Skip to main content
Veterinary World logoLink to Veterinary World
. 2022 Jan 30;15(1):205–212. doi: 10.14202/vetworld.2022.205-212

Molecular characterization of genes responsible for biofilm formation in Staphylococcus aureus isolated from mastitic cows

Eman Shafeek Ibrahim 1, Amany Ahmed Arafa 1, Sohad Mohamed Dorgam 1, Rasha Hamdy Eid 2, Nagwa Sayed Atta 1, Wahid Hussein El-Dabae 1,, Eslam Gaber Sadek 1
PMCID: PMC8924378  PMID: 35369599

Abstract

Background and Aim:

Mastitis is considered a significant disease of lactating animals. There are new attitudes for recognizing genes responsible for causing this disease to overcome and change the manipulation of this problem. This study aimed to isolate and identify Staphylococcus aureus strains from mastitic bovine animals and detect some specific biofilm-forming genes (icaA, icaD, and biofilm-associated protein [bap] genes clfA, fnbA, agrI, agrII, agrIII, agrIV, and cna).

Materials and Methods:

A total of 121 mastitic milk samples were analyzed using biochemical tests (catalase test, oxidative-fermentative test, and coagulase test) and Gram stain. Multiplex polymerase chain reaction was applied to characterize biofilm genes (icaA, icaD, bap, clfA, and fnbA) in addition to (agrI, agrII, agrIII, agrIV, and cna).

Results:

Among the 121 milk samples, 35 staphylococci isolates were derived with an incidence of 28.92% (35/121); among them, 19 are coagulase positive. Ninety percent of the isolates had ica genes (icaA and icaD) while bap gene was not recognized in any isolate. In addition, the incidence of fnbA, can, and clfA was 89.5% each. The prevalence of agr specific groups (agrI, agrII, agrIII, and agrIV) was 78.9%, 52.6%, 10.5%, and 15.8%, respectively.

Conclusion:

This study concluded that S. aureus has variant mechanisms of pathogenicity to form biofilm devoid of carrying a specific gene.

Keywords: biofilm genes, mastitis, molecular identification, Staphylococcus aureus

Introduction

Mastitis in bovine is the most widespread disease among dairy cattle. Consequently, it influences its production due to a combination of different factors such as host, climate, and infectious agents and reduces the quantity and quality of produced milk [1]. The primary cause of bovine mastitis is Staphylococcus aureus, responsible for a dramatic decrease in both quality and quantity of milk production, resulting in significant economic consequences in the dairy farms [2].

S. aureus strains have immense pathogenicity (e.g., encoding virulence factor genes and antibiotic resistance) and several ways to infect humans, such as through foodstuffs, skin infection during the milking process, and direct contact with contaminated fomites. Subsequently, animals producing food, especially cows, are a major route for S. aureus to enter the food chain [3]. Thus, identifying the virulence factors and mechanisms of this pathogen involved in such criteria is important. Furthermore, how they assist in adhering and colonizing the mammary glands’ epithelium cells, leading to persistence, successful foundation, and continuance in the host tissue. The most common virulence factors that aid staphylococci in adhering and colonizing the epithelium of the mammary gland are related to their capacity to form biofilms, resulting in loss of immunological defenses and frequent infections. Furthermore, staphylococcal adhesions have been shown to be necessary for binding host cells [4]. Biofilm formation may lead to continual contamination or infection because biofilm cells are highly resistant to hygiene measures, the effect of antimicrobial agents, and host immunity [5]. The process of biofilm formation by Staphylococcus spp. requires the contribution of different genes and proteins [6]. First, adherence of bacterial cells to a surface is initiated by a capsular antigen polysaccharide/adhesin (PS/A). Following that, growth occurs to create a multi-layered biofilm that induces polysaccharide intercellular adhesin (PIA) production. The intercellular adhesion operon is responsible for PIA and PS/A synthesis in staphylococcal species (ica), formed by the icaA, icaB, icaC, and icaD encoding genes as well as regulatory gene, icaR, carrying icaA, icaB, icaC, and icaD proteins [7].

