Abstract
Despite the importance of eggs in the human diet, and unlike other products, for which food safety risks are widely investigated, information on the occurrence of Campylobacter and antimicrobial resistance in eggs and layer hen flocks is lacking in Tunisia. This study was conducted to determine the occurrence of Campylobacter and the antimicrobial resistance in layer hens and on eggshells. Thus, 366 cloacal swabs and 86 eggshell smear samples were collected from five layer hen farms in the North-East of Tunisia. The occurrence of Campylobacter infection, and the antimicrobial resistance rates and patterns, were analyzed. The occurrence rates of Campylobacter infection in laying hens and eggshells were 42.3% and 25.6%, respectively, with a predominance of C. jejuni (68.4%, 81.9%), followed by C. coli (31.6%, 18.2%). The antimicrobial susceptibility testing revealed high resistance rates against macrolides, tetracycline, quinolones, β-lactams, and chloramphenicol, with percentages ranging from 35.5% to 100%. All isolates were multidrug resistant (MDR) and five resistance patterns were observed. These results emphasized the risk to consumer health and the need to establish a surveillance strategy to control and prevent the emergence and the spread of resistant strains of Campylobacter in poultry and humans.
Keywords: Campylobacter, layer hens, eggshell, occurrence, multidrug resistance
1. Introduction
Campylobacter is one of the leading bacterial causes of food-borne diseases, presenting important challenges to public health around the world [1,2]. Campylobacter jejuni and C. coli are the major species of clinical significance, responsible for more than 95% of campylobacteriosis in humans worldwide [3]. Campylobacter is considered to be a commensal bacteria colonizing gut birds; however, it was shown that C. jejuni is responsible for damage in the intestinal mucosa of birds, leading to systemic infections with diarrhea [4,5], and could induce leg burns or podo-dermatitis during viral co-infection [6]. In addition, C. hepaticus is the cause of spotted liver disease in chickens [7].
Human campylobacteriosis, a typical food-borne illness, causes clinical cases ranging from mild symptoms to fatal outcomes, such as reactive arthritis or Reiter and Guillain–Barré Syndromes [8]. The global burden of morbidity and mortality due to Campylobacter spp. showed that 550 million people worldwide suffer from campylobacteriosis, with a mortality rate of about 33 million per year [2]. Campylobacters are the most frequently isolated enteric bacterial pathogens in both developed countries and low- and middle-income countries (LMICs) [9]. The genus of Campylobacter includes 17 species and 6 subspecies; the thermotolerant species C. jejuni and C. coli are the best known human pathogens causing human gastroenteritis [10,11].
Several studies have reported that contaminated poultry is recognized as the major source of food-related transmission of Campylobacter to humans, due to improper handling or consumption of raw or undercooked meat, with 50% to 80% of human campylobacteriosis cases related to chicken sources [12].
The chicken intestines are considered to be the main reservoir of thermophilic Campylobacter species [13]. These bacteria can persist in feces and litter for many days, increasing the risk of egg surface contamination [14,15], which is a potential source of many food-borne illnesses [16,17].
Campylobacter contamination of broiler chickens, carcasses and meat is well documented, but few data are available concerning eggshell contamination [18]. Indeed, while the literature on broiler chicken infections is extensive, studies on the epidemiology of Campylobacter species in layer chickens are very limited. Over the years, increased rates of Campylobacter strains resistant to the antimicrobial agents of choice (fluoroquinolones and macrolides) and the alternative therapies (gentamicin and tetracycline) have been reported, making Campylobacter resistant strains an emerging public health concern [19].
Resistance to antimicrobials is partly due to their misuse both in human and veterinary medicines [20]. Different quinolone-antibiotics have been extensively used in poultry, leading to the emergence of quinolone-resistant strains of Campylobacter originating from chickens and humans [20]. Recently, sitafloxacin (SIT) was proven to be effective among various fluoroquinolones-resistant pathogens including Campylobacter, which could be a promising drug. As a consequence of the increased resistance to quinolones throughout the world [21], erythromycin (ERY) is the recommended drug for treating human campylobacteriosis [22].
This study was conducted to investigate the occurrence of Campylobacter in layer hens and eggshells and to determine the antimicrobial resistance rates by analyzing the antimicrobial resistance patterns of recovered Campylobacter strains in the North of Tunisia.
2. Materials and Methods
2.1. Sample Collection
A total of 366 cloacal swabs and 86 eggshell smears were randomly collected, during the period between October 2017 and May 2018, from five laying hen farms. All farms use an intensive floor hen rearing system with bird numbers ranging from 2000 to 18,000 hens per house. The samples were taken from Lohmann and Novogen Whitehens, with ages ranging from 65 to 75 weeks.
The sampled eggs were in nesting boxes inside the houses, and the swabs were soaked and placed in Bolton broth in a refrigerated container.
All farms display similar breeding and biosecurity/biosafety protocols. The sampled farms are located in the governorates of Ben Arous and Nabeul in the North-East of Tunisia, and these areas are responsible for 40.8% of the national layer hen production [23].
