Skip to main content
Vaccines logoLink to Vaccines
. 2022 Jan 11;10(1):108. doi: 10.3390/vaccines10010108

Development and Properties of Francisella tularensis Subsp. holarctica 15 NIIEG Vaccine Strain without the recD Gene

Vitaly Pavlov 1,*, Galina Vakhrameeva 1, Alexander Mokrievich 1, Mikhail E Platonov 1, Galina Titareva 1, Raisa Mironova 1, Tatiana Kombarova 1, Tatiana Gapelchenkova 1, Ivan Dyatlov 1
Editor: Tohru Suzuki1
PMCID: PMC8778684  PMID: 35062769

Abstract

The genomic analysis of all subspecies F. tularensis, as found in Gen Bank NCBI, reveals the presence of genes encoding proteins like to the multifunctional RecBCD enzyme complex in E. coli and other bacteria. To date, the role of the recD gene in F. tularensis, which encodes the alpha chain of exonuclease V, in DNA metabolism processes, has not been studied either in vitro or in vivo. F. tularensis subsp. holarctica 15 NIIEG, a vaccine strain, served as the basis to create the F. tularensis 15D strain with recD deletion. The lack of the recD gene suppresses the integration of suicide plasmids with F. tularensis genome fragments into the chromosome. The modified strain showed reduced growth in vitro and in vivo. This study shows that such deletion significantly reduces the virulence of the strain in BALB/c mice.

Keywords: Francisella tularensis 15 NIIEG, recD gene, allelic exchange, in vitro and in vivo reproduction, BALB/c mice

1. Introduction

Tularemia is an acute infectious disease in humans and animals that is etiologically caused by the bacteria Francisella tularensis; humans’ high susceptibility to the pathogen makes this disease extremely dangerous for subspecies of F. tularensis subsp. tularensis (mortality rate of up to 60% in untreated cases) [1,2]. To prevent tularemia, endemic areas of Russia use a live vaccine based on the F. tularensis subsp. holarctica 15 NIIEG strain [3]. In Western Europe and North America, they use a live vaccine based on an F. tularensis LVS (live vaccine strain) in case of an emergency, which is obtained by a series of passages of F. tularensis 15 in vitro [4]. Both vaccine strains of F. tularensis have several weaknesses. The vaccine based on the 15 NIIEG strain causes adverse reactions in 6–10% of vaccinated patients [5]. The LVS strain has the same shortcomings: besides reactogenicity, the culture exhibits some dissociation during culturing [6,7]. All of this prevents the FDA from licensing a live tularemia vaccine in the USA [8].

Homologous recombination involving products of the recA gene and the multifunctional RecBCD enzyme complex is one of the factors affecting the stability of the bacterial genome [9]. The genomes of the genus Francisella contain regions encoding the RecBCD enzyme complex like to the structure of the region encoding the E. coli RecBCD enzyme complex. The amino acid sequence of the E. coli RecD protein has 40% similarity and 27% identity compared to the sequence of the RecD protein of F. tularensis subsp. holarctica. In the LVS and 15 NIIEG strains, the recD gene forms a single operon with the recB (FTL_0669) gene; genes recBD and recC(FTL_0666) are separated by an intergenic region of 71 bp [Gen Bank NCBI, CP009694.1] (Supplementary S1).

The genomes of all F. tularensis subspecies have a recD-like nucleotide sequences: FTL_0670 [Gen Bank NCBI, CP009694.1] in holarctica, FTM_0631 [Gen Bank NCBI, CP000915.1] in mediasiatica, [Gen Bank NCBI, AJ749949.2] in tularensis.

The role of recD in F. tularensis in DNA metabolism and reproduction in vitro and in vivo remains unclear. Here, we describe the construction of F. tularensis 15 NIIEG strain without recD gene and further research of its properties. recD deletion significantly reduces the ability to integrate suicide plasmids with F. tularensis genome fragments and the bacteria growth in vitro. Complementation of the deletion restores the molecular and biological properties of the modified strain.

2. Materials and Methods

Bacterial strains, plasmids, and primers. Bacterial strains and plasmids used in this study are listed in Table 1. The primers for synthesis and control of the modified regions of the F. tularensis genome are listed in Table 2.

Table 1.

Bacterial strains and plasmids used in this research.