Furthermore, S. aureus has many adhesins that play an important role in the onset of pathogenicity through the binding of host tissues that are considered essential factors of virulence. These adhesins include fibronectin-binding proteins (fnbA and fnbB), clumping factors (clfA and clfB), collagen-binding protein (cna), biofilm-associated protein (bap) [8], and collagen-binding protein (cna) [9], which are considered essential virulence factors in binding host cells, colonization, and invasion [10]. The accessory gene regulatory (agr) system is fundamental in S. aureus virulence gene expression. The agr operon, which includes the genes agrA, agrB, agrC, and agrD, controls more than 70 genes in S. aureus, 23 of which regulate infectivity [11]. Furthermore, S. aureus genes could be divided into four groups of (agr I, agr II, agr III, and agr IV) genes. They are different in their characteristics and occurrence in various geographical areas. Thus, it is necessary to determine the main types in each region [12].

This study aimed to isolate and identify S. aureus strains obtained from mastitic bovine animals and specify the involved genes in biofilm formation (icaA, icaD, bap, clfA, fnbA, AgrI, AgrII, AgrIII, AgrIV, and cna).

Materials and Methods

Ethical approval

This study was approved (no. 12020232/2019) by Ethical Committee for Medical Research at the National Research Centre, Egypt.

Study period and location

The study was conducted from January to March 2020. The study was conducted at National Research Center, Dokki, Egypt. The samples were processed at the National Research center, Veterinary Research Division, Microbiology and Immunology Department Laboratory.

Collection of samples

One hundred and twenty one affected quarter milk samples (quarter selected based on physical examination; appearance of inflammation as redness and swelling) were obtained from 40 cows suffered from mastitis and did not receive any medical treatment for 7-10 days in private farms in Giza Governorate, Egypt. Those farms did not implement the required hygienic measures to control mastitis and other infectious diseases. The milking process was performed using a traditional method.

Before the milk collection, the animals did not receive antibiotic treatment for at least 1 month. The collection of milk samples was conducted under complete aseptic conditions according to Oliver et al. [13].

Isolation and identification of S. aureus

Every milk sample was cultured on two plates: Columbia Agar base with 5% defibrinated sheep blood (Oxoid, UK) and mannitol salt agar (Oxoid). The tested plates were incubated at 37±1°C for 24-48 h. According to colony morphology, Gram staining, in addition to catalase reaction, and oxidative-fermentative test, all isolates were identified as staphylococci. Coagulase test was used to characterize all S. aureus strains [14].

DNA extraction

DNA milk samples were extracted using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with some modifications (temperature adjustment at 25°C and pH set at 4.0) to the manufacturer’s instructions.

Oligonucleotide primers

The utilized primers of polymerase chain reaction (PCR) from Metabion (Germany) are listed in Table-1 [8,15-19]. PCR was conducted in an Applied Biosystems 2720 thermal cycler (Applied Biosystems, USA).

Table-1.

Primers sequences, target genes, amplicon sizes, and cycling conditions.

Target gene Primers sequences Amplified segment (bp) Primary denaturation Amplification (35 cycles) Final extension Reference

