Generation and Characterization of Six Human Induced Pluripotent Stem Cell Lines (iPSC) From Three Families with AP4M1-associated Hereditary Spastic Paraplegia (SPG50)

Abstract

Biallelic loss-of-function variants in the subunits of the adaptor protein complex 4 lead to childhood-onset hereditary spastic paraplegia (AP-4-HSP): SPG47 (AP4B1), SPG50 (AP4M1), SPG51 (AP4E1), and SPG52 (AP4S1). Here, we describe the generation of induced pluripotent stem cells (iPSCs) from three AP-4-HSP patients with biallelic, loss-of-function variants in AP4M1 and their sex-matched parents (asymptomatic, heterozygous carriers). Following reprogramming using non-integrating Sendai virus, iPSCs were characterized following standard protocols including karyotyping, embryoid body formation, pluripotency marker expression and STR profiling. These first iPSC lines for SPG50 provide a valuable resource for studying this rare disease and related forms of hereditary spastic paraplegia.

Resource Table:

Unique stem cell lines identifier	BCHNEUi007-A BCHNEUi008-A BCHNEUi009-A BCHNEUi010-A BCHNEUi011-A BCHNEUi012-A
Alternative names of stem cell lines	DEF_1726-01 DEF_1726-03 DEF_1779-01 DEF_1779-03 DEF_1586-01 DEF_1586-03
Institution	Boston Children’s Hospital, Harvard Stem Cell Institute
Contact information of distributor	Darius Ebrahimi-Fakhari darius.ebrahimi-fakhari@childrens.harvard.edu
Type of cell lines	iPSC
Origin	Human
Cell Source	Fibroblasts
Clonality	Clonal cell lines
Method of reprogramming	Sendai Virus, non-integrating (OCT4, SOX2, KLF4 and hc-MYC)
Multiline rationale	Three lines from patients with SPG50 due to pathogenic biallelic variants in AP4M1 and control lines from sex-matched parents who are clinically unaffected heterozygous carriers.
Gene modification	No
Type of modification	N/A
Associated disease	AP4M1, Hereditary Spastic Paraplegia type 50, SPG50
Gene/locus	AP4M1; Reference sequences: NM_004722.4 BCHNEUi007-A: c.916C>T (p.Arg306Ter) / c.694dupG (p.Glu232GlyfsTer21) BCHNEUi008-A: c.694dupG (p.Glu232GlyfsTer21) BCHNEUi009-A: c.1025+2dupT / c.205A>C (p.Thr69Pro) BCHNEUi010-A: c.1025+2dupT BCHNEUi011-A: c.218dupA (p.Asn73LysfsTer43) / c.851A>C (p.Tyr284Ser) BCHNEUi012-A: c.218dupA (p.Asn73LysfsTer43)
Method of modification	N/A
Name of transgene or resistance	N/A
Inducible/constitutive system	N/A
Date archived/stock date	October 23rd 2020
Cell line repository/bank	N/A
Ethical approval	This study was approved by the Institutional Review Board at Boston Children’s Hospital (IRB-P00033016 & IRB-P00016119). Written informed consent was obtained.

Resource Utility

These iPSC lines are the first patient-derived disease model of hereditary spastic paraplegia type 50 (SPG50) and the second iPSC lines of AP-4-associated hereditary spastic paraplegia [1, 2]. Thus, they provide a valuable resource to study adaptor protein complex 4 biology, disease mechanisms and therapeutic interventions.

Resource Details

The hereditary spastic paraplegias (HSP) are a group of over 80 neurogenetic diseases and the most common cause of inherited spasticity and associated disability. Here, we focus on a form of complex, childhood-onset hereditary spastic paraplegia caused by bi-allelic loss-of-function variants in genes that encode subunits of the adaptor protein complex 4 (AP-4-HSP): SPG47 (AP4B1); SPG50 (AP4M1), SPG51 (AP4E1), and SPG52 (AP4S1) [1, 3, 4]. Adaptor protein (AP) complexes are heterotetramers that selectively incorporate transmembrane cargo proteins into vesicles and mediate their intracellular transport [5]. To understand AP-4 deficiency in patient-derived cells, we created iPSC lines from three well-characterized patients with AP4M1-associated HSP (or SPG50) [4] and sex-matched parents as controls. The AP4M1 (NM_004722.4) variants present in these patients include a compound-heterozygous non-sense and frameshift variant (c.916C>T (p.Arg306Ter) / c.694dupG (p.Glu232GlyfsTer21), a compound-heterozygous splice-site and missense variant (c.1025+2dupT / c.205A>C (p.Thr69Pro)) and a compound-heterozygous frameshift and missense variant (c.218dupA (p.Asn73LysfsTer43) / c.851A>C (p.Tyr284Ser)). All patients presented with core clinical and imaging features of AP-4-HSP [4], and loss of AP-4 function was established in their fibroblasts (unpublished). Fibroblasts were obtained by standard punch biopsy and reprogrammed using non-integrating Sendai virus to overexpress OCT4, SOX2, KLF4 and hc-MYC. All iPSC lines recovered well after thawing (Fig. 1A, scale bar 400μm). For each line, one clone was selected based on expression of pluripotency markers and differentiation potential. Pluripotency was assessed by immunofluorescence staining for OCT4, Nanog, SSEA4 and Tra-1-60 (Fig. 1B, scale bar 300μm) as well as qRT-PCR of NANOG, OCT4, REX1, and SOX2 (Fig. 1D). All iPSC lines showed robust expression of pluripotency markers. To examine the potential to differentiate into all three germ layers, embryoid bodies from iPSC lines were tested for expression of ectodermal (EN1, MAP2 and NR2F2), mesodermal (SNAI2, RGS4 and HAND2) and endodermal (SST, KLF5 and AFP) markers using qRT-PCR (Fig. 1E). Karyotype analysis showed normal karyotypes and no clonal abnormalities (Fig. 1C). STR analysis for 16 short tandem repeat markers (Table 2) showed identical profiles for iPSC lines with their respective fibroblast line. To verify AP4B1 variants in iPSC lines, Sanger sequencing was performed (Fig. 1F). Mycoplasma testing using a standard assay (MycoAlert™) was negative.

Fig. 1.

Generation and characterization of six human induced pluripotent stem cell lines (iPSC) from three families with AP4M1-associated hereditary spastic paraplegia (SPG50).

Table 2:

Characterization and Validation

Classification	Test	Result	Data
Morphology	Photography	Normal	Figure 1 panel A
Phenotype	Qualitative analysis by immunocytochemistry	Immunocytochemistry for pluripotency markers OCT4, Nanog, SSEA4 and Tra-1-60	Figure 1 panel B
	Quantitative analysis by RT-qPCR	qRT-PCR for expression of Nanog, OCT4, REX1, SOX, HTERT and DNMT3B	Figure 1 panel B
Genotype	Karyotype (G-banding) and resolution	BCHNEUi007-A: 46,XY Band Resolution: 425-475 BCHNEUi008-A: 46,XY Band Resolution: 375-475 BCHNEUi009-A: 46,XY Band Resolution: 450-525 BCHNEUi010-A: 46,XY Band Resolution: 475-525 BCHNEUi011-A: 46,XY Band Resolution: 425-475 BCHNEUi012-A: 46,XY Band Resolution: 500-550	Figure 1 panel E
Identity	STR analysis	Performed 16 loci tested, all matched (D3S1358, TH01, D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, Penta D, vWA, D8S1179, TPOX, FGA, Amelogenin)	Archived with the journal Archived with the journal
Mutation analysis	Sanger Sequencing	Confirmed variants listed in Table 1.	Figure 1 panel F
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by luminescence (MycoAlert™): Negative	Archived with the journal
Differentiation potential	Embryoid body formation	Expression of ectodermal (EN1, MAP2 and NR2F2), mesodermal (SNAIL2, RGS4 and HAND2) and endodermal markers (SST, KLF5 and AFP)	Figure 1 panel D
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

Materials and Methods

Generation of iPSC

Skin punch biopsies were incubated in 0.5% Dispase Solution (STEMCELL Technologies) to remove epidermis. Samples were placed in gelatin-coated wells under growth conditions (37°C, 5% CO2), and a coverslip was added to prevent lifting. Fibroblast media consisted of DMEM with 10% FBS and 1% Penicillin/Streptomycin (Thermo Fisher Scientific). The CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) was used to transduce cells (Table 1&2). Eight days after transduction, iPSCs were re-plated on Geltrex™-coated dishes and maintained in StemFlex medium (Thermo Fisher Scientific). Emerging stem cell colonies were picked and re-plated on Geltrex™-coated dishes for expansion. Cells were passaged weekly using Gentle Cell Dissociation Reagent (STEMCELL Technologies).

Table 1:

Summary of iPSC Lines

iPSC line names	Abbreviation in figures	Gender	Age	Ethnicity	Genotype of locus	Disease
BCHNEUi007-A	AP4M1 [LoF/LoF]	Male	18 months	Caucasian	c.916C>T (p.Arg306Ter) / c.694dupG (p.Glu232GlyfsTer21)	SPG50
BCHNEUi008-A	AP4M1 [WT/LoF]	Male	40 years	Caucasian	c.694dupG (p.Glu232GlyfsTer21)	Unaffected control
BCHNEUi009-A	AP4M1 [LoF/LoF]	Male	6 years	African-American	c.1025+2dupT / c.205A>C (p.Thr69Pro)	SPG50
BCHNEUi010-A	AP4M1 [WT/LoF]	Male	28 years	African-American	c.1025+2dupT	Unaffected control
BCHNEUi011-A	AP4M1 [LoF/LoF]	Male	9 years	Caucasian	c.218dupA (p.Asn73LysfsTer43) / c.851A>C (p.Tyr284Ser)	SPG50
BCHNEUi012-A	AP4M1 [WT/LoF]	Male	52 years	Caucasian	c.218dupA	Unaffected control

Immunocytochemistry for markers of pluripotency

For immunocytochemistry, iPSCs were grown on coverslips. After washing with PBS, cells were fixed in 4% PFA. After three washes with PBS containing 0.05% Tween 20 (PBST), cells were permeabilized with PBS containing 0.1% Triton X-100 for 15min and subsequently washed with PBST. Blocking was performed overnight at 4°C with 4% donkey serum in PBS. After washing with PBS, cells were incubated with primary antibodies (Table 3) for 1 hour, washed with PBST and incubated with secondary antibodies for 1 hour and stained with DAPI. Imaging was performed using an Olympus IX71 Inverted Microscope.

Table 3:

Reagents Details

Antibodies used for immunocytochemistry
	Antibody	Dilution	Company Cat # and RRID
Pluripotency Markers	Rabbit anti-OCT4	1:100	Abcam Cat# ab19857, RRID:AB_445175
	Rabbit anti-NANOG	1:50	Abcam Cat# ab21624, RRID:AB_446437
	Rat anti-SSEA3	1:200	Millipore Cat# MAB 4303, RRID:AB_177628
	Mouse anti-SSEA4	1:200	Millipore Cat# MAB 4304, RRID:AB_177629
	Mouse anti-TRA-1-60	1:200	Millipore Cat# MAB 4360, RRID:AB_10917470
Secondary antibodies	Alexa Fluor 488 Donkey Anti-Rabbit IgG	1:500	Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792
	Alexa Fluor 488 Donkey Anti-Mouse IgG	1:500	Thermo Fisher Scientific Cat# A-21202, RRID:AB_141607
	Alexa Fluor 555 Goat Anti-Mouse IgM	1:500	Thermo Fisher Scientific Cat# A-21426, RRID:AB_2535847
Primers
	Target	Forward/Reverse primer (5′-3′)
Pluripotency Markers (qPCR)	NANOG	CAGTCTGGACACTGGCTGAA/CTCGCTGATTAGGCTCCAAC
	OCT4	TGTACTCCTCGGTCCCTTTC/TCCAGGTTTTCTTTCCCTAGC
	SOX2	GCTAGTCTCCAAGCGACGAA/GCAAGAAGCCTCTCCTTGAA
	DNMT3B	ATAAGTCGAAGGTGCGTCGT/GGCAACATCTGAAGCCATTT
	HTERT	TGTGCACCAACATCTACAAG/GCGTTCTTGGCTTTCAGGAT
	REX1	TGGACACGTCTGTGCTCTTC/GTCTTGGCGTCTTCTCGAAC
House-Keeping Genes (qPCR)	ACTB	GGACTTCGAGCAAGAGATGG/AGCACTGTGTTGGCGTACAG
Targeted sequencing of AP4M1	AP4M1	BCHNEUi007-A & BCHNEUi008-A: 1) GCAACCACCTCAGGGCGAG / GGGCTTGGCTCTTTGAGAGC 2) GAGCTTCCTTCCTAGCGGCTC / CTCGCCCTGAGGTGGTTGC BCHNEUi009-A & BCHNEUi010-A: 1) CCGGCTCCAGGTTTATCTAAA / GGCTCCCTCTGCCAGCTCA 2) AGCTGACGGGACTGCCAGGA / GCCACAGTAATCGCCCAGAAG BCHNEUi011-A & BCHNEUi012-A: 1) AGCTGACGGGACTGCCAGGA / GCCACAGTAATCGCCCAGAAG 2) GCAACCACCTCAGGGCGAG / GGGCTTGGCTCTTTGAGAGC

RNA Isolation and qRT-PCR

Total RNA isolation was done using RNeasy Mini Kit (Qiagen), and RNA quantification was done using the qScript® cDNA Synthesis Kit (Quanta Bio). qRT-PCR cycles were performed using the QuantStudio 12K Flex System (Thermo Fisher Scientific).

Embryoid Body Formation

To assess their ability to form three germ layers, iPSCs were lifted in clumps to allow for spontaneous EB formation in suspension. iPSC cultures were washed with DPBS and incubated with Accutase (STEMCELL Technologies) for 3 min at 37°C. Cell clumps were lifted with a cell scraper in EB formation medium, consisting of DMEM, 5% KnockOut™ Serum Replacement and 0.5% Penicillin/Streptomycin (Thermo Fisher Scientific). Clumps were added to a 15ml tube and settled for 10 min before removing the supernatant. EB formation medium with ROCK inhibitor (STEMCELL Technologies) was added, and cell clumps were plated on ultra-low attachment plates (Corning Costar) for 24h. EB formation medium was replaced every other day until replating to Gelatin-coated-plates on day 8. Cells were then cultured until day 15 in DMEM with 10% FBS. RNA isolation and qRT-PCR were performed as described above.

Karyotyping

Karyotyping was performed at WiCell.

Mycoplasma Detection

Testing was done using the MycoAlert™ Detection Kit (Lonza).

STR Profiling

STR analysis was performed at Genetica DNA Laboratories. Sixteen loci and an additional mouse marker for the detection of mouse DNA contamination were analyzed using the PowerPlex® 16 HS System (Promega).

AP4M1 Variant Sequencing

To verify variants in AP4M1, PCR was performed on cDNA samples using Platinum PCR SuperMix High Fidelity (Thermo Fisher Scientific) and the MiniAmp Thermal Cycler (Applied BioSystems). Total RNA was isolated using the High Pure RNA Isolation Kit and 1ug was used to obtain cDNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche). PCR products were verified on a 1.5% agarose gel and submitted to Genewiz for enzymatic purification and Sanger sequencing.