SAMN02603714 |
| P. aeruginosa LESB58 genome | NCBI | BioSample Accession: SAMEA1705916 |
| P. aeruginosa PAK genome | NCBI | BioSample Accession: SAMEA1695737 |
| P. aeruginosa PA14 genome | NCBI | BioSample Accession: SAMN02603591 |
| P. aeruginosa PA7 genome | NCBI | BioSample Accession: SAMN02603435 |
| Non-redundant protein database (nr) | NCBI | https://ftp.ncbi.nih.gov/blast/db/FASTA/ |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| CFBE41o- airway cells | Laboratory of John P. Clancy | N/A |
|
| ||
| Oligonucleotides | ||
|
| ||
| EUB338: GCTGCCTCCCGTAGGAGT | Amann et al., 1990 | N/A |
| NON338: ACTCCTACGGGAGGCAGC | Wallner et al., 1993 | N/A |
| PseaerA: ggtaaccgtcccccttgc | Hogardt et al., 2000 | N/A |
| PseaerB: tctcggccttgaaacccc | Hogardt et al., 2000 | N/A |
| Pae997: tctggaaagttctcagca | Amann et al., 1996 | N/A |
| PSE227: aatccgacctaggctcatc | Watt et al., 2006 | N/A |
| Universal 515: cgtattaccgcggctgctggcac | Nadkarni et al., 2002 | N/A |
| anti-Universal 515: GTGCCAGCAGCCGCGGTAATACG | This study | N/A |
|
| ||
| Software and algorithms | ||
|
| ||
| mothur v1.35.0 | Schloss, 2009 | https://mothur.org/ |
| trimmomatic v0.36 | Bolger et al., 2014 | https://github.com/timflutre/trimmomatic |
| FastQC v0.11.5 | Andrews, 2013 | https://github.com/csf-ngs/fastqc |
| Guppy | Oxford Nanopore Technologies | https://nanoporetech.com/community |
| SPAdes v3.11.0 | Bankevich et al., 2012 | https://github.com/ablab/spades |
| unicycler v0.4.4 | Wick et al., 2017 | https://github.com/rrwick/Unicycler |
| QUAST v4.3 | Gurevich et al., 2013 | https://github.com/rrwick/Unicycler |
| SprayNPray v1.0 | Garber et al., 2021a | https://github.com/Arkadiy-Garber/SprayNPray |
| prokka v1.14.6 | Seemann, 2014 | https://github.com/tseemann/prokka |
| roary v3.13.0 | Page et al., 2015 | https://github.com/sanger-pathogens/Roary |
| RAxML v8.2.4 | Stamatakis, 2014 | https://github.com/stamatak/standard-RAxML |
| breseq v0.31.0 | Deatherage and Barrick, 2014 | https://barricklab.org/twiki/pub/Lab/ToolsBacterialGenomeResequencing/documentation/index.html |
| EasyFig v2.2.2 | Sullivan et al., 2011 | https://mjsull.github.io/Easyfig/ |
| anvi’o v5.5.0 | Eren et al., 2015 | https://github.com/merenlab/anvio |
| FeGenie v1.0 | Garber et al., 2020 | https://github.com/Arkadiy-Garber/FeGenie |
| Pseudofinder v1.0 | Syberg-Olsen et al., 2021 | https://github.com/filip-husnik/pseudofinder |
| Imaris v9.7.2 | Oxford Instruments | https://imaris.oxinst.com/ |
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Human subjects
We performed a prospective, longitudinal study of 33 CF adults with symptomatic CRS and prior functional endoscopic sinus surgery (FESS) (Zemke et al., 2019), following an IRB-approved protocol (STUDY19100149). Participants were treated in a CF-focused otolaryngology clinic at the University of Pittsburgh. During quarterly clinic visits and unscheduled clinic visits, at least two sinus swabs were collected endoscopically for 16S rRNA gene amplicon sequencing and bacterial culturing. Of the 33 participants enrolled in the prior study and for whom sinus samples had been collected, we sequenced whole genomes of P. aeruginosa from 6 people, who are the focus of this study. Clinical parameters of this study’s six study participants are included in Tables 1 (average age, sex, and CFTR genotypes) and 2 (age of each of the six study participants at the time of enrollment).
Bacterial strains
Bacteria were routinely cultured on LB or Pseudomonas Isolation Agar (PIA) at 37°C unless otherwise described in the methods. All bacterial strains are listed on the Key resources table.
Cell lines
The immortalized human cell line CFBE41o- originated from bronchial epithelial cells belonging to a person with CF that was homozygous for the ΔF508 mutation in CFTR, the gene encoding the cystic fibrosis transmembrane conductance regulator protein. CFBE41o- cells were routinely cultured in minimal essential media (MEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 5 U/mL penicillin-5 mg/mL streptomycin (P/S), and 0.5 mg/mL Plasmocin at 37°C with 5% CO2. CFBE41o- were seeded onto transwell inserts and grown in this same media (replaced every 48–72 h) for 7–10 days before use in experiments. Antibiotics were omitted from cell culture media for the duration of the experiments with bacteria. The identity and purity of the CFBE41o- cells were verified by short tandem repeat profiling (University of Arizona Genetics Core).
METHOD DETAILS
16S rRNA gene amplicon sequencing
Sequences from the Illumina MiSeq at the Center for Medicine and the Microbiome were deconvolved and quality-checked by dust low complexity filtering, quality value (QV) trimming, and trimming of primers used for 16S rRNA gene amplification. Each read was first trimmed until the QV was no longer below 30. If the trimmed read was shorter than 75bp, the read was discarded. The read was also discarded if less than 95% of the bases were above a QV of 30. The scripts, fastq_quality_trimmer and fastq_quality_filter, from Hannon’s Cold Spring Harbor Laboratory’s FASTAX-Toolkit were used by the pipeline to perform the trimming and filtering, respectively. Mated pair forward and reversed reads were merged using the following criterion: minimum required overlap = 25 bp, proportion overlap mismatch > 0.2 bp, maximum N’s allowed = 4, and a read length minimum of 125 bp. The 16S reads were then taxonomically classified through a Mothur-based 16S clustering and sequence annotation pipeline (Schloss et al., 2009) that performed sequence classifications with the Ribosomal Database Project (RDP) reference sequences. To monitor for contamination, three environmental controls and two extraction kit controls were sequenced, along with two E. coli positive controls. The composition of control samples differed significantly from all sequenced study samples (PERMANOVA; p < 0.0001), as did the read counts for the environmental and kit controls compared to the study samples (t test; p value < 0.0001). The url for mothur is located in the Key resources table.
P. aeruginosa isolate collection
For every participant’s study visits, a sinus swab was streaked onto Pseudomonas Isolation agar (PIA) and incubated at 37°C for 48 hours. Single colonies were selected based on colony morphology and frozen as a 30% glycerol stock at −80°C.
P. aeruginosa isolate phenotyping
We screened for the following phenotypes by spotting 3μL of an LB overnight culture of each clinical isolate, as well as PAO1 or other controls, onto the appropriate agar plate. Verification of growth, colony size, and lysis and sheen phenotypes were determined after 48 hours of growth on LB agar (24 hours at 37°C and 24 hours at room temperature). Protease production was determined on Brain Heart Infusion (BHI) agar plates supplemented with 10% skim milk, after 24 hours of growth at 37°C. Rhamnolipid production was determined following the protocol by Köhler et al. (2000). Rhamnolipid agar plates contained 42mM Na2HPO4, 22mM KH2PO4, 8.5mM NaCl, and 15 g/L Noble agar supplemented with the following filter-sterilized ingredients after autoclaving: 0.1mM CaCl2, 2mM MgSO4, 0.2% glucose, 0.05% glutamate, 0.025% methylene blue, 0.2% Hexadecyltrimethylammonium bromide (CTAB), and 0.05% casamino acids. Rhamnolipid plates were incubated for 24 hours at 37°C, followed by 72 hours at room temperature in the dark. Mucoidy was determined on both PIA and LB agar after 24 hours of incubation at 37°C, followed by 48 hours at room temperature. Controls used to determine mucoidy included PAO1 (non-mucoid), FRD1 (mucoid; contains the mucA22 allele), and FRD875 (nonmucoid; FRD1 with a disrupted algD) (Woolwine and Wozniak, 1999). Hyper-pigment binding and rugosity were determined on Vogel-Bonner Minimal Media (Vogel and Bonner, 1956) (VBMM; 0.2 g/ L MgSO4•7H2O, 2.0 g /L citric acid, 3.5 g/L NaNH4HPO4•4H2O, 10 g/L K2HPO4, pH 7.0) with 10 mM citrate, 40 μg/ml congo red, and 15 μg/ml brilliant blue as previously described (Harrison et al., 2020) The controls for hyper-pigment binding and rugosity phenotypes were PAO1 (not an RSCV) and PAO1 with a clean deletion of wspF (an RSCV; Güvener and Harwood, 2007).