Secondary denaturation Annealing Extension
16S rRNA CCTATAAGACTGGGATAAC TTCGGG 791 94˚C 94°C 55°C 72°C 72°C [15]
CTTTGAGTTTCAACCTTGCG GTCG 5 min 30 s 40 s 45 s 10 min
icaA CCT AAC TAA CGA AAG GTA G 1315 94°C 94°C 49°C 72°C 72°C [16]
AAG ATA TAG CGATAA GTG C 5 min 30 s 1 min 1 min 10 min
icaD AAA CGTAAG AGA GGT GG 381 94°C 94°C 49°C 72°C 72°C
GGC AAT ATG ATC AAGATA 5 min 30 s 40 s 40 s 10 min
Bap CCC TAT ATC GAA GGT GTA GAA TTG 971 94°C 94°C 62°C 72°C 72°C [8]
GCT GTT GAA GTT AAT ACT GTA CCT GC 5 min 30 s 40 s 50 s 10 min
ClfA GCAAAATCCAGCACAACAG GAAACGA 638 94°C 94°C 55°C 72°C 72°C [15]
CTTGATCTCCAGCCATAAT TGGTGG 5 min. 30 sec. 40 sec. 45 sec. 10 min.
FnbA CATAAATTGGGAGCAGCAT CA 127 94°C 94°C 58°C 72°C 72°C [17]
ATCAGCAGCTGAATTCCCA TT 5 min 30 s 30 s 30 s 7 min.
GTAAATGCACTTGCTTCAG GAC
AgrI Pan: ATG CAC ATG GTG CAC ATG C 441 94°C 94°C 55°C 72°C 72°C [18]
GTC ACA AGT ACT ATA AGC TGC GAT 5 min 30 s 40 s 45 s 10 min
AgrII Pan: ATG CAC ATG GTG CAC ATG C 575 94°C 94°C 55°C 72°C 72°C
TAT TAC TAA TTG AAA AGT GGC CATAGC 5 min 30 s 40 s 45 s 10 min
AgrIII Pan: ATG CAC ATG GTG CAC ATG C 323 94°C 94°C 55°C 72°C 72°C
GTA ATG TAA TAG CTT GTA TAA TAA TAC CCA G 5 min 30 s 40 s 40 s 10 min
AgrIV Pan: ATG CAC ATG GTG CAC ATG C 659 94°C 94°C 55°C 72°C 72°C
CGA TAA TGC CGT AAT ACC CG 5 min 30 s 40 s 45 s 10 min
Can GTCAAGCAGTTATTAACACCAGA C 423 94°C 94°C 55°C 72°C 72°C [19]
AATCAGTAATTGCACTTTGTCCAC TG 5 min 30 s 40 s 45 s 10 min

PCR products

PCR products were separated by electrophoresis at room temperature (25°C) on 1.5% agarose gel (AppliChem, Germany, GmbH) in 1× Tris-borate-EDTA buffer with gradients of 5 V/cm. A gel documentation system (Alpha Innotech, Biometra, Germany) was used to photograph the gel (Gel documentation system; Biometra, Germany) and the data were evaluated using a computer software (Genesys image capture, Biometra, Germany).

Results and Discussion

Bovine mastitis is a significant disease in lactating herds worldwide [20]. S. aureus is considered the most common causative agent, leading to more virulent mastitis in cows. It possesses the greatest risk in dairy production in many countries [21].

In the current study, a total of 35 staphylococci isolates have been isolated with a prevalence of 28.92% (35/121). The identified prevalence of S. aureus and Coag–ve staphylococci other than S. aureus was 57.14% (20/35) and and 42.85% (15/35). All staphylococci isolates were confirmed using 16S rRNA gene, as shown in Figure-1.

Figure-1.

Figure-1

16S rRNA gene at 791bp; Lanes (1-11) are positive, Lane L: 1000 bp ladder, N: (negative control) and P: (positive control).

S. aureus isolated from subclinical mastitis cow was 36% [22] and less than the prevalence (6.5%) detected by Haltia et al. [23]. According to this study, the high prevalence of S. aureus may result from contaminated milk utensils and Milker’s hands.

The possibility of S. aureus infection occurring is related to its capacity to release different factors of virulence that contribute to the invasion of the bacteria [24]. The formation of biofilm increased the virulence of S. aureus. In addition, strains can create biofilms that possess higher antibiotic tolerance, antiseptics, and poor environmental conditions [25]. The genes of ica are responsible for slime formation in S. aureus by controlling PIA production. It can also determine the ability of S. aureus strains to generate biofilm.

Namvar et al. [26] found that S. aureus could not generate biofilm unless strains were positive for the ica D gene. Strains posing the ica ADBC group were likely to generate biofilm [27]. Among 90% of S.aureus isolates (Table-2), ica genes (ica A and ica D) were detected (Figures-2 and 3).

Table-2.

Polymerase chain reaction results for biofilm genes.

Coagulase positive staphylococcus sample 16S rRNA icaA icaD fnbA can bap clfA agrI agrII agrIII agrIV
1 + + + + + + + +
2 + + + + + + +
3 + + + + + + + +
4 + + +
5 + + + + + + + +
6 +
7 + + + + + + + +
8 + + + + + + + +
9 + + + + + + + +
10 + + + + + + +
11 + + + + + + + +
12 + + + + + + +
13 + + + + + + + +
14 + + + + + + + +
15 + + + + + + + +
16 + + + + + + + +
17 + + + + + + +
18 + + + + + + + +
19 + + + + + + + +

Figure-2.

Figure-2

icaA gene at 1315bp; Lanes 6 is negative, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

Figure-3.

Figure-3

icaD gene at 381 bp; Lanes 6 is negative, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

These results almost agree with other findings as ica genes were identified in all isolates [3]. While Gowrishankar et al. [28] detected those isolates of S. aureus in India carry ica genes in a percentage of 84.13%. In Mexico, Avila-Novoa et al. [29] identified the genes in 52.3% of isolates.

The bap gene implicates biofilm formation by promoting primary attachment and adhesion to inert and live surfaces [30]. This study showed that all the tested strains (100%) were negative for the bap gene (Figure-4).

Figure-4.

Figure-4

bap gene at 971bp; Lane (1-19) are negative, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

According to Vautor et al. [31], the absence of bap indicates that the ica-dependent pathway is predominantly responsible for adhesion and biofilm development in strains. Bissong et al. [32] found that the occurrence of the bap gene was limited (12, 15.6%). Li et al. [33] identified bap gene in 43.9% of S. aureus strains biofilm producers, proving the significance of bap gene in biofilm production. Our results are in agreement with Xu et al. [34], who were unable to detect bap gene in S. aureus recovered from subclinical mastitic cow. Khoramrooz et al. [35] and Darwish and Asfour [36] detected expression of bap gene in 5% and 2.5% among obtained isolates, respectively. Our results showed that the ica- gene process could sometimes be essential for attachment and formation of biofilm among isolated strains; this can be a possible explanation for our finding.

The fnbA genes appear to be necessary for bacterial invasion and adhesion, and they may be associated with their ability to form biofilms. The incidence of expression of the surface protein genes for S. aureus (fnbA, can, and clfA) was 89.5% for each gene as reported in Table-2; these results demonstrated resemblance and minor variations to earlier studies; Peerayeh et al. [37] revealed that clfA and fnbA (Figures-5 and 6) encoding genes had been found in each of the tested isolates (20 strains), with can gene are being found in 20% of identified isolates(Figure-7). In contrast, Ote et al. [38], and Ikawaty et al. [39] observed a higher prevalence of can gene (31.9% and 49%, respectively).

Figure-5.

Figure-5

clfA gene at 638bp; Lanes (4 and 6) are negative, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

Figure-6.

Figure-6

fnbA gene at 127bp; Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

Figure-7.

Figure-7

cna gene at 423 bp; Lanes (4 and 6) are negative, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

S. aureus strains have been divided into four categories, agrI to agrIV, [18] based on differences in their agr genes. The agr-encoded quorum-sensing system’s important function in virulence regulation makes it an appropriate target for antimicrobial drug development. According to Table-2, the prevalence of agr specificity groups (agrI, agrII, agrIII, and agrIV) were 78.9%, 52.6, 10.5%, and 15.8%, respectively. According to Figures-8 to 11, our results showed that agrI was the most common type found in isolated S. aureus. Javdan et al. [40], and Cheraghi et al. [41], stated that the most dominant type was agr Type I. It is said that definite groups of agr in S. aureus are implicated in certain diseases, such as isolates that possess agrI are related to bacteremia and persistent diseases [42]. The development of biofilm is a complex process involving numerous factors such as poor hygienic measures and poor management of milking practices.

Figure-8.

Figure-8

agrI gene at 441bp; Lanes (1, 4, 6, 7) are negative, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

Figure-11.

Figure-11

agrIV gene at 659bp; Lanes (1, 3, 7) are positive, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

Figure-9.

Figure-9

agrII gene at 575bp; Lanes (2, 3, 4, 5, 6, 10, 12, 15, 17) are negative, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

Figure-10.

Figure-10

agrIII gene at 323bp; Lanes (5 and 15) are positive, Lane L: 1000 bp ladder, N: (Negative control) and P: (Positive control).

Conclusion

It can be concluded that the variant mechanisms of pathogenicity induced by S. aureus to form biofilm without needing a specific gene. It is necessary to identify the presence of genes related to biofilm production as formation of biofilm results in attachment to glandular udder tissue and biomaterials, thus increasing the virulence of bacteria. Besides, the biofilm’s existence increases the bacterial resistance to antibiotics, consequently complicating its treatment. This study presents preliminary results for additional in-depth prospect studies. Finally, good hygienic measures and habits, in addition to good management of milking practices, can reduce the incidence of S. aureus mastitis.

Authors’ Contributions

RHE and EGS: Collected the samples, applied the practical work including isolation of S. aureus and identification of obtained isolates. ESI, WHE and AAA: Planned the work, applied the practical work including isolation of S. aureus and identification of obtained isolates, PCR and revised the manuscript. SMD: Carried out PCR and drafted the manuscript. NSA: Revised the manuscript. All authors read and approved the final manuscript.

Acknowledgments

The authors would like to express their appreciation to all staff members of the Microbiology and Immunology Department for their support during the study. The study was funded by National Research Centre, Egypt (Internal project No. 12020232).

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.

References

  • 1.Hogeveen H, Van Der Voort M. Assessing the economic impact of an endemic disease:The case of mastitis. Rev. Sci. Tech. 2017;36(1):217–226. doi: 10.20506/rst.36.1.2623. [DOI] [PubMed] [Google Scholar]
  • 2.Merz A, Stephan R, Johler S. Staphylococcus aureus isolates from goat and sheep milk seem to be closely related and differ from isolates detected from bovine milk. Front. Microbiol. 2016;7:319. doi: 10.3389/fmicb.2016.00319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wang W, Li X, Jiang T, Peng Z, Xu J, Yi L, Li F, Fanning S, Baloch Z. Prevalence and characterization of Staphylococcus aureus cultured from raw milk taken from dairy cows with mastitis in Beijing, China. Front. Microbiol. 2018;9:11–23. doi: 10.3389/fmicb.2018.01123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ren Q, Liao G, Wu Z, Lv J, Chen W. Prevalence and characterization of Staphylococcus aureus isolates from subclinical bovine mastitis in Southern Xinjiang, China. J. Dairy Sci. 2020;103(4):3368–3380. doi: 10.3168/jds.2019-17420. [DOI] [PubMed] [Google Scholar]
  • 5.Song M, Li Q, Zhang Y, Song J, Shi X, Shi C. Biofilm formation and antibiotic resistance pattern of dominant Staphylococcus aureus clonal lineages in China. J. Food Saf. 2016;37(2):12304. [Google Scholar]
  • 6.Heilmann C. Adhesion mechanisms of staphylococci. In: Heilmann C, editor. Bacterial Adhesion. New York: Springer; 2011. pp. 105–123. [DOI] [PubMed] [Google Scholar]
  • 7.Gad G.F.M, El-Feky M.A, El-Rehewy M.S, Hassan M.A, Abbolella H, Abd El-Baky R.M. Detection of icaA, icaD genes and biofilm production by Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract catheterized patients. J. Infect. Dev. Ctries. 2009;3(5):342–351. doi: 10.3855/jidc.241. [DOI] [PubMed] [Google Scholar]
  • 8.Cucarella C, Solano C, Valle J, Amorena B, Lasa I, Penadés J.R. Bap, a Staphylococcus aureus surface protein involved in biofilm formation. J. Bacteriol. 2001;183(9):2888–2896. doi: 10.1128/JB.183.9.2888-2896.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Azara E, Longheu C, Sanna G, Tola S. Biofilm formation and virulence factor analysis of Staphylococcus aureus isolates collected from ovine mastitis. J. Appl. Microbiol. 2017;123(2):372–379. doi: 10.1111/jam.13502. [DOI] [PubMed] [Google Scholar]
  • 10.Aslantaş Ö, Demir C. Investigation of the antibiotic resistance and biofilm-forming ability of Staphylococcus aureus from subclinical bovine mastitis cases. J. Dairy Sci. 2016;99(11):8607–8613. doi: 10.3168/jds.2016-11310. [DOI] [PubMed] [Google Scholar]
  • 11.Thompson A, Brown P.D. Association between the AGR locus and the presence of virulence genes and pathogenesis in Staphylococcus aureus using a Caenorhabditis elegans model Terissa. Int. J. Inf. Dis. 2017;54:72–76. doi: 10.1016/j.ijid.2016.11.411. [DOI] [PubMed] [Google Scholar]
  • 12.Bibalan M, Shakeri F, Javid N, Ghaemi A, Ghaemi E. Accessory gene regulator types of Staphylococcus aureus isolated in Gorgan, North of Iran. J. Clin. Diagn. Res. 2014;8(4):DC07–DC09. doi: 10.7860/JCDR/2014/6971.4219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Oliver S.P, Gonzalez R.N, Hogan J.S, Jayarao B.M, Owens W.E. Microbiological Procedures for the Diagnosis of Bovine Udder Infection and Determination of Milk Quality. 4th ed. Madison: National Mastitis Council; 2004. [Google Scholar]
  • 14.Quinn P.J, Market B.K, Leonard F.C, Patrick E.S.F, Fanning S, Hartigan P.J. Veterinary Microbiology and Microbial Disease. 2nd ed. Chichester: Wiley-Blackwell; 2011. [Google Scholar]
  • 15.Mason W.J, Blevins J.S, Beenken K, Wibowo N, Ojha N, Smeltzer M.S. Multiplex PCR protocol for the diagnosis of staphylococcal infection. J. Clin. Microbiol., 2001;39(9):3332–3338. doi: 10.1128/JCM.39.9.3332-3338.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ciftci A, Findik A, Onuk A, Savasan S. Detection of methicillin resistance and slime factor production Staphylococcus aureus in bovine mastitis. Braz. J. Microbiol. 2009;40(2):254–261. doi: 10.1590/S1517-83822009000200009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Vancraeynest D, Hermans K, Haesebrouck F. Genotypic and phenotypic screening of high and low virulence Staphylococcus aureus isolates from rabbits for biofilm formation and MSCRAMMs. Vet. Microbiol. 2004;103(3-4):241–247. doi: 10.1016/j.vetmic.2004.09.002. [DOI] [PubMed] [Google Scholar]
  • 18.Abd El-Hamid M.I, Bendary M.M. Association between AGR alleles and toxin gene profiles of S. aureus isolates from human and animal sources in Egypt. Int. J. Adv. Res. 2013;1(8):33–144. [Google Scholar]
  • 19.Tristan A, Ying L, Bes M, Etienne J, Vandenesch F, Lina G. Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections. J. Clin. Microbiol. 2003;41(9):4465–4467. doi: 10.1128/JCM.41.9.4465-4467.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ruegg P.L. A 100-year review:Mastitis detection, management, and prevention. J. Dairy Sci. 2017;100(12):10381–10397. doi: 10.3168/jds.2017-13023. [DOI] [PubMed] [Google Scholar]
  • 21.Monistero V, Graber H, Pollera C, Cremonesi P, Castiglioni B, Bottini E, Marquez A.C, Rojas L.L, Kroemker V, Wente N, Petzer I, Santisteban C, Runyan J, Santos M, Alves B, Piccinini R, Bronzo V, Abbassi M.S, Said M, Moroni P. Staphylococcus aureus isolates from bovine mastitis in eight countries:Genotypes, detection of genes encoding different toxins and other virulence genes. Toxins. 2018;10(6):247. doi: 10.3390/toxins10060247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Abdelazeem M.A, Enany M.E, El-Tarabili R.M, Ghobashy M. O. I, Helmy Y.A. Prevalence, antimicrobial resistance profiles, virulence and enterotoxins-determinant genes of MRSA isolated from subclinical bovine mastitis in Egypt. Pathogen. 2020;9(5):362. doi: 10.3390/pathogens9050362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Haltia L, Honkanen-Buzalski T, Spiridonova I, Olkkonen A, Myllys V. A study of bovine mastitis, milking procedures and management practices on 25 Estonian dairy herds. Acta Vet. Scandal. 2006;48(1):22. doi: 10.1186/1751-0147-48-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Cosgrove S.E. The relationship between antimicrobial resistance and patient outcomes:Mortality, length of hospital stay, and health care costs. Clin. Infect. Dis. 2006;42(Suppl 2):S82–S89. doi: 10.1086/499406. [DOI] [PubMed] [Google Scholar]
  • 25.Neopane P, Nepal H.P, Hrestha R, Uehara O, Abiko Y. In vitro biofilm formation by Staphylococcus aureus isolated from wounds of hospital-admitted patients and their association with antimicrobial resistance. Int. J. Gen. Med. 2018;11:25–32. doi: 10.2147/IJGM.S153268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Namvar A.E, Asghari B, Ezzatifar F, Azizi G, Lari A.R. Detection of the intercellular adhesion gene cluster (Ica) in clinical Staphylococcus aureus isolates. GMS Hyg. Infect. Control. 2013;8(1):Doc03. doi: 10.3205/dgkh000203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Atshan S.S, Shamsudin M.N, Sekawi Z, Lung L, Hamat R.A, Karunanidhi A, Ali A.M, Ghaznavi-Rad E, Moghaddam H.G, Seng J.S.C, Nathan J.J, Pei C.P. Prevalence of adhesion and regulation of biofilm-related genes in different clones of Staphylococcus aureus. J. Biomed. Biotechnol. 2012;2012:976972. doi: 10.1155/2012/976972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Gowrishankar S, Kamaladevi A, Balamurugan K, Pandian S.K. In vitro and in vivo biofilm characterization of methicillin-resistant Staphylococcus aureus from patients associated with pharyngitis infection. Biomed Res. Int. 2016;2016:1289157. doi: 10.1155/2016/1289157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Avila-Novoa M, Iñiguez-Moreno M, Solís-Velázquez O, González-Gómez J.P. Biofilm formation by Staphylococcus aureus isolate from food contact surfaces in the dairy industry of Jalisco, Mexico. J. Food Qual. 2018;2018:1746139. [Google Scholar]
  • 30.Cucarella C, Tormo M.A, Ubeda C, Pilar-Trotonda M, Monzon M, Peris C, Amorena B, Lasa I, Penades J.S. Role of biofilm associated protein Bap in the pathogenesis of bovine Staphylococcus aureus. Infect. Immun. 2004;72(4):2177–2185. doi: 10.1128/IAI.72.4.2177-2185.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Vautor E, Magnone V, Rios G, Le Brigand K, Bergonier D, Lina G, Meugnier H, Barbry P, Thiéry R, Pépin M. Genetic differences among Staphylococcus aureus isolates from dairy ruminant species:A single-dye DNA microarray approach. Vet. Microbiol. 2009;133(1-2):105–14. doi: 10.1016/j.vetmic.2008.06.006. [DOI] [PubMed] [Google Scholar]
  • 32.Bissong M. E. A, Ateba C.N. Genotypic and phenotypic evaluation of biofilm production and antimicrobial resistance in Staphylococcus aureus isolated from Milk, North West Province, South Africa. Antibiotics. 2020;9(4):156. doi: 10.3390/antibiotics9040156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Li L, Yang H.J, Liu D.C, He H.B, Wang C.F, Zhang J.F, Gao Y.D, Yangjun Z. Analysis of biofilm formation and associated genes detected in Staphylococcus isolates from bovine mastitis. Intern. J. Appl. Res. Vet. Med. 2012;10(1):62–68. [Google Scholar]
  • 34.Xu J, Tan X, Zhang X, Xia X, Sun H. The diversities of staphylococcal species, virulence and antibiotic resistance genes in subclinical mastitis milk from a single Chinese cow herd. Microb. Pathog. 2015;88:29–38. doi: 10.1016/j.micpath.2015.08.004. [DOI] [PubMed] [Google Scholar]
  • 35.Khoramrooz S.S, Mansouri F, Marashifard M, Hosseini S.A.M, Chenarestane-Olia F.A, Ganavehei B, Gharibpour F, Shahbazi A, Mirzaii M, Khalil D. D.S. Detection of biofilm related genes, classical enterotoxin genes and AGR typing among Staphylococcus aureus isolated from bovine with subclinical mastitis in Southwest of Iran. Microb. Pathog. 2016;97:45–51. doi: 10.1016/j.micpath.2016.05.022. [DOI] [PubMed] [Google Scholar]
  • 36.Darwish S.F, Asfour H.A. Investigation of biofilm forming ability in staphylococci causing bovine mastitis using phenotypic and genotypic assays. Sci. World J. 2013;2013:378492. doi: 10.1155/2013/378492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Peerayeh S.N, Azimian A, Nejad Q.B, Kashi M. Prevalence of agr specificity groups among Staphylococcus aureus isolates from university hospitals in Tehran. Lab. Med. 2009;40(1):27–29. [Google Scholar]
  • 38.Ote I, Taminiau B, Duprez J.N, Dizier I, Mainil J.G. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. Vet. Microbiol. 2011;153(3-4):285–292. doi: 10.1016/j.vetmic.2011.05.042. [DOI] [PubMed] [Google Scholar]
  • 39.Ikawaty R, Brouwer E.C, Van Duijkeren E, Mevius D, Verhoef J, Fluit A.C. Virulence factors of genotyped bovine mastitis Staphylococcus aureus isolates in the Netherlands. Int. J. Dairy Sci. 2010;5(2):60–70. [Google Scholar]
  • 40.Javdan S, Narimani T, Abadi M, Gholipour A. Agr typing of Staphylococcus aureus species isolated from clinical samples in training hospitals of Isfahan and Shahrekord. BMC Res. Notes. 2019;12(1):363. doi: 10.1186/s13104-019-4396-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Cheraghi S, Pourgholi L, Shafaati M, Fesharaki S.H, Jalali A, Nosrati R, Boroumand M.A. Analysis of virulence genes and accessory gene regulator (agr) types among methicillin-resistant Staphylococcus aureus strains in Iran. J. Glob. Antimicrob. Resist. 2017;10:315–320. doi: 10.1016/j.jgar.2017.06.009. [DOI] [PubMed] [Google Scholar]
  • 42.Pereyraa E.A.L, Picech F, Rennaa M.S, Baravalle C, Andreottia C.S, Russic R, Calvinhod L.F, Diez C.N, Dallarda B. Detection of Staphylococcus aureus adhesion and biofilm-producing genes and their expression during internalization in bovine mammary epithelial cells. Vet. Microbiol. 2015;183:69–77. doi: 10.1016/j.vetmic.2015.12.002. [DOI] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES