Abstract
Retinoic acid signaling is indispensable for the completion of spermatogenesis. It is known that loss of retinoic acid nuclear receptor alpha (RARA) induces male sterility due to seminiferous epithelium degeneration. Initial genetic studies established that RARA acts in Sertoli cells, but a recent paper proposed that RARA is also instrumental in germ cells. In the present study, we have re-assessed the function of RARA in germ cells by genetically ablating the Rara gene in spermatogonia and their progenies using a cell-specific conditional mutagenesis approach. We show that loss of Rara in postnatal male germ cells does not alter the histology of the seminiferous epithelium. Furthermore, RARA-deficient germ cells differentiate normally and give rise to normal, living pups. This establishes that RARA plays no crucial role in germ cells. We also tested whether RARA is required in Sertoli cells during the fetal period or after birth. For this purpose, we deleted the Rara gene in Sertoli cells at postnatal day 15 (PN15), i.e., after the onset of the first spermatogenic wave. To do so, we used temporally controlled cell-specific mutagenesis. By comparing the testis phenotypes generated when Rara is lost either at PN15 or at embryonic day 13, we show that RARA exerts all of its functions in Sertoli cells not at the fetal stage but from puberty.
Keywords: anti-RARA antibodies for IHC, mouse, retinoic acid, Sertoli cell, seminiferous epithelium, Sox9-CreERT2, spermatogenesis, Stra8-Cre, synchronization factor, tamoxifen-inducible Cre recombinase, testis
1. Introduction
Spermatogenesis, the process that allows for the formation of spermatozoa, consists of three distinct phases: (i) the proliferative phase, during which the spermatogonia stem cells divide and differentiate to maintain both germ cell production and stem cell renewal; (ii) the meiotic phase, during which the spermatocytes undergo two consecutive divisions to produce haploid spermatids; and (iii) the spermiogenesis phase, during which the spermatids differentiate into spermatozoa. Occurring within the seminiferous epithelium of the testis, spermatogenesis is supported by somatic Sertoli cells. Both germ cells and Sertoli cells are impacted upon changes in vitamin A metabolism or its signaling pathway ([1,2] and references therein). For instance, vitamin A deficiency in rodents induces an arrest of spermatogonia differentiation, resulting in the progressive depletion of more differentiated germ cells. Additionally, Sertoli cells lose their cyclical changes in morphology and gene expression [3,4]. Importantly, administration of all-trans retinoic acid (ATRA) to vitamin A-deficient rodents restores spermatogenesis [4,5], indicating that ATRA is the active metabolite of vitamin A in the testis.
ATRA acts through binding to retinoic acid receptors (RARs; isotypes RARA, RARB, and RARG) [6]. Although the three RARs are expressed in the testis [7,8,9], they are not equally important for spermatogenesis, as inferred from the phenotypic analysis of knockout mice. Rarb-knockout males are fertile, with no alteration of spermatogenesis [10,11,12]. In contrast, Rara-knockout males display a pathological phenotype characterized by spermatogenic defects and infertility [13,14]. As for Rarg, its knockout yields vitamin A deficiency-like testis degeneration, resulting from an arrest of spermatogonia differentiation [15].
To assess RARA functions in spermatogonia, male mice lacking Rara in germ cells were generated and analyzed [16]. In these mutants (called Rara-cKO), the seminiferous epithelium was found to be severely affected, displaying extensive vacuolation and sloughing of immature germ cells. Surprisingly, an earlier study did not mention vacuolization of the seminiferous epithelium and germ cell sloughing in mutant males lacking all three RAR isotypes in germ cells [17]. In order to reconcile the discrepancies between these two studies, here we have generated mice lacking only RARA in germ cells, carefully ensured that Rara gene excision was obtained, and reassessed their testis phenotype. Despite meticulous analysis, we did not find any abnormality, thus contradicting the results published recently [16] but confirming that RARA is fully dispensable in germ cells for their proper differentiation.
We previously showed that selective ablation of the Rara gene in Sertoli cells from embryonic day 13.5 (E13.5) onward fully recapitulates the set of abnormalities found in the testis of Rara-knockout males [12,18]—i.e., delay in the first spermatogenic cycle; seminiferous epithelium vacuolization; sloughing of immature germ cells; apoptosis of spermatocytes; and failure of spermiation, the process whereby mature spermatids are translocated and released into the lumen of the seminiferous epithelium. This suggests that all functions played by RARA in the testis are Sertoli cell-autonomous [12]. However, the time period in which RARA is essential to allow proper Sertoli cell functioning in the adult is still unknown, because the Rara gene was until now invalidated in Sertoli cells either before or just after the onset of their appearance during fetal development [12,18]. To gain insights into this question, we set up and analyzed in the present study a genetic model in which Rara gene deletion occurs after birth. We found that loss of RARA in Sertoli cells from postnatal day 15 (PN15) onwards induces all testis abnormalities displayed by Rara-knockout males. This finding indicates that RARA-dependent signaling in Sertoli cells is required at the onset of spermatogenesis but not during fetal stages. Together, our results firmly establish that RARA is essential in postnatal Sertoli cells for spermatogenesis, while it appears to be dispensable in germ cells.
2. Materials and Methods
2.1. Mice and Treatments
Mice of a mixed C57BL/6-129/Sv (50–50%) genetic background were housed in an animal facility licensed by the French Ministry of Agriculture (agreement no. D-67-218-37). All experiments were approved by the local ethical committee (Com’Eth, accreditations APAFIS#28483-2020120115253832) and were supervised by N.B.G., M.M., or N.V., who are qualified in compliance with the European Community guidelines for laboratory animal care and use (2010/63/UE).
Mice bearing L2 alleles of Rara, in which exon 6 is flanked by loxP sites [19], were bred with transgenic mice, driving the expression of Cre recombinase (i) in germ cells thanks to the Tg(Stra8-cre)1Reb transgene [20], hereafter referred to as Stra8-CreTg/0 mice, or (ii) in Sertoli cells thanks to the tamoxifen (TAM)-inducible Tg(Sox9-cre/ERT2)1Msan transgene [21], hereafter referred to as Sox9-CreERT2 Tg/0 mice. To monitor for efficient gene excision, we also introduced in each case the Gt(ROSA)26Sortm1(EYFP)Cos transgene, hereafter referred to as R26R-EYFPTg/0 mice [22]. This reporter directs the expression of EYFP in cells that have experienced Cre-mediated recombination. Mice were genotyped with primer sets as listed in Table 1.
Table 1.
Sequences of the primers used for genotyping mice.
| Gene or Transgene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Amplicon Size (bp) |
|---|---|---|---|
| Rara (+ allele) * | CAGGGAGGATGCTGTTTGTA | AACTGCTGCTCTGGGTCTCG | 371 |
| Rara (L2 allele) * | 427 | ||
| Rara (∆ allele) * | TACACTAACTACCCTTGACC | 357 | |
|
Tg(Stra8-cre)1Reb and Tg(Sox9-cre/ERT2)1Msan |
ATTTGCCTGCATTACCGGTC | ATCAACGTTTTCTTTTCGGA | 350 |
| Gt(ROSA)26Sortm1(EYFP)Cos (excised allele) | AAGGGAGCTGCAGTGGAGTA | TGGTGCAGATGAACTTCAGG | 620 |
* +, L2, and Δ correspond to wild-type, floxed, and excised allele of Rara gene, respectively.
In Stra8-CreTg/0 mice, the recombinase is first expressed at PN3 in a subset of undifferentiated spermatogonia and in all differentiating spermatogonia [20,23]. Both mutant and control males (bearing and free of Tg(Stra8-cre)1Reb transgene, respectively) were generated from the same breeding pairs, in the same litters.
In Sox9-CreERT2 Tg/0 mice, the recombinase is expressed in SOX9-positive cells throughout development and adulthood [21], including the postnatal Sertoli cells [24], where it becomes functional only upon TAM treatment. Experimental males (bearing and free of Tg(Sox9-cre/ERT2)1Msan transgene) were generated from the same breeding pairs, in the same litters. Pups were administered TAM (50 mg/kg body weight) by intraperitoneal injections, three times every second day, between PN5 and PN15. Both those bearing and those free of the transgene received TAM, precluding therefore that the observed abnormalities at later stages are due to this drug [25]. TAM (T5648, Sigma-Aldrich, 38070 Saint-Quentin-Fallavier, France) was dissolved in ethanol at a concentration of 100 mg/mL and further diluted in sunflower oil to a concentration of 10 mg/mL before administration.
2.2. Histology, Stage Frequencies, and Synchronization Factor
For histology, testis and cauda epididymis samples were fixed in Bouin’s fluid for 16 h and embedded in paraffin. Histological sections (5 μm thick) were stained with hematoxylin and eosin (HE) or with periodic acid–Schiff (PAS). Testes from at least three mice per genotype were analyzed at each time point.
In the seminiferous epithelium, the different generations of germ cells form cellular associations of fixed composition (called epithelial stages). Twelve epithelial stages (I–XII) can be identified in the mouse [26,27]. The determination of epithelial stages’ frequencies was performed on PAS-stained sections from 3- to 9-month-old mutants and control mice (bearing and free of Tg(Stra8-cre)1Reb transgene, respectively). Sections were scanned in a Hamamatsu NanoZoomer 2.0-HT scanner, and 200 to 300 seminiferous tubules per mouse were analyzed using the NDP.view2 software. The identifying features were as follows: stages I–III, small unstained or weakly stained proacrosomal granule; stage IV, acrosomic granule forming an indentation and beginning to flatten; stages V–VI, acrosomic system forming a straight PAS-positive line, with the angle subtended by the acrosome being lower than or equal to 120; stages VII–VIII, acrosome forming a cap that covers more than one-third of the nucleus; stage IX, oblong spermatid nuclei; stage X, elongating spermatid head displaying a sharp angle between its ventral and caudal surface; stage XI, spermatid nucleus thinner, more elongated and stained more intensely; stage XII, presence of meiotic metaphases, meiotic anaphases, and/or secondary spermatocytes. Testes from 10 controls, 3 heterozygotes, and 3 of each mutant type were analyzed. One entire testis cross-section was scanned for each animal.
The comparison of the stage frequencies was assessed using the synchronization factor as described by van Beek and Meistrich [28], for which we developed a program [29]. Statistical analysis was performed using a one-tailed Student’s t-test.
2.3. Immunohistochemistry (IHC) and In Situ Hybridization (ISH)
Testes were fixed by intracardiac perfusion of ice-cold 4% (w/v) paraformaldehyde dissolved in phosphate-buffered saline (PBS) and then kept in the same fixative overnight at 4 °C, washed in PBS, dehydrated, and embedded in paraffin. Sections (5 µm thick) were stored at 4 °C. To assess the specificity of the anti-RARA antibodies or the antisense Rara probe, testes from RaraSer−/− and/or Rara-knockout mutants [12,19] were used as “negative” controls.
For IHC, sections were processed for antigen retrieval for 20 min at 120 °C in a pressure cooker. They were rinsed in PBS and then incubated in a humidified chamber for 16 h at 4 °C, with the primary antibodies diluted in PBS containing 0.1% (v/v) Tween 20 (PBST). After rinsing in PBST (three times for 3 min each), detection of the bound primary antibodies was performed for 45 min at room temperature in a humidified chamber using dye-conjugated secondary antibodies. The sections were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to label nuclei and with Alexa Fluor 488-conjugated peanut agglutinin (lectin from Arachis hypogaea) to label the acrosomal systems. Antibodies used in the IHC, working dilution, and related procedure for antigen retrieval are listed in Table 2. Testes from 4 mice per genotype were analyzed at each time point (PN15, PN21, and 4 months old). IHC experiments were performed in triplicate.
Table 2.
List of antibodies used in the present study.
| Antigen | Species | Reference | Source | Dilution | Antigen Retrieval |
Secondary Antibody |
|---|---|---|---|---|---|---|
| AR | Rabbit | sc-816 | Santa Cruz Biotechnologies | 1/100 | Protocol 1 | Cy3-conjugated donkey anti-rabbit IgG |
| DDX4 | Rabbit | ab13840 | Abcam | 1/1000 | Protocol 1 | Cy3-conjugated goat anti-rabbit IgG |
| EYFP | Chicken | GFP-1020 | Aves | 1/1000 | Protocol 1 | Alexa Fluor 488-conjugated goat anti-chicken IgG |
| GATA1 | Rat | sc-265 | Santa Cruz Biotechnologies | 1/50 | Protocol 1 | Cy3-conjugated donkey anti-rat IgG |
| GATA4 | Goat | sc-1237 | Santa Cruz Biotechnologies | 1/75 | Protocol 1 | Alexa Fluor 488-conjugated donkey anti-goat IgG |
| RARA | Rabbit | RPalpha(F) | [30] | 1/50 | Protocol 2 | Cy3-conjugated donkey anti-rabbit IgG |
| RARA * | Rabbit | sc-551 | Santa Cruz Biotechnologies | 1/100 | Protocol 1 | Cy3-conjugated donkey anti-rabbit IgG |
| RARA * | Mouse | sc-515796 | Santa Cruz Biotechnologies | 1/25 | Protocol 1 | Cy3-conjugated donkey anti-mouse IgG |
| RARA ** | Mouse | NB200-322 | NovusBio | 1/1000 | Protocol 1 | Cy3-conjugated donkey anti-mouse IgG |
| RARA ** | Rabbit | NBP2-58082 | NovusBio | 1/100 | Protocol 2 | Cy3-conjugated donkey anti-rabbit IgG |
| RARA ** | Rabbit | CS-155-100 | Diagenode | 1/1000 | Protocol 2 | Cy3-conjugated donkey anti-rabbit IgG |
| RARA ** | Rabbit | C15310155 | Diagenode | 1/500 | Protocol 3 | Cy3-conjugated donkey anti-rabbit IgG |
| SOX9 | Rabbit | AB5535 | Merk Millipore | 1/1000 | Protocol 1 | Alexa Fluor 488-conjugated donkey anti-rabbit IgG |
Protocol 1: 10 mM sodium citrate buffer (pH = 6.0); Protocol 2: 10 mM tris base, 1 mM EDTA, and 0.05% (v/v) Tween 20 (pH = 9.0); Protocol 3: 0.05% citraconic anhydride buffer (pH = 7.4). * These antibodies recognize epitopes which are not RARA (see below); ** these antibodies recognize epitopes which are not RARA, as illustrated in Figure S1.
For ISH, the BaseScope v2–RED Reagent kit was used according to the manufacturer’s instructions (Advanced Cell Diagnostics, ref. 323900). Briefly, deparaffinized sections were treated with hydrogen peroxide for 10 min, washed in distilled water, and boiled at 100 °C for 10 min in the target retrieval reagent. Protease IV was then applied for 15 min at 40 °C on dehydrated sections. After rinsing in distilled water, prewarmed probes (Mm-Ppib, ref. 320881, and Mm-Rara, ref. 824731) were applied on the sections for 2 h at 40 °C. The slides were then washed in the appropriate buffer and subjected to a series of signal amplifications (AMP1 to AMP8). Hybridization signals were detected using the chromogenic Fast RED-B/Fast RED-A reagent. The sections were counterstained for 3 min with 12.5% (v/v) Harris hematoxylin, and then for 20 s in 0.02% (v/v) ammonium hydroxide, both diluted in distilled water. Four samples per genotype at PN15 were analyzed in duplicate.
2.4. Counts of Sertoli Cells Expressing RARA
Sertoli cell counts were performed on at least 10 seminiferous tubule cross-sections from the testes of PN21 TAM-treated mice (bearing and free of Tg(Sox9-cre/ERT2)1Msan transgene). Testes from 4 mice per genotype at PN21 were analyzed. The proportion of RARA-expressing Sertoli cells was expressed as a percentage of GATA4-positive Sertoli cells. Statistical analysis was performed using a one-tailed Student’s t-test, having verified for equal variance after arcsine transformation of the percentages.
3. Results and Discussion
3.1. Spermatogenesis Is Not Altered in Males Lacking RARA in Germ Cells
In the first approach (Figure 1A), we bred Stra8-CreTg/0 females with RaraL2/L2 males. Then, Stra8-CreTg/0/Rara+/L2 females were mated with RaraL2/L2/R26R-EYFPTg/0 males to generate the F2 offspring. This was performed because the Tg(Stra8-cre)1Reb transgene is not functional in the ovary [20], thereby avoiding deletion of the floxed alleles in the germ cells and transmission of null, excised (∆) alleles of Rara to the F2 offspring [31]. Genotyping of these F2 mice showed that the L2 alleles were detected in DNA extracted from tail biopsies of Tg(Stra8-cre)1Reb-positive mice, while the excised (∆) allele of Rara was not detected, as expected (Figure 1B). Loss of RARA in germ cells could not be evidenced by IHC because (i) all the commercially available antibodies directed against RARA that we tested lack specificity (Figure 2 and Figure S1) and (ii) the RPalpha(F) antibody [30] displays low sensitivity and did not allow for detecting RARA in germ cells [8]. Thus, Cre-mediated ablation of the Rara gene in germ cells of 3-month-old males was assessed by visualizing the expression of the excised Gt(ROSA)26Sortm1(EYFP)Cos reporter transgene on testis sections. In agreement with previous reports [2,16,17], we found that EYFP was robustly expressed in all germ cells of Stra8-CreTg/0/RaraL2/L2/R26R-EYFPTg/0 males, from the pachytene spermatocyte to the elongated spermatid stages. Expression of EYFP was weaker in the earlier stages of germ cell differentiation (Figure 1C). Moreover, EYFP was not detected in somatic cells, as expected. Assuming that the expression of the reporter faithfully reflects the excision of Rara alleles, loss of RARA occurred in all germ cells. Our breading procedure yielded both control (RaraL2/L2/R26R-EYFPTg/0) and mutant (Stra8-CreTg/0/RaraL2/L2/R26R-EYFPTg/0) males, hereafter referred to as RaraGerm+/+ and RaraGerm−/− mice, respectively.
Figure 1.
RaraGerm−/− mutants display normal spermatogenesis. (A) Breeding scheme. Stra8-CreTg/0 females were crossed with RaraL2/L2 males. This produced Stra8-CreTg/0/Rara+/L2 F1 females, who were bred with RaraL2/L2/R26R-EYFPTg/0 males to produce control (RaraGerm+/+) and mutant (RaraGerm−/−) mice in F2. (B) Representative PCR analysis of tail DNA from F2 males with the genotype as indicated. The 427-, 371-, and 357-bp-long fragments correspond to floxed (L2), wild-type (+), and excised (∆) alleles of the Rara gene, respectively (upper panel). Rara∆/L2, Rara+/L2, and RaraL2/L2 were used as PCR controls, as indicated. Note that the ∆ allele of Rara is absent from the F2 progeny, as expected (upper panel). The 350-bp-long fragment corresponds to the Tg(Stra8-cre)1Reb transgene (Cre, lower panel). L: ladder; bp: base pair. (C) Detection of DDX4 (red signal) and EYFP (green signal) on histological sections of testes from 3-month-old control (RaraGerm+/+) and mutant (RaraGerm−/−) mice bearing the reporter transgene. Nuclei were counterstained with DAPI (blue signal). In the control testis, EYFP was not detected (upper panel). In the mutant testis, EYFP was detected in all pachytene spermatocytes and spermatids, but not in Sertoli cells (lower panel). This illustrates efficient Cre-mediated excision in mutant mice. (D) PAS stains illustrating normal germ cell associations in the seminiferous epithelium of 3-month-old control (RaraGerm+/+) and mutant (RaraGerm−/−) testes, as indicated. Legend: prL, L, and P, preleptotene, leptotene, and pachytene spermatocytes, respectively; Ser, Sertoli cell; St2–3 to St10, steps 2–3 to step 10 of spermatid maturation; StE, elongated spermatid; StR, round spermatid; II–III, VII, IX, and X, epithelial stages. Scale bar: 10 μm in (C); 70 μm in (D).
Figure 2.
Two commercially available antibodies directed against RARA lacked specificity in IHC experiments. IHC analysis on histological sections of testes from 8-week-old wild-type (WT) and Rara-knockout mice (Rara-null). (A) The sc-551 antibody recognized an epitope (red signal) which was distinct from RARA because it was similarly detected in the cytoplasm of Sertoli cells of WT and Rara-null mice. Sertoli cell nuclei were identified by using an antibody directed against the GATA4 transcription factor (green signal). (B) The sc-525796 antibody recognized a nuclear epitope (red signal) which was distinct from RARA because it was detected in the nuclei of germ cells (arrowheads) and Sertoli cells (arrows) of WT and Rara-null mice. The right panels show enlargements of the boxes in the left panels. Nuclei were counterstained with DAPI (blue signal). Star indicates interstitial signal due to the use of a mouse monoclonal antibody. Scale bar: 80 µm for left panels; 20 μm for right panels.
Quite surprisingly, in view of the pathological phenotype described in Rara-cKO mutants [16], RaraGerm−/− males (n = 3) were fertile. When mated with wild-type females, they sired 10 litters for a total of 78 pups. In comparison, RaraGerm+/+ males (n = 11) sired 21 litters for a total of 146 pups. This was not statistically different from the reproductive capabilities of the RaraGerm−/− males (p = 0.25). Testis sections of 3-month-old RaraGerm+/+ (n = 10) and RaraGerm−/− males (n = 3) were stained using PAS and analyzed. In both RaraGerm+/+ and RaraGerm−/− males, the cellular associations characterizing the twelve stages of the seminiferous epithelium cycle (I to XII) were readily identified. Moreover, in agreement with the fertility of RaraGerm−/− males, their seminiferous epithelium also displayed normal histology (Figure 1D), with the twelve stages of the cycle present in normal proportions (Figure 3A). Accordingly, the mean synchronization factors were similar (Figure 3B). These data indicate that RaraGerm−/− males display normal spermatogenesis, as opposed to Rara-cKO mutants [16].
Figure 3.
The distribution of the stages of the seminiferous epithelium cycle was normal in mutants lacking RARA in germ cells. (A) Relative frequencies of the 12 stages of the seminiferous epithelium cycle (I to XII) in control (RaraGerm+/+, red bars), heterozygote (Rara∆/L2, orange bars), and mutant (RaraGerm−/−, blue bars; Rara∆/Germ−, green bars) mice. (B) Calculated synchronization factors. Error bars represent standard deviations (n = 10 for RaraGerm+/+; n = 3 for other genotypes). NS, not statistically significant.
The lack of abnormalities in the testis of RaraGerm−/− males compared to Rara-cKO males [16] led to questioning the efficacy of Rara gene excision in germ cells of RaraGerm−/− males [31]. Since the recombination of a given floxed sequence by Cre depends on its genomic context [32], one could figure out that the Gt(ROSA)26Sortm1(EYFP)Cos transgene was accessible for Cre-mediated recombination, while the Rara locus was not. Thus, in the second approach (Figure 4A), we bred Stra8-CreTg/0/Rara+/L2 F1 males with RaraL2/L2/R26R-EYFPTg/0 females in order to transmit one excised (∆) allele of Rara to the F2 offspring. In fact, the sperm of Stra8-CreTg/0/Rara+/L2 F1 males transmitted either the Rara+ or the Rara∆ allele because of the expression of Cre in their germ cells thanks to the Tg(Stra8-cre)1Reb transgene. This breeding scheme reduced the amount of floxed Rara alleles that Cre had to excise in the germ cells of F2 males and additionally presented the advantage of being identical to the one set up by Peer et al. in their study [16]. Genotyping of tail biopsies from F2 males showed that the excised (∆) allele of Rara was present in some animals, even in absence of the Tg(Stra8-cre)1Reb transgene (Figure 4B). This observation confirmed that excision of Rara had occurred in the sperm of the Stra8-CreTg/0/Rara+/L2 F1 father, who transmitted a null (∆) allele to its progeny. The Stra8-CreTg/0/Rara∆/L2/R26R-EYFPTg/0 F2 males (hereafter named RaraΔ/Germ−) were considered mutants (i.e., lacking RARA in germ cells). Importantly, F2 males without the Tg(Stra8-cre)1Reb transgene were obtained from the same breeding pairs and were used as controls (hereafter named Rara∆/L2 males).
Figure 4.
Rara∆/Germ− mice display normal spermatogenesis (A) Breeding scheme. Stra8-CreTg/0 females were crossed with RaraL2/L2 males. This produced Stra8-CreTg/0/Rara+/L2 F1 males, who transmitted either the Rara+ or the Rara∆ allele to their F2 progeny when bred with RaraL2/L2/R26R-EYFPTg/0 females. This generated control (Rara∆/L2) and mutant (Rara∆/Germ−) mice in F2. (B) Representative PCR analysis of tail DNA from F2 males with the genotypes as indicated. The 427-, 371-, and 357-bp-long fragments correspond to floxed (L2), wild-type (+), and excised (∆) alleles of the Rara gene, respectively (upper panel). Rara∆/L2, Rara+/L2, and RaraL2/L2 were used as PCR controls, as indicated. An L2 allele, transmitted by the female, was detected in each F2 progeny. The + and ∆ alleles, transmitted by the male, were detected in a mutually exclusive manner. The 350-bp-long fragment corresponds to the Tg(Stra8-cre)1Reb transgene (Cre, lower panel). L: ladder; bp: base pair. (C) Detection of EYFP by ultraviolet light illumination in pups born from a Rara∆/Germ− male mated with a wild-type (WT) female (upper panel). EYFP-positive (e.g., #1, #2, #4, and #5) and EYFP-negative (e.g., #3) progenies were obtained in a Mendelian proportion (50%), as expected if almost 100% of germ cells from the father underwent Cre-mediated recombination (i.e., were ablated for the reporter). Representative PCR analysis of tail DNA progenies as indicated. A 350-bp-long fragment corresponds to the Tg(Stra8-cre)1Reb transgene (Cre), and a 620-bp-long fragment corresponds to the Cre-recombined reporter (EYFP). (D) PAS stains illustrating normal germ cell associations in the seminiferous epithelium of 9-month-old control (Rara∆/L2) and mutant (Rara∆/Germ−) testes. Legend: prL, L, and P, preleptotene, leptotene, and pachytene spermatocytes, respectively; St2–3 to St10, steps 2–3 to step 10 of spermatid maturation; II–III, VII, IX, and X, epithelial stages. Scale bar: 70 μm in (D).
Here again, RaraΔ/Germ− males (n = 5) were fertile. When mated with wild-type females, they sired 14 litters, with an average of 7.6 pups per litter, a proportion similar to the one obtained from control males (see above). Most importantly, out of the 185 pups born from this breeding, 179 (i.e., ~94%) were Rara∆/+ and 6 (i.e., 6%) were RaraL2/+. This finding indicates that recombination of the Rara locus by Cre was efficient in almost 94% of the germ cells produced by RaraΔ/Germ− males. In agreement with this finding, a Mendelian proportion of pups sired by RaraΔ/Germ− males were EYFP-positive when observed under ultraviolet light illumination (Figure 4C). Thus, even though we could not evidence RARA loss by IHC (Figure 2 and Figure S1), we concluded that RaraΔ/Germ− mice were actually deprived of RARA in 94% of their germ cells. Next, we carefully analyzed the histology of the testes from 9-month-old RaraΔ/Germ− males (n = 3) (Figure 4D). The full representation of the germ cell associations that are characteristic of the 12 stages of the seminiferous epithelium cycle was present in similar proportions in testes from Rara∆/Germ− and Rara∆/L2 males (Figure 3A). Their mean synchronization factor was accordingly similar to that of controls (Figure 3B). Altogether, these experiments show that Rara is efficiently inactivated in germ cells without causing any defect in spermatogenesis.
This finding clearly contradicts the proposal that RARA plays an essential role in germ cells [16]. While looking for an explanation for such a discrepancy, we noticed that the loxP-flanked allele of Rara (Rarafl allele), used to generate Rara-cKO males, still contains a neomycin resistance mini-gene in intron #3, the orientation of which is opposite to that of the Rara gene [16]. Often, the insertion of a mini-gene in an intron interferes with the normal functioning of the targeted allele, generating a so-called “hypomorphic” allele driving diminished gene expression (reviewed in [33,34]). One can easily conceive that the expression of Rara driven by the Rarafl allele is not optimal, a possibility that cannot be assessed because males without Rarafl alleles were used as controls, unfortunately [16]. If the Rarafl allele is actually hypomorphic, one can hypothesize that Rara-cKO males not only lack RARA in germ cells, but they also suffer from RARA insufficiency in all other cell types, including Sertoli cells. In keeping with this hypothesis, it is worth noting that males lacking RARA in Sertoli cells opportunely display vacuolization of their seminiferous epithelium and sloughing of immature germ cells [12], just like Rara-cKO males do [16].
Although the present study shows that ablating solely the Rara gene in germ cells has no visible impact on spermatogenesis, it was previously found that the combined ablation of Rara and Rarg in germ cells yields an arrest of spermatogonia differentiation [17], which is more severe than that observed when solely Rarg is ablated [15]. This clearly indicates that RARA partially compensates for the loss of RARG, but it is fully dispensable when RARG is present.
3.2. RARA Exerts Most, If Not All, of Its Functions on Spermatogenesis in Postnatal Sertoli Cells
Aside from germ cells, RARA is strongly expressed in Sertoli cells [8,12]. The fate of these cells is established during embryonic development, at the time of sex determination. In the mouse, this occurs at around E12.5 [35]. Then, Sertoli cells proliferate prior to puberty and terminally differentiate to become postmitotic at puberty, at around PN15 [36]. RARA expression in Sertoli cells starts as early as E13.5 [37] and persists throughout adulthood [8]. Ablation of Rara in Sertoli cells from E13.5 (RaraSer−/− mutants) [12] does not allow for discriminating the functions exerted by RARA during the fetal period and at later stages of development. It was recently proposed that both testosterone production by Leydig cells and proliferation of Sertoli cells are controlled by RARA during the fetal period [37]. As some of the defects displayed by RaraSer−/− mutants (e.g., vacuolization of the seminiferous epithelium, loss of germ cells) may have arisen as a consequence of altered Sertoli cell proliferation or reduced testosterone synthesis by Leydig cells during fetal life, determining whether prenatal expression of RARA in Sertoli cell is sufficient to ensure normal spermatogenesis remained an important question.
In this context, we aimed to assess the role of RARA in spermatogenesis in postnatal Sertoli cells by inducing ablation of Rara using a tamoxifen-inducible Cre-loxP mutagenesis system. We chose to ablate the Rara gene before Sertoli cells became postmitotic but after the onset of the first spermatogenic wave (i.e., between PN5 and PN15). To do so, RaraL2/L2 mice were crossed with Sox9-CreERT2 Tg/0 transgenics, thereby generating both RaraL2/L2 and Sox9-CreERT2 Tg/0/RaraL2/L2 experimental males from the same breeding pairs (Figure S2A). They were all treated with TAM, as recommended [25], three times between PN5 and PN15 and analyzed at several time points as indicated (Figure 5A).
Figure 5.
Evidence for ablation of Rara gene in postnatal Sertoli cells. (A) Diagram illustrating the time-course of TAM administration to F3 RaraL2/L2 and Sox9-CreERT2 Tg/0/RaraL2/L2 experimental males (see also Figure S2). Pups were intraperitoneally injected with TAM three times, every other day, between PN5 and PN15 and analyzed at the time points as indicated. (B) ISH showing expression of Rara and Ppib mRNA on testis sections with the indicated genotype at PN15. Nuclei were counterstained with hematoxylin (light blue signal). Few red dots revealing Rara mRNA were observed in testis sections from RaraSer−/− and RaraSer−/−PN15 mutant males, while numerous red dots were detected in the RaraSer+/+ control testis (left panel). As expected, abundant red dots revealing the ubiquitous Ppib mRNA were evidenced in each sample. Insets show higher magnifications. (C) IHC showing expression of RARA (red signal) and GATA4 (green signal) on testis sections with the indicated genotype at PN15. Overlapping signals yield an orange staining. Nuclei were counterstained with DAPI (blue signal). Arrows and arrowheads point to RARA-positive and RARA-negative Sertoli cell nuclei, respectively. Scale bar: 60 µm in (B); 25 μm in (C).
To evaluate if TAM-treated Sox9-CreERT2 Tg/0/RaraL2/L2 males actually lacked RARA in their Sertoli cells, we first performed ISH analyses. They showed that Rara mRNA could not be detected in their testes (n = 4) at PN15 (i.e., between 4 and 6 days after the last TAM administration). The number of dots detected in this situation was almost identical to that observed in the testes of RaraSer−/− mutants (Figure 5B). Accordingly, TAM-treated Sox9-CreERT2 Tg/0/RaraL2/L2 males are hereafter referred to as RaraSer−/−PN15 mice. Further IHC analyses were performed combining the use of anti-RARA [8,30] and anti-GATA4 antibodies for detecting Sertoli cells. In all the RaraSer−/−PN15 mutants analyzed at PN15 (n = 4) and PN21 (n = 4), the seminiferous tubules contained many Sertoli cells devoid of RARA, but some others were still expressing it (Figure 5C and Figure S2B). Quantification on histological sections revealed that 35 ± 11% of Sertoli cells remained RARA-positive at PN21 (Figure S2C). Importantly, these Sertoli cells were always scattered across the seminiferous tubules, with no case where all the Sertoli cells of a given tubule still expressed RARA. Thus, ablation of the Rara alleles occurred in about 65% of the Sertoli cells from the RaraSer−/−PN15 mutants, and no seminiferous tubule escaped Cre-mediated recombination. The reason RARA remains present in some Sertoli cells is unclear. It is possible that the protein half-life is long enough to make RARA persist for a few hours, even in the absence of its mRNA [38].
Most importantly, despite the persistence of RARA in some Sertoli cells, all the RaraSer−/−PN15 mutants were infertile (n = 19). To uncover the reason for their infertility, we performed histological analyses at 3.5 months after the last TAM treatment (Figure 6). Testis sections from these males (n = 12) showed that mature spermatids failed to align at the luminal side of the seminiferous epithelium and were often retained within the epithelium (insets in Figure 6B,C). Many seminiferous tubule sections, distributed through-out the testis, displayed large vacuoles (Figure 6E,F) or were depleted of germ cells (Figure 6F). Accordingly, the caudal epididymis contained few spermatozoa but an unusually high number of round immature germ cells, suggesting extensive desquamation of cells from the seminiferous epithelium (Figure 6H,I). The degree of vacuolation and tubule degeneration varied between RaraSer−/−PN15 mutants. About 80% of them (i.e., 10 out of 12) were considered severely affected; more than half of their seminiferous tubule sections contained more than two vacuoles (Figure 6C,F,I). The remaining 20% were mildly affected; about one-fifth of their seminiferous tubules sections contained one or two vacuoles (Figure 6B,E,H). These alterations were not regionalized to a particular area but were distributed across the testes.
Figure 6.
Loss of RARA in Sertoli cells from PN15 yields seminiferous epithelium defects in adulthood. Histological analyses of testis and epididymis of 4-month-old control and RaraSer−/−PN15 mice. (A–C) PAS stains of histological sections through the testis, illustrating retained mature spermatids at epithelial stage IX in RaraSer−/−PN15 mutants. The insets show high-magnification views of the boxed areas. Arrowheads point to retained mature spermatids. (D–F) HE stains of histological sections through the testis, illustrating vacuolation of the seminiferous epithelium in RaraSer−/−PN15 mutants. (G–I) HE stains of histological sections through the caudal epididymis. The epididymis of RaraSer−/−PN15 mutants contains fewer spermatozoa (compare SZ in G–I) but numerous round germ cells. Legend: R, round immature germ cells; St9, step 9 of spermatid maturation; SZ, spermatozoa; T*, tubule depleted of germ cells; VA, vacuoles; IX, epithelial stage. Scale bar: 75 μm in (A–C) and (G–I); 150 μm in (D–F).
Interestingly, the histological abnormalities displayed by our RaraSer−/−PN15 mutants are similar in all respects to those we described in RaraSer−/− mice, including the variability between individuals [12]. This finding indicates that (i) heterogeneity in the severity of the abnormalities is not linked to the proportion of Sertoli cells that have lost RARA, and (ii) RARA produced by Sertoli cells until PN15 is dispensable for the proper development of the seminiferous epithelium. In this context, our study casts doubt on the proposal that RARA is instrumental to Sertoli cell proliferation during the fetal period [37].
Several genes normally display a periodical pattern of expression in Sertoli cells at given stages of the seminiferous epithelium cycle [39,40]. In the present study, we investigated the periodical expression of selected genes in Sertoli cells through IHC analysis of 4-month-old testes using anti-GATA-1 [41] and anti-androgen receptor (AR) [42] antibodies. As expected, GATA1 expression in Sertoli cells was high at stage VII and very low at stage XII of the seminiferous epithelium cycle in control testes (Figure 7A). In RaraSer−/−PN15 mutants, GATA1 was detected in Sertoli cells at all stages of the seminiferous epithelium cycle (Figure 7B). Along the same lines, AR expression was robust in Sertoli cells at stage V and weak at stage XII of the control testes (Figure 7C), but it was high all along the cycle of the seminiferous epithelium in RaraSer−/−PN15 mutants (Figure 7D). We conclude from these experiments that the loss of RARA in Sertoli cells during puberty abrogates their periodical expression of GATA1 and AR. Interestingly, this occurs even though RARA appears not lost in all Sertoli cells of a given seminiferous tubule. As a similar phenomenon is observed in a germ cell-deficient environment [1], it is possible that abrogation of the periodical expression of genes in Sertoli cells of RaraSer−/−PN15 mutants is linked to their loss of germ cells. Our present data thus suggest that RARA maintains the periodical activity of Sertoli cells rather than initiating it during fetal development, as we previously proposed [12].
Figure 7.
Loss of RARA in Sertoli cells from PN15 abrogates the periodical expression of genes in adulthood. IHC analysis on histological sections from testes of 4-month-old control and RaraSer−/−PN15 mutant mice. (A,B) In the control, GATA1 expression (red signal) was strong in Sertoli cell nuclei at stage VII and at the background level at stage XII of the seminiferous epithelium cycle. In the RaraSer−/−PN15 testis, GATA1 was uniformly expressed at all epithelial stages. Sertoli cell nuclei were identified using an antibody directed against SOX9 (green signal in Sertoli cells). (C,D) In the control, AR expression (red signal) was strong in Sertoli cell nuclei at stage V and weak at stage XII. In the RaraSer−/−PN15 testis, AR was uniformly expressed at all epithelial stages. Nuclei were counterstained by DAPI (blue signal). In (A–D), the acrosomal system is identified by Alexa Fluor 488-conjugated peanut agglutinin (green signal), allowing proper staging. The dotted lines indicate the periphery of seminiferous tubules. Legend: E, elongated spermatids; M, spermatocytes in metaphase; PR and P, preleptotene and pachytene spermatocytes, respectively; R, round spermatids; S, Sertoli cells; S2, type 2 spermatocytes; Z, zygotene spermatocytes. Roman numerals designate stages of the seminiferous epithelium cycle. Scale bar: 70 μm.
4. Conclusions
RARs are nuclear transcription factors that, once activated by ATRA, regulate the expression of target genes, which in turn control various processes, among which is spermatogenesis. As Rara-knockout mice display a pathological testis phenotype and RARA is expressed in both somatic and germ cells of the testis, a strong research effort has been directed towards the identification of the cell types in which RARA is operational [12,13,16,17,43]. Our present study adds to this effort. Firstly, by showing that ablation of RARA in germ cells has no effects on testis integrity and functioning, it invalidates the recent proposal that RARA has dual functions in germ cells, balancing proliferation and differentiation of spermatogonia and controlling genome integrity during meiosis. Secondly, it shows that ablation of RARA in Sertoli cells, starting from PN15, recapitulates the complete set of abnormalities induced by knocking out Rara in all cells. Thus, it demonstrates that RARA exerts all its functions in Sertoli cells only, and at puberty but not at fetal stages. Although being a challenging and difficult task, it is now necessary to reveal more specifically the gene networks and mechanisms that RARA governs in Sertoli cells to allow proper spermatogenesis. Animal models with controlled ablation of Rara in Sertoli cells as we presented here could be useful in such future studies.
Acknowledgments
We thank Cecile Rochette-Egly and R. Lutzing for providing us with the latest available aliquots of the RPalpha(F) antibody against RARA. N.V. thanks the French National Center for Scientific Research (CNRS), the French National Institute of Health and Medical Research (INSERM), the Initiative of Excellence (IdEx), the Laboratories of Excellence (LabEx), and Strasbourg University.
Abbreviations
| ATRA | All-trans retinoic acid |
| DAPI | 4′,6-diamidino-2-phenylindole |
| E13.5 | Embryonic day 13.5 |
| HE | Hematoxylin–eosin |
| IHC | Immunohistochemistry |
| ISH | In situ hybridization |
| PAS | Periodic acid–Schiff |
| PBS | Phosphate-buffered saline |
| PBST | Phosphate-buffered saline containing Tween 20 |
| PN0 to PN21 | Postnatal days 0 to 21 |
| RAR | Retinoic acid receptor |
| TAM | Tamoxifen |
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells11050891/s1. Figure S1: Four commercially available antibodies directed against RARA recognize epitopes which are not RARA and are therefore not suitable for IHC experiments. Figure S2: Generation of mice in which Rara deletion is induced in Sertoli cells after birth, and quantitative assessment of RARA loss.
Author Contributions
Conceptualization, D.C., S.S.-C., M.M., N.B.G. and N.V.; methodology, M.M. and N.B.G.; software, S.F.; validation, D.C., B.F., M.K. and N.V.; formal analysis, N.V.; investigation, D.C., S.S.-C., B.F., M.K. and N.V.; resources, M.M., N.B.G. and N.V.; data curation, N.V.; writing—original draft preparation, N.B.G. and N.V.; writing—review and editing, D.C., S.S.-C., B.F., M.K., S.F., M.M., N.B.G. and N.V.; visualization, D.C., B.F., N.B.G. and N.V.; supervision, N.B.G. and N.V.; project administration, D.C., S.S.-C. and N.V.; funding acquisition, M.M., N.B.G. and N.V. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by grants from the CNRS, INSERM, UNISTRA, and Agence Nationale pour la Recherche (ANR-17-CE14-0010-01 and ANR-20-CE14-0022). It was also supported in part by the grant ANR-10-LABX-0030-INRT, a French State fund managed by the ANR under the frame of the program Investissements d’Avenir (ANR-10-IDEX-0002-02).
Institutional Review Board Statement
The animal study protocol was approved by the Institutional Ethics Committee of the IGBMC (protocol code APAFIS#28483-2020120115253832).
Informed Consent Statement
Not applicable.
Data Availability Statement
The authors confirm that the data supporting the findings of this study are available within the article and its Supplementary Materials.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Gewiss R.L., Schleif M.C., Griswold M.D. The role of retinoic acid in the commitment to meiosis. Asian J. Androl. 2021;23:549–554. doi: 10.4103/aja202156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Teletin M., Vernet N., Yu J., Klopfenstein M., Jones J.W., Feret B., Kane M.A., Ghyselinck N.B., Mark M. Two functionally redundant sources of retinoic acid secure spermatogonia differentiation in the seminiferous epithelium. Development. 2019;146:dev170225. doi: 10.1242/dev.170225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Gaemers I.C., van Pelt A.M., van der Saag P.T., de Rooij D.G. All-trans-4-oxo-retinoic acid: A potent inducer of in vivo proliferation of growth-arrested A spermatogonia in the vitamin A-deficient mouse testis. Endocrinology. 1996;137:479–485. doi: 10.1210/endo.137.2.8593792. [DOI] [PubMed] [Google Scholar]
- 4.Ghyselinck N.B., Vernet N., Dennefeld C., Giese N., Nau H., Chambon P., Viville S., Mark M. Retinoids and spermatogenesis: Lessons from mutant mice lacking the plasma retinol binding protein. Dev. Dyn. 2006;235:1608–1622. doi: 10.1002/dvdy.20795. [DOI] [PubMed] [Google Scholar]
- 5.Van Pelt A.M., de Rooij D.G. Retinoic acid is able to reinitiate spermatogenesis in vitamin A-deficient rats and high replicate doses support the full development of spermatogenic cells. Endocrinology. 1991;128:697–704. doi: 10.1210/endo-128-2-697. [DOI] [PubMed] [Google Scholar]
- 6.Chambon P. The nuclear receptor superfamily: A personal retrospect on the first two decades. Mol. Endocrinol. 2005;19:1418–1428. doi: 10.1210/me.2005-0125. [DOI] [PubMed] [Google Scholar]
- 7.Boulogne B., Levacher C., Durand P., Habert R. Retinoic acid receptors and retinoid X receptors in the rat testis during fetal and postnatal development: Immunolocalization and implication in the control of the number of gonocytes. Biol. Reprod. 1999;61:1548–1557. doi: 10.1095/biolreprod61.6.1548. [DOI] [PubMed] [Google Scholar]
- 8.Vernet N., Dennefeld C., Rochette-Egly C., Oulad-Abdelghani M., Chambon P., Ghyselinck N.B., Mark M. Retinoic acid metabolism and signaling pathways in the adult and developing mouse testis. Endocrinology. 2006;147:96–110. doi: 10.1210/en.2005-0953. [DOI] [PubMed] [Google Scholar]
- 9.Lord T., Oatley M.J., Oatley J.M. Testicular Architecture Is Critical for Mediation of Retinoic Acid Responsiveness by Undifferentiated Spermatogonial Subtypes in the Mouse. Stem Cell Rep. 2018;10:538–552. doi: 10.1016/j.stemcr.2018.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ghyselinck N.B., Dupe V., Dierich A., Messaddeq N., Garnier J.M., Rochette-Egly C., Chambon P., Mark M. Role of the retinoic acid receptor beta (RARbeta) during mouse development. Int. J. Dev. Biol. 1997;41:425–447. [PubMed] [Google Scholar]
- 11.Luo J., Pasceri P., Conlon R.A., Rossant J., Giguere V. Mice lacking all isoforms of retinoic acid receptor beta develop normally and are susceptible to the teratogenic effects of retinoic acid. Mech. Dev. 1995;53:61–71. doi: 10.1016/0925-4773(95)00424-6. [DOI] [PubMed] [Google Scholar]
- 12.Vernet N., Dennefeld C., Guillou F., Chambon P., Ghyselinck N.B., Mark M. Prepubertal testis development relies on retinoic acid but not rexinoid receptors in Sertoli cells. EMBO J. 2006;25:5816–5825. doi: 10.1038/sj.emboj.7601447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Doyle T.J., Braun K.W., McLean D.J., Wright R.W., Griswold M.D., Kim K.H. Potential functions of retinoic acid receptor A in Sertoli cells and germ cells during spermatogenesis. Ann. N. Y. Acad. Sci. 2007;1120:114–130. doi: 10.1196/annals.1411.008. [DOI] [PubMed] [Google Scholar]
- 14.Lufkin T., Lohnes D., Mark M., Dierich A., Gorry P., Gaub M.P., LeMeur M., Chambon P. High postnatal lethality and testis degeneration in retinoic acid receptor alpha mutant mice. Proc. Natl. Acad. Sci. USA. 1993;90:7225–7229. doi: 10.1073/pnas.90.15.7225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Gely-Pernot A., Raverdeau M., Celebi C., Dennefeld C., Feret B., Klopfenstein M., Yoshida S., Ghyselinck N.B., Mark M. Spermatogonia differentiation requires retinoic acid receptor gamma. Endocrinology. 2012;153:438–449. doi: 10.1210/en.2011-1102. [DOI] [PubMed] [Google Scholar]
- 16.Peer N.R., Law S.M., Murdoch B., Goulding E.H., Eddy E.M., Kim K. Germ Cell-Specific Retinoic Acid Receptor alpha Functions in Germ Cell Organization, Meiotic Integrity, and Spermatogonia. Endocrinology. 2018;159:3403–3420. doi: 10.1210/en.2018-00533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gely-Pernot A., Raverdeau M., Teletin M., Vernet N., Feret B., Klopfenstein M., Dennefeld C., Davidson I., Benoit G., Mark M., et al. Retinoic Acid Receptors Control Spermatogonia Cell-Fate and Induce Expression of the SALL4A Transcription Factor. PLoS Genet. 2015;11:e1005501. doi: 10.1371/journal.pgen.1005501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chung S.S., Wang X., Wolgemuth D.J. Male sterility in mice lacking retinoic acid receptor alpha involves specific abnormalities in spermiogenesis. Differentiation. 2005;73:188–198. doi: 10.1111/j.1432-0436.2005.00018.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Chapellier B., Mark M., Garnier J.M., LeMeur M., Chambon P., Ghyselinck N.B. A conditional floxed (loxP-flanked) allele for the retinoic acid receptor alpha (RARalpha) gene. Genesis. 2002;32:87–90. doi: 10.1002/gene.10071. [DOI] [PubMed] [Google Scholar]
- 20.Sadate-Ngatchou P.I., Payne C.J., Dearth A.T., Braun R.E. Cre recombinase activity specific to postnatal, premeiotic male germ cells in transgenic mice. Genesis. 2008;46:738–742. doi: 10.1002/dvg.20437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kopp J.L., Dubois C.L., Schaffer A.E., Hao E., Shih H.P., Seymour P.A., Ma J., Sander M. Sox9+ ductal cells are multipotent progenitors throughout development but do not produce new endocrine cells in the normal or injured adult pancreas. Development. 2011;138:653–665. doi: 10.1242/dev.056499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Srinivas S., Watanabe T., Lin C.S., William C.M., Tanabe Y., Jessell T.M., Costantini F. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev. Biol. 2001;1:4. doi: 10.1186/1471-213X-1-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Gallagher S.J., Kofman A.E., Huszar J.M., Dannenberg J.H., DePinho R.A., Braun R.E., Payne C.J. Distinct requirements for Sin3a in perinatal male gonocytes and differentiating spermatogonia. Dev. Biol. 2013;373:83–94. doi: 10.1016/j.ydbio.2012.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Barrionuevo F.J., Hurtado A., Kim G.J., Real F.M., Bakkali M., Kopp J.L., Sander M., Scherer G., Burgos M., Jimenez R. Sox9 and Sox8 protect the adult testis from male-to-female genetic reprogramming and complete degeneration. eLife. 2016;5:e15635. doi: 10.7554/eLife.15635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Patel S.H., O’Hara L., Atanassova N., Smith S.E., Curley M.K., Rebourcet D., Darbey A.L., Gannon A.L., Sharpe R.M., Smith L.B. Low-dose tamoxifen treatment in juvenile males has long-term adverse effects on the reproductive system: Implications for inducible transgenics. Sci. Rep. 2017;7:8991. doi: 10.1038/s41598-017-09016-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ahmed E.A., de Rooij D.G. Staging of mouse seminiferous tubule cross-sections. Methods Mol. Biol. 2009;558:263–277. doi: 10.1007/978-1-60761-103-5_16. [DOI] [PubMed] [Google Scholar]
- 27.Russell L.D., Ettlin R.A., Hikim A.P.S., Clegg E.D. Histological and Histopathological Evaluation of the Testis. 1st ed. Cache River Press; Clearwater, FL, USA: 1990. [Google Scholar]
- 28.Van Beek M.E., Meistrich M.L. A method for quantifying synchrony in testes of rats treated with vitamin A deprivation and readministration. Biol. Reprod. 1990;42:424–431. doi: 10.1095/biolreprod42.3.424. [DOI] [PubMed] [Google Scholar]
- 29.Testis Synchronisation Factor Code. [(accessed on 2 March 2022)]. Available online: https://github.com/VernetNadege/Testis_Synchronization_Factor_Code.
- 30.Gaub M.P., Rochette-Egly C., Lutz Y., Ali S., Matthes H., Scheuer I., Chambon P. Immunodetection of multiple species of retinoic acid receptor alpha: Evidence for phosphorylation. Exp. Cell Res. 1992;201:335–346. doi: 10.1016/0014-4827(92)90282-D. [DOI] [PubMed] [Google Scholar]
- 31.Bao J., Ma H.Y., Schuster A., Lin Y.M., Yan W. Incomplete cre-mediated excision leads to phenotypic differences between Stra8-iCre; Mov10l1(lox/lox) and Stra8-iCre; Mov10l1(lox/Delta) mice. Genesis. 2013;51:481–490. doi: 10.1002/dvg.22389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Long M.A., Rossi F.M. Silencing inhibits Cre-mediated recombination of the Z/AP and Z/EG reporters in adult cells. PLoS ONE. 2009;4:e5435. doi: 10.1371/journal.pone.0005435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Lewandoski M. Conditional control of gene expression in the mouse. Nat. Rev. Genet. 2001;2:743–755. doi: 10.1038/35093537. [DOI] [PubMed] [Google Scholar]
- 34.Lindner L., Cayrou P., Rosahl T.W., Zhou H.H., Birling M.C., Herault Y., Pavlovic G. Droplet digital PCR or quantitative PCR for in-depth genomic and functional validation of genetically altered rodents. Methods. 2021;191:107–119. doi: 10.1016/j.ymeth.2021.04.001. [DOI] [PubMed] [Google Scholar]
- 35.Hacker A., Capel B., Goodfellow P., Lovell-Badge R. Expression of Sry, the mouse sex determining gene. Development. 1995;121:1603–1614. doi: 10.1242/dev.121.6.1603. [DOI] [PubMed] [Google Scholar]
- 36.Jegou B. The Sertoli cell in vivo and in vitro. Cell Biol. Toxicol. 1992;8:49–54. doi: 10.1007/BF00130510. [DOI] [PubMed] [Google Scholar]
- 37.Bellutti L., Abby E., Tourpin S., Messiaen S., Moison D., Trautmann E., Guerquin M.J., Rouiller-Fabre V., Habert R., Livera G. Divergent Roles of CYP26B1 and Endogenous Retinoic Acid in Mouse Fetal Gonads. Biomolecules. 2019;9:536. doi: 10.3390/biom9100536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Boskovic G., Desai D., Niles R.M. Regulation of retinoic acid receptor alpha by protein kinase C in B16 mouse melanoma cells. J. Biol. Chem. 2002;277:26113–26119. doi: 10.1074/jbc.M201185200. [DOI] [PubMed] [Google Scholar]
- 39.Hasegawa K., Saga Y. Retinoic acid signaling in Sertoli cells regulates organization of the blood-testis barrier through cyclical changes in gene expression. Development. 2012;139:4347–4355. doi: 10.1242/dev.080119. [DOI] [PubMed] [Google Scholar]
- 40.Sugimoto R., Nabeshima Y., Yoshida S. Retinoic acid metabolism links the periodical differentiation of germ cells with the cycle of Sertoli cells in mouse seminiferous epithelium. Mech. Dev. 2012;128:610–624. doi: 10.1016/j.mod.2011.12.003. [DOI] [PubMed] [Google Scholar]
- 41.Yomogida K., Ohtani H., Harigae H., Ito E., Nishimune Y., Engel J.D., Yamamoto M. Developmental stage- and spermatogenic cycle-specific expression of transcription factor GATA-1 in mouse Sertoli cells. Development. 1994;120:1759–1766. doi: 10.1242/dev.120.7.1759. [DOI] [PubMed] [Google Scholar]
- 42.Zhou Q., Nie R., Prins G.S., Saunders P.T., Katzenellenbogen B.S., Hess R.A. Localization of androgen and estrogen receptors in adult male mouse reproductive tract. J. Androl. 2002;23:870–881. [PubMed] [Google Scholar]
- 43.Chung S.S., Wang X., Wolgemuth D.J. Expression of retinoic acid receptor alpha in the germline is essential for proper cellular association and spermiogenesis during spermatogenesis. Development. 2009;136:2091–2100. doi: 10.1242/dev.020040. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The authors confirm that the data supporting the findings of this study are available within the article and its Supplementary Materials.