Name Description Source or Reference
Strains
E. coli DH5α F- (φ80dlacZΔM15) recA1 endA1 gyrA96 thi-1 hsdR17(rkmk+) supE44 relA1 deoR Δ(lacZYA-argF) U169 GKPM-Obolensk * [10]
E. coli S17-1 λpir (thi pro hsdR– hsdM+ recA RP4-2-Tc::Mu-Km::Tn7(TpR SmR)) GKRM-Obolensk [11]
E. coli S17(pHVmob) AmpR, CmR, a derivative of S17-1 λpir containing pHVmob plasmid This paper
E. coli DH5α(pGM∆recD) AmpR, CmR, SucS, derivative of DH5α, pGM∆recD plasmid This paper
E. coli DH5α (pUK194) AmpR KmR derivative of DH5α containing pUK194 plasmid This paper
E. coli DH5α(pUK/recD) AmpR KmR derivative of DH5α with pUK194 plasmid, a fragment of the F. tularensis genome with the recD gene This paper
E. coli DH5α(pGM∆sodC) AmpR, CmR, SucS, derivative of DH5α containing pGM∆sodC plasmid This paper
E. coli S17(pPV∆glC) AmpR, CmR, SucS, derivative of S17-1 λpir containing pPV∆iglC plasmid, GKRM-Obolensk [11]
F. tularensis 15 NIIEG PmR, AmpR, subsp. holarctica, a vaccine strain GKPM-Obolensk
F. tularensis 15D PmR, a modified F. tularensis 15 NIIEG strain with the recDgene deleted This paper
F. tularensis 15D(pHVmob) PmR, CmR F. tularensis 15D with pHVmob plasmid This paper
F. tularensis 15(pK194) KmR, a F. tularensis 15 NIIEG strain with pK194 plasmid, This paper
F. tularensis 15D(pUK194) PmR, a F. tularensis 15D strain with pUK194 plasmid This paper
F. tularensis 15D(pUK/recD) PmR, a F. tularensis 15D with pUK/recD plasmid containing a fragment of the F. tularensis genome with the recD gene This paper
Plasmids
pC194 CmR. Replicates autonomously in F. tularensis cells [12,13,14]
pHV33 AmpR, CmR [15]
pHVmob AmpR, CmR, pHV33 plasmid containing a 1.7-kb fragment of RP4 plasmid with a mob region This paper
pGM5 AmpR, CmR, sacB. [16]
pGM∆recD AmpR, CmR, sacB, pGM5 plasmid with a modified 2.9-kb fragment of the F. tularensis 15 NIIEG genome, 603 bps deleted from the recD gene This paper
pK194 KmR, derivative of pC194 plasmid with the cat gene replaced by KmR from the mTn10Km transposon. Replicates autonomously in F. tularensis cells This paper
pUC19 AmpR [17]
pUK194 AmpR KmR cointegrate of pUC19 and pK194 plasmids at the HindIII site. This paper
pUK/recD AmpR KmR, pUK194 plasmid with a 3.5-kb fragment of the F. tularensis genome containing the recD gene This paper
pPV∆iglC AmpR, CmR, sacB, pPV plasmid with a 3.0-kb fragment of the F. tularensis 15 NIIEG genome, 545 bps deleted from the iglC gene [11]
pGM∆sodC AmpR, CmR, sacB, pGM5 plasmid with a modified 1.7-kb fragment of the F. tularensis 15 NIIEG genome, 528 bps deleted from the sodC gene This paper

* GKPM-Obolensk stands for the State Collection of Pathogenic Microorganisms and Cell.

Table 2.

Primers used in this research.

Name Sequence 5′-3′ a,b Primer Localization
For recD deletion
Amplicon upstream the recD gene
FSD AAAgtcgacTGGCAAAGATGATAGTGT forward primer with a SalI site
RBD AAAggatccTTACATAGACGGAGTAGTCT reverse primer with a BamHI site
Amplicon downstream the recD gene
FBD AAAggatccTAAGCTCAGAGAATGACAGA forward primer with a BamHI site
RSD AAAgtcgacGTGCTATCCTACCAGG reverse primer with a SalI site
Amplicon to control recD deletion
FCD GATGGTTATGGAGTTTATCGAGC forward primer
RCD TAAGAGCCTCTTTGTAGTCACGG reverse primer
For sodC deletion
Amplicon upstream the sodC gene
sodCL-F AAAgtcgacAACGACAGCATATTGCCACTCATAG forward primer with a SalI site
sodCL-R AAAggatccCACCTCCAAAATTTAGGTCATATC reverse primer with a BamHI site
Amplicon downstream the sodC gene
sodCR-F AAAggatccGTGCTAGAATGTGGTGTGGAGTTA forward primer with a BamHI site
sodCR-R AAAgtcgacCATATCAATATGACCTTTCTTTGGC reverse primer with a SalI site
Amplicon to control sodC deletion
sodC-KF CGTATCAGCTAAAGTGATAATCGGT forward primer
sodC-KR GACAAAATACTGCAACACCAACAGC reverse primer

a Primers for amplification of target fragments in the tularemia microbe chromosome designed using the F. tularensis ssp. holarctica LVS gene sequence (Gen Bank NCBI, CP009694.1). Comparative analysis showed the recBCD operons in LVS and 15 NIIEG strains to have identical nucleotide sequences, see Supplementary S2. b Lowercase refers to recognition sites for restriction enzymes.