Swimming motility was determined by stabbing a pipette tip dipped in stationary phase P. aeruginosa into the middle of LB Lenox supplemented with 0.3% agar and incubating at 30°C for 24 hours (Jorth et al., 2015). Twitching motility was determined similarly by stabbing the pipette tip to the bottom of an LB with 1% agar plate. After 48 hours at 37°C, the agar was carefully removed with a spatula, the plastic Petri dish was stained for 10 minutes with 1% crystal violet, and then washed with deionized water (Déziel et al., 2001). Controls for motility assays were MPAO1 or PAO1 (swims and twitches), MPAO1 fliC::Tn (does not swim), and PAO1 ΔpilA (does not twitch) (Shrout et al., 2006; Held et al., 2012).
To assess pyoverdine production, P. aeruginosa isolates were grown to stationary phase in LB broth at 37°C, then inoculated into M9 media supplemented with magnesium and calcium (33.9g/L Na2HPO4, 15 g/L KH2PO4, 5g/L NH4Cl, 2.5g/L NaCl, 0.6mM MgCl2, 1.75mM CaCl2) (Visca et al., 1992), to which 20mM sodium succinate and 0.5% iron-limited casamino acids were added. Pyoverdine was measured after 24 hours of shaken growth at 37°C using an excitation of 400nm and emission of 447nm, and normalized to the cell density (OD600 nm). The iron-limited casamino acids solution was generated by pre-treating the solution with 5g Chelex-100 per 100mL of casamino acids for 1 hour while stirring, then filter-sterilizing. To assess pyocyanin production, P. aeruginosa isolates were grown for 24 hours shaking at 37°C in 5mL of King’s A media. To extract pyocyanin, the 5mL cultures were centrifuged and supernatants were removed. To the supernatants, 3mL of chloroform was added, the solution was vortexed for 20 seconds, and then centrifuged for 10 minutes at 4,000 rpm. The chloroform layer was extracted, 1mL of 0.2M HCl added, then the solution was vortexed and centrifuged for 5 minutes at 4,000 rpm. The pink layer was removed and the absorbance at 520nm was measured. The pyocyanin concentration in micrograms per milliliter of culture supernatant was calculated by multiplying the absorbance at 520nm by 17.072 (the molar extinction coefficient of pyocyanin at 520nm) (Essar et al., 1990).
Amino acid auxotrophy was determined by growth in M9 media plus iron and succinate, with or without 0.5% casamino acids, whereas nucleotide auxotrophy was determined in the same media with or without 2mM adenosine. Additional details for reference strains used as controls in the phenotyping assays are located in the Key resources table.
Cytotoxicity and IL-8 secretion in a polarized CF airway epithelial cell model
CF airway epithelial cells (CFBE41o-) were seeded at 2.5×105 cells per well onto 12-mm Transwell permeable membrane supports (Corning Inc., Corning, NY) and grown for 48 hours with minimal essential medium (MEM) supplemented with fetal bovine serum, penicillin, streptomycin, and plasmocin both apically and basolaterally. After 48 hours, cells were allowed to polarize by growing at the air-liquid interface for 5 additional days prior to experimentation. Cytotoxicity was assessed by measuring a change in transepithelial electrical resistance (TEER) over time, following inoculating filters apically with stationary phase bacterial cultures at an MOI of 25–30. Thirty minutes prior to each TEER measurement, MEM clear media was added apically to polarized CFBE41o- and returned to incubation at 37°C with 5% CO2. After each TEER measurement time point, the apical media was removed and cells were allowed to incubate at 37°C with 5% CO2 until 30 minutes prior to the next TEER reading. Interleukin 8 (IL-8) secretion was measured by enzyme-linked immunosorbent assay (ELISA; R&D Systems, Minneapolis, MN). Additional details about the CFBE41o- cells and the ELISA are in the Key resources table.
Whole genome sequencing of longitudinal P. aeruginosa isolates
Whole genome sequencing was performed on all isolates from six study participants. The six participants were chosen based on their having more than six P. aeruginosa isolates in our collection, from more than three study visits. Genomic DNA from all P. aeruginosa isolates from patients 9, 24, 32, 33, 41, and 52 was extracted using a QIAgen DNeasy kit (QIAGEN, Hilden, Germany). All samples were sequenced to at least 80-fold mean read coverage on an Illumina NextSeq 500. Reads were trimmed using Trimmomatic version 0.36(Bolger et al., 2014) in paired end mode using the following command: trimmomatic PE -phred33 -threads 4 -trimlog trim.log /path/to/read1.fastq.gz /path/to/read2.fastq.gz/path/to/forward_paired.fq.gz/path/to/forward_unpaired.fq.gz/path/to/reverse_paired.fq.gz/path/to/reverse_unpaired.fq.gz ILLUMINACLIP:/path/to/adapters/NexteraPE-PE.fa:2:30:10 LEADING:20 TRAILING:20 SLIDINGWINDOW:4:20 MINLEN:70 Reads shorter than 70 nucleotides were removed, and trimmed reads were quality checked with FastQC version 0.11.5 (Andrews, 2013), using the following command: fastqc /path/to/forward_paired.fq.gz /path/to/forward_unpaired.fq.gz /path/to/reverse_paired.fq.gz /path/to/reverse_unpaired.fq.gz -o /path/to/output/directory -t 8 The earliest isolate from each of the six participants was additionally sequenced on a MinION (Oxford Nanopore Technologies) and Guppy was used to call bases and trim barcodes with the following command: guppy_basecaller–input_path /path/to/raw/nanopore/–save_path /path/to/save/base-called/files/–flowcell FLO-MIN106–kit SQK-LSK109–cpu_threads_per_caller 4–num_callers 4–barcode_kits “EXP-NBD104”–trim_barcodes The accession number for the BioProject containing all short and long reads from P. aeruginosa isolates and the urls for trimmomatic, FastQC, and guppy are listed in the Key resources table.
Hybrid genome assembly of reference isolates, assembly of subsequent isolates, genome annotation, and phylogenetic analyses
We de novo assembled the genome of the first P. aeruginosa sinus isolate from each participant, using both Illumina short read and Oxford Nanopore long reads to create a hybrid assembly as a reference genome for each of the six study participants’ lineages (Table 2). To create a separate P. aeruginosa reference isolate for each person, reads were de novo assembled using Unicycler version 0.4.4 in conservative mode (Wick et al., 2017), using the following command: unicycler −1 /path/to/trimmed/Illumina_forward_paired.fq.gz −2 /path/to/trimmed/Illumina_reverse_paired.fq.gz -s /path/to/trimmed/Illumina_forward_unpaired.fq.gz -l /path/to/long/reads/nanopore.fastq -o /path/to/desired/output/unicycler_assembly -t 16–mode conservative–keep 2 All Illumina-only sequenced subsequent isolates were assembled using SPAdes version 3.11.0 (Bankevich et al., 2012) with the following command: spades.py -o /path/to/desired/output/directory/–careful–pe1–1 /path/to/trimmed/reads/forward_paired.fq.gz–pe1–2 /path/to/trimmed/reads/reverse_paired.fq.gz–pe1 s /path/to/trimmed/reads/forward_unpaired.fq.gz -k 21,33,55,77,99 Contigs shorter than 1 kB were removed from unicycler and SPAdes assemblies, and the assemblies were quality checked with QUAST version 4.3 (Gurevich et al., 2013), using the following command: quast.py -o /path/to/output/directory/ -l spades21,spades33,spades77,spades55simple,spades55final,spades99,contigs,scaffolds /path/to/K21/simplified_contigs.fasta /path/to/K33/simplified_contigs.fasta /path/to/K77/simplified_contigs.fasta /path/to/K55/simplified_contigs.fasta /path/to/K55/final_contigs.fasta /path/to/K99/simplified_contigs.fasta /path/to/contigs.fasta /path/to/scaffolds.fasta Any isolates with fewer than 95% mapped reads in the breseq analysis described below were examined for evidence of contamination using SprayNPray (Garber et al., 2021a) using the following command: spray-and-pray.py -g isolate_ID.fna -ref nr.faa–makedb–out isolate_ID.csv -t 16 -species aeruginosa -genus Pseudomonas -Class Gammaproteobacteria -phylum Proteobacteria -domain Bacteria -perc 50 SprayNPray identifies contigs with comparatively low coverage, BLASTp searches each gene on each contig in its SPAdes assembly against RefSeq (O’Leary et al., 2016) to determine if the most common top hit is from a species other than P. aeruginosa, and examines the average GC content of the contig. Contaminating contigs were removed from five isolates prior to running prokka and roary: P32_36, P32_85, P32_108, P41_47, and P41_119. All assemblies were annotated with prokka version 1.14.6 (Seemann, 2014) using the following command: prokka–center X–force–locustag x–outdir /path/to/desired/output/directory/prokka–prefix desired_isolate_ID–gffver 3–cpus 16 /path/to/contigs.fa Core genome SNPs were identified by aligning genes in prokka-generated .gff files using roary (Tange, 2011; Page et al., 2015) version 3.12.0 with the following command: roary -e–mafft -p 8 -f /path/to/desired/roary/output/directory/ /path/to/directory/with/all/prokka_gffs/*.gff A phylogenetic tree was constructed from the core_gene_alignment.aln file with RAxML version 8.2.4 (Stamatakis, 2014) using the following command: raxmlHPC-PTHREADS -x 2421 -f a -m GTRGAMMA -n name_of_output_tree.txt -p 748 -s /path/to/roary/core_gene_alignment.aln -T 16 -w /path/to/output/directory -N 100 The accession numbers for reference genomes and the urls for the nr database, SPAdes, SprayN-Pray, prokka, roary, and RAxML are located in the Key resources table.
Identification of mutations in longitudinal collections of P. aeruginosa isolates
We used breseq version 0.31.0 (Deatherage and Barrick, 2014) in consensus mode to identify mutations in each person’s subsequent isolates relative to their de novo, hybrid-assembled reference genome (first isolate)’s prokka-generated .gbk file, using the following command: breseq -r /path/to/hybrid/assembled/prokka/annotated/reference.gbk -j 10–consensus-minimum-coverage-each-strand 4 /path/to/isolate/trimmed/reads/forward_paired.fq.gz /path/to/isolate/trimmed/reads/forward_unpaired.fq.gz /path/to/isolate/trimmed/reads/reverse_paired.fq.gz /path/to/isolate/trimmed/reads/reverse_unpaired.fq.gz -o /path/to/desired/output/directory/ The optional flag–consensus-minimum-coverage-each-strand 4 was used to exclude mutations supported by very few reads. All mutations were manually inspected and curated to remove false positives due to misaligned reads. The plots in Figures 3A and 3B were made by aligning open reading frames with BLASTn using EasyFig version 2.2.2 (Sullivan et al., 2011). In Table 2, the number of mutations includes SNPs, insertions and deletions, but not genomic rearrangements (“Unassigned new junction evidence” in breseq) or putative deletions that were called as “Unassigned missing coverage evidence” in breseq. The range of mutations represents the smallest and largest number of mutations that a single isolate had, relative to the reference isolate from that same patient. The number of transposases in lab strains was determined based on the functional name from InterProScan (Blum et al., 2021) on pseudomonas.com (Winsor et al., 2016) and the number of unique transposases was based on InterPro accession number/annotation. For ORFs that were assigned multiple transposase InterPro accession numbers, the annotation with the lowest Expect value (E) from a BLAST alignment was chosen. The urls for breseq and EasyFig are located in the Key resources table.
Comparison of core and accessory genomic contents between six whole genome sequenced lineages of P. aeruginosa
We used the command anvi-script-FASTA-to-contigs-db in anvi’o version 5.5.0 (Eren et al., 2015) to create a contigs database containing the 6 hybrid-assembled reference isolates and the lab strain PAO1. The genomes were annotated with functional categories (Cluster of Orthologous Genes; COG) using anvi-run-ncbi-cogs with the optional flag–search-with blastp. Following generation of a genome storage profile with anvi-gen-genomes-storage, a pangenome analysis was performed with anvi-pan-genome using the following flags:–mcl-inflation 8–use-ncbi-blast. Each strain’s unique accessory genes (gene clusters that were not present in any other clinical isolate or PAO1) were defined by a bin and bins were exported using anvi-summarize. The dot plot of counts of unique accessory genes per COG category was produced using DotPlot.R in the software package FeGenie (Garber et al., 2020). The phylogenetic tree overlaid on the anvi’o gene cluster dendogram depicts the core genome SNP distance (from roary) and was built with RAxML using the GTRGAMMA model with 100 bootstraps and imported into anvi’o using the anvi-import-misc-data function. The urls for anvi’o and FeGenie are located in the Key resources table.
Identification of pseudogenes
Pseudogenes and gene fragmentations were identified using Pseudofinder (Syberg-Olsen et al., 2021), using the following command: pseudofinder.py sleuth -g isolate_ID.fna -rn PAO1.ffn -rg PAO1.gff-out isolate_ID -t 16 -id 90 -e 1E-10 -l 0.75 Pseudofinder’s ‘Sleuth’ module was used to identify pseudogenes by querying (using BLASTN, e-value cutoff of 1E-5) reference gene sequences (PAO1 for most lineages, PA14 for Patient 33’s isolates) against each isolate genome. Pseudogenes were defined as 1) genes lacking a start codon 2) genes with frameshift mutations that significantly altered the resulting protein sequence, 3) genes that have an internal stop codon truncating the gene to less than 75% of its original length, or 4) genes lacking a stop codon, resulting in a runon gene that is more than 125% its original length. Pseudofinder’s ‘Annotate’ module was used to identify gene fragmentations by querying each isolate’s protein sequences (using BLASTP, e-value cutoff of 1E-5) against a reference genome (PAO1 for most lineages, PA14 for Patient 33’s isolates), and calculating each gene’s length relative to the length of its most closely related homolog. In Figure 5A, virulence genes were identified based on annotation of the PAO1 and PA14 genomes on pseudomonas.com. The url for Pseudofinder is located in the Key resources table.
MiPACT-HCR Sample Processing
Two sinus samples (each from separate visit dates) were analyzed for Patients 32 and 33, whereas the other four patients each had one sinus sample analyzed. Samples were processed for MiPACT-HCR as described (DePas et al., 2016) with minor alterations. Briefly, sinus biofilm samples that had been fixed in either 10% formalin or RNAlater were incubated overnight in B4P1 (4% (vol/vol) 29:1 acrylamide:bis-acrylamide, 1% (vol/vol) paraformaldehyde, and 0.25% (wt/vol) VA-044 hardener in 1 3 PBS), made fresh and filter sterilized. B4P1 solution was then refreshed and the sample was polymerized for 3 hours in a 37°C water bath under vacuum to prevent oxygen exposure. After polymerization, samples were trimmed with a sterile razorblade to ∼5mm diameter. Samples were then incubated for 30 minutes, shaking at room temperature in 0.1 methylimidazole buffer pH 8.5 and fixed in EDC for 1 hour in a 37°C water bath to further preserve RNA (Sylwestrak et al., 2016). Samples were then cleared for 2–3 days in a clearing chamber (Greenbaum et al., 2017) with 8% SDS pH 8.0 in 1X PBS. After clearing, samples were cut into smaller ∼1mm diameter pieces and incubated in 1 mL of Molecular Instruments probe hybridization buffer with 30 nM of initiator probes in a 46°C water bath for 48 hours. Samples were washed with Molecular Instruments probe hybridization wash buffer in a 50°C water bath for 3 hours, and amplification was performed in Molecular Instruments amplification buffer with the appropriate hairpin sets at room temperature, shaking, for 48 hours (DePas et al., 2016). The P. aeruginosa HCR probe mix contained B1 overhangs and was used with B1 hairpins conjugated to Alexafluor-546. The universal and nonspecific probes contained B4 overhangs and were used with B4 hairpins conjugated to Alexafluor-488. Samples were washed in 337.5 mM NaCl wash buffer (DePas et al., 2016) for 1 hour in a 46°C water bath and then incubated in RIMS + 1 μg/mL DAPI, with shaking, at room temperature overnight. Samples were then imaged in RIMS on a Leica SP8 confocal microscope with a HC PL APO 20x/0.70 NA CS objective or a HC PL APO 63x/1.40 NA Oil CS2 objective or on a Zeiss 710 confocal microscope with a Pln Apo 20x/0.80 NA DICII objective. Cultured cell controls were prepared and processed as described (DePas et al., 2016).
MiPACT-HCR Image Analysis
For each sample, ten random fields of view were analyzed and the Patient ID for each sample was blinded during imaging. Images were analyzed using Imaris 9.7.2 (additional information located in the Key resources table). P. aeruginosa HCR-identified objects were converted to surfaces and the volume of each surface was calculated. Only surfaces with volumes > 1.0 μm3 (pre-corrected) were counted. For distance measurements, an ImarisXT surfaces-to-spots Xtension was used to create spots from each surface. The average distance of each spot to the five closest spots was then calculated. Sequences of probes are listed in the Key resources table of the STAR Methods. The EUB338 FISH probe (Amann et al., 1990) was dilabeled with Alexafluor-546, with one fluorophore at the 5′ end and one at the 3′ end. Two HCR initiator/hairpin systems were used in this study: B1 and B4. For Pseudomonas B1 initiator probes, 5′-TATAGCATTCTTTCTTGAGGAGGGCAGCAAACGGGAAGAG-3′ was added to the 3′ end of the indicated DNA probe. For EUB338, NON338, Universal 515, and anti-Universal 515 B4 initiator probes, 5′-ATTTCACATTTACAGACCTCAACCTACCTCC AACTCTCAC-3′ was added to the 3′ end of the indicated DNA probe and 5′-CCTCAACCTACCTCCAACTCTCACCATATTCGCTTCT AAAA-3′ was added to the 5′ end of the indicated DNA probe. DNA hairpins conjugated to either AlexaFluor-488 or AlexaFluor-546, as indicated (Molecular Instruments), were used with the appropriate initiator probe sets.
We verified that our P. aeruginosa probe set (Amann et al., 1996; Hogardt et al., 2000; Watt et al., 2006) did not bind to a different species (Staphylococcus aureus MN8) in vitro, that nonspecific probes (NON338 (Wallner et al., 1993) and anti-Universal 515) did not result in appreciable signal in situ, and that a general bacterial probe mix (EUB338 and Universal 515; Nadkarni et al., 2002) also bound objects identified by the P. aeruginosa probe set in situ. PACT processing can result in tissue swelling (Yang et al., 2014). Additionally, imaging at low magnification (with a lower NA) can decrease resolution and increase apparent size. To determine if apparent bacterial cell size was affected by MiPACT-HCR processing and low magnification imaging, we calculated the size distribution of stationary phase P. aeruginosa PA14 after fixation and embedding in B4P1 either 1.) using FISH (with a EUB338 probe), with a 63× 1.40 NA objective, after no SDS clearing or 2.) using HCR (with a EUB338 probe), with a 20× 0.80 NA objective, after 3 days of SDS clearing. The average cell size of condition 1 was 2.96 μm3 and of condition 2 was 8.21 μm3. To correct for the increased apparent size using MiPACT-HCR, all volumes were divided by 2.77 (8.21/2.96). To determine how 3D swelling affects linear distance measurements, we assumed a spherical volume for stationary phase cells and used d = (6*(V/π))1/3 to calculate the diameters of spherical objects with volumes of 2.96 μm3 (1.78 μm diameter) and 8.21 μm3 (2.50 μm diameter). A corrective value of 1.40 (2.50/1.78) was therefore applied to all distance measurements. Additional details for all probes used for MiPACT-HCR imaging are included in the Key resources table.
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical analyses were performed with GraphPad Prism version 9.1.2 or in RStudio version 1.1.456. Information on statistical tests is provided in the figure legends. Data are presented as mean ± SD, unless otherwise indicated in the figure legend. All experiments were performed on a minimum of three biological replicates unless otherwise noted in the methods and statistical significance was determined with α = 0.05. For experiments with bacteria or human cell lines, biological replicates were defined as experiments performed on separate experimental days and/or with different passages of CFBE41o- cells.
Supplementary Material
Highlights.
Selection favors P. aeruginosa mutations that promote aggregation in the CF sinuses
Aggregation and bottlenecks fragment populations, amplifying effects of genetic drift
Mutators persist in small populations and drive early genome degradation
Population size and infection-site biogeography impact evolutionary trajectories
ACKNOWLEDGMENTS
We thank the people with CF who participated in our study and contributed to this research. We also thank Dr. Daria Van Tyne and Dr. Megan Kiedrowski for helpful discussion and assistance during the study. This work was supported by a Cystic Fibrosis Foundation (CFF) Carol Basbaum Memorial Research Fellowship (ARMBRU19F0) and National Institutes of Health (NIH) grant T32HL129949 to C.R.A.; NIH grant T32AI049820 and CFF grant MELVIN15F0 to J.A.M.; CFF grant ZEMKE16A0 and NIH grant 5K23HL131930 to A.C.Z.; NIH grant T32AI060525 and CFF grant ZAMORA20F0 to P.F.Z.; NIH grant T35DK065521 to I.L.F.; NIH grant R01HL138630 to A.M.; UPMC Children’s Hospital of Pittsburgh Research Advisory Committee Start-up Grant to W.H.D.; NIH grant R21HL143091 to B.A.M.; University of Pittsburgh CTSI Pilot Program and NIH NCATS grant UL1 TR0000005 to S.E.L. and J.M.B.; NIH grant R61HL137077 and GILEAD Investigator Sponsored Research Award to S.E.L., V.S.C., and J.M.B.; NIH grant U01AI124302 to V.S.C.; and NIH grants R01HL123771 and P30DK072506 and CFF grants BOMBER14G0 and RDP BOMBER19R0 to J.M.B. The graphical abstract was made using BioRender.com.
Footnotes
DECLARATION OF INTERESTS
V.S.C. is a founder of Microbial Genome Sequencing Center, LLC (MiGS) and is a scientific advisor for MiGS.
SUPPLEMENTAL INFORMATION
Supplemental information can be found online at https://doi.org/10.1016/j.celrep.2021.109829.
REFERENCES
- Aanæs K (2013). Bacterial sinusitis can be a focus for initial lung colonisation and chronic lung infection in patients with cystic fibrosis. J. Cyst. Fibros.12 (Suppl2), S1–S20. [DOI] [PubMed] [Google Scholar]
- Alanin MC, Aanaes K, Høiby N, Pressler T, Skov M, Nielsen KG, Taylor-Robinson D, Waldmann E, Krogh Johansen H, and von Buchwald C (2016). Sinus surgery postpones chronic Gram-negative lung infection: cohort study of 106 patients with cystic fibrosis. Rhinology 54, 206–213. [DOI] [PubMed] [Google Scholar]
- Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, and Stahl DA (1990). Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56, 1919–1925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Amann R, Ludwig W, Schulze R, Spring S, Moore E, and Schleifer K-H (1996). rRNA-Targeted Oligonucleotide Probes for the Identification of Genuine and Former Pseudomonads. Syst. Appl. Microbiol. 19, 501–509. [Google Scholar]
- Andrews S (2013). FastQC. GitHub repository. https://github.com/csf-ngs/fastqc. [Google Scholar]
- Armbruster CR, Coenye T, Touqui L, and Bomberger JM (2020). Interplay between host-microbe and microbe-microbe interactions in cystic fibrosis. J. Cyst. Fibros.19(Suppl1), S47–S53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, et al. (2012). SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 19, 455–477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bartell JA, Sommer LM, Haagensen JAJ, Loch A, Espinosa R, Molin S, and Johansen HK (2019). Evolutionary highways to persistent bacterial infection. Nat. Commun. 10, 629. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bartell JA, Sommer LM, Marvig RL, Skov M, Pressler T, Molin S, and Johansen HK (2021). Omics-based tracking of Pseudomonas aeruginosa persistence in”eradicated” cystic fibrosis patients. Eur. Respir. J. 57, 2000512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bjarnsholt T, Alhede M, Alhede M, Eickhardt-Sørensen SR, Moser C, Kühl M, Jensen PØ, and Høiby N (2013). The in vivo biofilm. Trends Microbiol. 21, 466–474. [DOI] [PubMed] [Google Scholar]
- Blum M, Chang HY, Chuguransky S, Grego T, Kandasaamy S, Mitchell A, Nuka G, Paysan-Lafosse T, Qureshi M, Raj S, et al. (2021). The Inter-Pro protein families and domains database: 20 years on. Nucleic Acids Res.49 (D1), D344–D354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bobay L-M, and Ochman H (2018). Factors driving effective population size and pan-genome evolution in bacteria. BMC Evol. Biol. 18, 153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boles BR, and Singh PK (2008). Endogenous oxidative stress produces diversity and adaptability in biofilm communities. Proc. Natl. Acad. Sci. USA 105, 12503–12508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bolger AM, Lohse M, and Usadel B (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bomar L, Brugger SD, and Lemon KP (2018). Bacterial microbiota of the nasal passages across the span of human life. Curr. Opin. Microbiol. 41, 8–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bonestroo HJC, de Winter-de Groot KM, van der Ent CK, and Arets HGM (2010). Upper and lower airway cultures in children with cystic fibrosis: do not neglect the upper airways. J. Cyst. Fibros. 9, 130–134. [DOI] [PubMed] [Google Scholar]
- Boutin S, and Dalpke AH (2017). Acquisition and adaptation of the airway microbiota in the early life of cystic fibrosis patients. Mol. Cell Pediatr. 4, 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burke GR, and Moran NA (2011). Massive genomic decay in Serratia symbiotica, a recently evolved symbiont of aphids. Genome Biol. Evol. 3, 195–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Campbell MA, Łukasik P, Simon C, and McCutcheon JP (2017). Idiosyncratic Genome Degradation in a Bacterial Endosymbiont of Periodical Cicadas. Curr. Biol. 27, 3568–3575.e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chaaban MR, Kejner A, Rowe SM, and Woodworth BA (2013). Cystic fibrosis chronic rhinosinusitis: a comprehensive review. Am. J. Rhinol. Allergy 27, 387–395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chu ND, Clarke SA, Timberlake S, Polz MF, Grossman AD, and Alm EJ (2017). A Mobile Element in mutS Drives Hypermutation in a Marine Vibrio. MBio 8, e02045–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ciofu O, Riis B, Pressler T, Poulsen HE, and Høiby N (2005). Occurrence of hypermutable Pseudomonas aeruginosa in cystic fibrosis patients is associated with the oxidative stress caused by chronic lung inflammation. Antimicrob. Agents Chemother. 49, 2276–2282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ciofu O, Johansen HK, Aanaes K, Wassermann T, Alhede M, von Buchwald C, and Høiby N (2013). P. aeruginosa in the paranasal sinuses and transplanted lungs have similar adaptive mutations as isolates from chronically infected CF lungs. J. Cyst. Fibros. 12, 729–736. [DOI] [PubMed] [Google Scholar]
- Colque CA, Albarracín Orio AG, Feliziani S, Marvig RL, Tobares AR, Johansen HK, Molin S, and Smania AM (2020). Hypermutator Pseudomonas aeruginosa Exploits Multiple Genetic Pathways To Develop Multidrug Resistance during Long-Term Infections in the Airways of Cystic Fibrosis Patients. Antimicrob. Agents Chemother. 64, e02142–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cooper VS, Schneider D, Blot M, and Lenski RE (2001). Mechanisms causing rapid and parallel losses of ribose catabolism in evolving populations of Escherichia coli B. J. Bacteriol. 183, 2834–2841. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cope EK, Goldberg AN, Pletcher SD, and Lynch SV (2017). Compositionally and functionally distinct sinus microbiota in chronic rhinosinusitis patients have immunological and clinically divergent consequences. Microbiome 5, 53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cramer N, Klockgether J, Wrasman K, Schmidt M, Davenport CF, and Tümmler B (2011). Microevolution of the major common Pseudomonas aeruginosa clones C and PA14 in cystic fibrosis lungs. Environ. Microbiol. 13, 1690–1704. [DOI] [PubMed] [Google Scholar]
- D’Argenio DA, Wu M, Hoffman LR, Kulasekara HD, Déziel E, Smith EE, Nguyen H, Ernst RK, Larson Freeman TJ, Spencer DH, et al. (2007). Growth phenotypes of Pseudomonas aeruginosa lasR mutants adapted to the airways of cystic fibrosis patients. Mol. Microbiol. 64, 512–533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- D’Souza G, Waschina S, Pande S, Bohl K, Kaleta C, and Kost C (2014). Less is more: selective advantages can explain the prevalent loss of biosynthetic genes in bacteria. Evolution 68, 2559–2570. [DOI] [PubMed] [Google Scholar]
- Darch SE, Simoska O, Fitzpatrick M, Barraza JP, Stevenson KJ, Bonnecaze RT, Shear JB, and Whiteley M (2018). Spatial determinants of quorum signaling in a Pseudomonas aeruginosa infection model. Proc. Natl Acad. Sci. USA 115, 4779–4784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- De Boeck K, Lee T, Amaral M, Drevinek P, Elborn JS, Fajac I, Kerem E, and Davies JC (2020). Cystic fibrosis drug trial design in the era of CFTR modulators associated with substantial clinical benefit: stakeholders’ consensus view. J. Cyst. Fibros. 19, 688–695. [DOI] [PubMed] [Google Scholar]
- Deatherage DE, and Barrick JE (2014). Identification of mutations in laboratory-evolved microbes from next-generation sequencing data using breseq. Methods Mol. Biol. 1151, 165–188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- DePas WH, Starwalt-Lee R, Van Sambeek L, Kumar SR, Gradinaru V, and Newman DK (2016). Exposing the Three-Dimensional Biogeography and Metabolic States of Pathogens in Cystic Fibrosis Sputum via Hydrogel Embedding, Clearing, and rRNA Labeling. mBio 7, e00796–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Déziel E, Comeau Y, and Villemur R (2001). Initiation of biofilm formation by Pseudomonas aeruginosa 57RP correlates with emergence of hyperpiliated and highly adherent phenotypic variants deficient in swimming, swarming, and twitching motilities. J. Bacteriol. 183, 1195–1204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Diaz Caballero J, Clark ST, Coburn B, Zhang Y, Wang PW, Donaldson SL, Tullis DE, Yau YC, Waters VJ, Hwang DM, and Guttman DS (2015). Selective Sweeps and Parallel Pathoadaptation Drive Pseudomonas aeruginosa Evolution in the Cystic Fibrosis Lung. mBio 6, e00981–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eren AM, Esen ÖC, Quince C, Vineis JH, Morrison HG, Sogin ML, and Delmont TO (2015). Anvi’o: an advanced analysis and visualization platform for ‘omics data. PeerJ 3, e1319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Essar DW, Eberly L, Hadero A, and Crawford IP (1990). Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: interchangeability of the two anthranilate synthases and evolutionary implications. J. Bacteriol. 172, 884–900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Evans JC, and Segal H (2007). A novel insertion sequence, ISPA26, in oprD of Pseudomonas aeruginosa is associated with carbapenem resistance. Antimicrob. Agents Chemother. 51, 3776–3777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feliziani S, Marvig RL, Luján AM, Moyano AJ, Di Rienzo JA, Krogh Johansen H, Molin S, and Smania AM (2014). Coexistence and within-host evolution of diversified lineages of hypermutable Pseudomonas aeruginosa in long-term cystic fibrosis infections. PLoS Genet. 10, e1004651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Folkesson A, Jelsbak L, Yang L, Johansen HK, Ciofu O, Høiby N, and Molin S (2012). Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: an evolutionary perspective. Nat. Rev. Microbiol. 10, 841–851. [DOI] [PubMed] [Google Scholar]
- Freschi L, Jeukens J, Kukavica-Ibrulj I, Boyle B, Dupont MJ, Laroche J, Larose S, Maaroufi H, Fothergill JL, Moore M, et al. (2015). Clinical utilization of genomics data produced by the international Pseudomonas aeruginosa consortium. Front. Microbiol. 6, 1036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garber AI, Nealson KH, Okamoto A, McAllister SM, Chan CS, Barco RA, and Merino N (2020). FeGenie: A Comprehensive Tool for the Identification of Iron Genes and Iron Gene Neighborhoods in Genome and Metagenome Assemblies. Front. Microbiol. 11, 37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garber AI, Armbruster CR, Lee SR, Cooper VS, Bomberger JM, and McAllister SM (2021a). SprayNPray: user-friendly taxonomic profiling of genome and metagenome contigs. bioRxiv, 2021.07.17.452725.preprint. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garber AI, Kupper M, Laetsch DR, Weldon SR, Ladinsky MS, Bjorkman PJ, and McCutcheon JP (2021b). The evolution of interdependence in a four-way mealybug symbiosis. Genome Biol. Evol. 13, evab123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gentile VG, and Isaacson G (1996). Patterns of sinusitis in cystic fibrosis. Laryngoscope 106, 1005–1009. [DOI] [PubMed] [Google Scholar]
- Giraud A, Radman M, Matic I, and Taddei F (2001). The rise and fall of mutator bacteria. Curr. Opin. Microbiol. 4, 582–585. [DOI] [PubMed] [Google Scholar]
- Greenbaum A, Chan KY, Dobreva T, Brown D, Balani DH, Boyce R, Kronenberg HM, McBride HJ, and Gradinaru V (2017). Bone CLARITY: Clearing, imaging, and computational analysis of osteoprogenitors within intact bone marrow. Sci. Transl. Med. 9, 387. [DOI] [PubMed] [Google Scholar]
- Gurevich A, Saveliev V, Vyahhi N, and Tesler G (2013). QUAST: quality assessment tool for genome assemblies. Bioinformatics 29, 1072–1075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Güvener ZT, and Harwood CS (2007). Subcellular location characteristics of the Pseudomonas aeruginosa GGDEF protein, WspR, indicate that it produces cyclic-di-GMP in response to growth on surfaces. Mol. Microbiol. 66, 1459–1473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hansen SK, Rau MH, Johansen HK, Ciofu O, Jelsbak L, Yang L, Folkesson A, Jarmer HØ, Aanæs K, von Buchwald C, et al. (2012). Evolution and diversification of Pseudomonas aeruginosa in the paranasal sinuses of cystic fibrosis children have implications for chronic lung infection. ISME J. 6, 31–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harrison JJ, Almblad H, Irie Y, Wolter DJ, Eggleston HC, Randall TE, Kitzman JO, Stackhouse B, Emerson JC, Mcnamara S, et al. (2020). Elevated exopolysaccharide levels in Pseudomonas aeruginosa flagellar mutants have implications for biofilm growth and chronic infections. PLoS Genet. 16, e1008848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Held K, Ramage E, Jacobs M, Gallagher L, and Manoil C (2012). Sequence-verified two-allele transposon mutant library for Pseudomonas aeruginosa PAO1. J. Bacteriol. 194, 6387–6389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heltshe SL, Khan U, Beckett V, Baines A, Emerson J, Sanders DB, Gibson RL, Morgan W, and Rosenfeld M (2018). Longitudinal development of initial, chronic and mucoid Pseudomonas aeruginosa infection in young children with cystic fibrosis. J. Cyst. Fibros. 17, 341–347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hendricks MR, Lashua LP, Fischer DK, Flitter BA, Eichinger KM, Durbin JE, Sarkar SN, Coyne CB, Empey KM, and Bomberger JM (2016). Respiratory syncytial virus infection enhances Pseudomonas aeruginosa biofilm growth through dysregulation of nutritional immunity. Proc. Natl. Acad. Sci. USA 113, 1642–1647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hoboth C, Hoffmann R, Eichner A, Henke C, Schmoldt S, Imhof A, Heesemann J, and Hogardt M (2009). Dynamics of adaptive microevolution of hypermutable Pseudomonas aeruginosa during chronic pulmonary infection in patients with cystic fibrosis. J. Infect. Dis. 200, 118–130. [DOI] [PubMed] [Google Scholar]
- Hogardt M, Trebesius K, Geiger AM, Hornef M, Rosenecker J, and Heesemann J (2000). Specific and rapid detection by fluorescent in situ hybridization of bacteria in clinical samples obtained from cystic fibrosis patients. J. Clin. Microbiol. 38, 818–825. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hogardt M, Hoboth C, Schmoldt S, Henke C, Bader L, and Heesemann J (2007). Stage-specific adaptation of hypermutable Pseudomonas aeruginosa isolates during chronic pulmonary infection in patients with cystic fibrosis. J. Infect. Dis. 195, 70–80. [DOI] [PubMed] [Google Scholar]
- Holloway BW (1955). Genetic Recombination in Pseudomonas aeruginosa. Microbiology, Published online December 1, 1995. 10.1099/00221287-13-3-572. [DOI] [PubMed] [Google Scholar]
- Huse HK, Kwon T, Zlosnik JEA, Speert DP, Marcotte EM, and Whiteley M (2010). Parallel Evolution in Pseudomonas aeruginosa over 39,000 Generations In Vivo. mBio 1, e00199–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Johansen HK, Aanaes K, Pressler T, Nielsen KG, Fisker J, Skov M, Høiby N, and von Buchwald C (2012). Colonisation and infection of the paranasal sinuses in cystic fibrosis patients is accompanied by a reduced PMN response. J. Cyst. Fibros. 11, 525–531. [DOI] [PubMed] [Google Scholar]
- Jorth P, Staudinger BJ, Wu X, Hisert KB, Hayden H, Garudathri J, Harding CL, Radey MC, Rezayat A, Bautista G, et al. (2015). Regional Isolation Drives Bacterial Diversification within Cystic Fibrosis Lungs. Cell Host Microbe 18, 307–319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kirchberger PC, Schmidt ML, and Ochman H (2020). The Ingenuity of Bacterial Genomes. Annu. Rev. Microbiol. 74, 815–834. [DOI] [PubMed] [Google Scholar]
- Köhler T, Curty LK, Barja F, van Delden C, and Pechère JC (2000). Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J. Bacteriol. 182, 5990–5996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kresse AU, Dinesh SD, Larbig K, and Römling U (2003). Impact of large chromosomal inversions on the adaptation and evolution of Pseudomonas aeruginosa chronically colonizing cystic fibrosis lungs. Mol. Microbiol. 47, 145–158. [DOI] [PubMed] [Google Scholar]
- Kresse AU, Blöcker H, and Römling U (2006). ISPa20 advances the individual evolution of Pseudomonas aeruginosa clone C subclone C13 strains isolated from cystic fibrosis patients by insertional mutagenesis and genomic rearrangements. Arch. Microbiol. 185, 245–254. [DOI] [PubMed] [Google Scholar]
- Kuo C-H, and Ochman H (2010). The extinction dynamics of bacterial pseudogenes. PLoS Genet. 6, e1001050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee TWR, Brownlee KG, Conway SP, Denton M, and Littlewood JM (2003). Evaluation of a new definition for chronic Pseudomonas aeruginosa infection in cystic fibrosis patients. J. Cyst. Fibros. 2, 29–34. [DOI] [PubMed] [Google Scholar]
- Lerat E, and Ochman H (2005). Recognizing the pseudogenes in bacterial genomes. Nucleic Acids Res. 33, 3125–3132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lucas SK, Yang R, Dunitz JM, Boyer HC, and Hunter RC (2018). 16S rRNA gene sequencing reveals site-specific signatures of the upper and lower airways of cystic fibrosis patients. J. Cyst. Fibros. 17, 204–212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mainz JG, Naehrlich L, Schien M, Käding M, Schiller I, Mayr S, Schneider G, Wiedemann B, Wiehlmann L, Cramer N, et al. (2009). Concordant genotype of upper and lower airways P aeruginosa and S aureus isolates in cystic fibrosis. Thorax 64, 535–540. [DOI] [PubMed] [Google Scholar]
- Mainz JG, Michl R, Pfister W, and Beck JF (2011). Cystic fibrosis upper airways primary colonization with Pseudomonas aeruginosa: eradicated by sinonasal antibiotic inhalation. Am. J. Respir. Crit. Care Med. 184, 1089–1090. [DOI] [PubMed] [Google Scholar]
- Marvig RL, Johansen HK, Molin S, and Jelsbak L (2013). Genome analysis of a transmissible lineage of pseudomonas aeruginosa reveals pathoadaptive mutations and distinct evolutionary paths of hypermutators. PLoS Genet. 9, e1003741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McCutcheon JP, and Moran NA (2011). Extreme genome reduction in symbiotic bacteria. Nat. Rev. Microbiol. 10, 13–26. [DOI] [PubMed] [Google Scholar]
- McCutcheon JP, Boyd BM, and Dale C (2019). The Life of an Insect Endosymbiont from the Cradle to the Grave. Curr. Biol. 29, R485–R495. [DOI] [PubMed] [Google Scholar]
- Merhej V, Royer-Carenzi M, Pontarotti P, and Raoult D (2009). Massive comparative genomic analysis reveals convergent evolution of specialized bacteria. Biol. Direct 4, 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Montanari S, Oliver A, Salerno P, Mena A, Bertoni G, Tümmler B, Cariani L, Conese M, Döring G, and Bragonzi A (2007). Biological cost of hypermutation in Pseudomonas aeruginosa strains from patients with cystic fibrosis. Microbiology (Reading) 153, 1445–1454. [DOI] [PubMed] [Google Scholar]
- Moran NA (1996). Accelerated evolution and Muller’s rachet in endosymbiotic bacteria. Proc. Natl. Acad. Sci. USA 93, 2873–2878. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moran NA, and Plague GR (2004). Genomic changes following host restriction in bacteria. Curr. Opin. Genet. Dev. 14, 627–633. [DOI] [PubMed] [Google Scholar]
- Muhlebach MS, Zorn BT, Esther CR, Hatch JE, Murray CP, Turkovic L, Ranganathan SC, Boucher RC, Stick SM, and Wolfgang MC (2018). Initial acquisition and succession of the cystic fibrosis lung microbiome is associated with disease progression in infants and preschool children. PLoS Pathog. 14, e1006798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nadkarni MA, Martin FE, Jacques NA, and Hunter N (2002). Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology (Reading) 148, 257–266. [DOI] [PubMed] [Google Scholar]
- Nelson J, Karempelis P, Dunitz J, Hunter R, and Boyer H (2018). Pulmonary aspiration of sinus secretions in patients with cystic fibrosis. Int. Forum Allergy Rhinol. 8, 385–388. [DOI] [PubMed] [Google Scholar]
- O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako-Adjei D, et al. (2016). Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 44, D733–D745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oakeson KF, Gil R, Clayton AL, Dunn DM, von Niederhausern AC, Hamil C, Aoyagi A, Duval B, Baca A, Silva FJ, et al. (2014). Genome degeneration and adaptation in a nascent stage of symbiosis. Genome Biol. Evol. 6, 76–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oliver A (2010). Mutators in cystic fibrosis chronic lung infection: Prevalence, mechanisms, and consequences for antimicrobial therapy. Int. J. Med. Microbiol. 300, 563–572. [DOI] [PubMed] [Google Scholar]
- Oliver A, and Mena A (2010). Bacterial hypermutation in cystic fibrosis, not only for antibiotic resistance. Clin. Microbiol. Infect. 16, 798–808. [DOI] [PubMed] [Google Scholar]
- Oliver A, Cantón R, Campo P, Baquero F, and Blázquez J (2000). High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 288, 1251–1254. [DOI] [PubMed] [Google Scholar]
- Page AJ, Cummins CA, Hunt M, Wong VK, Reuter S, Holden MT, Fookes M, Falush D, Keane JA, and Parkhill J (2015). Roary: rapid large-scale prokaryote pan genome analysis. Bioinformatics 31, 3691–3693. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Papadopoulos D, Schneider D, Meier-Eiss J, Arber W, Lenski RE, and Blot M (1999). Genomic evolution during a 10,000-generation experiment with bacteria. Proc. Natl. Acad. Sci. USA 96, 3807–3812. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Parkhill J, Sebaihia M, Preston A, Murphy LD, Thomson N, Harris DE, Holden MT, Churcher CM, Bentley SD, Mungall KL, et al. (2003). Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat. Genet. 35, 32–40. [DOI] [PubMed] [Google Scholar]
- Pletcher SD, Goldberg AN, and Cope EK (2019). Loss of Microbial Niche Specificity Between the Upper and Lower Airways in Patients With Cystic Fibrosis. Laryngoscope 129, 544–550. [DOI] [PubMed] [Google Scholar]
- Purdy-Gibson ME, France M, Hundley TC, Eid N, and Remold SK (2015). Pseudomonas aeruginosa in CF and non-CF homes is found predominantly in drains. J. Cyst. Fibros. 14, 341–346. [DOI] [PubMed] [Google Scholar]
- Ramsey BW (1996). Management of pulmonary disease in patients with cystic fibrosis. N. Engl. J. Med. 335, 179–188. [DOI] [PubMed] [Google Scholar]
- Raynes Y, and Sniegowski PD (2014). Experimental evolution and the dynamics of genomic mutation rate modifiers. Heredity 113, 375–380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Renoz F, Foray V, Ambroise J, Baa-Puyoulet P, Bearzatto B, Mendez GL, Grigorescu AS, Mahillon J, Mardulyn P, Gala JL, et al. (2021). At the Gate of Mutualism: Identification of Genomic Traits Predisposing to Insect-Bacterial Symbiosis in Pathogenic Strains of the Aphid SymbiontSerratia symbiotica. Front. Cell. Infect. Microbiol. 11, 660007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robertson JM, Friedman EM, and Rubin BK (2008). Nasal and sinus disease in cystic fibrosis. Paediatr. Respir. Rev. 9, 213–219. [DOI] [PubMed] [Google Scholar]
- Rudkjøbing VB, Thomsen TR, Alhede M, Kragh KN, Nielsen PH, Johansen UR, Givskov M, Høiby N, and Bjarnsholt T (2012). The microorganisms in chronically infected end-stage and non-end-stage cystic fibrosis patients. FEMS Immunol. Med. Microbiol. 65, 236–244. [DOI] [PubMed] [Google Scholar]
- Sanders LH, Rockel A, Lu H, Wozniak DJ, and Sutton MD (2006). Role of Pseudomonas aeruginosa dinB-encoded DNA polymerase IV in mutagenesis. J. Bacteriol. 188, 8573–8585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schloss PD, et al. (2009). Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 75, 7537–7541. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, et al. (2009). Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Seemann T (2014). Prokka: rapid prokaryotic genome annotation. Bioinformatics 30, 2068–2069. [DOI] [PubMed] [Google Scholar]
- Sentausa E, Basso P, Berry A, Adrait A, Bellement G, Couté Y, Lory S, Elsen S, and Attrée I (2020). Insertion sequences drive the emergence of a highly adapted human pathogen. Microb. Genom. 6, mgen000265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shrout JD, Chopp DL, Just CL, Hentzer M, Givskov M, and Parsek MR (2006). The impact of quorum sensing and swarming motility on Pseudomonas aeruginosa biofilm formation is nutritionally conditional. Mol. Microbiol. 62, 1264–1277. [DOI] [PubMed] [Google Scholar]
- Smith EE, Buckley DG, Wu Z, Saenphimmachak C, Hoffman LR, D’Argenio DA, Miller SI, Ramsey BW, Speert DP, Moskowitz SM, et al. (2006). Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc. Natl. Acad. Sci. USA 103, 8487–8492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stamatakis A (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30, 1312–1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Starkey M, Hickman JH, Ma L, Zhang N, De Long S, Hinz A, Palacios S, Manoil C, Kirisits MJ, Starner TD, et al. (2009). Pseudomonas aeruginosa rugose small-colony variants have adaptations that likely promote persistence in the cystic fibrosis lung. J. Bacteriol. 191, 3492–3503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stressmann FA, Rogers GB, Marsh P, Lilley AK, Daniels TW, Carroll MP, Hoffman LR, Jones G, Allen CE, Patel N, et al. (2011). Does bacterial density in cystic fibrosis sputum increase prior to pulmonary exacerbation? J. Cyst. Fibros. 10, 357–365. [DOI] [PubMed] [Google Scholar]
- Sullivan MJ, Petty NK, and Beatson SA (2011). Easyfig: a genome comparison visualizer. Bioinformatics 27, 1009–1010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Syberg-Olsen MJ, Garber AI, Keeling PJ, McCutcheon JP, and Husnik F (2021). Pseudofinder: detection of pseudogenes in prokaryotic genomes (bioRxiv). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sylwestrak EL, Rajasethupathy P, Wright MA, Jaffe A, and Deisseroth K (2016). Multiplexed Intact-Tissue Transcriptional Analysis at Cellular Resolution. Cell 164, 792–804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tange O (2011). GNU Parallel: The Command-Line Power Tool. ;login: The USENIX Magazine 36, 42–47. [Google Scholar]
- Tenaillon O, Barrick JE, Ribeck N, Deatherage DE, Blanchard JL, Dasgupta A, Wu GC, Wielgoss S, Cruveiller S, Médigue C, et al. (2016). Tempo and mode of genome evolution in a 50,000-generation experiment. Nature 536, 165–170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vandecraen J, Chandler M, Aertsen A, and Van Houdt R (2017). The impact of insertion sequences on bacterial genome plasticity and adaptability. Crit. Rev. Microbiol. 43, 709–730. [DOI] [PubMed] [Google Scholar]
- Visca P, Colotti G, Serino L, Verzili D, Orsi N, and Chiancone E (1992). Metal regulation of siderophore synthesis in Pseudomonas aeruginosa and functional effects of siderophore-metal complexes. Appl. Environ. Microbiol. 58, 2886–2893. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vogel HJ, and Bonner DM (1956). Acetylornithinase of Escherichia coli: partial purification and some properties. J. Biol. Chem. 218, 97–106. [PubMed] [Google Scholar]
- Waine DJ, Honeybourne D, Smith EG, Whitehouse JL, and Dowson CG (2008). Association between hypermutator phenotype, clinical variables, mucoid phenotype, and antimicrobial resistance in Pseudomonas aeruginosa. J. Clin. Microbiol. 46, 3491–3493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wallner G, Amann R, and Beisker W (1993). Optimizing fluorescent in situ hybridization with rRNA-targeted oligonucleotide probes for flow cytometric identification of microorganisms. Cytometry 14, 136–143. [DOI] [PubMed] [Google Scholar]
- Walter S, Gudowius P, Bosshammer J, Römling U, Weissbrodt H, Schürmann W, von der Hardt H, and Tümmler B (1997). Epidemiology of chronic Pseudomonas aeruginosa infections in the airways of lung transplant recipients with cystic fibrosis. Thorax 52, 318–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Watt M, Hugenholtz P, White R, and Vinall K (2006). Numbers and locations of native bacteria on field-grown wheat roots quantified by fluorescence in situ hybridization (FISH). Environ. Microbiol. 8, 871–884. [DOI] [PubMed] [Google Scholar]
- Wei J, Goldberg MB, Burland V, Venkatesan MM, Deng W, Fournier G, Mayhew GF, Plunkett G 3rd, Rose DJ, Darling A, et al. (2003). Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T. Infect. Immun. 71, 2775–2786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Whiteson KL, Bailey B, Bergkessel M, Conrad D, Delhaes L, Felts B, Harris JK, Hunter R, Lim YW, Maughan H, et al. (2014). The upper respiratory tract as a microbial source for pulmonary infections in cystic fibrosis. Parallels from island biogeography. Am. J. Respir. Crit. Care Med. 189, 1309–1315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wick RR, Judd LM, Gorrie CL, and Holt KE (2017). Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 13, e1005595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson P, Lambert C, Carr SB, and Pao C (2014). Paranasal sinus pathogens in children with cystic fibrosis: do they relate to lower respiratory tract pathogens and is eradication successful? J. Cyst. Fibros. 13, 449–454. [DOI] [PubMed] [Google Scholar]
- Winsor GL, Griffiths EJ, Lo R, Dhillon BK, Shay JA, and Brinkman FSL (2016). Enhanced annotations and features for comparing thousands of Pseudomonas genomes in the Pseudomonas genome database. Nucleic Acids Res. 44, D646–D653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Winstanley C, O’Brien S, and Brockhurst MA (2016). Pseudomonas aeruginosa Evolutionary Adaptation and Diversification in Cystic Fibrosis Chronic Lung Infections. Trends Microbiol. 24, 327–337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wolter DJ, Hanson ND, and Lister PD (2004). Insertional inactivation of oprD in clinical isolates of Pseudomonas aeruginosa leading to carbapenem resistance. FEMS Microbiol. Lett. 236, 137–143. [DOI] [PubMed] [Google Scholar]
- Woolwine SC, and Wozniak DJ (1999). Identification of an Escherichia coli pepA homolog and its involvement in suppression of the algB phenotype in mucoid Pseudomonas aeruginosa. J. Bacteriol. 181, 107–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang B, Treweek JB, Kulkarni RP, Deverman BE, Chen C-K, Lubeck E, Shah S, Cai L, and, and Gradinaru V (2014). Single-cell phenotyping within transparent intact tissue through whole-body clearing. Cell 158, 945–958. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu X-J, Walker DH, Liu Y, and Zhang L (2009). Amino acid biosynthesis deficiency in bacteria associated with human and animal hosts. Infect. Genet. Evol. 9, 514–517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zemke AC, Nouraie SM, Moore J, Gaston JR, Rowan NR, Pilewski JM, Bomberger JM, and Lee SE (2019). Clinical predictors of cystic fibrosis chronic rhinosinusitis severity. Int. Forum Allergy Rhinol. 9, 759–765. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All genomic sequencing reads were deposited in NCBI’s SRA under BioProject PRJNA750353 and are publicly available as of the date of publication. Accession numbers are listed in the Key resources table.
KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial and virus strains | ||
|
| ||
| P. aeruginosa PAO1 | Matthew R. Parsek | N/A |
| P. aeruginosa FRD1 | Daniel J. Wozniak (Woolwine and Wozniak,1999) | N/A |
| P. aeruginosa FRD875 | Daniel J. Wozniak (Woolwine and Wozniak, 1999) | N/A |
| PAO1 ΔwspF | Caroline S. Harwood (Güvener and Harwood, 2007) | N/A |
| PAO1 ΔpilA | Matthew R. Parsek (Shrout et al., 2006) | N/A |
| P. aeruginosa MPAO1 | Colin Manoil (Held et al., 2012) | N/A |
| MPAO1 phzM::Tn | Colin Manoil (Held et al., 2012) | N/A |
| MPAO1 fliC::Tn | Colin Manoil (Held et al., 2012) | N/A |
|
| ||
| Critical commercial assays | ||
|
| ||
| Human IL-8/CXCL8 DuoSet ELISA | R&D Systems | DY208–05; RRID: AB_2892143 |
|
| ||
| Deposited data | ||
|
| ||
| Raw reads for 67 P. aeruginosa isolates from the paranasal sinuses of adults with CF and CRS | This study | SRA BioProject: PRJNA750353 |
| P. aeruginosa PAO1 genome | National Center for Biotechnology Information (NCBI) | BioSample Accession: SAMN02603714 |
| P. aeruginosa LESB58 genome | NCBI | BioSample Accession: SAMEA1705916 |
| P. aeruginosa PAK genome | NCBI | BioSample Accession: SAMEA1695737 |
| P. aeruginosa PA14 genome | NCBI | BioSample Accession: SAMN02603591 |
| P. aeruginosa PA7 genome | NCBI | BioSample Accession: SAMN02603435 |
| Non-redundant protein database (nr) | NCBI | https://ftp.ncbi.nih.gov/blast/db/FASTA/ |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| CFBE41o- airway cells | Laboratory of John P. Clancy | N/A |
|
| ||
| Oligonucleotides | ||
|
| ||
| EUB338: GCTGCCTCCCGTAGGAGT | Amann et al., 1990 | N/A |
| NON338: ACTCCTACGGGAGGCAGC | Wallner et al., 1993 | N/A |
| PseaerA: ggtaaccgtcccccttgc | Hogardt et al., 2000 | N/A |
| PseaerB: tctcggccttgaaacccc | Hogardt et al., 2000 | N/A |
| Pae997: tctggaaagttctcagca | Amann et al., 1996 | N/A |
| PSE227: aatccgacctaggctcatc | Watt et al., 2006 | N/A |
| Universal 515: cgtattaccgcggctgctggcac | Nadkarni et al., 2002 | N/A |
| anti-Universal 515: GTGCCAGCAGCCGCGGTAATACG | This study | N/A |
|
| ||
| Software and algorithms | ||
|
| ||
| mothur v1.35.0 | Schloss, 2009 | https://mothur.org/ |
| trimmomatic v0.36 | Bolger et al., 2014 | https://github.com/timflutre/trimmomatic |
| FastQC v0.11.5 | Andrews, 2013 | https://github.com/csf-ngs/fastqc |
| Guppy | Oxford Nanopore Technologies | https://nanoporetech.com/community |
| SPAdes v3.11.0 | Bankevich et al., 2012 | https://github.com/ablab/spades |
| unicycler v0.4.4 | Wick et al., 2017 | https://github.com/rrwick/Unicycler |
| QUAST v4.3 | Gurevich et al., 2013 | https://github.com/rrwick/Unicycler |
| SprayNPray v1.0 | Garber et al., 2021a | https://github.com/Arkadiy-Garber/SprayNPray |
| prokka v1.14.6 | Seemann, 2014 | https://github.com/tseemann/prokka |
| roary v3.13.0 | Page et al., 2015 | https://github.com/sanger-pathogens/Roary |
| RAxML v8.2.4 | Stamatakis, 2014 | https://github.com/stamatak/standard-RAxML |
| breseq v0.31.0 | Deatherage and Barrick, 2014 | https://barricklab.org/twiki/pub/Lab/ToolsBacterialGenomeResequencing/documentation/index.html |
| EasyFig v2.2.2 | Sullivan et al., 2011 | https://mjsull.github.io/Easyfig/ |
| anvi’o v5.5.0 | Eren et al., 2015 | https://github.com/merenlab/anvio |
| FeGenie v1.0 | Garber et al., 2020 | https://github.com/Arkadiy-Garber/FeGenie |
| Pseudofinder v1.0 | Syberg-Olsen et al., 2021 | https://github.com/filip-husnik/pseudofinder |
| Imaris v9.7.2 | Oxford Instruments | https://imaris.oxinst.com/ |
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.