2.2. Isolation of Campylobacter
Upon arrival at the laboratory, samples were inoculated into Bolton Broth (Oxoid, Basingstoke, UK), containing the Bolton selective supplement for enrichment, and then incubated at 42 °C for 24 h in a microaerobic environment (5% O2, 10% CO2, and 85% N2), with GENbox generators (BioMérieux, Craponne, France). After enrichment, putative Campylobacter-positive samples were streaked on Karmali agar (Oxoid, Basingstoke, UK) and incubated under the same conditions as described above for 48 h [24]. From each sample, suspected colonies were examined for the typical morphology and motility of Campylobacter, under a light microscope and using the oxidase/catalase tests. Thereafter, presumed Campylobacter colonies were subjected to PCR analysis for genus confirmation and species identification. Confirmed Campylobacter isolates were conserved at −80 °C in Mueller–Hinton broth containing 25% glycerol (v/v).
2.3. Identification of Thermotolerant Campylobacter
Total DNA was extracted from the cultured isolates as follows. Colonies were collected and suspended in 500 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8.0)) and boiled for 10 min in a boiling water bath. The suspension was immediately cooled on ice for 5 min and centrifuged at 13,000× g for 5 min. The supernatant was recovered and used as a template for the PCR assay.
Confirmation of the Campylobacter genus of the presumed isolates was performed by PCR amplification of a specific fragment of the 16S rDNA gene, using the primers described by Linton et al., (1996). Then, the isolates were identified as C. jejuni or C. coli by PCR assays based on amplification of the mapA and ceuE genes, respectively [25,26]. The sequences and origins of the three primer sets used for gene amplification are indicated in Table 1.
Table 1.
Genes | Primer Sequences 5’–3’ | Tm (°C) | Size (pb) | References |
---|---|---|---|---|
ARNr 16S | F: GGATGACACTTTTCGGAGC R: CATTGTAGCACGTGTGTC |
52 | 816 | Linton et al., (1996) |
mapA | F: CTATTTTATTTTTGAGTGCTTGTG R: GCTTTATTTGCCATTTGTTTTATTA |
52 | 589 | Stucki et al., (1995) |
ceuE | F: ATTGAAAATTGCTCCAACTATG R: GATTTTATTATTTGTAGCAGCG |
52 | 462 | Gonzalez et al., (1997) |
C. jejuni (ATCC 33291) and C. coli (CCUG 11283-T) strains were used as positive controls.
All PCR reactions contained 2.5 μL DNA template, 0.2 µM of each primer, 0.2 mM dNTP, 1X Dream Taq DNA polymerase buffer, and 1.0 U Dream Taq DNA polymerase, in a final reaction volume of 25 µL.
For genus identification, the PCR program was as follows: 5 min at 95 °C, 35 cycles consisting of 1 min at 95 °C, 1 min at 55 °C, 1 min at 72 °C, and a final extension step of 10 min at 72 °C. The same program was used for species identification, except the annealing temperature was at 59 °C. All DNA amplification reactions were carried out in a T100 thermal cycler (Bio-Rad, Marnes-La-Coquette, France).
For visualization of PCR products, quantities of 10 μL were subjected to electrophoresis on agarose gel containing ethidium bromide, and bands were visualized with UV light.
2.4. Antimicrobial Susceptibility Testing
The panel of the tested antibiotics was gentamicin (GEN: 10 μg), erythromycin (ERY: 15 μg), tetracycline (TET: 30 μg), chloramphenicol (CHL: 30 μg), nalidixic acid (NAL: 30 μg), ciprofloxacin (CIP: 5 μg), ampicillin (AMP:10 μg), and amoxicillin/clavulanic acid (AMC: 10/20 μg). Campylobacter isolates were tested against the eight selected antibiotics by the disk diffusion method, as recommended by the European Committee on Antimicrobial Susceptibility Testing [27].
The bacterial isolates were cultivated on Karmali plates for 48 h. A bacterial suspension was prepared for each isolate and adjusted to 0.5 MacFarland. A volume of 0.1 mL was spread onto a Mueller–Hinton agar plate and antibiotic discs were then applied. The diameter of the inhibitory zone was measured after cultivation for 24 h at 37 °C as previously described. Results concerning AMP, AMC, CIP, ERY, GEN, and TET were evaluated following interpretive criteria provided by the EUCAST-2017 [27]. For CHL and NAL, we used the resistance breakpoints of enteric bacteria in the family Enterobacteriaceae because there are no breakpoints that are specific for Campylobacter.
2.5. Data Analysis
All the data collected within the present study were analyzed using R software, a language and an environment for statistical computing [28]. The antimicrobial resistance analyses were performed by means of a Chi-square statistic (p < 0.05) [29]. This test is a non-parametric tool designed to compare frequency counts between two groups of different sample sizes; the selection criteria for significantly prevalent variance was a stringent p-value of 0.001 or less.
3. Results
3.1. Occurrence of Campylobacter in Layer Hens and Eggshell Samples
Out of the 366 cloacal swab samples, 43% (155/366) were positive for Campylobacter spp. Overall, 106 isolates were assigned as C. jejuni (68.4%) and 49 as C. coli (31.6%). The occurrence of Campylobacter contamination on eggshells was 25.6% (22/86), with the predominance of C. jejuni, which showed a percentage of 81.8% (18/22), followed by C. coli with 18.2% (4/22). The occurrence of contamination ranged from 20% to 100% per flock and from 29% to 47.4% per governorate (p < 001). In the region of Nabeul, the occurrence of Campylobacter was 47.4% (126/266), while in the Ben Arous region, it was 29% (29/100).
3.2. Antimicrobial Susceptibility
All isolates were resistant to tetracycline, erythromycin, nalidixic acid, ciprofloxacin, and chloramphenicol. Regarding the β-lactams, a very high resistance rate (85.8%) was noted within strains against ampicillin; 98% of C. coli and 80% of C. jejuni were resistant (Table 2).
Table 2.
Antibiotic Classes | Antibiotics | Sensitivity | Resistance |
C. jejuni (n = 106) |
C. coli (n = 49) |
Total (n = 155) |
---|---|---|---|---|---|---|
(≥S) | (R<) | (%) | (%) | (%) | ||
β-lactams | Ampicillin | 19 | 14 | 80 | 98 * | 85.8 |
Amoxicillin/clavulanic acid | 19 | 14 | 43 * | 18 | 35.5 | |
Fluoroquinolones | Ciprofloxacin | 26 | 26 | 100 | 100 | 100 |
Nalidixic Acid | 19 | 14 | 100 | 100 | 100 | |
Macrolides | Erythromycin | 20 | 20 | 100 | 100 | 100 |
Tetracyclines | Tetracycline | 30 | 30 | 100 | 100 | 100 |
Phenicols | Chloramphenicol | 17 | 17 | 100 | 100 | 100 |
Aminoglycosides | Gentamicin | 17 | 17 | 1.9 | 0 | 1 |
* Significant difference between the two species (p < 0.05).
The percentage of resistant isolates to amoxicillin/clavulanic acid was 43% in C. coli vs. 18% for C. jejuni. The lowest rate of resistance was found for gentamicin with 1.9% for C. jejuni isolates and 0% for C. coli isolates. The resistance percentages in C. jejuni and C. coli isolated from laying hens are shown in Table 2.
Multidrug-resistance was detected among all Campylobacter isolates, and resistance profiles including 4 and 5 antibiotic classes were observed in 11.6% and 88.4% of strains, respectively. Five antimicrobial resistance patterns were found for all Campylobacter isolates (Table 3), with a predominance (43.2%) of the combination “AM-AMC-NAL-CIP-ERI-TET-CHL”.
Table 3.
Multidrug Resistance Profiles | C. jejuni | C. coli | Total | |||
---|---|---|---|---|---|---|
(n = 106) % | (n = 49) % | |||||
n | % | n | % | n | (%) | |
AM-AMC-NAL-CIP-ERI-TET-CHL | 58 | 55% | 9 | 18% | 67 | 43.22% |
AM-NAL-CIP-ERI-TET-CHL | 20 | 19% | 40 | 82% | 60 | 38.7% |
AM-CIP-ERI-TET-CHL | 10 | 9% | 0 | 0% | 10 | 6.45% |
NAL-CIP-ERI-TET-CHL | 12 | 11% | 0 | 0% | 12 | 7.74% |
AM-ERI-TET-CHL | 6 | 6% | 0 | 0% | 6 | 3.87% |
n: number; AM: Amoxicillin; AMC: Amoxicillin/clavulanic acid; CIP: Ciprofloxacin; NAL: Nalidixic Acid; ERY: Erythromycin; TET: Tetracycline; CHL: Chloramphenicol; GEN: Gentamicin.
Most of the C. jejuni isolates (55%) belonged to this group, as compared to the C. coli isolates (18%). The pattern "AM-NAL-CIP-ERI-TET-CHL” was detected in 38.7% of the isolates. The majority of C. coli strains were multidrug-resistant; only one C. coli isolate showed the specific pattern “AM-NAL-CIP-ERI-TET-CHL”.
4. Discussion
Compared to broiler chickens, laying hens showed a higher frequency of Campylobacter colonization [12,30]. When infected, the laying hens excrete large quantities of Campylobacter cells; therefore, their droppings represent an important source of contamination in poultry and animal farms [30]. Meat from spent laying hens is not commonly consumed; however, in Tunisia, high meat yields from such hens is marketed. Besides, there are few published data reporting the presence of Campylobacter in laying hen flocks. For these reasons, it was interesting to carry out this work and study the occurrence of Campylobacter in laying hen flocks to investigate the potential risk of Campylobacter infections for consumers.
Our results revealed an occurrence of 43% (155/366) of Campylobacter spp. in layer hen farms, which is higher than that reported in our previous study in broilers (22.4%) [31]. Both broilers and laying hens could harbor campylobacters at high percentages in the gut at the slaughter age. However, the laying hens were raised for longer periods, which allowed the persistence and the widespread nature of infections. Nevertheless, the temporal dynamics of Campylobacter spp. colonization in laying hens is not yet well-understood [32]. When comparing our result (43%) with other reports, it was higher than those reported in Greece (13.3%) [33] and Australia (11%) [17], but lower than those observed in Finland (86%) [34], Italy (65%) [35], and Sri Lanka (64%) [36].
After identification of the isolated Campylobacter strains, a predominance of C. jejuni (67%) over C. coli species (33%) was noted; this is in agreement with our previously reported results in broiler flocks [31]. Such a difference has been described by several studies [33,37] and similar data were reported by the EFSA in 2016, with a predominance of C. jejuni (60%) over C. coli (40%).
Despite the evidence that the consumption of contaminated chickens’ meat is responsible for an important percentage of human campylobacteriosis cases, the involvement of other poultry products such as eggs has not yet been studied in Tunisia. A better understanding of the role of eggs in the spread of Campylobacter has become necessary. Thus, one of the objectives of our study was to investigate the occurrence rate of thermotolerant Campylobacter on eggshells. These data could be useful for the risk assessment of human campylobacteriosis caused by the consumption of undercooked eggs, the consumption of food produced with raw eggs, or by handling eggs.
The eggshell contamination can occur in the hen’s reproductive tract or by feces after laying. Thus, subsequent contamination of egg products with Campylobacter spp. could be generated [38]. Our results showed that out of 86 eggshell samples, 22 (26%) were positive for Campylobacter. This rate is higher than that reported in Malaysia, (12%) [39], Germany (4.1%) [40], and Trinidad (1%) [41]. However, this rate remains lower than reported in Japan, which was 36% [42]. This high contamination rate could be a potential source of egg product contamination during the production process, especially for cracked eggs [40,42]. Indeed, one contaminated egg might be enough to contaminate a whole batch of unpasteurized liquid eggs, which could be a real potential risk for consumer health [33] Out of the positive samples, 82% (18/22) were identified as C. jejuni and 18% (4/22) as C. coli, showing the dominance of C. jejuni species, as described in Egypt [43].
Another important aspect that has likely contributed to the failure of controlling and therefore eradicating Campylobacter contamination in poultry flocks is the emergence of antimicrobial-resistant strains. Indeed, as with all infectious diseases of bacterial origin, the therapy of Campylobacter is essentially based on the use of antibacterial molecules. The emergence of resistant strains limits the efficiency of these drugs and causes therapeutic failures in animals and the spread of resistant strains in humans.
In general, erythromycin and ciprofloxacin are the recommended antibiotics for the treatment of campylobacteriosis in humans [44], whereas tetracyclines and beta-lactams, which are used to treat intestinal infections, are not generally recommended in campylobacteriosis cases [45,46]. On the other hand, gentamicin was proven in vitro to have good antimicrobial activity and may be considered as an alternative treatment [47].
In our study, we tested eight antibiotics that are commonly used in poultry farms in Tunisia [31]. The results showed high rates of resistance in C. coli and C. jejuni strains to erythromycin, tetracycline, ciprofloxacin, nalidixic acid, and chloramphenicol. However, lower rates were observed for ampicillin, amoxicillin/clavulanic acid, and gentamicin. Although most antibiotics are prohibited during the laying period, the use of antibiotics during the incubation and growth periods is allowed for laying hens. During growth and development, the acquisition of antibiotic resistance genes is likely important [48].
The high antimicrobial resistance rates could be related to the excessive use of antibiotics in chicken farms to control bacterial infections, as well as the use of growth promoters. Indeed, several studies have shown a clear positive association between the use of fluoroquinolones in poultry production and the emergence of resistant Campylobacter strains in poultry and humans [49,50,51]. In countries prohibiting the use of fluoroquinolones in poultry production, such as Australia and Nordic European countries, low rates of resistant Campylobacter were found in chickens and humans [52].
On the other hand, the Horizontal Gene Transfer (HGT) plays a key role in AMR acquisition. The HGT is even more frequent in microorganisms sharing similar mobilomes, and is more likely in the gut-associated microorganisms [53].
Comparing the results of this study in laying hens with broilers [31], a difference in the resistance rates of isolated strains, as compared to nalidixic acid, was found. Indeed, it was noted that all Campylobacter strains isolated from laying hens were resistant, whereas only 46.2% of strains from broilers were resistant to nalidixic acid in broilers.
Even though the use of chloramphenicol is prohibited in our country, all isolates were resistant. Interestingly, none of the sampled farms had used this drug; however, they used florfenicol as a broad-range antibiotic. On the basis of this observation, we can explain the resistance against chloramphenicol as a combined acquired resistance against florfenicol/chloramphenicol [54].
On the other hand, the low rates of gentamicin resistance found in Campylobacter isolates from laying hens/eggs and previously from broiler chickens (1% and 12.9%, respectively) were probably related to its infrequent use in poultry production. These resistance rates are consistent with previous studies reporting a low level of gentamicin resistance in C. jejuni isolated from chicken meat [51,55].
To a lesser extent, the rates of β-lactams resistance of Campylobacter isolated from layers were 85.8% for ampicillin and 35.5% for amoxicillin/clavulanic acid. These rates were higher than those reported in our previous study in broilers [31]. When looking the resistance rates within species, we noted a significant difference between ampicillin (80% versus 98%) and amoxicillin/clavulanic acid (43% versus18%), in C. jejuni and C. coli, respectively. Similar alarming resistance rates with regard to β-lactams were reported in several countries, such as Algeria (100%) [56] and Italy (100%) [57]. Even though β-lactams are not used in the treatment of campylobacteriosis in humans, the emergence of extended-spectrum beta-lactamase (ESBL)-producing Campylobacter strains could be a source of ESBL-gram-negative bacteria dissemination. It is noteworthy to remember that ESBL is an emerging global health threat and is associated with high mortality worldwide [58].
All Campylobacter isolates were identified as multidrug-resistant, with patterns including resistance to more than three antibiotics, as described in our previous results [28]. Several studies have shown that the emergence of multidrug-resistant isolates in animals represents a significant problem in Tunisia [59]. This worrying phenomenon is further complicated by the lack of an effective national antimicrobial surveillance system in husbandry.
5. Conclusions
Our study reported the occurrence of Campylobacter spp. in laying hen farms and on eggshells in Tunisia, and described AMR in the isolated C. jejuni and C. coli strains. The high antimicrobial resistance rates with multidrug-resistant strains’ emergence should be taken into consideration. Particularly, resistance to fluoroquinolones and macrolides is alarming since they are the drugs of choice. Our findings are of great concern considering that poultry are the major source of human campylobacteriosis and antimicrobial-resistant strains could be easily transmitted to humans via the food chain. Therefore, the assessment and monitoring of Campylobacter spp. infection in poultry flocks and AMR surveillance is needed to protect public health.
Acknowledgments
We would like to thank the farm owners for their permission to collect samples and to use them in this study. We also thank the farm veterinarians for facilitating the collection of samples.
Author Contributions
Conceptualization, M.G., A.B. and A.M.; methodology, M.G. and A.B.; software, C.B.H. and M.G.; validation, M.G., A.B. and A.M.; formal analysis, A.B. and A.M.; investigation, M.G., A.B., N.A., S.H. and G.B.; resources, A.G. and A.M.; data curation, M.G., A.B. and A.M.; writing—original draft preparation, M.G.; writing—review and editing, A.B., A.G. and A.M.; visualization, M.G.; supervision, A.B. and A.M.; project administration, A.B. and A.M.; funding acquisition, A.B., A.M. and A.G. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Tunisian Ministry of Higher Education and Scientific Research through funds allocated to the Laboratory of Epidemiology and Veterinary Microbiology (LR16IPT03) and by the Internal Collaborative Project of Pasteur Institute of Tunis (PCI), with the reference: PCI-23 (2016–2017).
Institutional Review Board Statement
This study was reviewed and approved by the Biomedical Ethics Committee of Institute Pasteur of Tunis, ref. 2018/12/I/LR16IPT03. Farm owners were informed of the objectives of this study and agreed to participate in this study.
Informed Consent Statement
Not applicable.
Data Availability Statement
All the data supporting reported results are involved in this manuscript.
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Thomas K.M., de Glanville W.A., Barker G.C., Benschop J., Buza J.J., Cleaveland S., Davis M.A., French N.P., Mmbaga B.T., Prinsen G., et al. Prevalence of Campylobacter and Salmonella in African food animals and meat: A systematic review and meta-analysis. Int. J. Food Microbiol. 2020;315:108382. doi: 10.1016/j.ijfoodmicro.2019.108382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kreling V., Falcone F.H., Kehrenberg C.A. Campylobacter sp.: Pathogenicity factors and prevention methods—New molecular targets for innovative antivirulence drugs? Appl. Microbiol. Biotechnol. 2020;104:10409–10436. doi: 10.1007/s00253-020-10974-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Fitzgerald C. Campylobacter. Clin. Lab. Med. 2015;35:289–298. doi: 10.1016/j.cll.2015.03.001. [DOI] [PubMed] [Google Scholar]
- 4.Meade K.G., Narciandi F., Cahalane S., Reiman C., Allan B., O’Farrelly C. Comparative in vivo infection models yield insights on early host immune response to Campylobacter in chickens. Immunogenetics. 2009;61:101–110. doi: 10.1007/s00251-008-0346-7. [DOI] [PubMed] [Google Scholar]
- 5.Sanyal S.C., Islam K.M., Neogy P.K., Islam M., Speelman P., Huq M.I. Campylobacter jejuni diarrhea model in infant chickens. Infect. Immun. 1984;43:931–936. doi: 10.1128/iai.43.3.931-936.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Humphrey S., Chaloner G., Kemmett K., Davidson N., Williams N., Kipar A., Humphrey T., Wigley P. Campylobacter jejuni is not merely a commensal in commercial broiler chickens and affects bird welfare. MBio. 2014;5:e01364-14. doi: 10.1128/mBio.01364-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.García-sánchez L., Melero B., Diez A.M., Jaime I., Rovira J. Characterization of Campylobacter species in Spanish retail from different fresh chicken products and their antimicrobial resistance. Food Microbiol. 2018;76:457–465. doi: 10.1016/j.fm.2018.07.004. [DOI] [PubMed] [Google Scholar]
- 8.Rahman M.A., Paul P.R., Hoque N., Islam S.S., Haque A.K.M.Z., Sikder M.H., Matin A., Yamasaki S., Kabir S.M.L. Prevalence and Antimicrobial Resistance of Campylobacter Species in Diarrheal Patients in Mymensingh, Bangladesh. Biomed. Res. Int. 2021;2021:9229485. doi: 10.1155/2021/9229485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Khan J.A., Rathore R.S., Abulreesh H.H., Qais F.A., Ahmad I. Prevalence and Antibiotic Resistance Profiles of Campylobacter jejuni Isolated from Poultry Meat and Related Samples at Retail Shops in Northern India. Foodborne Pathog. Dis. 2018;15:218–225. doi: 10.1089/fpd.2017.2344. [DOI] [PubMed] [Google Scholar]
- 10. [(accessed on 1 April 2020)]. Available online: https://www.who.int/news-room/fact-sheets/detail/campylobacter.
- 11.Wangroongsarb P., Cheunban N., Jittaprasatsin C., Kamthalang T., Saipradit N., Chaichana P., Pulsrikarn C., Parnmen S., Sripichai O. Prevalence and antimicrobial susceptibility of Campylobacter isolated from retail chickens in Thailand. Int. J. Food Microbiol. 2021;339:10901. doi: 10.1016/j.ijfoodmicro.2020.109017. [DOI] [PubMed] [Google Scholar]
- 12.Sibanda N., McKenna A., Richmond A., Ricke S.C., Callaway T., Stratakos A.C., Gundogdu O., Corcionivoschi N. A review of the effect of management practices on Campylobacter prevalence in poultry farms. Front. Microbiol. 2018;9:2002. doi: 10.3389/fmicb.2018.02002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Stern N.J., Robach M.C. Enumeration of Campylobacter spp. in broiler feces and in corresponding processedcarcasses. J. Food Prot. 2003;66:1557–1563. doi: 10.4315/0362-028X-66.9.1557. [DOI] [PubMed] [Google Scholar]
- 14.De Reu K., Grijspeerdt K., Heyndrickx M., Zoons J., De Baere K., Uyttendaele M., Debevere J., Herman L. Bacterial eggshell contamination in conventional cages, furnished cages and aviary housing systems for laying hens. Br. Poult. Sci. 2005;46:149–155. doi: 10.1080/00071660500065359. [DOI] [PubMed] [Google Scholar]
- 15.Cox N.A., Richardson L.J., Buhr R.J., Fedorka-Cray P.J. Campylobacter species occurrence within internal organs and tissues of commercial caged Leghorn laying hens. Poult. Sci. 2009;88:2449–2456. doi: 10.3382/ps.2009-00195. [DOI] [PubMed] [Google Scholar]
- 16.Sahin O., Kobalka P., Zhang Q. Detection and survival of Campylobacter in chicken eggs. J. Appl. Microbiol. 2003;95:1070–1079. doi: 10.1046/j.1365-2672.2003.02083.x. [DOI] [PubMed] [Google Scholar]
- 17.Fonseca B.B., Beletti M.E., de Melo R.T., Mendonça E.P., Coelho L.R., Nalevaiko P.C., Rossi D.A. Campylobacter jejuni in commercial eggs. Braz. J. Microbiol. 2014;45:76–79. doi: 10.1590/S1517-83822014000100011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Novoa Rama E., Bailey M., Jones D.R., Gast R.K., Anderson K., Brar J., Taylor R., Oliver H.F., Singh M. Prevalence, Persistence, and Antimicrobial Resistance of Campylobacter spp. from Eggs and Laying Hens Housed in Five Commercial Housing Systems. Foodborne Pathog. Dis. 2018;15:506–516. doi: 10.1089/fpd.2017.2404. [DOI] [PubMed] [Google Scholar]
- 19.Mourkas E., FlorezCuadrado D., Pascoe B., Calland J.K., Bayliss S.C., Mageiros L., Méric G., Hitchings M.D., Quesada A., Porrero C. Gene pool transmission of multidrug resistance among Campylobacter from livestock, sewage and human disease. Environ. Microbiol. 2019;21:4597–4613. doi: 10.1111/1462-2920.14760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sproston E.L., Wimalarathna H.M.L., Sheppard S.K. Trends in fluoroquinolone resistance in Campylobacter. Microb. Genomics. 2018;4:e000198. doi: 10.1099/mgen.0.000198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Smith A.B., Renter D.G., Shi X., Cernicchiaro N., Sahin O., Nagaraja T.G. Campylobacter Prevalence and Quinolone Susceptibility in Feces of PreharvestFeedlot Cattle Exposed to Enrofloxacin for the Treatment of Bovine Respiratory Disease. Foodborne Pathog. Dis. 2018;15:377–385. doi: 10.1089/fpd.2017.2398. [DOI] [PubMed] [Google Scholar]
- 22.Di Giannatale E., Calistri P., Di Donato G., Decastelli L., Goffredo E., Adriano D., Mancini M.E., Galleggiante A., Neri D., Antoci S. Thermotolerant Campylobacter spp. in chicken and bovine meat in Italy: Prevalence, level of contamination and molecular characterization of isolates. PLoS ONE. 2019;14:e0225957. doi: 10.1371/journal.pone.0225957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. [(accessed on 27 November 2019)]. Available online: http://www.gipac.tn/index.php/la-filere-oeufs.
- 24.Williams L.K., Jørgensen F., Grogono-Thomas R., Humphrey T.J. Enrichment culture for the isolation of Campylobacter spp: Effects of incubation conditions and the inclusion of blood in selective broths. Int. J. Food Microbiol. 2009;130:131–134. doi: 10.1016/j.ijfoodmicro.2009.01.018. [DOI] [PubMed] [Google Scholar]
- 25.Stucki U., Frey J., Nicolet J., Burnens A.P. Identification of Campylobacter jejuni on the basis of a species-specific gene that encodes a membrane protein. J. Clin. Microbiol. 1995;33:855–859. doi: 10.1128/jcm.33.4.855-859.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Gonzalez I., Grant K.A., Richardson P.T., Park S.F., Collins M.D. Specific identification of the Enteropathogens Campylobacter jejuni and Campylobacter coli by using a PCR test based on the ceuE gene encoding a putative virulence determinant. J. Clin. Microbiol. 1997;35:759–763. doi: 10.1128/jcm.35.3.759-763.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.EUCAST: Comite de L’antibiogramme, Societe Francaise de Microbiologie. 2017. [(accessed on 28 December 2021)]. p. 129. Available online: https://www.sfm-microbiologie.org/wp-content/uploads/2020/07/24CASFM_2013.pdf.
- 28.R Development Core Team . R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing; Vienna, Austria: 2008. [Google Scholar]
- 29.McHugh M.L. The Chi-square test of independence. Biochem. Medica. 2012;23:143–149. doi: 10.11613/BM.2013.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Newell D.G., Elvers K.T., Dopfer D., Hansson I., Jones P., James S., Gittins J., Stern N.J., Davies R., Connerton I., et al. Biosecuritybased interventions and strategies to reduce Campylobacter spp. on poultry farms. Appl. Environ. Microbiol. 2011;77:8605–8614. doi: 10.1128/AEM.01090-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Gharbi M., Béjaoui A., Ben Hamda C., Jouini A., Ghedira K., Zrelli C., Hamrouni S., Aouadhi C., Bessoussa G., Ghram A., et al. Prevalence and Antibiotic Resistance Patterns of Campylobacter spp. Isolated from Broiler Chickens in the North of Tunisia. Biomed Res. Int. 2018;2018:7943786. doi: 10.1155/2018/7943786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Asakura H., Nakayama T., Yamamoto S., Izawa K., Kawase J., Torii Y., Murakami S. Long-Term Grow-Out Affects Campylobacter jejuni Colonization Fitness in Coincidence With Altered Microbiota and Lipid Composition in the Cecum of Laying Hens. Front. Vet. Sci. 2021;8:657. doi: 10.3389/fvets.2021.675570. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Jones D.R., Guard J., Gast R.K., Buhr R.J., Fedorka-Cray P.J., Abdo Z., Plumblee J.R., Bourassa D.V., Cox N.A., Rigsby L.L. Influence of commercial laying hen housing systems on the incidence and identification of Salmonella and Campylobacter. Poult. Sci. 2016;95:1116–1124. doi: 10.3382/ps/pew036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Sulonen J., Kärenlampi R., Holma U., Hänninen M.-L. Campylobacter in Finnish organic laying hens in autumn 2003 and spring 2004. Poult. Sci. 2007;86:1223–1228. doi: 10.1093/ps/86.6.1223. [DOI] [PubMed] [Google Scholar]
- 35.Dipineto L., Gargiulo A., Russo T.P., De Luca Bossa L.M., Borrelli L., Menna L.F., Fioretti A. Campylobacter jejuni, Campylobacter coli, and cytolethal distending toxin genes in laying hens. Avian Dis. 2011;55:103–105. doi: 10.1637/9525-091510-ResNote.1. [DOI] [PubMed] [Google Scholar]
- 36.Kalupahana R.S., Kottawatta K.S.A., Kanankege K.S.T., Van Bergen M.A.P., Abeynayake P., Wagenaar J.A. Colonization of Campylobacter spp. in broiler chickens and laying hens reared in tropical climates with low-biosecurity housing. Appl. Environ. Microbiol. 2013;79:393–395. doi: 10.1128/AEM.02269-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kovanen S.M., Kivistö R.I., Rossi M., Schott T., U.-Kärkkäinen M., Tuuminen T., Uksila J., Rautelin H., Hänninen M.-L. Multilocus sequence typing (MLST) and whole-genome MLST of Campylobacter jejuni isolates from human infections in three districts during a seasonal peak in Finland. J. Clin. Microbiol. 2014;52:4147–4154. doi: 10.1128/JCM.01959-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Baron F., Jan S. Microbiology of egg and egg products. INRA Prod. Anim. 2010;23:193–203. doi: 10.20870/productions-animales.2010.23.2.3300. [DOI] [Google Scholar]
- 39.Nor Faiza S., Saleha A.A., Jalila A., Fauziah N. Research note occurrence of campylobacter and salmonella in ducks and duck eggs in Selangor, Malaysia. Trop. Biomed. 2013;30:155–158. [PubMed] [Google Scholar]
- 40.Messelhäusser U., Thärigen D., Elmer-Englhard D., Bauer H., Schreiner H., Höller C. Occurrence of thermotolerant Campylobacter spp. on eggshells: A missing link for food-borne infections? Appl. Environ. Microbiol. 2011;77:3896–3897. doi: 10.1128/AEM.00145-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Adesiyun A., Offiah N., Seepersadsingh N., Rodrigo S., Lashley V., Musai L., Georges K. Microbial health risk posed by table eggs in Trinidad. Epidemiol. Infect. 2005;133:1049–1056. doi: 10.1017/S0950268805004565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Sato M., Sashihara N. Occurrence of Campylobacter in commercially broken liquid egg in Japan. J. Food Prot. 2010;73:412–417. doi: 10.4315/0362-028X-73.3.412. [DOI] [PubMed] [Google Scholar]
- 43.Hedawey K.A.A., Youssef A.S. Incidence of Campylobacter species in laying hens and table egg in Sohag governorate. Assiut Vet. Med. J. 2014;141:120–124. [Google Scholar]
- 44.Ghunaim H., Behnke J.M., Aigha I., Sharma A., Doiphode S.H., Deshmukh A., Abu-Madi M.M. Analysis of resistance to antimicrobials and presence of virulence/stress response genes in Campylobacter isolates from patients with severe diarrhoea. PLoS ONE. 2015;10:e0119268. doi: 10.1371/journal.pone.0119268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Blaser M.J., Perez-Perez G.I. Campylobacter Pylori Antigens and Uses Thereof for Detection of Campylobacter pylori Infection. 5459041. U.S. Patent. 1995 October 17;
- 46.Wieczorek K., Osek J. Antimicrobial resistance mechanisms among Campylobacter. Biomed Res. Int. 2013;2013:340605. doi: 10.1155/2013/340605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Iovine N.M. Resistance mechanisms in Campylobacter jejuni. Virulence. 2013;4:230–240. doi: 10.4161/viru.23753. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Zhu T., Chen T., Cao Z., Zhong S., Wen X., Mi J., Ma B., Zou Y., Zhang N., Liao X., et al. Antibiotic resistance genes in layer farms and their correlation with environmental samples. Poult. Sci. 2021;100:101485. doi: 10.1016/j.psj.2021.101485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Garcia-Migura L., Hendriksen R.S., Fraile L., Aarestrup F.M. Antimicrobial resistance of zoonotic and commensal bacteria in Europe: The missing link between consumption and resistance in veterinary medicine. Vet. Microbiol. 2014;170:1–9. doi: 10.1016/j.vetmic.2014.01.013. [DOI] [PubMed] [Google Scholar]
- 50.Giacomelli M., Salata C., Martini M., Montesissa C., Piccirillo A. Antimicrobial resistance of Campylobacter jejuni and Campylobacter coli from poultry in Italy. Microb. Drug Resist. 2014;20:181–188. doi: 10.1089/mdr.2013.0110. [DOI] [PubMed] [Google Scholar]
- 51.Marotta F., Garofolo G., Di Marcantonio L., Di Serafino G., Neri D., Romantini R., Sacchini L., Alessiani A., Di Donato G., Nuvoloni R. Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry. PLoS ONE. 2019;14:e0223804. doi: 10.1371/journal.pone.0223804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Skarp C.P.A., M.-Hänninen L., Rautelin H.I.K. Campylobacteriosis: The role of poultry meat. Clin. Microbiol. Infect. 2016;22:103–109. doi: 10.1016/j.cmi.2015.11.019. [DOI] [PubMed] [Google Scholar]
- 53.Mazodier P., Davies J. Gene Transfer between Distantly Related Bacteria. Annu. Rev. Genet. 1991;25:147–171. doi: 10.1146/annurev.ge.25.120191.001051. [DOI] [PubMed] [Google Scholar]
- 54.Udo E.E., Boswihi S.S., Mathew B., Noronha B., Verghese T. Resurgence of Chloramphenicol Resistance in Methicillin-Resistant Staphylococcus aureus Due to the Acquisition of a Variant Florfenicol Exporter (fexAv)-Mediated Chloramphenicol Resistance in Kuwait Hospitals. Antibiotics. 2021;10:1250. doi: 10.3390/antibiotics10101250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Mattheus W., Botteldoorn N., Heylen K., Pochet B., Dierick K. Trend analysis of antimicrobial resistance in Campylobacter jejuni and Campylobacter coli isolated from Belgian pork and poultry meat products usingsurveillance data of 2004–2009. Foodborne Pathog. Dis. 2012;9:465–472. doi: 10.1089/fpd.2011.1042. [DOI] [PubMed] [Google Scholar]
- 56.Messad S., Mamdi T.-H., Bouhamed R., Ramdani-Bouguessa N., Tazir M. Frequency of contamination and antimicrobial resistance of thermotolerant Campylobacter isolated from some broiler farms and slaughterhouses in the region of Algiers. Food Control. 2014;40:324–328. doi: 10.1016/j.foodcont.2013.12.016. [DOI] [Google Scholar]
- 57.Fraqueza M.J., Martins A., Borges A.C., Fernandes M.H., Fernandes M.J., Vaz Y., Bessa R.J.B., Barreto A.S. Antimicrobial resistance among Campylobacter spp. strains isolated from different poultry production systems at slaughterhouse level. Poult. Sci. 2014;93:1578–1586. doi: 10.3382/ps.2013-03729. [DOI] [PubMed] [Google Scholar]
- 58.Erb S., D’Mello-Guyett L., Malebo H.M., Njee R.M., Matwewe F., Ensink J., Hinic V., Widmer A., Frei R. High prevalence of ESBL-Producing, E. coli in private and shared latrines in an informal urban settlement in Dar es Salaam, Tanzania. Antimicrob. Resist Infect. Control. 2018;7:3. doi: 10.1186/s13756-017-0292-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Abbassi M. Antimicrobial Resistance in Escherichia coli Isolates from Healthy Poultry, Bovine and Ovine in Tunisia: A Real Animal and Human Health Threat. J. Clin. Microbiol. Biochem. Technol. 2017;3:19–23. doi: 10.17352/jcmbt.000021. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All the data supporting reported results are involved in this manuscript.