Culture conditions. F. tularensis strains were grown at 37 °C in FT agar: per 1 L: fish meal hydrolysate 16 g, enzymatic lysate of cattle blood 4 g, a mixture of B vitamins 0.014 g, calcium pantothenate 0.014 g, magnesium sulfate 0.45 g, sodium sulphite 0.65 g, cysteine 0.4 g, glucose 6 g, agar 10 g, pH 7.2 (manufactured by the department of nutrient media SRCAMB), chocolate agar [18], or in brain heart infusion broth (BHI) (Becton–Dickinson, Franklin Lakes, NJ, USA), and FTB broth: per one l–5 g of casein acid hydrolysate, 5 g of yeast extraction, 12 g of monopotassium phosphate, 3.9 g of potassium hydroxide, 10 g of sodium chloride, 0.1 g of cysteine hydrochloride monohydrate, 6 mg of iron II sulfate heptahydrate, 2 g of glucose, pH 7.2. The cultivation was carried out in flasks on a thermostated shaker, 200 rpm, or in the plate wells on the shaker Multiscan FC unit (Thermo scientific, Singapore). When required, polymyxin B (100 μg/mL), chloramphenicol (3 μg/mL), kanamycin (20 μg/mL), or sucrose (10%) was added to media. Bacterial inocula for animal infection studies was generated by streaking F. tularensis strains onto FT plates, resuspending bacteria in PBS, and diluting to the appropriate concentration.

E. coli was grown at 37 °C in Luria–Bertani broth (LB) and on LB agar (LA) [19]. LB was supplemented with ampicillin (100 μg/mL), chloramphenicol (20 μg/mL), kanamycin (20 μg/mL), or sucrose (10%) when required.

For growth curves, single colonies of 15 NIIEG and the derivates were grown on FT-agar plates, then prepared a bacterial suspension in BHI broth to an optical density at 600 nm (OD600) of 0.8. Ten microliters of each culture was added to wells with 190 microliters of BHI broth. Moreover, 96-well culture flat bottom plate with a lid (Costar REF 3599, Corning, NY, USA) was used for cultivation in Multiscan FC unit (Thermo scientific) at 37 °C with shaking 100 rpm/min for 24 h. OD600 was recorded in wells at one-hour intervals.

DNA manipulations. To isolate plasmid DNA from E. coli cells, plasmid-transform E. coli cells, and perform genetic engineering, we followed the guidelines in [20]. Plasmid DNA from F. tularensis was isolated as described earlier in [21]. F. tularensis DNA was isolated with the GenElute™ Bacterial Genomic DNA Kit (Sigma-Aldrich, Moscow, Russia). F. tularensis whole-genome sequencing was performed using the Illumina MiSeq instrument according to the manufacturer’s instruction. MiSeq Reagent Kit v3 (300 cycles) was used for sequencing.

Interspecies conjugation. Plasmids were transferred from E. coli S17-1 cells into F. tularensis cells as described in [11,22] and modified as follows: 50 μL of a suspension of the donor E. coli S17-1 strain with the mobilized plasmid (1 × 108 cells) was mixed with 50 μL of the recipient F. tularensis strain (3 × 1010 cells), and was spotted 10 μL on LB agar. The cultures were then incubated at 25 °C over 20 h and seeded onto FT agar containing 100 μg/mL of polymyxin B and 1 μg/mL of chloramphenicol to select F. tularensis clones with the cat gene of plasmid. Petri dishes were incubated 5 days at 37 °C.

Cryotransformation of F. tularensis bacteria by plasmid DNA. Overnight agar culture was suspended in 10 mL of FTB.: The suspension was cultivated in a shaker at 37 °C and 200 rpm over 2.5 h and concentrated by centrifugation. Centrifugation sediment was suspended in 80 μL of the transformation buffer TB (0.1 M MgSO4, 10 mM (NH4)2 SO4, pH 7.5).

For cryotransformation, 2 μL of the DNA solution was mixed with 20 μL of the bacterial suspension in a 250-μL microtube, and incubated over 10 min at room temperature. Then the tube was cooled down in liquid nitrogen over 5 min and heated to 37 °C over 10 min. The suspension was inoculated into 500 μL FTB, incubated at 37 °C over 2 h and plated onto the selective FT agar containing selective antibiotic [23].

Design of pHVmob plasmid. pHV33 plasmid DNA was digested with BamHI and ligated with 1.7-kb Bam HI fragment with a mob region of pPV plasmid [11]. Recombinant plasmid was transformed into E. coli DH5α. The clones with ~8.9-kb pHVmob plasmid were selected on LA with chloramphenicol. Functional activity of the mob region in pHVmob was tested by its ability to mobilize the plasmid from E. coli S17-1λpir into F. tularensis 15 NIIEG.

Design of bireplicon vector pUK194. pUK194 with amp and kan genes was constructed as result of ligation of plasmids pK194 and pUC19 digested with HindIII.

pK194 was developed on base of modified pHV33 plasmid carrying kan gene from mTn10Km transposon instead cat gene. pHV33Km was selected after insertion mTn10Km transposon in F. tularensis 15(pHV33). pHV33Km was digested with HindIII, 2.9-kb fragment gel purified and ligated. Plasmid (pK194) obtained contains kan gene and is capable of autonomously replication in F. tularensis 15 NIIEG.

recD deletion in F. tularensis 15 NIIEG genome.

