The copy number variation of DMBT1 gene effects body traits in two Chinese cattle breeds

Abstract

Copy number variations (CNVs) belong to mutations in the genome level with loci in the region of genic or intergenic. It is through different effects (such as position effect and dose effect) that influence complex traits and diseases. Deleted in Malignant Brain Tumors 1 (DMBT1) gene is a member of the scavenger receptor cysteine-rich super family. In cattle, this gene has been associated with the susceptibility to bovine tuberculosis. In this study, a new CNV was found in DMBT1 gene of Chinese cattle breeds and tested in two different Chinese cattle breeds (Jiaxian red and Pinan) for frequency distribution analysis. Besides, the body size data such as body length, body height, chest girth, chest width, rump length, and rump girth for Jiaxian (JX) and Pinan (PN) cattle were collected and associated with the newly identified CNV. The CNV was significantly associated with the body length and chest girth of JX cattle, and the rump length of PN cattle (P < 0.05). Furthermore, the expression profile of the DMBT1 gene was tested in calves’ tissues and the myoblasts differentiation. It was found that the DMBT1 gene expression was high in tuberculosis susceptible tissues (liver and lungs) at the calf stage and high in myoblast early differentiation. These tests were done using the qPCR method. As the result, the CNV of DMBT1 gene could be used as a candidate marker for bovine growth and health in marker-assisted selection (MAS) breeding.

Introduction

Beef cattle play an important role as ruminants to provide meat and meat products to the whole world. The need for beef is increasing as the quality of human life improved. In China, Jiaxian red and Pinan are two famous beef cattle breeds. Jiaxian red is a native breed and Pinan is a hybrid from Piedmont*Nanyang native cattle. As the need for beef increases, it is necessary to use new breeding biotechnologies to improve the breeds especially their body sizes, so that they could produce more meat. Molecular breeding technologies aim to find markers and genes involved in the livestock growth (Pollak et al. 2005).

Marker-assisted selection (MAS) breeding is an indispensable approach needed in livestock breeding. The choice of effective molecular markers is crucial in MAS, and these include markers such as restriction fragment length polymorphism (RFLP), simple sequence repeat (SSR), insertion and deletion (Indels), single-nucleotide polymorphism (SNP), etc. (Hay et al. 2018; Huang et al. 2011). Copy number of variations (CNVs) could also be used as the molecular markers for MAS breeding, such as those associated with milk composition and growth traits in cattle (Gao et al. 2017; Cao et al. 2018). The CNV can cause a larger biological effect because of its large variation range (50 bp to Mbp) than SNPs. It has an impact through more complex and diverse mechanisms such as positional effects and dose effects. The CNV types include the duplication, normal, and deletion. It has been found that a large number of CNV sites are present in the animal genome (Bhanuprakash et al., 2018). According to our current study, there is a CNV region which overlaps with the DMBT1 gene that may be associated with the bovine growth.

Deleted in Malignant Brain Tumors 1 (DMBT1) gene is a member of the scavenger receptor cysteine-rich super family which is expressed in many tissues (especially epithelial tissues). It is reported that DMBT1 has a lot of functions in human biological processes, such as immune response, mucosal protection, and malignant tumorigenesis (Rosenstiel et al. 2007; Scheurlen et al. 1997; Renner et al. 2007). In cattle, an SNP137 locus on the buffalo DMBT1 gene may affect bovine tuberculosis (BTB) resistance. BTB is an infectious disease of cattle and belongs to a zoonotic disease. Sick cattle often develop symptoms such as dyspnea caused by Mycobacterium bovis. In cattle, these bacteria mostly affect the lungs, breasts, intestines, and lymph nodes. The BTB outbreak can cause serious economic problems by reducing milk production, slaughtering of livestock, and limiting meat exports from infected areas (Jajere et al. 2018). Therefore, this SNP selection signal provides evidence of DMBT1 as a BTB susceptibility gene in cattle breeds. It is suggested that SNP137 in the DMBT1 gene is a molecular marker that may be used to breed BTB-resistant cattle (Nikki et al. 2013). In addition, through the peripheral blood transcriptome sequencing of female bovine that was pregnant by artificial insemination and cows that were pregnant by natural breeding, 18 differently expressed genes including the DMBT1 gene were found (Dickinson et al. 2018). This shows that the DMBT1 gene may have a function in influencing the fertility potential of female cattle. However, the DMBT1 CNV associated with the bovine growth traits have not been reported.

The aim of study was to identify the DMBT1 CNV associated with bovine growth traits in two Chinese native cattle (Jiaxian red and Pinan). This study found a novel CNV in the DMBT1 gene, and it was associated with growth traits in the two Chinese native beef cattle breeds. This information will assist in molecular breeding of Chinese beef cattle.

Materials and methods

All animal procedures performed in this research were in accordance with the ethical standards of the institution or organization at which the study was conducted (Northwest A&F University, Protocol Number: NWAFAC1008).

Collection of animal blood samples

For the CNV distribution test, two Chinese cattle breeds (Pinan and Jiaxian red) were used as test animals. Animals from each breed are shown in Table 1. The cattle that we chose were adult females. All cattle were fed with the same nutritional level of feed. Then, blood samples and body sizes data were collected in all groups. The body sizes data included body length, body height, chest girth, chest width, rump length, and rump girth. Furthermore, DNA extraction from the blood was done using traditional phenol–chloroform method and DNA concentration was diluted to 10 ng/μL.

Table 1.

The information of animals in this study

Breedsa	Number	Origin	Age
PN	168	Xinye county, Henan Province, China	2–4 years old
JX	101	Jia county and Baofeng county, Henan Province, China	24 months

^aPN Pinan cattle, JX Jiaxian Red cattle

DMBT1 CNV-primer design

Our previous study found that a CNV region (chr26: 42785603–42793602 bp, AC_000183.1, 8000 bp) overlaps with the bovine DMBT1 gene (Huang et al., 2021). The CNV test primers for DNA quantitative PCR (DNA-qPCR) were designed in the CNV region using the Primer 5.0 software. The basic transcription factor 3 (BTF3) gene was used as a reference gene which was a normal copy number type (CN = 2) to evaluate the CNV of DMBT1 gene. The detail of all primers' information is shown in Table 2.

Table 2.

The information of primers in the CNV and mRNA expression test

Primersa	Sequence	Locationb	Amplified fragment (bp)
DMBT1-CNV	F: 5′- TGAGCCATAACACAGGCATCTGA-3′ R: 5′- TGGTAATATAAACACCTGGACTCGG-3′	Chr26: 42789218–42789415	198
BTF3	F: 5′- AACCAGGAGAAACTCGCCAA -3′ R: 5′- TTCGGTGAAATGCCCTCTCG -3	Chr20: 8044271–8044436	166
DMBT1-qPCR	F: 5′-ACGAGCTACCTCCAATCCCT -3′ R: 5′- TGGTGTCGTTATCCACCTGC -3	XM_024985978.1	160
MYOG-qPCR	F: 5′- CGAGTGCCCCTTGAAGACAA -3′ R: 5′- TACACACCTTACACGCCCAC -3	NM_001111325.1	82
β-actin-qPCR	F: 5′- GTCATCACCATCGGCAATGAG -3′ R: 5′- AATGCCGCAGGATTCCATG -3	NM_173979.3	84

^aPrimers of DMBT1-CNV and BTF3 were used to test the CNV of DMBT1 gene; primers of DMBT1-qPCR, MYOG-qPCR, and β-actin-qPCR were used to test the mRNA expression level

^bThe locations were according to the reference genome and mRNA sequence from NCBI database (Assembly Bos_taurus_UMD_3.1.1.)

gDNA-qPCR test for the copy number of DMBT1 gene

The gDNA-qPCR test was used to detect CNV of the DMBT1 gene by Bio-Rad CFX96 Touch system (Bio-Rad, Hercules, CA). Three replicates were used for each sample, and each qPCR test reaction system contained 10 ng of genomic DNA, 6.25 μL of SYBR^® Green mix I (Genstar, Beijing, China), 10 nmol of DMBT1-CNV or BTF3 primers and ddH2O to the total of 12.5 μL. The qPCR program was set to 10 min at 95 °C, followed by 15 s at 95 °C, 1 min at 60 °C and returned to the second step for 40 cycles, and finally, the plate was read.

Tissues profile of DMBT1 gene and its mRNA expression pattern in bovine myoblasts

Bovine tissue samples were collected from the Qinchuan calves (QC, Xi’an city, Shaanxi Province, 6-month-old, n = 3). Tissues included the brain, spleen, kidney, lungs, and liver in calves. All samples were collected from healthy and fresh tissues, and then stored at − 80℃. Primary bovine myoblasts were isolated by collagenase I digesting the skeletal muscle at stage of bovine embryo and added in the growth medium to culture (Miyake et al. 2012). For myoblast differentiation, the myoblasts were kept at medium containing 2% horse serum and 1% penicillin/streptomycin, when at differentiation day 0. The bovine myoblasts were at induced differentiation every day, and were collected in 0, 1, 3, and 5 days. Total RNA was extracted using Trizol Reagent (TaKaRa, Kusatsu, Shiga Prefecture, Japan). Then, 500 ng RNA (from each sample) was reverse transcribed to cDNA by the PrimeScript™RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Kusatsu, Shiga Prefecture, Japan).

The qPCR test primers were designed by Primer 5.0 according to the DMBT1 mRNA sequence information (XM_024985978.1). The bovine β-actin gene was used as the control gene for the profile test. The primer information is shown in Table 2. The DMBT1 mRNA expression test was done using the cDNA as template and using SYBR Green mix I instructions (Genstar, Beijing, China). The gene transcription level was evaluated by 2^^−ΔΔCT.

Statistical analysis

In this study, threshold cycles (CT) value of qPCR was used to calculate the copy number of the DMBT1 gene by 2*2^^−ΔΔCT (Yang et al. 2020). Then, we sorted the CNV into three types, the duplication type (CN > 2), deletion type (CN < 2), and the normal type (CN = 2). The frequency of three CNV types was calculated and showed by EXECL software. Furthermore, the association analysis was performed for the CNV of DMBT1 and the bovine body size in different breeds by SPSS 19.0 (SPSS, Inc., Chicago, IL, USA). This analysis used the model: P_ij = μ + A_i + C_j + E_ij, where P_ij means the observation of phenotypic data; μ means the group mean of each phenotype, A_i means the effect of age, C_j means the CNV effect of DMBT1 gene, and E_ij means the effect of random residue error. Significance analysis was done using the least significant difference (LSD) test to determine whether the CNV has a significant effect. According to the current study, no significance of birth season and other factors influenced the phenotypic data. Thus, the model was a reduced model (Zhang et al. 2018; Xu et al. 2019; Cao et al. 2018; Peng et al. 2019). The t test was used for gene expression analysis of two groups which expressed as mean ± standard error (mean ± SE).

Results

Analysis of the copy number variation frequency distribution

After tested the CNV of the DMBT1 gene in Jiaxian red (JX) and Pinan (PN) cattle, the frequency of CNV is shown in Fig. 1. The CNV found in the DMBT1 gene mostly belonged to the duplication of copy number. Similar trend of the CNV distribution was found in PN and JX cattle. The normal type occupied about 20%, and others were the duplication types. Furthermore, different copy number was obtained from PN cattle with an average range of 2 to > 5. However, in JX cattle, it had a lower frequency level of CN = 5 and a higher level of CN > 5. The results indicated that the CNV of bovine DMBT1 has a wide range and a large degree of variation in two Chinese cattle groups.

Fig. 1.

The frequency of DMBT1 CNV in JX and PN cattle. Histograms showed the distributions and statistics of different copy numbers of the DMBT1 gene among two cattle breeds. The x-axis represents the copy number, and the y-axis represents the frequency of the copy number in the population. Copy numbers were rounded to the nearest integer. PN Pinan cattle, JX Jiaxian red cattle

Analysis of the association between the DMBT1 CNV with body size data

Generally, it divides the CNV into three types: duplication, normal, and deletion, but the summary of the original copy number measurements into a general “genotype” may cause some original details to be lost. Thus, it is always different from the real genotype (McCarroll and Altshuler 2007). In this study, the CN was chosen to define the type of CNVs. According to the distribution of CNV in two cattle groups, we defined five types as the genotypes, including the CN = 2, CN = 3, CN = 4, CN = 5, and CN > 5. Then, association analysis found that the CNV was significantly associated with the body length and chest girth of JX cattle (P < 0.05) (Table 3). For JX cattle, the CN = 3 had the best phenotypic value than others. Then, the DMBT1 CNV also was significantly associated with the rump length in PN cattle (P < 0.05). It was found that the normal type in PN cattle was better than the duplication type (Table 4).

Table 3.

The association analysis of CNV with the body size data in JX cattle

Body traits	CNV types2					P value1
	CN = 2 (n = 17)	CN = 3 (n = 16)	CN = 4 (n = 17)	CN = 5 (n = 9)	CN > 5 (n = 38)
Body length (cm)	141.6ab ± 9.8	145.4a ± 7.4	137.5b ± 5.1	140.2ab ± 9.1	145.5a ± 10.2	0.022*
Chest girth (cm)	171.0b ± 10.9	177.4a ± 9.9	169.1b ± 10.4	176.8ab ± 12.3	177.3a ± 10.2	0.036*

¹Values with no common superscript letters in the same row differ at *P < 0.05

²CN copy number of DMBT1 gene, n the number of cattle with different CNV types

Table 4.

The association analysis of CNV with the body size data in PN cattle

Body traits	CNV types2
	CN = 2 (n = 33)	CN = 3 (n = 36)	CN = 4 (n = 29)	CN = 5 (n = 28)	CN > 5 (n = 25)	P value1
Rump length (cm)	50.3b ± 0.5	48.6a ± 0.5	48.8b ± 0.5	49.5ab ± 0.5	48.2a ± 0.5	0.030*
	Normal type (n = 33)		Duplication type (n = 128)
Rump length (cm)	50.3 ± 0.5		48.8 ± 0.3			0.006**

¹Values with no common superscript letters in the same row differ at *P < 0.05. **P means that the difference is extremely significant

²CN copy number of DMBT1 gene, n the number of cattle with different CNV types

Tissues profile of DMBT1 gene in calves

In this study, five different tissues of QC calves (n = 3) were used for testing the profile of DMBT1 expression (Fig. 2). It was found that DMBT1 was highly expressed in lungs and liver tissues (normalized by liver tissues). There was differential expression level of DMBT1 gene in different tissues at the calf stage. Meanwhile, in spleen, the expression level of DMBT1 gene was lower than in liver tissues (P < 0.01). The DMBT1 gene expression level in brain and kidney tissues was lower than that in the other tissues of calves (P < 0.01).

Fig. 2.

The DMBT1 gene expression level in different tissues of QC calves. The values were the means of three repeated experiments calculated by 2^^−ΔΔCT. Error bars represented the standard deviation (SD) (n = 3), and the relative mRNA expression levels of DMBT1 were normalized to β-actin. The superscript * in the bar graph represents the difference when P < 0.05, and ** represents the difference when P < 0.01

DMBT1 gene mRNA expression pattern in bovine myoblasts’ differentiation

Study on the DMBT1 gene expressed in the progress of bovine myoblasts’ differentiation could help deeply understand and infer the gene function (Sun et al. 2018). We tested the differentiation at 1 days, 3 days, and 5 days of myoblasts to show the DMBT1 gene expression pattern in bovine myoblasts differentiation (Fig. 3). The results showed that DMBT1 gene expression was first increased in 1d, and then, it was down-regulated in final differentiation. Meanwhile, the myogenin (MYOG) was highly expressed in bovine myoblasts differentiation stage, which shows that the inducing differentiation was successful (Fig. 4). All of target genes’ expression in the muscle cells’ differentiation was normalized by β-actin gene and the 0 day was used as a control.

Fig. 3.

The DMBT1 gene expression level in bovine myoblast differentiation. The values were the means of three repeated experiments calculated by 2^^−ΔΔCT. Error bars represented the standard deviation (SD) (n = 3), and the relative mRNA expression levels of DMBT1 were normalized to β-actin. 0d bovine myoblasts differentiation day 0, 1d bovine myoblasts differentiation day 1, 3d bovine myoblasts’ differentiation day 3, 5d bovine myoblasts differentiation day 4. The superscript * in the bar graph represents the difference when P < 0.05, and ** represents the difference when P < 0.01

Fig. 4.

The MYOG gene expression level in bovine myoblast differentiation. The values were the means of three repeated experiments calculated by 2^^−ΔΔCT. Error bars represented the standard deviation (SD) (n = 3), and the relative mRNA expression levels of MYOG were normalized to β-actin. 0d bovine myoblasts’ differentiation day 0, 1d bovine myoblasts’ differentiation day 1, 3d bovine myoblasts’ differentiation day 3, 5d bovine myoblasts’ differentiation day 4. The superscript * in the bar graph represents the difference when P < 0.05, and ** represents the difference when P < 0.01

Discussion

Variations in the genome reflect the diversity in animals. The abundant and complex variations are involved in growth, development, and diseases of livestock animals. In the current study, researchers were interested in finding the variations at whole-genome level and try to find major genes or mutations to explore the differences in phenotypes (Liu and Bickhart 2012). CNVs are a member of genome mutations which mostly occur in non-coding regions. They are long fragment sequence duplication, deletion, or insertion in the genome (Kawamura et al. 2011). For cattle breeding, studies indicated that CNVs could affect the body size in cattle (da Silva et al. 2016). As our group’s previous studies have shown, in Chinese native cattle groups, CNVs of the guanylate binding protein 2 (GBP2) gene were found to be associated with the growth traits in cattle (Zhang et al. 2018). The CNV of Kruppel like factor 3 (KLF3) gene was found to be significantly associated with the chest girth (P = 0.032) (Xu et al. 2019). Guanylate-binding protein 4 (GBP4) CNV could influence the body weight and body height in bovine (P < 0.05) (Cao et al. 2018). Furthermore, the CNV of the bovine apolipoprotein L3 (APOL3) gene has shown to have a relationship with phenotypic value in Xianan (XN) and PN cattle (Peng et al. 2019).

Based on our current sequencing study, a CNV region belonging to exonic type and overlapped with the DMBT1 gene was found (Huang et al. 2021). We tested the copy number status of this region in two large Chinese cattle groups (PN and JX cattle) by qPCR tests. In our tested groups, our results reflected that this CNV belonged to the duplication type which accord with the previous sequencing results. The distribution results indicated that a similar trend of the CNV distribution was seen in PN and JX cattle groups and CNV had a large degree of variation in these cattle. However, the CNV of the DMBT1 gene appeared to have a higher degree of variation in JX cattle than in PN cattle, proving the diversity of DMBT1 CNV in Chinese bovine selections. The animals chosen were both from Henan province. Jiaxian red belongs to one type of Chinese native cattle, while Pinan as a hybrid breed that introduces foreign blood. Thus, the different CNV distribution may be caused by the Breed factor (Xu et al. 2014). The differences in DMBT1 CNV distribution show that it might be involved in the bovine divergent selection.

The marker-assisted selection was aimed at using the mutations as the markers to choose the high-quality traits (Visscher and Goddard 2011). It is crucial to find the markers which are related to economic traits (Li et al. 2019, 2020). In this study, we also found that the CNV of the DMBT1 gene was significantly associated with body length and chest girth in JX cattle. Then, for PN cattle, DMBT1 CNV was significantly associated with rump length, and normal type (CN = 2) was a dominant genotype in the selection of rump length. Pinan cattle have the double-muscling phenotype in the rump. Thus, our results indicated DMBT1 as a candidate marker in PN cattle for the development of rump muscle. The divergence of dominant CNV type in two bovine groups might be due to the cattle differences and the number of cattle used in this study. Due to the body phenotype that was non-independent, it is anticipated that DMBT1 CNV has a relationship with different correlative economic traits. These findings indicated that DMBT1 CNV might be functional as pleiotropic structural variants. Due to the CNV of DMBT1 loci in the gene-body region, it may influence the DMBT1 in the mRNA level. However, the complex mechanism needs further study in the future. The DMBT1 gene was reported as the bovine tuberculosis susceptibility-related gene (Nikki et al. 2013). We speculated that the CNV of DMBT1 gene may have the relationship with the susceptibility of bovine tuberculosis. However, in this study, due to lack of information on the susceptibility to bovine tuberculosis, no in-depth research has been conducted. Overall, the novel CNV in the DMBT1 gene was found and it affected body traits in two Chinese bovine breeds.

In addition, the mRNA expression pattern of DMBT1 gene showed profile of tissues in calves and mRNA level of expression in bovine myoblasts’ differentiation. The results of expression test showed the gene highly expressed in liver and lungs at the calf stage. DMBT1 gene was associated with the susceptibility of bovine tuberculosis in buffalo (Nikki et al. 2013). The bovine tuberculosis was always showing to happen in the bovine liver and lungs at the stage of calf or adult. It was indicated that the bovine DMBT1 gene may act as a biomarker of bovine tuberculosis. According to the expression of DMBT1 gene in myoblast differentiation, the DMBT1 gene may play a role in skeletal muscle at early myogenesis stage.

Conclusion

This study investigated the new alteration of copy number in the DMBT1 gene in two Chinese cattle breeds. Association analysis found that the DMBT1 CNV affected body traits in Chinese bovine populations. Moreover, gene expression tests indicated that the DMBT1 gene might play a functional role in cattle tissue growth and muscle development. As a new marker, it could help in cattle molecular breeding by selecting the favorable DMBT1 CNV type in the future.

Author contribution

LZ and JX wrote the original draft. YZ reviewed and edited the manuscript. XL, ZZ, JZ, YW, ZY, PY, FC, WH, ZQ, GY, and CL provided the technical and material. EW, HC, BR, and YH directed and supervised the project.

Data availability

The original data are available upon request to the corresponding author.

Declarations

Conflict of interest

The authors declare there are no conflicts of interest.

Ethical approval

Animal care and study protocols were in accordance with the Animal Care Commission of the College of Veterinary Medicine, Northwest A&F University.

Consent for publication

Not applicable.