Design of suicide plasmid for recD deletion. pGMΔrecD plasmid was create on base of pGM5 vector [16] (Figure 1).

Figure 1.

Figure 1

pGM5 plasmid.

FSD/RBD and FBD/RSD primers were used for synthesis of two amplicons adjacent to the recD F. tularensis gene and sized 1433 bp (5′ left arm) and 1462 bp (3′ right arm). The amplicons were hydrolyzed with SalI and BamHI and ligated with SalI linearized and dephosphorylated pGM5. The mixture after ligation was transformed the E. coli DH5α. Clones with pGMΔrecD plasmid were selected on AmpRCmRSucS phenotype and by PCR on the FCD/RCD primers.

Allelic replacement of recD gene. Broth culture of F. tularensis with integrated pGMΔrecD was incubated at 37 °C over 6 h, then plated onto FT agar with added 5% sucrose and polymyxin B and continued incubation at 37 °C over 3 days for selection of SucR clones. The clones were checked on CmS phenotype on FT agar with Cm (1 μg/mL). and presence only genome region without recD gene using FCD/RCD and FSD/RSD primers.

Creation of plasmid with recD gene (pUK/recD) for complementation. A 3498-kb amplicon with the recD gene was created by PCR on FSD/RSD primers and F. tularensis 15 NIIEG DNA, hydrolyzed with SalI and ligated in SalI site of pUK194. The ligate was used to transform E. coli DH5α cells. Presence of F. tularensis recD gene in AmpRKmR transformants was checked by PCR on FSD/RSD and FCD/RCD primers.

Design of suicide plasmid for sodC deletion. pGMΔsodC plasmid was create on base of pGM5. sodCL-F/sodCL and sodCR-F/sodCR-R primers were used for synthesis of two amplicons adjacent to the sodC F. tularensis gene and sized 937 bp (5′ left arm) and 745 bp (3′ right arm). The amplicons were hydrolyzed with SalI and BamHI and ligated with SalI linearized and dephosphorylated pGM5. The mixture after ligation was transformed the E. coli DH5α. Clones with pGMΔsodC plasmid were selected on AmpRCmRSucS phenotype and by PCR on the sodC-KF/sodC-KR primers.

Testing F. tularensis strains’ capacity for homologous recombination. F. tularensis 15 NIIEG, 15D, 15D(pUK/recD, and 15D(pUK194) strains were tested for their capacity for homologous recombination of pPV/∆iglC [11] and pGMΔsodC suicide plasmids. With this purpose pPV/∆iglC was mobilized from E. coli S17-1 into F. tularensis, and pPV/∆iglC was cryotransformated into F. tularensis. pHVmob plasmid autonomous replicating in F. tularensis and capable of mobilizing from E. coli S17-1 into F. tularensis was used as control for efficiency of plasmids transfer.

Infection of macrophages. The murine macrophage line J774A.1 from the Russian Collection of Cell Cultures, St. Petersburg was used. 1 × 105 cells were seeded into wells of in 24-well tissue culture plates (Costar, Corning, NY, USA) and incubated in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO BRL, Grand Islands, NY, USA) supplemented with 10% fetal bovine serum and 2 mM L-glutamine at 37 °C in humidified air containing 5% CO2. 24 h. F. tularensis suspension was inoculated in the wells with macrophages monolayer at a multiplicity of infection 100:1. After incubation for 2 h at 37 °C, wells were washed with PBS to remove extracellular bacteria. Macrophages were reconstituted in culture medium supplemented with 2 μg/mL of gentamicin and incubated for the indicated periods of time. Then, the infected macrophages were lysed with 0.5 mL of 0.05% dodeoxycholate and the number of CFU determined by plating serial 10-fold dilutions on FT agar medium.

Animal infections. All animal studies were conducted at the Protocol Number VP-2021/4 from 23.09.2021 of the SRCAMB Bioethics Committee in accordance with the Good Animal Care requirements [24]. Six- to 8-week-old BALB/c mice (Institute of Bioorganic Chemistry, Russian Academy Sciences in Pushchino, Russian Federation) were infected subcutaneously (s.c.) in a final volume of 0.2 mL with F. tularensis 15 NIIEG derivatives. Challenge doses per mouse were from 1 × 102 to 1 × 105 CFU (five mice per one dose).

Statistical Analyses. All values were expressed as means ± standard errors of the means. One-way analysis of variance (ANOVA), followed by a post hoc test (Bonferroni) and a one-tailed Student t test, was used to identify differences between groups.

3. Results and Discussion

3.1. Comparative Analysis of Amino Acid Sequences RecD Proteins in the Genus Francisella

The amino acid sequences of in strains of different species and subspecies of the genus Francisella have some differences. RecD protein F. philomiragia and F. tularensis subsp. novicida, in comparison with other subspecies of the tularemia microbe, has an extended deletion of 22 aa. At the N-terminus of the RecD protein in F. tularensis subsp. holarctica and F. philomiragia, there is a 9 amino acid deletion, which distinguishes these species from others. There are 28 amino acid substitutions and a deletion of 22 amino acid residues in the RecD protein of F. tularensis subsp. novicida in comparison with other subspecies of the tularemia microbe. The amino acid sequences of the RecD proteins of F. philomiragia differ in 47 amino acid residues from RecD of subspecies of F. tularensis (Supplementary S3).

3.2. recD Deletion in F. tularensis 15 NIIEG Genome

The recD deletion variant of F. tularensis 15 NIIEG was obtained using the suicide plasmid pGMΔrecD, created on the basis of the pGM5 vector, consisting of the pBR22 plasmid and the modified pC194 plasmid, which lost the ability to replicate in F. tularensis [16]. Plasmid pGMΔrecD was introduced into F. tularensis 15 NIIEG cells by cryotransformation. Clones carrying pGMΔrecD were selected on FT-agar with chloramphenicol (1 μg/ml). The presence of sacB gene in the clones was detected by the inhibition of culture growth on FT-agar with the addition of 10% sucrose. FCD/RCD primers were used for a check of presence of both native and modified recD gene in the clones. As a result of allelic exchange, clones with the CmSSucR phenotype were selected, containing only a modified region of the genome without the recD gene. Amplicon obtained with FCD/RCD primers on the modified strain 15D DNA was 0.6 kb shorter than it on parent strain DNA (Figure 2, Supplementary S4).

Figure 2.

Figure 2

PCR analysis with FCD/RCD primers of F. tularensis DNA: 15 NIIEG—line 2, 15D—line 3. 100 bp plusDNA ladder (Fermentas)–lines 1 and 4.

F. tularensis 15D was free from selection markers of pGM∆recD suicide plasmid, such as chloramphenicol resistance or sucrose sensitivity. Comparison of nucleotide sequences of recD regions of F. tularensis 15D and 15 NIIEG strains showed that the modified strain to have 604 nucleotides deletion. No nucleotide substitutions found in the recB and recC genes adjacent to recD, see Supplementary S5.

3.3. Effects of recD on Homologous Recombination in F. tularensis

To study the effects of the recD gene on homologous recombination in F. tularensis, we tested the F. tularensis 15D strain and its derivatives: 15D(pUK/recD) with pUK/recD plasmid carrying genome fragment with the recD gene; and 15D(pUK194) with pUK194 vector plasmid. The homologous recombination event was assessed by the appearance of clones resistant to chloramphenicol as a result of transfer of suicide plasmids carrying F. tularensis DNA fragments. pPVΔiglC plasmid integration efficiency into the F. tularensis 15D and 15D(pUK194) chromosomes by mobilization from E. coli S17-1 was significantly lower than it for parent strain 15 NIIEG, see Table 3. The same result was obtained for pGMΔsodC plasmid which was transformed F. tularensis 15D and 15D(pUK194). The phenomenon of homologous recombination with the participation of the suicide plasmids in strain 15 NIIEG was confirmed by the fact that the transfer of vectors (pPV and pGM5) did not lead to the appearance of CmR clones. Transformation of pUK/recD plasmid into the 15D strain restored the suicide plasmids integration capacity to the same level of efficiency as in the parent strain 15 NIIEG, see Table 3.

Table 3.

Efficiency of the integration of pPVΔiglC and pGMΔsodC suicide plasmids into F. tularensis chromosomes.

F. Tularensis Strain CmR Clones Per Recipient Cell
pPV/∆iglC pGM/∆sodC
15D <1 × 10−9 <1 × 10−9
15 NIIEG 1 × 10−7 1 × 10−6
15D(pUK/recD) 1 × 10−6 1 × 10−6
15D(pUK194) <1 × 10−9 <1 × 10−9

The modified strains practically did not differ from 15 NIIEG in their ability to mobilize (~1 × 107 CFU) and transform (~1 × 106 CFU per μg of DNA) in experiments with the pHVmob plasmid that replicating autonomously into F. tularensis (Table 4).

Table 4.

Efficiency of the transfer of pHVmob plasmid into F. tularensis strains.

F. Tularensis Strain CmR Clones Per Recipient Cell
Mobilization Efficiency
(Per Recipient Cell)
Cryotransformation Efficiency (CFUμg DNA)
15D 3 × 10−2 1 × 106
15 NIIEG 3 × 10−2 1 × 106
15D (pUK/recD) 3 × 10−2 1 × 106
15D (pUK194) 3 × 10−2 1 × 106

3.4. Growth of F. tularensis 15D in Nutrient Media and J774.1A Cells

Comparative analysis of F. tularensis 15D colonies sizes on chocolate agar after 3 days of culturing at 37 °C showed that modified strain colonies were smaller F. tularensis 15 NIIEG one, see Figure 3.

Figure 3.

Figure 3

F. tularensis colonies morphology on chocolate agar (A,B), FT-agar (C,D): 15 NIIEG (A,C) and 15D (B,D).

Slower growth of F. tularensis 15D in comparisio with 15 NIIEG was observed in BHI medium, see Figure 4A. Transcomplementation of the recD deletion in F. tularensis 15D with pUK/recD restored speed growth in comparison to the 15D(pUK194), carrying only plasmid vector, see Figure 4B.

Figure 4.

Figure 4

F. tularensis growth in BHI broth at 37 °C, strains: (A)—15D and 15 NIIEG; (B)—15D (pUK/recD) and 15D (pUK194).

F. tularensis 15D bacteria, aside from reduced growth in vitro, had reduced reproduction ability in J774.1A cells compared to the 15 NIIEG strain, see Figure 5.

Figure 5.

Figure 5

Effect of recD deletion on F. tularensis reproduction in J774.1A cells. 15 NIIEG strain was used as control. Macrophages were infected with bacteria at a ratio of 100:1. The macrophages were lysated at 3, 24, and 48 h upon infection. The diagram shows the average results of the number of colonies on FT agar as Lg CFU/mL ± confidence interval (p < 0.05) obtained in three independent experiments.

3.5. recD Deletion Effects on F. tularensis Virulence

F. tularensis 15D without recD gene had significantly reduced virulence for BALB/c mice infected s.c. in comparison with 15 NIIEG, see Table 5.

Table 5.

BALB/c mice survival after s.c. F. tularensis challenge.

F. Tularensis Strain Challenge Dose Survival (%)
15D 1 × 103 100
1 × 105 100
15D(pUK/recD) 8 × 102 0
8 × 104 0
15D (pUK194) 6 × 102 100
6 × 104 100
15 NIIEG 1 × 102 30
1 × 103 0

Transcomplementation of the recD deletion in F. tularensis 15D with pUK/recD increased virulence in comparison to the 15D and 15D (pUK194), carrying only plasmid vector, see Table 5.

4. Discussion

One of the possible directions for stabilizing and reactogenicity reducing of existing tularemia vaccines is the modification or deletion of genes, the products of which are involved in repair processes and intragenomic rearrangements. Such targets can be recA gene [25], recB [26], and recD gene. The function of RecD protein of E. coli, a component multifunctional enzyme RecBCD in nucleic acid exchange, has been studied in detail [27,28]. The F. tularensis LVS genome contains the FTL_0670 gene (Gen Bank NCBI) encoding a protein similar to the E. coli RecD protein. An identical nucleotide sequence is also present in the genome of F. tularensis 15 NIIEG (Supplementary S2).

recD gene deletion in strain 15 NIIEG led to a slowdown in bacterial growth on solid and liquid nutrient media, as well as to a slowdown in reproduction in J774.1A macrophage-like cells. The observed decrease in the replication of strain 15D in macrophages can probably be explained by its reduced ability to grow in the BHI medium, which mimics the growth conditions in macrophages [29,30,31]. This effect may have led to a significant decrease in the virulence of the modified F. tularensis 15D strain. Influence of the recD gene on bacterial growth was previously demonstrated for Pseudomonas syringae Lz4W [32].

There are extended nucleotide repeats in F. tularensis genomes [33], which could be the reason for genomic rearrangements. To elucidate the recD gene role in the process of homologous recombination, the F. tularensis 15 NIIEG strain without the recD gene was created. The recipient properties of 15D strain during interspecies transfer and cryotransformation of autonomous replication in F. tularensis plasmids did not differ from the properties of the parental strain. However, the transfer and integration of suicide plasmids carrying extended F. tularensis genome fragments into 15D strain were significantly suppressed in comparison with strain 15 NIIEG. Transcomplementation of this mutation in 15D strain led to the restoration of suicidal plasmids integration. Thus, the deletion of the recD gene may reduce the likelihood of intragenomic rearrangements in the vaccine strain, which will lead to stabilization of the properties of the tularemia vaccine. The properties of the vaccine strain without the recD gene listed above allow us to hope that this approach is promising for the development of more stable and less reactogenic vaccine strains of F. tularensis.

Acknowledgments

The authors would like to thank Angelina Kislichkina, and Alexandr Bogun for their help in the DNA sequencing.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vaccines10010108/s1, Supplementary S1: Structure of the genome regions of F. tularensis and E. coli with recBCD genes; Supplementary S2: Comparison of therecBCD regions of Francisella tularensis subsp. holarctica LVS and Francisella tularensis subsp. holarctica 15 NIIEG; Supplementary S3: Multiple alignment of the amino acid sequence of the RecD proteins of the genus Francisella; Supplementary S4: Electrophoregram of amplicons; Supplementary S5: Comparison of therecBCD regions of Francisella tularensis subsp. holarctica LVS and Francisella tularensis subsp. holarctica 15D.

Author Contributions

Conceptualization, V.P., A.M. and M.E.P.; methodology, G.V., G.T., R.M., T.K. and T.G.; formal analysis, V.P. and M.E.P.; investigation, G.V., G.T., R.M., T.K. and T.G.; resources, funding acquisition, and project administration, I.D. and A.M.; writing—original draft preparation, V.P. and A.M.; writing—review and editing, all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Higher Education of the Russian Federation, agreement.075-15-2019-1671 dated 31 October 2019.

Institutional Review Board Statement

All animal studies were conducted at the Protocol Number VP-2021/4 from 23.09.2021 of the SRCAMB Bioethics Committee in accordance with the Good Animal Care requirements.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data used for this study are available in the text of the article and in the Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Gill V., Cunha B.A. Tularemia pneumonia. Semin. Respir. Infect. 1997;12:61–67. [PubMed] [Google Scholar]
  • 2.Dennis D.T., Inglesby T.V., Henderson D.A., Bartlett J.G., Ascher M.S., Eitzen E., Fine A.D., Friedlander A.M., Hauer J., Layton M., et al. Tularemia as a Biological Weapon: Medical and Public Health Management. J. Am. Med. Assoc. 2001;285:2763–2773. doi: 10.1001/jama.285.21.2763. [DOI] [PubMed] [Google Scholar]
  • 3.Olsuf’ev N.G. Taxonomy, Microbiology and Laboratory Diagnosis of the Causative agent of Tularemia. Izd. Meditsina; Moscow, Russia: 1975. 192p. (In Russian) [Google Scholar]
  • 4.Ellis J., Oyston P.S.F., Green M., Titball R.W. Tularemia. Clin. Microbiol. Rev. 2002;15:631–636. doi: 10.1128/CMR.15.4.631-646.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Medunitsyn N.V. Vaccinology. Izd. Triada-Kh; Moscow, Russia: 1999. 272p. (In Russian) [Google Scholar]
  • 6.Eigelsbach H.T., Downs C.M. Prophylactic effectiveness of live and killed tularemia vaccines. I. Production of vaccine and evaluation in the white mouse and guinea pig. J. Immunol. 1961;87:415–425. [PubMed] [Google Scholar]
  • 7.Sandstrom G. The tularemia vaccine. J. Chem. Technol. Biotechnol. 1994;59:315–320. doi: 10.1002/jctb.280590402. [DOI] [PubMed] [Google Scholar]
  • 8.Conlan J.W., Oyston P.C.F. Vaccines against Francisella tularensis. Ann. N. Y. Acad. Sci. 2007;1105:325–350. doi: 10.1196/annals.1409.012. [DOI] [PubMed] [Google Scholar]
  • 9.Smith G.R. How RecBCD enzyme and Chi promote DNA break repair and recombination: A molecular biologist’s view. Microbiology and molecular biology reviews. Microbiol. Mol. Biol. Rev. 2012;76:217–228. doi: 10.1128/MMBR.05026-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Woodcock D.M., Crowther P.J., Doherty J., Jefferson S., DeCruz E., Noyer-Weidner M., Smith S.S., Michael M.Z., Graham M.W. Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids Res. 1989;17:3469–3478. doi: 10.1093/nar/17.9.3469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Golovliov I., Sjostedt A., Mokrievich A., Pavlov V. A method for allelic replacement in Francisella tularensis. FEMS Microbiol. Lett. 2003;222:273–280. doi: 10.1016/S0378-1097(03)00313-6. [DOI] [PubMed] [Google Scholar]
  • 12.Iordanescu S. Recombinant plasmid obtained from two different, compatible staphylococcal plasmids. J. Bacteriol. 1975;124:597–601. doi: 10.1128/jb.124.2.597-601.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Horinouchi S., Weisblum B. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 1982;150:815–825. doi: 10.1128/jb.150.2.815-825.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pomerantsev A.P., Domaradskii I.V., Doronin I.P., Fursov V.V. Investigation of cat-gene expression of plasmids Sa and pC194 in Escherichia coli, Francisella tularensis and Bacillus subtilis cells. Mol. Gen. Mikrobiol. Virusol. 1991;9:21–24. (In Russian) [PubMed] [Google Scholar]
  • 15.Primrose S.B., Ehrlich S.D. Isolation of plasmid deletion mutants and study of their instability. Plasmid. 1981;6:193–201. doi: 10.1016/0147-619X(81)90066-4. [DOI] [PubMed] [Google Scholar]
  • 16.Mokrievich A.N., Vakhrameeva G.M., Titareva G.M., Bakhteeva I.V., Mironova R.I., Kombarova T.I., Kravchenko T.B., Dyatlov I.A., Pavlov V.M. Construction and characterization of Francisella tularensis vaccine strain with a single copy of iglC gene and lacking recA gene. Mol. Gen. Microbiol. Virol. 2015;30:148–156. doi: 10.3103/S0891416815030039. [DOI] [PubMed] [Google Scholar]
  • 17.Yanisch-Perron C., Vieira J., Messing J. Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene. 1985;33:103–119. doi: 10.1016/0378-1119(85)90120-9. [DOI] [PubMed] [Google Scholar]
  • 18.Bakshi C.S., Malik M., Regan K., Melendez J.A., Metzger D.W., Pavlov V.M., Sellati T.J. Superoxide dismutase B gene (sodB)-deficient mutants of Francisella tularensis demonstrate hypersensitivity to oxidative stress and attenuated virulence. J. Bacteriol. 2006;188:6443–6448. doi: 10.1128/JB.00266-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Miller D. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory; Cold Spring Harbor, NY, USA: 1972. [Google Scholar]
  • 20.Sambrook J., Fritsch E.F., Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY, USA: 1989. [Google Scholar]
  • 21.Pavlov V.M., Mokrievich A.N., Volkovoy K. Cryptic plasmid pFNL10 from Francisella novicida-like F6168, The base of plasmid vectors for Francisella tularensis. FEMS Immunol. Med. Microbiol. 1996;13:253–256. doi: 10.1111/j.1574-695X.1996.tb00247.x. [DOI] [PubMed] [Google Scholar]
  • 22.Mokrievich A.N., Vakhrameeva G.M., Mironova R.I., Kombarova T.I., Titareva G.M., Kravchenko T.B., Bakhteeva I.V., Dyatlov I.A., Pavlov V.M. Construction and Investigation of the Vaccine Strain Francisella tularensis without iglC genes. Commun. 1. Probl. Osobo Opasnykh Inf. 2013;117:70–74. doi: 10.21055/0370-1069-2013-3-70-74. (In Russian) [DOI] [Google Scholar]
  • 23.Shishkova N.A., Vakhrameyeva G.M., Pavlov V.M., Mokrievich A.N., Dyatlov I.A. Plazmida cryotransformation of vaccin strain Francisella tularensis 15 NIIEG. Bacteriology. 2018;3:38–42. doi: 10.20953/2307-6631-2018-2-38-42. (In Russian) [DOI] [Google Scholar]
  • 24.National Research Council . Guide for the Care and Use of Laboratory Animals. 8th ed. National Academy Press; Washington, DC, USA: 2010. 220p [Google Scholar]
  • 25.Lapin A.A., Mokrievich A.N., Vakhrameeva G.M., Kombarova T.I., Bakhteeva I.V., Dyatlov I.A., Pavlov V.M. Immunobiological properties of Francisella tularensis 15/10 strain with deleted recA gene. Probl. Osobo Opasn. Infekts. 2011;110:65–67. doi: 10.21055/0370-1069-2011-4(110)-65-67. (In Russian) [DOI] [Google Scholar]
  • 26.Cano D.A., Pucciarelli M.G., Portillo F.G., Casadesús J. Role of the RecBCD Recombination Pathway in Salmonella Virulence. J. Bacteriol. 2002;184:592–595. doi: 10.1128/JB.184.2.592-595.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Amundsen S.K., Taylor A.F., Smith G.R. The RecD subunit of the Escherichia coli RecBCD enzyme inhibits RecA loading, homologous recombination, and DNA repair. Proc. Natl. Acad. Sci. USA. 2000;97:7399–7404. doi: 10.1073/pnas.130192397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Taylor A.F., Smith G.R. RecBCD enzyme is a DNA helicase with fast and slow motors of opposite polarity. Nature. 2003;423:889–893. doi: 10.1038/nature01674. [DOI] [PubMed] [Google Scholar]
  • 29.Hazlet K.R.O., Caldon S.D., McArthur D.G., Cirillo K.A., Kirimanjeswara G.S., Magguilli M.L., Malik M., Shah A., Broderick S., Golovliov I., et al. Adaptation of Francisella tularensis to the mammalian environment is governed by cues which can be mimicked in vitro. Infect. Immun. 2008;76:4479–4488. doi: 10.1128/IAI.00610-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hazlet K.R.O., Cirillo K.A. Environmental adaptation of Francisella tularensis. Microbes. Infect. 2009;11:828–834. doi: 10.1016/j.micinf.2009.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Holland K.M., Rosa S.J., Kristjansdottir K., Wolfgeher D., Franz B.J., Zarrella T.M., Kumar S., Sunagar R., Singh A., Bakshi C.S., et al. Differential growth of Francisella tularensis, which alters expression of virulence factors, dominant antigens, and surface-carbohydrate synthases, governs the apparent virulence of Ft SchuS4 to immunized animals. Front. Microbiol. 2017;8:1158. doi: 10.3389/fmicb.2017.01158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Regha K., Satapathy A.K., Ray M.K. RecD Plays an Essential Function During Growth at Low Temperature in the Antarctic Bacterium Pseudomonas syringae Lz4W. Genetics. 2005;170:1473–1484. doi: 10.1534/genetics.104.038943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Larsson P., Oyston P.C.F., Chain P., Chu M.C., Duffield M., Fuxelius H.-H., Garcia E., Hälltorp G., Johansson D., Isherwood K.E., et al. The complete genome sequence of Francisella tularensis the causative agent of tularemia. Nat. Genet. 2005;37:153–159. doi: 10.1038/ng1499. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

All data used for this study are available in the text of the article and in the Supplementary Materials.


Articles from Vaccines are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES