Skip to main content
eLife logoLink to eLife
. 2022 Mar 15;11:e74056. doi: 10.7554/eLife.74056

MicroRNA-138 controls hippocampal interneuron function and short-term memory in mice

Reetu Daswani 1, Carlotta Gilardi 1, Michael Soutschek 1, Prakruti Nanda 1, Kerstin Weiss 2, Silvia Bicker 1, Roberto Fiore 1, Christoph Dieterich 3, Pierre-Luc Germain 1, Jochen Winterer 1,✉, Gerhard Schratt 1,✉
Editors: John R Huguenard4, John R Huguenard5
PMCID: PMC8963876  PMID: 35290180

Abstract

The proper development and function of neuronal circuits rely on a tightly regulated balance between excitatory and inhibitory (E/I) synaptic transmission, and disrupting this balance can cause neurodevelopmental disorders, for example, schizophrenia. MicroRNA-dependent gene regulation in pyramidal neurons is important for excitatory synaptic function and cognition, but its role in inhibitory interneurons is poorly understood. Here, we identify miR138-5p as a regulator of short-term memory and inhibitory synaptic transmission in the mouse hippocampus. Sponge-mediated miR138-5p inactivation specifically in mouse parvalbumin (PV)-expressing interneurons impairs spatial recognition memory and enhances GABAergic synaptic input onto pyramidal neurons. Cellular and behavioral phenotypes associated with miR138-5p inactivation are paralleled by an upregulation of the schizophrenia (SCZ)-associated Erbb4, which we validated as a direct miR138-5p target gene. Our findings suggest that miR138-5p is a critical regulator of PV interneuron function in mice, with implications for cognition and SCZ. More generally, they provide evidence that microRNAs orchestrate neural circuit development by fine-tuning both excitatory and inhibitory synaptic transmission.

Research organism: Mouse

Introduction

MicroRNAs (miRNAs) are short noncoding RNAs that act as negative regulators of mRNA translation and stability (Bartel, 2018). Over the last decade, a large body of evidence shows that miRNAs control excitatory neuron development, function, and plasticity (McNeill and Van Vactor, 2012; Schratt, 2009). Specific miRNAs, for example, miR-132, -134, and -138, have been identified which control dendritic spines, the major sites of excitatory synaptic contact (Schratt et al., 2006; Siegel et al., 2009). The complete lack of miRNAs from excitatory forebrain neurons in Dicer-deficient mice enhances learning and memory (Konopka et al., 2010), and specific miRNAs have been linked to both short-term and long-term memory regulation (Cheng et al., 2018; Gao et al., 2010; Walgrave et al., 2021). Although miRNAs are likewise substantially expressed in inhibitory γ-aminobutyric acid (GABA)ergic interneurons (He et al., 2012), relatively little is known about miRNA function in this cell type. The complete lack of miRNAs reduces the number of cortical interneurons (Tuncdemir et al., 2015) while the absence of miRNAs in interneurons expressing vasoactive intestinal peptide (VIP) leads to cortical circuit dysfunction (Qiu et al., 2020). miR-128 knockout in Drd1a-positive GABAergic medium spiny neurons of the striatum results in increased motor activity and fatal epilepsy (Tan et al., 2013).

In the rodent hippocampus, microcircuits of excitatory pyramidal neurons and local inhibitory interneurons provide an extensively studied model in the context of information processing, with specific implications for the control of spatial short-term and long-term memory (Booker and Vida, 2018; Markram et al., 2004; Pelkey et al., 2017). Among the different interneuron classes, fast-spiking parvalbumin (PV)-expressing interneurons play a particularly prominent role in controlling pyramidal neuron output to drive appropriate behavioral responses (Murray et al., 2011; Rico and Marín, 2011). For example, CA1 PV interneurons are required for spatial working memory, but neither for reference memory nor for memory acquisition in contextual fear conditioning (CFC) (Fuchs et al., 2007; Lovett-Barron et al., 2014; Murray et al., 2011). PV interneuron dysfunction has been implicated in neuropsychiatric disorders, most notably schizophrenia (SCZ), but also epilepsy and autism-spectrum disorders (ASD) (Del Pino et al., 2018; Sohal and Rubenstein, 2019). However, the role of specific miRNAs in PV interneurons in the context of higher cognitive function is completely elusive.

Results

We previously identified the brain-enriched miR138-5p as an important regulator of excitatory synapse function in hippocampal pyramidal neurons (Siegel et al., 2009). To study the role of miR138-5p on a behavioral level, we generated mice with a conditional ROSA26 transgene (138-floxed) which allows expression of a miR138-5p inactivating sponge transcript harboring a lacZ coding sequence and six imperfect miR138-5p binding sites (6x-miR-138sponge) upon Cre-recombinase expression. Sponge transcripts sequester endogenous miRNA, thereby leading to miRNA inactivation and the derepression of cognate target genes (Ebert and Sharp, 2010). 138-floxed mice without Cre transgene served as a control throughout the experiments. Since these control mice completely lack expression of any sponge-related transcript in vivo, we first carefully validated the specificity and efficiency of the 138-sponge transcript in primary rat hippocampal neurons. Therefore, we compared the 138-sponge transcript to an identical control sponge, except that the six imperfect miR-138 binding sites were replaced with a shuffled sequence not supposed to sequester any miRNA expressed in neurons (cf. Materials and methods). This analysis revealed a robust and specific inactivation of miR138-5p by 138-sponge in vitro (Figure 1—figure supplement 1a-c).

We then activated 138-sponge expression at embryonic stage in vivo by crossing 138-floxed mice to the ubiquitous Cre-driver line CMV-Cre (138-spongeub, Figure 1a). lacZ staining revealed highly penetrant expression of 6x-miR-138 sponge in the hippocampus of 138-floxed mice upon CMV-Cre expression (Figure 1—figure supplement 1d). To test for the degree of miR138-5p inhibition in vivo, we made use of a dual fluorescence miR-138 sensor virus which we injected into the hippocampus of 138-spongeub mice. Briefly, the sensor consists of a GFP coding sequence (cds) followed by two perfect miR-138 binding sites and a mCherry cds (Figure 1—figure supplement 1e). Thus, the lower the ratio of GFP/mCherry, the higher the cellular miR-138 activity. Quantifying GFP/mCherry ratios over many infected neurons revealed that in neurons with 6x-miR-138-sponge expression, GFP/mCherry ratios were significantly higher compared to controls, indicative of an efficient sequestering of endogenous miR138-5p by our sponge construct (Figure 1b).

Figure 1. Impaired working memory in ubiquitous 138-sponge mice.

(a) Schematic overview of the strategy for generating 138-spongeub mice. (b) Left: representative images of mCherry and GFP expression in hippocampal neurons from 138-floxed and 138-spongeub mice, respectively. Right: bar graphs of GFP/mCherry ratios from CA1 hippocampal neurons infected with a 138-pbds sensor construct; 138-floxed: n=105 cells from two mice, 138-spongeub: n=127 cells from three mice; p=0.02 (KS-test). (c) Upper panel: schematic representation of the Y-maze novelty preference task; lower panel: exploration time spent in familiar (F) and novel (N) arm; 138-floxed: n=12 mice; 138-spongeub: n=14 mice; ***p=0.005; n.s.=0.711 (Student’s two-tailed heteroscedastic t-test). (d) Upper panel: schematic representation of the novel object recognition task; lower panel: exploration time presented as percentage of total time spent with either novel or familiar object; 138-floxed: n=12 mice; 138-spongeub: n=12 mice; ****p<0.00002; n.s. p=0.11 (Student’s two-tailed heteroscedastic t-test). (e) Upper: schematic representation of the contextual fear conditioning task; lower: time (s) mice spent freezing 24 hr after the foot shock was administrated; 138-floxed: n=7 mice; 138-spongeub: n=7 mice; n.s. p=0.97 (Student’s two-tailed heteroscedastic t-test). (f) mEPSC recording in CA1 pyramidal neurons. Upper panel: example traces; scale bar: 20 pA, 500 ms. Lower panel left: mEPSC amplitude (138-floxed: range, from 14.3 to 25.6 pA; median, 17.2 pA; interquartile range [IQR], 3.9 pA. 138-spongeub: range, from 14.1 to 25.2 pA; median, 17.4 pA; IQR, 3.1 pA; n.s. p=0.74 Student’s two-tailed heteroscedastic t-test). Lower panel right: mEPSC frequency (138-floxed: range, from 0.2 to 0.9 Hz; median, 0.5 Hz; IQR, 0.2 Hz. 138-spongeub: range, from 0.3 to 0.7 Hz; median, 0.5 Hz; IQR, 0.1 Hz; n.s. p=0.91 Student’s two-tailed heteroscedastic t-test). 138-floxed: n=13 cells/4 mice; 138-spongeub: n=13 cells/3 mice. (g) Upper panel: representative images of Golgi-stained CA1 pyramidal neuron dendritic segments of the indicated genotypes. Lower panel: quantification of dendritic spine width (left) and density (number/μm; right) based on Golgi staining; 138-floxed: n=15 cells/3 mice (1312 spines total); 138-spongeub: n=18 cells/3 mice (1687 spines total) (n.s., p=0.25 (width); p=0.49 (density); Student’s two-tailed heteroscedastic t-test). mEPSC, miniature excitatory postsynaptic current.

Figure 1—source data 1. This file contains the raw data on which the graphs in Figure 1 are based.

Figure 1.

Figure 1—figure supplement 1. Validation, behavioural and electrophysiological characterization of ubiquitous miR-138 sponge mice.

Figure 1—figure supplement 1.

(a) Relative luciferase activity in hippocampal neurons (DIV 12–17) transfected with pGL3 CTR (control) or pGL3-138 pbds (sensor) constructs. pGL3-CTR=1. n=3 independent transfections. **p=0.0013 (One sample t-test). (b) Relative luciferase activity in hippocampal neurons (DIV 12–17) transfected as in (a), in addition with either control (100 ng) or increasing amounts of 138 sponge (25–100 ng). pGL3-CTR/pGL3-138 only =1. n=3 independent transfections, **p=0.005, *p=0.032, #p=0.045 (Student’s two-tailed heteroscedastic t-test). (c) Quantification of relative dendritic spine volume in rat hippocampal neurons (DIV10–18) transfected with GFP and increasing amounts (25–100 ng) of either control or 138 sponge. GFP only =1. n=3 independent transfections; each value represents at least 150 spines per cell, from six individual neurons per experiment. **p=0.006, *p=0.027, #p=0.004 (Student’s two-tailed heteroscedastic t-test). (d) Representative enzymatic b-Gal staining of hippocampal slices obtained from 138-floxed mice (P21) injected with either saline (left) or rAAV-CMV-CRE (right). (e) Schematic of the sensor principle. (f) Activity counts of mice from indicated genotypes monitored over 24 hr in their home cage; 138-floxed: n=7 mice, 138-spongeub: n=7 mice; data shown as mean ±s.d. (g) Percentage of spontaneous alternations in the Y-Maze. 138-floxed: n=14 mice; 138-spongeub: n=14 mice; p=0.43 (Student’s two-tailed heteroscedastic t-test). (h, i) Percentage of total distance travelled (h)/time spent (i) in the center of an open field arena during 30 min exploration by mice of the indicated genotypes; 138-floxed: n=14 mice; 138-spongeub: n=14 mice; (h) p=0.30, (i) p=0.054 (Student’s two-tailed heteroscedastic t-test). (j) Percentage of total time spent in the open arms of an elevated plus maze (EPM) during 5 min exploration by mice of the indicated genotypes; 138-floxed: n=14 mice; 138-spongeub: n=14 mice; p=0.50 (Mann-Whitney test). (k, l) Cumulative distribution mEPSC amplitude (p=0.65; Kolmogorov-Smirnov [KS] test) (k) and frequency (p=0.85; KS test) (l). (m) PPR of stimulated EPSCs in CA1 pyramidal neurons. Upper panel: example traces of PPR (inter stimulus interval of 50 ms) for 138-floxed (orange) and 138-spongeub (blue); scale bar: 100 pA, 20 ms. Lower panel: PPRs for different interstimulus intervals ranging from 25 ms to 100 ms (138-floxed vs. 138-spongeub [mean ±s.d.]: 25 ms, 1.6±0.1 vs. 1.5±0.2 [n=13]; 50 ms: 1.6±0.2 vs. 1.5±0.2 [n=13]; 75 ms: 1.4±0.1 vs. 1.3±0.1 [n=11]; 100 ms: 1.3±0.1 vs. 1.3±0.1 [n=11]. n.s. p=0.14, 0.09, 0.17, and 0.13 for 25, 50, 75, and 100 ms) inter stimulus intervals, respectively. Mann-Whitney test. PPR, paired-pulse ratio.
Figure 1—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 1—figure supplement 1 are based.

We next assessed the cognitive abilities of 138-spongeub mice using behavioral testing. Locomotion in the home cage was similar between 138-spongeub and control mice, ruling out severe developmental motor impairments as a potential confound (Figure 1—figure supplement 1f). In the Y-maze test, no genotype-dependent differences in spontaneous alternations were observed, suggesting that exploratory behavior was not affected by miR138-5p inactivation (Figure 1—figure supplement 1g). In contrast, 138-spongeub mice displayed a significant impairment in novelty preference (Figure 1c), indicating a loss of spatial short-term memory. In the novel object recognition (NOR) task, 138-spongeub mice were unable to discriminate the novel from the familiar object (Figure 1d), thereby corroborating the observed short-term memory deficit. In contrast, associative long-term memory, as assessed by classical fear conditioning (Figure 1e), as well as anxiety-related behavior (open field, elevated plus maze [EPM]), was not affected by miR138-5p inhibition (Figure 1—figure supplement 1h-j). Thus, ubiquitous miR138-5p inhibition leads to a short-term memory deficit.

We went on to test whether short-term memory impairments in 138-spongeub mice were associated with alterations in synaptic transmission in hippocampal area CA1 and recorded miniature excitatory postsynaptic currents (mEPSCs) in CA1 pyramidal neurons. Amplitude and frequency of mEPSCs were indistinguishable between 138-spongeub and control slices (Figure 1f, Figure 1—figure supplement 1k, i). Likewise, we did not detect any significant alterations in dendritic spine morphology in these neurons using Golgi staining (Figure 1g). Finally, we did not observe differences in paired-pulse ratio (PPR), which negatively correlates with presynaptic release probability (Figure 1—figure supplement 1m), suggesting that excitatory synaptic transmission at the Schaffer collateral CA1 pyramidal cell synapse was not affected by miR138-5p inhibition.

To identify miR138-5p target mRNAs and to obtain further insight into the biological function of miR138-5p regulated genes, we performed polyA-RNA sequencing with total RNA isolated from hippocampal tissue. Differential gene expression analysis recovered a total of 338 differentially expressed genes (DEGs; 265 upregulated, 73 downregulated) (FDR <0.05; Figure 2a). The presence of miR138-5p binding sites correlated with increased transcript levels compared with 138-floxed mice (Figure 2b). miR138-5p 7-mer 1a, and to a lesser extent 7mer-m8 and 8mer sites, predicted significant derepression (Figure 2—figure supplement 1a). In total, 56 (21%) of the upregulated, but only 6 (8%) of the downregulated genes harbor miR138-5p binding sites within their 3′UTR. Taken together, this data demonstrates that many of the observed upregulated genes are a direct consequence of miR138-5p inhibition and further confirms the specificity of the miR138-5p sponge transgene.

Figure 2. Upregulation of interneuron-enriched synaptic genes in ubiquitous miR-138 sponge mice.

(a) Volcano plot of differentially expressed genes (DEGs) obtained from polyA-RNAseq of total hippocampal RNA from 138-flox and 138-spongeub mice. N=3. Genes with FDR <0.05 are labeled blue (downregulated) or green (upregulated). Rims3 and Erbb4 are indicated. (b) Cumulative distribution plots of log2-fold expression changes (138-spongeub/138-floxed) for genes either containing (targets, red curve) or not containing (non-targets, black curve) predicted miR-138 binding sites. p=2.55e–05 (KS-test). (c) Gene ontology (GO) term analysis for DEGs. Top ten enriched cellular component (CC) GO terms with less than 200 total genes are shown. (d) Enrichment analysis of DEGs in different brain cell types based on published single-cell RNA-seq data (Zeisel et al., 2018). Normalized enrichment score >0: upregulated in 138-spongeub mice. KS, Kolmogorov-Smirnov.

Figure 2.

Figure 2—figure supplement 1. Gene expression analysis in ubiquitous miR-138 sponge mice.

Figure 2—figure supplement 1.

(a) Cumulative distribution plots of log2-fold expression changes (138-spongeub/138-floxed) for genes either containing 7mer-1a (green), 7mer-m8 (red), 8mer (blue), or no (no site, black curve) predicted miR-138 binding sites. P value is calculated compared to the no site population and indicated in the graph (KS-test). (b) Gene ontology (GO) term analysis for DEGs. Top ten enriched cellular component (CC) GO terms are shown. (c) Normalized expression levels, in single-cell clusters from Zeisel et al., 2018, of the genes upregulated in the miR-138 sponge. The genes are most abundantly expressed in inhibitory neurons. (d) Expression plots of selected miR-138 binding site containing transcripts in different neuronal subtypes. EXC: excitatory neurons; PV: parvalbumin+interneurons; SST: somatostatin +interneurons; VIP: Vasoactive intestinal peptide+interneurons based on http://research-pub.gene.com/NeuronSubtypeTranscriptomes/. (e) Expression of validated miR138-5p targets based on RNA-seq in 138-floxed and 138-spongeUb mice. n=3 mice. Lypla1 n.s. p=0.90; Sirt1 n.s. p=0.66; Reln n.s. p=0.50 (Student’s two-tailed heteroscedastic t-test). DEG, differentially expressed gene; KS, Kolmogorov-Smirnov.
Figure 2—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 2—figure supplement 1 are based.

Gene ontology (GO) term analysis on DEGs from the RNA-seq analysis (Figure 2c; Figure 2—figure supplement 1b) revealed that many GO terms associated with synaptic function are strongly overrepresented in genes upregulated in the hippocampus of 138-spongeub mice. In order to specify the origin for the observed gene expression changes, we compared DEGs to single-cell RNA-seq data from different cell types present in the hippocampus (Zeisel et al., 2018; Figure 2d, Figure 2—figure supplement 1c). Surprisingly, we found that those genes which were significantly upregulated in 138-spongeub mice are strongly enriched in inhibitory GABAergic interneurons. This finding is in line with the observation that excitatory synaptic transmission in hippocampal CA1 was not affected by miR138-5p inactivation (Figure 1f and g, Figure 2—figure supplement 1j-l). Accordingly, many of the upregulated miR138-5p targets showed a strong expression signal in different classes of inhibitory interneurons (Figure 2—figure supplement 1d). In contrast, known validated targets of miR138-5p which are not enriched in inhibitory interneurons (e.g., Lypla1, Sirt1, and Reln) were not differentially expressed between 138-spongeub and control mice (Figure 2—figure supplement 1e).

Next, we performed single-molecule miRNA FISH in cultured rat hippocampal neurons to visualize miR138-5p expression at subcellular resolution. This analysis revealed strong expression of miR138-5p in both Camk2a-positive excitatory and Erbb4-positive inhibitory hippocampal neurons (Figure 3a). Erbb4-positive cells express Gad65, but not Camk2a, confirming their GABAergic phenotype (Figure 3a). Quantification of the FISH signal did not reveal any significant differences in the average cellular miR138-5p expression between excitatory and inhibitory neurons (Figure 3—figure supplement 1a), in agreement with an analysis of published miRNA-seq data from the mouse cortex (Figure 3—figure supplement 1b; He et al., 2012). In contrast, miR138-5p expression was undetectable in GFAP-positive glial cells (Figure 3—figure supplement 1c). Thus, miR138-5p is robustly expressed in inhibitory interneurons, consistent with a previously unrecognized function in these cells.

Figure 3. Erbb4 is a direct miR-138 target in rat hippocampal interneurons.

(a) Single-molecule (Sm) FISH analysis of miR-138 (red) together with Camk2a or Erbb4 mRNA to label excitatory or inhibitory neurons, respectively. Hoechst was used to counterstain nuclei. GAD65/67 antibody staining was used to identify GABAergic neurons. Scale bar =100 μm (upper); 20 μm (lower left and center), 5 μm (lower right). (b) qPCR analysis of ErbB4 mRNA in total hippocampal RNA obtained from 138-floxed or 138-spongeub mice. U6 snRNA was used for normalization. n=3 mice; *p=0.003, (Student’s two-tailed heteroscedastic t-test). (c, d) Western blot analysis of Erbb4 protein in hippocampal lysates from 138-floxed or 138-spongeub mice (c) or lysates from rat hippocampal neurons (DIV12) transfected with miR-138 or control mimic (d). Tubulin was used for normalization. (c) n=3 mice; *p=0.025 (Student’s two-tailed heteroscedastic t-test); (d) n=3 independent transfections; ***p=0.0009 (one sample t-test). (e) Relative luciferase activity in rat cortical neurons (DIV9-12) transfected with Erbb4 3′UTR constructs with (138mut) or without (wt) a mutation in the miR-138 binding site, together with miR-138 or negative control mimics. Negative control mimic =1. n=4 independent transfections, *p=0.025, n.s. p=0.09 (Student’s two-tailed heteroscedastic t-test). (f) Sm FISH analysis of Erbb4 (green) in rat hippocampal interneurons infected with Dlx-control-sponge or miR-138-sponge. Left panel: representative neurons, scale bar =20 μm. Green: Erbb4 FISH; gray: DAPI (nuclei); red: mCherry (Dlx5/6 expressing interneurons). Right panel: Erbb4 FISH quantification. Control sponge =1. N=3 independent infections (10–12 cells per condition), ***p=0.0004 (one-sample t-test).

Figure 3—source data 1. This file contains the raw data on which the graphs in Figure 3 are based.

Figure 3.

Figure 3—figure supplement 1. Validation of miR-138 target genes in rat hippocampal interneurons.

Figure 3—figure supplement 1.

(a) Quantification of miR138-5p smFISH in Camk2a- and Erbb4-positive neurons. Camk2a-positive n =10 cells; ErbB4-positive n=7 cells, p=0.48 (Student’s two-tailed heteroscedastic t-test). (b) Quantification of miR138-5p levels in mouse brain tissue based on small RNA-seq data from He et al., 2012. (c) Single-molecule FISH analysis of miR-138 (red) together with GFAP antibody stain (green) to label glia cells. Hoechst was used to counterstain nuclei. Arrow points to miR-138/MAP2 positive, GFAP-negative neuron adjacent to glial cell. Scale bar =20 µm. (d) Single-molecule FISH analysis of Rims3 mRNA (green) together with Camk2a (gray; left) or Gad2 (gray; right) mRNA to label glutamatergic and GABAergic neurons, respectively. Scale bar =20 µm. (e) qPCR analysis of Rims3 mRNA in total hippocampal RNA obtained from 138-floxed or 138-spongeub mice. U6 snRNA was used for normalization. n=3 mice; *p=0.04 (Student’s two-tailed heteroscedastic t-test). (f) Relative luciferase activity in rat cortical neurons (DIV9-12) transfected with Rims3 3′UTR constructs with (138mut) or without (wt) a mutation in the miR-138 binding site, together with miR-138 or negative control mimics. Negative control mimic =1. n=3 independent transfections, *p=0.002, n.s. p=0.23 (Student’s two-tailed heteroscedastic t-test). (g) Representative picture of primary rat hippocampal neurons infected with Dlx5/6-mCherry-138 sponge (red) and stained for GAD65/67 (gray) and Hoechst (blue). Scale bar =10 μm. smFISH, single-molecule fluorescence in situ hybridization.
Figure 3—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 3—figure supplement 1 are based.

We went on to validate miR138-5p dependent regulation of predicted interneuron-enriched target genes, focusing on Erbb4 (Erb-B2 receptor tyrosine kinase 4). Erbb4 is an SCZ risk gene that has been linked to the regulation of GABAergic synaptic transmission and short-term memory (Fazzari et al., 2010; Wang et al., 2018). Using qPCR and Western blot, we observed a significant upregulation of both Erbb4 mRNA (Figure 3b) and protein (Figure 3c) levels in the hippocampus of 138-spongeub compared to 138-floxed mice, thereby validating our results from RNA-seq. On the other hand, transfection of primary rat hippocampal neurons with a synthetic miR138-5p mimic reduced Erbb4 protein levels (Figure 3d), demonstrating that miR138-5p is necessary and sufficient for the inhibition of Erbb4 expression. In luciferase reporter gene assays, transfection of miR138-5p significantly reduced the expression of an Erbb4 3′UTR construct containing a wild-type, but not mutant miR138-5p binding site (Figure 3e), rendering Erbb4 as direct miR138-5p target. Furthermore, we were able to validate the presynaptic vesicle-associated Rims3 as an interneuron-enriched miR138-5p target (Figure 3—figure supplement 1d-f).

To study the regulation of Erbb4 by miR138-5p specifically in interneurons, we designed a viral construct in which expression of an inhibitory miR-138 sponge or a respective control sponge is under the control of the interneuron-specific Dlx5/6 promoter (Dlx-138 sponge and Dlx-control sponge). rAAV expressing Dlx-138 sponge or DLX-control sponge co-localizes with Gad65/67 in primary rat hippocampal neurons, confirming interneuron-specific expression (Figure 3—figure supplement 1g). Erbb4 RNA based on single-molecule fluorescence in situ hybridization (smFISH) was significantly elevated in Dlx-138 sponge compared to Dlx-control sponge infected interneurons (Figure 3f), demonstrating that miR138-5p cell-autonomously inhibits Erbb4 expression in hippocampal interneurons.

Our experiments so far suggest that impairments in interneurons are causally involved in short-term memory deficits upon miR-138 inhibition. To address the hypothesis that the observed short-term deficits are hippocampus-dependent, we stereotactically injected Dlx-138 sponge or Dlx-control sponge into the dorsal hippocampus of young adult mice and assessed short-term memory 4 weeks later, as described. Specific expression of 138- and control sponge in hippocampal interneurons was confirmed by immunostaining (Figure 4a). The previously observed 138 sponge mediated impairments in Y-maze novel preference and NOR were fully recapitulated by this approach (Figure 4b and c), strongly suggesting that miR138-5p function in hippocampal interneurons is required for intact short-term memory. Importantly, short-term memory was fully preserved upon hippocampal interneuron-specific expression of the control sponge (Figure 4b and c), providing an independent confirmation of the specificity of our approach for miR138-5p inactivation.

Figure 4. Impaired short-term memory and inhibitory synaptic transmission upon miR-138 inhibition in hippocampal interneurons.

(a) Representative pictures of hippocampal interneurons in vivo infected with rAAV-Dlx-138-sponge. Upper panel: infected interneurons in hippocampal area CA1. Scale bar =50 μm. Middle and lower panels: neurons in hippocampal area CA1 at higher magnification. Left neuron: infected with rAAV-Dlx-138-sponge, expressing GAD65/67; right neuron: not infected, no GAD65/67 expression. Scale bar =10 μm. red: mCherry; gray: GAD65/67, blue: Hoechst nuclei. (b) Upper panel: schematic representation of the Y-maze novelty preference task; lower panel: exploration time spent in familiar (F) and novel (N) arm; Dlx-control sponge n=8 mice; Dlx-miR-138 sponge n=9 mice; ****p=0.00005; n.s.=0.079 (Student’s two-tailed heteroscedastic t-test). (c) Upper panel: schematic representation of the novel object recognition task; lower panel: exploration time presented as percentage of total time spent with either novel or familiar object; Dlx-control sponge n=9 mice; Dlx-miR-138 sponge n=10 mice; *p=0.03; n.s.=0.33 (Student’s two-tailed heteroscedastic t-test). (d) mIPSC frequency in CA1 pyramidal neurons. Upper panel left: example traces, Dlx-control sponge in orange, Dlx-miR-138 sponge in purple, scale bar: 50 pA, 200 ms. Lower panel left: mIPSC frequency (Dlx-control sponge: range, from 2.0 to 7.1 Hz; median, 3.8 Hz; IQR, 1.3 Hz. Dlx-miR-138 sponge: range, from 3.2 to 11.3 Hz; median, 6.4 Hz; IQR, 4.0 Hz; ****p<0.0001, Student’s two-tailed heteroscedastic t-test). Right panel: Cumulative distribution mIPSC frequency (p<0.0001; Kolmogorov-Smirnov test). (e) mIPSC amplitude in CA1 pyramidal neurons (Dlx-control sponge: range, from 21.5 to 34.6 pA; median, 25.9 pA; IQR, 4.0 pA. Dlx-miR-138 sponge: range, from 22.3 to 35.5 pA; median, 28.3 pA; IQR, 4.4 pA; n.s. p=0.13 Student’s two-tailed heteroscedastic t-test). Dlx-control sponge n=19 cells/2 mice; Dlx-miR-138 sponge n=19 cells/2 mice. IQR, interquartile range; mIPSC, miniature inhibitory postsynaptic current.

Figure 4—source data 1. This file contains the raw data on which the graphs in Figure 4 are based.

Figure 4.

Figure 4—figure supplement 1. Inhibitory synaptic transmission upon miR-138 inhibition in hippocampal interneurons and validation of miR-138 sponge activity in PV-expressing hippocampal interneurons.

Figure 4—figure supplement 1.

(a) Cumulative distribution of mIPSC amplitude (p<0.0001; Kolmogorov-Smirnov test). (b) mIPSC rise (10%–90%) and decay (90%–10%) time. Left panel: mIPSC rise (10%–90%) time (Dlx control sponge: range, from 1.0 to 2.1 ms; median, 1.5 ms; IQR, 0.4 ms. Dlx miR-138 sponge: range, from 1.1 to 2.8 ms; median, 1.6 ms; IQR, 0.3 ms; n.s. p=0.76 Mann-Whitney test). Right panel: mIPSC decay (90%–10%) time (Dlx control sponge: range, from 9.6 to 13.4 ms; median, 10.0 ms; IQR, 0.6 ms. Dlx miR-138 sponge: range, from 9.7 to 10.8 ms; median, 10.1 ms; IQR, 0.4 ms; n.s. p=0.3 Mann-Whitney test). Dlx control sponge n=19 cells/2 mice; Dlx miR-138 sponge n=19 cells/2 mice. (c) Bar graphs of GFP/mCherry ratios from PV+ or PV− CA1 hippocampal neurons in 138-floxed or 138-spongeUb mice infected with a 138-pbds sensor construct; 138-floxed/PV+: n=32 (two mice); 138-floxed/PV−: n=40 (two mice); 138-sponge/PV+: n=32 (three mice); 138-sponge/PV−: n=42 (three mice); n.s. p=0.113; *p=3.6×10–6 (Kolmogorov-Smirnov-Test). (d) Venn diagram describing the overlap between transcripts upregulated in SCZ patients (Gandal et al., 2018) and miR-138 sponge mice (Figure 2a). Fold enrichment =1.43; p=0.00859 (Fisher test). IQR, interquartile range; mIPSC, miniature inhibitory postsynaptic current; SCZ, schizophrenia.
Figure 4—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 4—figure supplement 1 are based.

Next, we investigated electrophysiological alterations that might underlie the observed short-term memory deficits. In hippocampal CA1 pyramidal neurons, which are the main targets of PV-positive (PV+) interneurons in the hippocampal circuit, frequency of miniature inhibitory postsynaptic current (mIPSC) was significantly increased in mice injected with the Dlx-138 sponge as compared to control sponge injected mice (Figure 4d). In contrast, amplitude (Figure 4e, Figure 4—figure supplement 1a) as well as rise and decay time (Figure 4—figure supplement 1) of mIPSCs was unaltered.

Based on this observation, we speculated that miR138-5p inactivation might be more robust in PV+ interneurons compared to other cell types. Thus, we again injected a miR-138 pbds sensor construct into the hippocampus of control or miR-138 spongeUb mice (Figure 1b), but now counterstained for PV to quantify miR-138 activity in PV+ and PV− cells (Figure 4—figure supplement 1c). Analysis of GFP/mCherry ratios revealed that expression of a miR-138 sponge significantly inactivated miR138-5p in PV+ neurons but had only a marginal effect in PV− cells (which predominantly consist of excitatory pyramidal neurons). Thus, the observed lack of regulation of miR138-5p targets in excitatory pyramidal neurons of 138-spongeUb mice is likely a result of inefficient sponge-mediated miR138-5p inhibition in this cell type. Since miR138-5p and alterations in PV+ interneuron function had recently been linked to SCZ (Pelkey et al., 2017; Watanabe et al., 2014), we performed a comparison between DEGs from 138-spongeub mouse hippocampus and cortical tissue of SCZ patients (Gandal et al., 2018). We found a significant overlap between genes upregulated in the 138-spongeub hippocampus and SCZ patients (p=0.00884; Figure 4—figure supplement 1d). Taken together, our results suggest that miR138-5p inactivation due to expression of a miR-138 sponge predominantly affects PV+ interneurons leading to an upregulation of synaptic genes which are deregulated in SCZ.

To elaborate on the functional role of miR138-5p in PV+ interneurons, we generated 138-spongePV mice by crossing 138-floxed mice to PV-Cre mice (Figure 5a). In 138-spongePV mice, the 6x-miR-138-sponge transcript is selectively expressed in the majority (about 90%) of PV-expressing inhibitory interneurons (PV-positive cells) (Figure 5b). On a behavioral level, we found that locomotion and anxiety-related behavior, as measured in the open field and EPM tests, was unaltered in 138-spongePV mice compared to their littermate controls (Figure 5—figure supplement 1a-c). However, similar as 138-spongeub mice (Figure 1c and d) and mice injected with rAAV-Dlx5/6-138-sponge into the hippocampus (Figure 4b and c), 138-spongePV mice showed impairments in behavioral tasks addressing short-term memory, such as the Y-maze novelty preference (Figure 5c) and NOR (Figure 5d) tests. No genotype-dependent differences in spontaneous alternations in the Y-maze were observed (Figure 5e). Similar to 138-spongeub mice, associative long-term memory as assessed by conditional fear conditioning was not affected in 138-spongePV mice (Figure 5—figure supplement 1d). These results demonstrate that miR138-5p activity in PV-positive interneurons is required to sustain proper short-term memory. Next, we investigated electrophysiological alterations that might underlie the observed short-term memory deficits. In hippocampal CA1 pyramidal neurons of 138-spongePV mice, similar to rAAV-Dlx5/6-138-sponge injected mice, frequency of mIPSC was significantly increased in 138-spongePV as compared to control slices (Figure 6a, Figure 6—figure supplement 1a), while neither amplitude, nor rise or decay time were changed (Figure 6—figure supplement 1b-d). The total number of PV-positive interneurons in the hippocampus was similar between 138-spongePV and 138-floxed mice (Figure 6—figure supplement 1e), suggesting that mIPSC frequency changes either result from an increased number of inhibitory presynaptic boutons synapsing onto pyramidal cells or an enhanced neurotransmitter release. To distinguish between these possibilities, we first analyzed presynaptic boutons contacting CA1 pyramidal cells by staining slices obtained from 138-floxed and 138-spongePV mice with antibodies against PV and the vesicular GABA transporter (VGAT). Our analysis revealed no significant difference in the number and intensity of PV-positive presynaptic boutons impinging onto the somata of CA1 pyramidal cells between 138-spongePV mice and their littermate controls (Figure 6b). To probe for changes in presynaptic release probability, we first recorded extracellularly stimulated inhibitory PPRs (iPPRs) in CA1 pyramidal cells but did not observe differences between the two groups (Figure 6c). Finally, we performed paired whole-cell recordings between presynaptic putative fast-spiking PV-positive interneurons in stratum pyramidale and postsynaptic CA1 pyramidal cells (Figure 6d–f; Figure 6—figure supplement 1f). The analysis of unitary connections revealed increased, albeit not significant, unitary inhibitory postsynaptic current (uIPSC) amplitudes (including failures of transmission) and success rates (i.e., an action potential elicits an IPSC) in 138-spongePV mice as compared to their control littermates (Figure 6d). However, we did not observe significant changes in PPR (Figure 6e). Our further analysis though revealed a significant decrease of the coefficient of variation (CV), indicative of more reliable unitary synaptic connections between PV-positive interneurons and CA1 pyramidal neurons in 138-spongePV mice (Figure 6f). These findings may also explain why mIPSC frequency was found to be altered as these inhibitory currents reflect inputs of many GABAergic neurons onto a single excitatory pyramidal neuron. In conclusion, CA1 pyramidal neurons in 138-spongePV mice receive increased inhibitory GABAergic synaptic input from putative fast-spiking PV-positive interneurons without detectable changes in perisomatic inhibitory bouton density or size.

Figure 5. Impaired short-term memory in PV-expressing interneuron specific miR-138 sponge mice.

(a) Schematic overview of the strategy for generating miR-138 spongePV mice. (b) Beta-gal expression is largely restricted to PV expressing interneuron. Left panel: representative picture from a CA1 region of a 138-spongePV hippocampal slice co-stained for the lacZ product beta-galactosidase (red) and PV (green). Scale bar =20 μm. Right panel: quantification of PV+/lacZ+ cells in 138-spongePV mice. n=3 mice. (c) Behavioral characterization of 138-spongePV mouse line, upper: schematic representation of the Y-maze novelty preference task; lower: exploration time spent in familiar (F) and novel (N) arm; 138-floxed n=10 mice; 138-spongePV n=10 mice; ***p=0.0002; n.s. p=0.19 (Mann-Whitney test). (d) Upper: schematic representation of the novel object recognition task; Lower: exploration time presented as percentage of total time spent with either novel or familiar object; 138-floxed n=10 mice; miR-138 sponge n=10 mice; *p=0.035, n.s. p=0.57 (Student’s two-tailed heteroscedastic t-test). (e) Percentage of spontaneous alternations in the Y-Maze. 138-floxed n=10; 138-spongePV n=10; n.s. p=0.90 (Student’s two-tailed heteroscedastic t-test). PV, parvalbumin.

Figure 5—source data 1. This file contains the raw data on which the graphs in Figure 5 are based.

Figure 5.

Figure 5—figure supplement 1. Behavioural characterization of PV-expressing interneuron specific miR-138 sponge mice.

Figure 5—figure supplement 1.

(a, b) Percentage of total distance travelled (a)/time spent (b) in the center of an open field arena during 30 min exploration by mice of the indicated genotypes; 138-floxed n=10 mice; 138-spongePV n=10 mice; (a) p=0.74 (b) p=0.28 (Student’s two-tailed heteroscedastic t-test). (c) Percentage of total time spent in the open arms of an elevated plus maze (EPM) during 5 min exploration by mice of the indicated genotypes; 138-floxed n=10 mice; 138-spongePV n=10 mice; p=0.53 (Mann-Whitney test). (d) Time (s) mice spent freezing 24 hr after the foot shock was administrated; 138-floxed n=9 mice; 138-spongePV n=9 mice; p=0.075 (Student’s two-tailed heteroscedastic t-test).
Figure 5—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 5—figure supplement 1 are based.

Figure 6. Enhanced inhibitory synaptic transmission onto hippcampal pyramidal neurons in PV-expressing interneuron specific miR-138 sponge mice.

(a) mIPSC frequency in CA1 pyramidal neurons. Upper panel: example traces, 138-floxed in orange, 138-songePV in red, scale bar: 50 pA, 200 ms. Lower panel: mIPSC frequency (138-floxed: range, from 1.6 to 10.2 Hz; median, 4.1 Hz; IQR, 1.5 Hz. 138-spongePV: range, from 3.6 to 15.2 Hz; median, 6.2 Hz; IQR, 4.2 Hz; ***p=0.0002, Mann-Whitney test). 138-floxed n=22 cells/5 mice; 138-spongePV n=23 cells/5 mice. (b) PV+, VGAT+ bouton density. Left panel: representative pictures (arrows point the PV+; VGAT+ boutons). Middle panel: number of boutons per CA1 pyramidal neuron cell perimeter based on Hoechst counterstain. Right panel: VGAT puncta mean intensity; 138-floxed: n=73 cells/3 mice; 138-spongePV: n=95 cells/5 mice; data represents the average per mouse±s.d; n.s., p=0.65 (bouton density), n.s., p=0.59 (mean intensity) (Student’s two-tailed heteroscedastic t-test); (c) Paired pulse ratio (PPR) of stimulated IPSCs in CA1 pyramidal neurons. Upper panel: example traces of PPR (inter stimulus interval of 100 ms) for 138-floxed (orange) and 138-spongeub (red); scale bar: 100 pA, 50 ms. Lower panel: PPRs for different interstimulus intervals ranging from 50 to 150 ms (138-floxed vs. 138-spongePV [mean ±s.d.]: 50 ms, 0.7 ±0.2 vs. 0.7±0.1 [n=13]; 100 ms: 0.8±0.1 vs. 0.7±0.1 [n=13]; 150 ms: 0.7±0.1 [n=12] vs. 0.7±0.1. n.s. p=0.45, p=0.69, and p=0.89 for 50, 100, and 150 ms, respectively. Mann-Whitney test). (d) Unitary connections between presynaptic fast-spiking interneurons and postsynaptic CA1 pyramidal cells. Upper panel: example traces, 138-floxed: average of 50 sweeps in orange, 26 single sweeps in gray, 138-songePV: average of 50 sweeps in red, 26 single sweeps in gray; scale bar: 100 pA, 100 mV, 25 ms. Lower panel left: uIPSC amplitude (138-floxed: range, from 18.9 to 73.2 pA; median, 46.6 pA; IQR, 40.2 pA. 138-spongePV: range, from 19.3 to 123.8 pA; median, 64.5 pA; IQR, 64.4 pA; n.s. p=0.11 Student’s two-tailed heteroscedastic t-test). Lower panel right: Success rate (138-floxed: range, from 40% to 98%; median, 86%; IQR, 54%. 138-spongePV: range, from 38% to 100%; median, 98%; IQR, 12%; n.s. p=0.14 Mann-Whitney test). 138-floxed n=7 pairs/3 mice; 138-spongePV n=9 pairs/5 mice. (e) PPR of unitary connections. Upper panel: example traces, 138-floxed in orange, 138-songePV in red, uIPSCs are normalized to the first uIPSC, scale bar: 100 mV, 50 ms. Lower panel: PPR (2nd/1st uIPSC) (138-floxed: range, from 0.42 to 0.85; median, 0.56; IQR, 0.10. 138-spongePV: range, from 0.44 to 0.62; median, 0.49; IQR, 0.14; n.s. p=0.34 Student’s two-tailed heteroscedastic t-test). 138-floxed n=7 pairs/3 mice; 138-spongePV n=9 pairs/5 mice. (f) Coefficient of variation (138-floxed: range, from 0.38 to 0.52; median, 0.44; IQR, 0.07. 138-spongePV: range, from 0.23 to 0.47; median, 0.38; IQR, 0.15; *p=0.028, Student’s two-tailed heteroscedastic t-test). 138-floxed n=7 pairs/3 mice; 138-spongePV n=9 pairs/5 mice. IQR, interquartile range; mIPSC, miniature inhibitory postsynaptic current; uIPSC, unitary inhibitory postsynaptic current.

Figure 6—source data 1. This file contains the raw data on which the graphs in Figure 6 are based.

Figure 6.

Figure 6—figure supplement 1. Electrophysiological characterization of hippocampal neurons in PV-expressing interneuron specific miR-138 sponge mice.

Figure 6—figure supplement 1.

(a–d) mIPSC in CA1 pyramidal neurons. (a) Cumulative distribution of mIPSCs frequency (p <0.0001; Kolmogorov-Smirnov [KS] test). (b) mIPSC amplitude (138-floxed: range, from 20.9 to 42.5 pA; median, 24.4 pA; IQR, 5.0 pA. 138-spongePV: range, from 18.0 to 41.6 pA; median, 25.7 pA; IQR, 4.0 pA; n.s. P = 0.22 Mann-Whitney test). (c) Cumulative distribution of mIPSCs amplitude (p<0.0001 KS test). 138-floxed n=22 cells/5 mice; 138-spongeub n=23 cells/5 mice. (d) mIPSC rise (10%–90%) and decay (90%–10%) time. Left panel: mIPSC rise (10%–90%) time (138-floxed: range, from 1.4 to 2.7 ms; median, 1.9 ms; IQR, 0.4 ms. 138-spongePV: range, from 1.3 to 2.5 ms; median, 2.0 ms; IQR, 0.4 ms; n.s. p=0.28 Mann-Whitney test). Right panel: mIPSC decay (90%–10%) time (138-floxed: range, from 9.9 to 13.6 ms; median, 11.1 ms; IQR, 0.9 ms. 138-spongePV: range, from 9.5 to 14.2 ms; median, 11.6 ms; IQR, 1.8 ms; n.s. p=0.20 Mann-Whitney test). 138-floxed n=22 cells/5 mice; 138-spongeub n=23 cells/5 mice. (e) Density of PV+ interneurons in CA1 hippocampus of mice with the indicated genotype. Values are expressed relative to a defined region of interest (ROI). 138-floxed: n=16 ROIs/4 mice; 138-spongePV: n=18 ROIs/5 mice; data represents the average per mouse±s.d.; n.s. p=0.8049 (Mann-Whitney test). (f) Properties of fast-spiking interneurons. Upper panel: example traces, 138-floxed in orange, 138-songePV in red, scale bar: 50 mV, 500 ms. Lower panel left: spiking frequency (138-floxed: range, from 123 to 159 Hz; median, 143 Hz; IQR, 29 Hz. 138-spongePV: range, from 96 to 170 Hz; median, 118 Hz; IQR, 46 Hz; n.s. p=0.31 Student’s two-tailed heteroscedastic t-test). Lower panel middle: input resistance (138-floxed: range, from 40 to 60 MΩ; median, 57 MΩ; IQR, 18 MΩ. 138-spongePV: range, from 30 to 71 MΩ; median, 33 MΩ; IQR, 26 MΩ; n.s. p=0.22 Mann-Whitney test). Lower panel right: resting membrane potential (138-floxed: range, from –68 to –62 mV; median, –64 mV; IQR, 4.5 mV. 138-spongePV: range, from –70 to –56 mV; median, –67 mV; IQR, 9 mV; n.s. p=0.78 Student’s two-tailed heteroscedastic t-test). 138-floxed n=5 cells/3 mice; 138-spongeub n=5 cells/5 mice. IQR, interquartile range; mIPSC, miniature inhibitory postsynaptic current.
Figure 6—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 6—figure supplement 1 are based.

Discussion

Here, we describe a central role for the brain-enriched miRNA miR138-5p in the regulation of inhibitory GABAergic transmission in the hippocampus. Particularly, we find that cell type-specific inhibition of miR138-5p in PV-positive interneurons enhances the reliability of unitary synaptic connections from putative fast-spiking PV-positive interneurons onto CA1 pyramidal neurons. The resulting increase in neurotransmitter release at this synapse is possibly due to an increase in the number of presynaptic release sites within individual boutons (Sakamoto et al., 2018), as we observed a decrease in CV, but did not detect significant changes in release probability. PV-positive interneurons are the main source of feedforward inhibition onto pyramidal neurons (Pouille and Scanziani, 2001) and have been functionally linked to working memory (Murray et al., 2011), possibly via controlling gamma oscillations (Hájos et al., 2004). We therefore propose a model whereby miR138-5p activity in PV+ interneurons is regulating neurotransmitter release, thereby keeping pyramidal cell output in a range required for proper information processing. Since miR138-5p controls dendritic spine morphogenesis in cultured hippocampal pyramidal neurons (Siegel et al., 2009), it might further regulate E-I balance in the hippocampal circuitry by controlling pyramidal neuron excitatory input. The absence of changes in excitatory synaptic transmission in the hippocampus of 138-spongeub mice might be due to ineffective silencing of the highly abundant miR138-5p in pyramidal neurons via our approach. This view is supported by our observation that a miR138-5p sensor plasmid is effectively unsilenced in PV+, but not PV− hippocampal neurons of 138-spongeub mice (Figure 4—figure supplement 1d) and by the lack of upregulation of miR138-5p targets preferentially expressed in pyramidal neurons (Figure 2—figure supplement 1c). The molecular explanation for this PV-specific miR138-5p inactivation is currently unknown.

Sponge-mediated inactivation of miRNAs is routinely used in cell culture, but studies employing this approach in transgenic mice are still scarce (Giusti et al., 2014), possibly in part because a stringent control would require the generation of an independent transgenic line. Here, we addressed this issue by comparing the effects of miR-138-sponge to a highly similar, but ineffective control sponge, in primary neurons in vitro and in the hippocampus in vivo using multiple assays. Thereby, we reproducibly observed 138-sponge specific effects on reporter gene expression (Figure 1—figure supplement 1b), dendritic spine size (Figure 1—figure supplement 1c), miniature inhibitory postsynaptic currents (Figure 4d and e), and short-term memory (Figure 4b and c), strongly arguing that the effects seen in miR-138-sponge mice are due to miR138-5p inactivation.

The molecular mechanisms downstream of miR138-5p inactivation leading to enhanced inhibition remain to be elucidated, but likely involve upregulation of proteins organizing inhibitory synapse function. An interesting candidate in this regard represents Erbb4, which has been shown to control GABAergic transmission (Fazzari et al., 2010; Wang et al., 2018) and working memory (Tian et al., 2017; Wen et al., 2010). In particular, release probability of GABAergic synapses onto pyramidal neurons was diminished in Erbb4 KO mice (Wang et al., 2018), which is in agreement with our finding that elevated Erbb4 levels in miR-138 sponge mice are paralleled by higher mIPSC frequencies. However, additional presynaptic genes might function downstream of miR138-5p, for example, Rims3, which physically and functionally interacts with presynaptic voltage-dependent Ca2+ channels (VDCCs) and increases neurotransmitter release (Takada et al., 2015). In the future, restoring the expression of specific inhibitory presynaptic genes in miR-138 sponge mice will be needed to assess their contribution to cellular and behavioral phenotypes caused by miR-138 inhibition.

Intriguingly, interfering with miR138-5p in inhibitory neurons of the adult hippocampus fully recapitulates deficits in inhibitory synaptic transmission and short-term memory observed in 138-spongeUb and 138-spongePV mice (Figure 4). Although this finding does not rule out a role for miR138-5p at early stages of development, it stresses the importance of miR138-5p for the homeostasis of the fully developed circuitry. A similar critical role at adulthood in the regulation of GABAergic transmission and behavior was recently shown for the miR138-5p target Erbb4 (Wang et al., 2018).

Our model of miR138-5p being a positive regulator of memory is consistent with results obtained from previous studies performed in mice (Boscher et al., 2020; Tatro et al., 2013; Tian et al., 2018). Moreover, GWAS analysis identified miR138-5p as a putative regulator of human memory performance (Schröder et al., 2014). A rare miR-138-2 gene variation is furthermore associated with SCZ in a Japanese population (Watanabe et al., 2014), and miR138-5p levels are altered in the superior temporal gyrus and dorsolateral prefrontal cortex of SCZ patients (Beveridge et al., 2010; Moreau et al., 2011). Finally, several miR138-5p targets have been genetically linked to SCZ (e.g., Erbb4, Drd2, and Igsf9b) (Kumar et al., 2010; Nicodemus et al., 2006) or are deregulated in the cortex of SCZ patients (e.g., Gabra3, Fxyd6, Tmem132c, and Baiap3, Gandal et al., 2018). Thus, miR138-5p might be involved in the control of cognitive function in humans and represent a promising target for the treatment of cognitive deficits associated with SCZ and other neurodevelopmental disorders.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Mus musculus) miR-138-flox  Taconic Artemis GmbH (Cologne, Germany) C57BL/6NTac-Gt(ROSA)26So tm2459(LacZ, antimir_138) Arte
Strain, strain background (M. musculus)  CMV-Cre  Jackson Laboratories B6.C-Tg(CMV-Cre)1Cgn (CMV-CRE)
Strain, strain background (M. musculus)  PV-Cre  Jackson Laboratories B6;129P2-Pvalbtm1(cre)Arbr/J (PV-CRE)
Recombinant DNA reagent  pAAV-6P-SEWB (modified)  Christensen et al., 2010 Used for cloning of miR-138 sponge plasmids
Recombinant DNA reagent  pAAV-mDlx-GFP-Fishell-1  Addgene, 83900 Used for cloning of mDlx-miR-138 sponge plasmids
Recombinant DNA reagent pGL3-promoter vector  Promega, Mannheim Used for cloning of miR-138 perfect binding site reporter
Recombinant DNA reagent  C1-mCherry  Addgene, 632524 Used for cloning of miRNA sensor plasmids
Recombinant DNA reagent  AAV-hSyn-EGFP  Addgene, 114213 Used for cloning of miRNA sensor plasmids
Recombinant DNA reagent  pmirGLO dual-luciferase expression vector reporter  Promega, Madison, WI Used for cloning of luciferase reporter constructs
Sequence-based reagent  Mir-138 FISH probe (Fast Red)  Thermo Fisher Scientific VM1-10093-VCP Sequence not provided by commercial supplier
Sequence-based reagent  ErbB4 FISH probe (488)  Thermo Fisher Scientific VC4-3146482-VC Sequence not provided by commercial supplier
Sequence-based reagent  Rims3 FISH probe (488)  Thermo Fisher Scientific VC4-3146880-VCP Sequence not provided by commercial supplier
Sequence-based reagent  Camk2a FISH probe (488)  Thermo Fisher Scientific VC6-11639-VCP Sequence not provided by commercial supplier
Sequence-based reagent  Gad2 FISH probe (647)  Thermo Fisher Scientific VC6-16451-VCP Sequence not provided by commercial supplier
Antibody  aGAD65+67 (rabbit polyclonal)  Abcam Ab11070 1:100 (in vitro); 1:1000 (ex vivo)
Antibody  aMAP2 (Mouse monoclonal)  Sigma-Aldrich M9942 1:1000
Antibody  aGFAP (rabbit polyclonal)  Dako Z0334 1:1000
Antibody  aParvalbumin (mouse monoclonal)  SWANT 235 1:1000
Antibody  aVGAT (rabbit polyclonal)  Synaptic systems 131003 1:1000
Antibody  amCherry (rabbit polyclonal)  Abcam Ab167453 1:1000
Antibody  aBeta galatosidase (chicken polyclonal)  Abcam Ab9361 1:4000
Antibody  aMouse Alexa Fluor 488 (Donkey polyclonal)  Invitrogen A21202 1:500
Antibody  aRabbit Alexa Fluor 546 (Goat polyclonal)  Invitrogen A11010 1:500
Antibody  aChicken Alexa Fluor 546 (Goat polyclonal)  Invitrogen A11040 1:500
Antibody  aMouse Alexa Fluor 647 (Donkey polyclonal)  Invitrogen A31571 1:500
Chemical compound, drug  Hoechst 33342  Thermo Fisher Scientific 62249

Construct design and cloning

MiR-138 sponge

MiR-138 sponge was cloned into the BsrGI and HindIII restriction sites of a modified pAAV-6P-SEWB backbone, where the GFP has previously been replaced with dsRed (Christensen et al., 2010). Different number of binding sites were tested, and the plasmid containing six binding sites was chosen for further experiments which included the virus production for the creation of the mouse lines.

MiR-138 sponge imperfect binding site: 5′ CGGCCTGATTCGTTCACCAGT 3′; spacer sequence: 5′ TTTTT 3′; Control sponge sequence: 5′ TGTGACTGGGGGCCAGAGG 3′; spacer sequence: 5′ CAGTG 3′.

AAV-Dlx5/6-miR-138 sponge

Dlx-138 sponge and Dlx-control sponge were cloned into a modified mCaMKIIα-mCherry-WPRE-hGHp(A) (p199, Viral vector facility of the Neuroscience Center Zurich) backbone where 138-sponge and 138-sponge reversed (control-sponge) were previously inserted using MiR-138 sponge vector as template. The backbone was opened with MluI (NEB: R0198S) and KpnI (NEB: R0142). pAAV-mDlx-GFP-Fishell-1 (gift from Gordon Fishell; Addgene plasmid #83900) was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB: R0606S).

Primers for 138 and control sponge: 5′ CACCACCTGTTCCTGTAGTGTAC 3′; 5′ CCAGAGGTTGATTATCGATAAGCTTAAC 3′.

AAV-CMV-Cre

AAV expressing Cre-recombinase under the control of the CMV promoter (gift from Fred Gage; Addgene plasmid #49056).

pGL3-138 perfect binding site (pbds) vector

The oligonucleotides were designed without any specific overhangs to allow blunt-end cloning in both directions for a perfect binding site reporter and an antisense control reporter. They were annealed and ligated into a pGL3 promoter vector (Promega, Mannheim) expressing firefly luciferase. For cloning, the pGL3 vector was before digested with XbaI and the ends were blunted to insert the binding sites via blunt-end cloning at the 3′end of the firefly open reading frame. After cloning, several clones were sequenced to determine sense and antisense reporter.

138 pbds reporter FW

5′CTAGACGGCCTGATTCACAACACCAGCTACCGGCCTGATTCACAACACCAGCTGGATCC 3′.

138 pbds reporter REV

5′CTAGCGGATCCAGCTGGTGTTGTGAATCAGGCCGGTAGCTGGTGTTGTGAATCAGGCCGT 3′.

AAV-miR-138 dual sensor construct

An EcoR1-BglII PCR fragment spanning the pCMV promoter, mCherry coding sequence, and SV40 poly adenylation signal were amplified using C1-mCherry (Addgene, 632524) as template. The PCR product was cloned into the BGlII/EcoR1 sites of the AAV-hSyn-EGFP (Addgene, 114213), upstream of the human Synapsin 1 promoter. Two miR-138 perfectly complementary binding sites were cloned into the SpeI and HIndIII restriction sites, between the EGFP coding sequence and WPRE element of AAV-hSYN-GFP, to generate the final AAV-138 sensor.

138 perfect binding sites FW

5′CTAGACGGCCTGATTCACAACACCAGCTACCGGCCTGATTCACAACACCAGCTGGATCC 3′.

138 perfect binding site REV

5′CTAGCGGATCCAGCTGGTGTTGTGAATCAGGCCGGTAGCTGGTGTTGTGAATCAGGCCGT 3′.

Luciferase constructs

pmirGLO dual-luciferase expression vector reporter (Promega, Madison, WI) was used to clone portions of 3′ untranslated regions of the investigated mRNAs. XhoI and SalI restriction enzymes were used.

ErbB4 wild-type sequence

5′TTGAATGAAGCAATATGGAAGCAACCAGCAGATTAACTAATTTAAATACTTC 3′.

ErbB4 138-mutant sequence

5’TTGAATGAAGCAATATGGAAGCAgCatGaAGATTAACTAATTTAAATACTTC 3’.

Rims3 wild-type sequence

5’GCCTCAGTCACCAGCTCTGTACCAGCAATACTCACCCCTCCACCTCCCTGACTT 3’.

Rims3 138-mutant sequence

5’GCCTCAGTgAtatcCTCTGTACCAGCAATACTCACCCCTCCACCTCCCTGACTT 3’.

Primary neuronal cell culture

Cultures of dissociated primary cortical and hippocampal neurons from embryonic day 18 (E18) Sprague-Dawley rats (Janvier, France) were prepared and cultured as described previously (Schratt et al., 2006). Animal euthanasia was approved by the local cantonal authorities (ZH196/17).

Transfection

Transfection of primary neurons was performed using Lipofectamine 2000 (Invitrogen, Karlsruhe). For each well of a 24-well plate, a total of 1 µg DNA was mixed with a 1:50 dilution of Lipofectamine in NB/NBP medium. After an incubation of 20 min at room temperature, it was further diluted 1:5 in NB/NBP medium and applied to the cells. Neurons were incubated for 2 hr with the mix. A 1:1000 dilution of APV (20 mM) in NB+/NBP+ was applied for 45–60 min afterward before exchanging with NB+/NBP+.

Luciferase assay

Luciferase assays were performed using the dual-luciferase reporter assay system on a GloMax R96 Microplate Luminometer (Promega). pmirGLO dual-luciferase expression vector reporter (Promega, Madison, WI) was used to clone portions of 3′ untranslated regions of the investigated mRNAs. PcDNA3 was used to balance all amounts to a total of 1 µg DNA per condition.

Animal lines

The C57BL/6NTac-Gt(ROSA)26So tm2459(LacZ, antimir_138) Arte (hereafter named ‘138-floxed’) mouse lines were created at TaconicArtemis GmbH (Cologne, Germany). The targeting strategy allowed the generation of a constitutive LacZ-miRNA138 Sponge Knock-In (KI) allele in the C57Bl/6 mouse ROSA26 locus via targeted transgenesis. The presence of the loxP-flanked transcriptional STOP cassette is expected to terminate the transcription from the CAG promoter and thus prevent the expression of the NLS-LacZ miRNA138 Sponge cDNA, which allows this line to be used as a control (138-floxed line). The constitutive KI allele was obtained after Cre-mediated removal of the loxP-flanked transcriptional STOP cassette from the conditional KI allele, by crossing the 138-flox line with a B6.C-Tg(CMV-Cre)1Cgn (CMV-CRE) line, which allows the expression of the sponge construct (138-spongeub mice). In all experiments, heterozygous male mice were used. The 138-spongePV line was generated by crossing 138-floxed line with a previously characterized B6;129P2-Pvalbtm1(cre)Arbr/J (PV-CRE) line.

Behavioral experiments

Animals were housed in groups of 3–5 per cage, with food and water ad libitum. All experiments were performed on adult male mice (3–5 months old).

The animal house had an inverted light-dark cycle, all testing was done during the dark phase (8 a.m. to 8 p.m.). Mice were handled for 10 min for 5 days before the experiments began. All measures were analyzed by Noldus Ethovision xt 14, unless stated differently. During the experimental phase, mice were transported individually and allowed to acclimatize to the experimental room in a holding cage for at least 20 min before the beginning of the task. At the end of each experiment, they were transported back into the animal storage room in their holding cage and placed back into their original home cage with their littermates. 10 ml/L detergent (For, Dr. Schnell AG) was used to clean equipment in between trials. Tasks which required the use of the same apparatus were scheduled at least 4 days apart. Two separate cohorts of mice were tested ( seven mice each). No cohort-specific differences were found. The behavioral essays were performed from the least to the most stressful: home cage activity, open field, y-maze, EPM, NOR, and CFC. All animal experiments were performed in accordance with the animal protection law of Switzerland and were approved by the local cantonal authorities (ZH017/18).

Open field (OFT)

OFT was performed as described previously (Lackinger et al., 2019). Each session lasted 30 min.

Y-maze

Spontaneous alternation: mice were placed in a Y-shaped maze (8.5 cm width × 50 cm length × 10 cm height) for 5 min. They were free to explore the whole maze and the alternation between the arms was calculated.

Novelty preference test: mice were given 5 min to explore two arms of the maze during the familiarization phase. A door made from the same Plexiglas used for the walls was used to prevent the access of the subjects into the third arm. At the end of the familiarization phase, mice were placed in their holding cage for 90 s, while the apparatus was cleaned to avoid olfactory trails. Mice were then placed back into the maze for the test phase, where all three arms were accessible. Preference ratio between the familiar and new arm was then scored based on the time spent in those arms.

Elevated plus maze

The maze was elevated 60 cm from the floor, with two arms enclosed by dark Plexiglas walls (5 cm width×30 cm length×15 cm height), two opposing open arms, and a central platform/intersection. Experiments were conducted in a homogenously illuminated room, with the maze placed in the center of the room. Mice were placed in the central platform of the EPM. The position and motion of the animals were automatically determined and recorded for 5 min. Time spent and distance traveled in the different arms were scored.

Novel object recognition

Objects were based on the Nature protocol published previously (Leger et al., 2013). They were tested beforehand to assess that no object was preferred, and they were randomized between trials and genotypes. Subjects were placed in the open field arena with two items of the same objects for a 5-min familiarization period. After a 90-s break in their holding cage while the arena and the objects were cleaned and one object changed, the mice were put back in the arena for the test phase for 5 min. Time spent exploring the new object was scored manually. Scoring took into consideration the time spent exploring the two objects and the number of visits (nose of the experimental mouse within a 3-cm radius from the object).

Contextual fear conditioning

This task was performed as previously described (Siegert et al., 2015). Briefly, mice were placed in the open field arena with Plexiglas walls and a metal grid bottom inside the multiconditioning chambers and a metal grid bottom (TSE fear conditioning system, TSE Systems, Germany). They were habituated for 3 min, then foot-shocked (2 s, 0.8 mA constant current) and returned to their home cages. After 24 h, mice were placed in the conditioning chamber. Freezing, defined as a total lack of movement except for heartbeat and respiration, was scored for a 3-min period.

RNAseq

RNA extraction

Adult male mice (4 months old) were anesthetized with isoflurane (Baxter, Unterschleißheim, Germany) and then quickly cervically dislocated and decapitated. Hippocampal tissue was dissected and freshly processed. RNA was extracted using mirVana microRNA Isolation Kit (Life Technologies) according to the manufacturer’s instructions.

Stranded polyA+ enriched RNA sequencing libraries were prepared at the GENCORE (EMBL, Genomics Core Facility, Heidelberg, Germany) and sequenced on an Illumina HiSeq 2000 machine using a 50-nt paired-end protocol (Lackinger et al., 2019).

We removed the sequencing adapter and quality-trimmed all short reads from the 3′end using FLEXBAR 2.5.3 and a Phred score cutoff >10. All reads longer than 18 bp were retained and rRNA reads were subtracted in silico using bowtie2 and an index of the complete repeating rRNA unit (BK000964.3). We used the STAR aligner 2.4.2a4 to map against the mouse genome (EnsEMBL 79 genome+annotations). We performed differential gene expression analysis using Cuffdiff 2.2.1.

Quantitative real-time PCR

qPCR was performed as described earlier (Valluy et al., 2015). Primer sequences are given below.

  • ErbB4 FW: 5′GACTCCAATAGGAATCAGTTTGTC 3′.

  • ErbB4 REV: 5′ TACTGGAGCCTCTGGTATGG 3′.

  • Rims3 FW: 5′ GCATCAGCGGTGAGATCTGT 3′.

  • Rims3 REV: 5’ CTGGGTCAAGCCGACGATAG 3’.

Imaging

Image acquisition was done with the experimenter being blinded to the different conditions. Pictures were taken on a confocal laser scanning microscope equipped with an Airyscan detector (LSM880, Zeiss). Image analysis was carried out on Fiji (ImageJ).

PV bouton count

A 63× oil objective was used to take images from the CA1 hippocampal region immunostained with PV, VGAT and Hoechst were used to counterstain the nuclei (further details in the immunostaining section). The number of PV+ and VGAT+ en passant boutons around the nuclear perimeter were counted and normalized to the total length of the perimeter. vGAT puncta mean intensity: vGAT puncta mean intensity: ImageJ was used to measure the intensity of all the vGAT puncta in the pictures used to quantify PV boutons.

PV cell quantification

A 20× objective was used and PV+ cells were counted on a maximum projection intensity of the CA1 region immunostained with PV (Hoechst was used to counterstain nuclei; further details in the immunostaining section). The number of PV + cells was normalized to a defined region of interest (230 × 460 μm2).

Viral mir-138 sensor

Tilescans were taken with a 20× objective of the infected hippocampal region. Intensity of GFP signal was normalized on the mCherry signal per cell. For the analysis, either all neurons (Figure 1b) or only PV+ neurons (Figure 4—figure supplement 1c) within the CA1 region were taken into consideration.

Spine analysis

In vitro

Hippocampal neurons were transfected at DIV 10 with 200 ng of GFP and the indicated amount of either miR-138-6×-sponge, CTR sponge, AAV backbone, or the Cholesterol-modified 2’O-Me-oligonucleotides (‘antagomirs’, Thermo Fisher Scientific, Karlsruhe). To balance all amounts to a total of 1 µg DNA per condition, PcDNA3 was used. At 18 DIV, cells were fixed using 4% PFA for 15 min and mounted on glass slides using Aqua-Poly/Mount (Polysciences Inc, Eppelheim). The experimenter was blinded to all the conditions. The z-stack images of GFP-positive neurons exhibiting pyramidal morphology were taken with the 63× objective of a confocal laser scanning microscope (Carl Zeiss, Jena). Eight consecutive optical sections of the dendrites were taken at a 0.4-μm interval with a 1024×1024 pixel resolution. Spine volumes were analyzed with the ImageJ software using the maximum intensity projections of the z-stack images. The GFP intensity of 150–200 spines per cell was measured and normalized to the total intensity of the dendritic tree. For each experimental condition, at least 18 representative neurons derived from three independent experiments were analyzed.

In vivo

Brains from 3-month-old 138-floxed and 138-spongeub mice were processed with FD Rapid GolgiStain Kit (Gentaur GmbH, PK401) according to the manufacturer’s protocol. Pictures were taken with a Zeiss axio-observer seven inverted widefield fluorescence microscope equipped with an Axiocam 702 mono Zeiss camera with a 100× oil objective. Dendritic spines were manually analyzed with Fiji (ImageJ).

Electrophysiology

Hippocampal slices (300-μm thick) were prepared at 4°C, as previously described (Winterer et al., 2019), from 138-floxed, 138-spongeub, and 138-spongePV mice (age: 6–8 weeks) and incubated at 34°C in sucrose-containing artificial cerebrospinal fluid (sucrose-ACSF, in mM: 85 NaCl, 75 sucrose, 2.5 KCl, 25 glucose, 1.25 NaH2PO4, 4 MgCl2, 0.5 CaCl2, and 24 NaHCO3) for 0.5 hr, and then held at room temperature until recording.

Whole-cell patch-clamp recordings were performed at 32°C on an upright microscope (Olympus BX51WI) under visual control using infrared differential interference contrast optics. Data were collected with an Axon MultiClamp 700B amplifier and a Digidata 1550B digitizer and analyzed with pClamp 11 software (all from Molecular Devices). Signals were filtered at 2 kHz for mEPSCs and mIPSCs and digitized at 5 kHz. Stimulus evoked and unitary postsynaptic currents were filtered at 4 kHz, fast-spiking interneurons at 10 kHz, both were digitized at 100 kHz. Recording pipettes were pulled from borosilicate capillary glass (Harvard Apparatus; GC150F-10) with a DMZ-Universal-Electrode-Puller (Zeitz) and had resistances between 2 and 3 MΩ.

The extracellular solution (ACSF) was composed of (in mM) 126 NaCl, 2.5 KCl, 26 NaHCO3, 1.25 NaH2PO4, 2 CaCl2, 2 MgCl2, and 10 glucose. For EPSCs measured in CA1 pyramidal cells and for fast-spiking interneurons, the intracellular solution was composed of 125 K-Gluconate, 20 KCl 0.5 EGTA, 10 HEPES, 4 Mg-ATP, 0.3 GTP, and 10 Na2-phosphocreatine (adjusted to pH 7.3 with KOH). Cells were held at –70 mV for mEPSCs and at –60 mV for stimulus evoked EPSCs (eEPSCs). 1 μM Gabazine was added to isolate AMPA-mediated postsynaptic currents, additionally 1 μM TTX for mEPSCs. For IPSCs intracellular solution was composed of 135 Cs-Gluconate, 5 KCl, 2 NaCl, 0.2 EGTA, 10 HEPES, 4 Mg-ATP, 0.3 GTP, and 10 Na2-phosphocreatine (adjusted to pH 7.3 with CsOH). Cells were held at +10 mV for mIPSCs and at –10 mV for stimulus evoked inhibitory postsynaptic currents (eIPSCs) and uIPSCs. 25 μM AP-5, 10 μM NBQX, and 10 μM SCH 50911 were added to isolate GABAa-mediated postsynaptic currents for eIPSCs, additionally 1 μM TTX for mIPSCs. Synaptic currents were evoked by mono-polar stimulation with a patch pipette filled with ACSF and positioned in the middle of CA1 stratum radiatum for eEPSCs and in stratum pyramidale for eIPSCs. Series resistance of CA1 pyramidal neurons (not compensated; range, from 7.0 to 19.7 MΩ; median, 11.3 MΩ; IQR, 2.4 MΩ) was monitored and recordings were discarded if series resistance changed by more than 20%. Membrane potentials were not corrected for liquid junction potential.

For paired recordings, whole-cell configuration was first established in putative fast-spiking interneurons. Cells were selected based on morphological appearance in stratum pyramidale of hippocampal CA1, on fast-spiking properties and on input resistance characteristics for PV-positive interneurons (Que et al., 2021; Figure 6—figure supplement 1f). Subsequently, whole-cell recordings were made from postsynaptic CA1 pyramidal neurons residing in close proximity to the presynaptic fast-spiking interneuron. Presynaptic fast-spiking interneurons were held in current-clamp mode and series resistance was compensated with the automatic bridge balance of the amplifier. The mean resting potential of the presynaptic fast-spiking interneurons was –65±4.1 mV (mean ± sd; Figure 6—figure supplement 1f). Fast-spiking interneurons were stimulated at 1 Hz for uIPSCs and at 0.03 Hz for paired-pulse uIPSCs. To characterize the discharge behavior of fast-spiking interneurons, depolarizing steps (50 pA) of 1500 ms were applied. The spiking frequency (Figure 6—figure supplement 1f) was determined at 800–1000 pA current injection. Input resistance was calculated from the mean deviation from baseline of steady-state voltage responses evoked by −150, –100, and –50 pA current injections.

Cell type enrichment analysis

For the cell type enrichment analysis, we used the single-cell data and annotation from Zeisel et al., 2018. We downloaded single-cell count data and annotation from https://storage.googleapis.com/linnarsson-lab-loom/l5_all.loom, restricted it to hippocampus cells, and aggregated to the pseudo-bulk level using muscat (Crowell et al., 2020) and the authors' cell identities. We retained only cell types represented by more than 50 cells, and normalized using TMM (Robinson and Oshlack, 2010). For each gene, we then identified the cell type in which it was the most highly expressed, forming gene sets for each cell type. We then created a sponge differential expression signature by multiplying the sign of the foldchange with the −log10(p value) of each gene and looked for enrichment of gene sets in this signature using fgsea (Korotkevich et al., 2021).

GO enrichment analysis

The R Bioconductor package TopGo (v.2.42.0) was used to perform GO enrichment analysis, essentially as in Lackinger et al., 2019.

To sum up, genes were annotated with the ‘Cellular Component’ ontology and significantly changed genes subsequently tested against the expressed background. For the main figure, we plotted the Top10 GO-Terms ranked by significance (filtering out those with more than 200 annotated genes).

miRNA binding site analysis

Mouse 3′UTR positions of predicted conserved microRNA binding sites were downloaded from Targetscan (version 7.2) (Agarwal et al., 2015) and filtered for the seed of miR138-5p. Putative miR-138 targets (including site-type information) were then aligned with the genes and log fold changes (logFC) as obtained by the differential expression analysis. Plotted is the cumulative proportion (logFC rank (–1)/number of genes (–1)) over the logFC.

Single-molecule fluorescence in situ hybridization

smFISH for miRNA detection on hippocampal neuron cultures was performed using the QuantiGene ViewRNA miRNA Cell Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol with slight modifications. To preserve dendrite morphology, protease treatment was reduced to a dilution of 1:10,000 in phosphate-buffered saline (PBS) for 45 s. smFISH for mRNA detection was performed using the QuantiGene ViewRNA ISH Cell Assay Kit (Thermo Fisher Scientific) as previously described (Valluy et al., 2015), but omitting the protease treatment. After completion of the FISH protocol, cells were washed with PBS, pre-blocked in gelatin detergent buffer, and processed for immunostaining. Pictures represent maximum intensity projections of z-stack images taken on a confocal laser scanning microscope equipped with an Airyscan detector (LSM880, Zeiss).

Stereotactic surgery

The viral vector (aaAAV-9/2 [hCMV-mCherry-SV40p(A)]rev-hSyn1-EGFP-2x (miR138-5p)-WPRE-SV40p(A)) was produced by the local Viral Vector Facility (VVF9 of the Neuroscience Center Zurich). The produced virus had a physical titer of 6.1×10e12 vector genomes/ml. Stereotactic brain injections were performed on 2- to 3-month-old 138-floxed and 138-spongeub mice as previously described (Zerbi et al., 2019). Briefly, mice were anesthetized with isoflurane and subsequently placed onto the stereotaxic frame. Before and after the procedure, animals received subcutaneous injection of 2 mg/kg Meloxicam for analgesia and local anesthetic (Emla cream 5% lidocaine, 5% prilocaine) was distributed on the head. Animals were injected bilaterally with 1 µl of virus into the dorsal hippocampus (coordinates from bregma: anterior/posterior −2.1 mm, medial/lateral ± 1.5 mm, and dorsal/ventral −1.8 mm) and 1 µl of virus in the ventral hippocampus (coordinates from bregma: anterior/posterior −3.3 mm, medial/lateral ± 2.75 mm, and dorsal/ventral −4.0 mm). Postoperative health checks were carried on over the 3 days after surgery.

Tissue collection

Animals were sacrificed by intraperitoneal injection of pentobarbital (150 mg/kg). When in deep anesthesia, mice were perfused intracardially with ice-cold PBS pH 7.4, followed by perfusion with 4% paraformaldehyde in PBS pH 7.4. The brains were then isolated and postfixed for 2–3 hr (138-floxed; 138-spongePV mice) or overnight (138-flox and 138-spongeub mice) at 4°C. The fixed tissue was placed in sucrose solution (30% sucrose in PBS) for 24 hr and frozen in tissue mounting medium (OCT mounting media, VWR chemicals). The tissue was coronally sectioned at 50–60 µm thickness on a cryostat, immediately placed in ice-cold PBS, and subsequently conserved in cryoprotectant solution (15% glucose, 30% ethylene glycol, 5 mM NaH2PO4*H2O, 20 mM Na2HPO4*2H2O) at –20°C.

Immunohistochemistry

Ex vivo (cryosections): for immunofluorescence, cryosections were washed in ice-cold PBS for 30 min, placed on microscope slides (Menzel-Gläser SUPERFROST PLUS, Thermo Fisher Scientific), and air-dried for 5–10 min. Afterward, permeabilization was performed by incubating sections in permeabilization solution (0.5% Triton X-100 in PBS) for 30 min at room temperature, followed by a blocking step in blocking buffer (0.5% Triton X-100, 300 mM NaCl, and 10% normal goat serum in PBS) with the addition of blocking Reagent (VC-MKB-2213, Adipogen Life Sciences, 1:10 dilution) for 1 hr at room temperature. Cryosections were washed in PBS two times for 10 min at room temperature and incubated with primary antibodies in blocking buffer overnight at 4°C. Subsequently, the sections were washed three times with blocking buffer, incubated with secondary antibodies and Hoechst 33342 in blocking buffer for 1 hr at room temperature, washed again three times in blocking buffer, washed in PBS, air-dried, and mounted with Aqua-Poly/Mount (POL18606, Polysciences).

Ex vivo (vibratome sections): for immunofluorescence, 300 µM sections were sliced on a vibratome in ice-cold sucrose-containing artificial cerebrospinal fluid, and then fixed in 4% PFA overnight. Free-floating sections were washed in ice-cold 1× PBS for 30 min, permeabilized by incubation in 0.5% PBX (0.5% Triton X-100 in PBS) for 30 min at room temperature, followed by a quenching step in 0.1 M Glycine to reduce background autofluorescence. Sections were blocked in blocking buffer (0.5% PBX, 10% normal goat serum in PBS) for 1 hr at room temperature, and then incubated in primary antibodies for 36 hr at 4°C. Sections were washed in 0.05% PBX two times for 10 min at room temperature, and then incubated with secondary antibodies in 0.05% PBX with 10% normal goat serum at room temperature for 3 hr.

Subsequently, the sections were washed three times with 0.05% PBX, incubated with Hoechst 33342 in 1× PBS for 10 min, and then washed again three times in PBS, mounted on SuperFrost + slides with Aqua-Poly/Mount (POL18606, Polysciences). A 40-µM Z-stack (with 0.25 µM z-step) was acquired on a Zeiss LSM 880 confocal microscope, with a Plan-Apochromatic 63×/1.4NA DIC M27 oil objective and FastAiryScan detector settings in the hippocampal CA1 region.

In vitro: cells were washed once with NBP, fixed for 20 min with 4%PFA and, after five washes with PBS (3× fast; 2× 5 min), permeabilized with GDB (20 mM sodium phosphate buffer (pH 7.4), 450 mM NaCl, 0.3% Triton X-100, 0.1% gelatin, and ddH2O) for 20 min. Primary antibody was diluted in GDB and incubated for 1 hr at room temperature, followed by five washes with PBS (3× fast; 2× 5 min). Secondary antibody was diluted in GDB and incubated in the dark, at room temperature for 1 hr. The cells were then washed again with PBS (3× fast; 2× 5 min). In the second last wash, Hoechst 33342 was added to the PBS. The coverslips were mounted with Aqua-Poly/Mount (POL18606, Polysciences) on microscope slides (Menzel-Gläser SUPERFROST PLUS, Thermo Fisher Scientific).

Statistics

Statistical analysis was performed on either GraphPad Prism 8.0 or RStudio. Plots were generated in R, mainly using the packages ggplot2, ggsci, ggrepel, and scales. For data sets with n>4, Box plots (Tukey style) were used. For data sets with n<5, average±s.d., including individual data points, is shown. Normal distribution of data was tested with the Shapiro-Wilk test. Based on the results, parametric (e.g., Student’s t-test) or nonparametric (e.g. Mann-Whitney and Kolmogorov-Smirnov) tests were used.

The detailed parameters (n, p value, test) for the statistical assessment of the data are provided in the figure legends.

Acknowledgements

The authors are grateful to S Brown and M Müller for valuable comments on the manuscript, T Wüst and C Furler for excellent technical assistance, T Germade for help with bioinformatics, D Colameo for help with animal perfusions and microscopy data analysis scripts, A Loye for help with histology and T Demeter for help with cloning. The authors thank G Fishell, F Gage, and the Viral Vector Facility of the Neuroscience Center Zurich for sharing plasmids. This work was supported by grants from the DFG (SCHR 1136/4-2) and the ETH 24 18-2 (NeuroSno).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Jochen Winterer, Email: jochen.winterer@hest.ethz.ch.

Gerhard Schratt, Email: gerhard.schratt@hest.ethz.ch.

John R Huguenard, Stanford University School of Medicine, United States.

John R Huguenard, Stanford University School of Medicine, United States.

Funding Information

This paper was supported by the following grants:

  • Deutsche Forschungsgemeinschaft SCHR 1136/4-2 to Gerhard Schratt.

  • Eidgenössische Technische Hochschule Zürich 24 18-2 (NeuroSno) to Gerhard Schratt.

Additional information

Competing interests

No competing interests declared.

No competing interests declared.

Author contributions

Investigation, Methodology, Visualization, Writing - original draft, Writing - review and editing.

Investigation.

Formal analysis, Software.

Investigation.

Investigation.

Investigation.

Investigation, Supervision.

Formal analysis, Funding acquisition, Software, Supervision.

Formal analysis, Software, Supervision.

Conceptualization, Investigation, Supervision, Visualization, Writing - review and editing.

Conceptualization, Funding acquisition, Supervision, Visualization, Writing - original draft, Writing - review and editing.

Ethics

All procedures were conducted in strict accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and the relevant local or national rules and regulations of Switzerland and were subject to prior authorization by the local cantonal authorities (ZH017/2018, ZH196/17).

Additional files

Transparent reporting form

Data availability

RNA-seq data has been deposited to GEO (accession no. GSE173982).

The following dataset was generated:

Daswani R, Dieterich C, Schratt G. 2021. miR-138 controls interneuron function and short-term memory. NCBI Gene Expression Omnibus. GSE173982

References

  1. Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. eLife. 2015;4:e5. doi: 10.7554/eLife.05005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bartel DP. Metazoan MicroRNAs. Cell. 2018;173:20–51. doi: 10.1016/j.cell.2018.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beveridge NJ, Gardiner E, Carroll AP, Tooney PA, Cairns MJ. Schizophrenia is associated with an increase in cortical microRNA biogenesis. Molecular Psychiatry. 2010;15:1176–1189. doi: 10.1038/mp.2009.84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Booker SA, Vida I. Morphological diversity and connectivity of hippocampal interneurons. Cell and Tissue Research. 2018;373:619–641. doi: 10.1007/s00441-018-2882-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Boscher E, Goupil C, Petry S, Keraudren R, Loiselle A, Planel E, Hébert SS. MicroRNA-138 Overexpression Alters Abeta42 Levels and Behavior in Wildtype Mice. Frontiers in Neuroscience. 2020;14:591138. doi: 10.3389/fnins.2020.591138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cheng Y, Wang Z-M, Tan W, Wang X, Li Y, Bai B, Li Y, Zhang S-F, Yan H-L, Chen Z-L, Liu C-M, Mi T-W, Xia S, Zhou Z, Liu A, Tang G-B, Liu C, Dai Z-J, Wang Y-Y, Wang H, Wang X, Kang Y, Lin L, Chen Z, Xie N, Sun Q, Xie W, Peng J, Chen D, Teng Z-Q, Jin P. Partial loss of psychiatric risk gene Mir137 in mice causes repetitive behavior and impairs sociability and learning via increased Pde10a. Nature Neuroscience. 2018;21:1689–1703. doi: 10.1038/s41593-018-0261-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Christensen M, Larsen LA, Kauppinen S, Schratt G. Recombinant Adeno-Associated Virus-Mediated microRNA Delivery into the Postnatal Mouse Brain Reveals a Role for miR-134 in Dendritogenesis in Vivo. Frontiers in Neural Circuits. 2010;3:16. doi: 10.3389/neuro.04.016.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Crowell HL, Soneson C, Germain PL, Calini D, Collin L, Raposo C, Malhotra D, Robinson MD. muscat detects subpopulation-specific state transitions from multi-sample multi-condition single-cell transcriptomics data. Nature Communications. 2020;11:6077. doi: 10.1038/s41467-020-19894-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Del Pino I, Rico B, Marín O. Neural circuit dysfunction in mouse models of neurodevelopmental disorders. Current Opinion in Neurobiology. 2018;48:174–182. doi: 10.1016/j.conb.2017.12.013. [DOI] [PubMed] [Google Scholar]
  10. Ebert MS, Sharp PA. MicroRNA sponges: progress and possibilities. RNA (New York, N.Y.) 2010;16:2043–2050. doi: 10.1261/rna.2414110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fazzari P, Paternain AV, Valiente M, Pla R, Luján R, Lloyd K, Lerma J, Marín O, Rico B. Control of cortical GABA circuitry development by Nrg1 and ErbB4 signalling. Nature. 2010;464:1376–1380. doi: 10.1038/nature08928. [DOI] [PubMed] [Google Scholar]
  12. Fuchs EC, Zivkovic AR, Cunningham MO, Middleton S, Lebeau FEN, Bannerman DM, Rozov A, Whittington MA, Traub RD, Rawlins JNP, Monyer H. Recruitment of parvalbumin-positive interneurons determines hippocampal function and associated behavior. Neuron. 2007;53:591–604. doi: 10.1016/j.neuron.2007.01.031. [DOI] [PubMed] [Google Scholar]
  13. Gandal MJ, Zhang P, Hadjimichael E, Walker RL, Chen C, Liu S, Won H, van Bakel H, Varghese M, Wang Y, Shieh AW, Haney J, Parhami S, Belmont J, Kim M, Moran Losada P, Khan Z, Mleczko J, Xia Y, Dai R, Wang D, Yang YT, Xu M, Fish K, Hof PR, Warrell J, Fitzgerald D, White K, Jaffe AE, PsychENCODE Consortium. Peters MA, Gerstein M, Liu C, Iakoucheva LM, Pinto D, Geschwind DH. Transcriptome-wide isoform-level dysregulation in ASD, schizophrenia, and bipolar disorder. Science (New York, N.Y.) 2018;362:eaat8127. doi: 10.1126/science.aat8127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gao J, Wang W-Y, Mao Y-W, Gräff J, Guan J-S, Pan L, Mak G, Kim D, Su SC, Tsai L-H. A novel pathway regulates memory and plasticity via SIRT1 and miR-134. Nature. 2010;466:1105–1109. doi: 10.1038/nature09271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Giusti SA, Vogl AM, Brockmann MM, Vercelli CA, Rein ML, Trümbach D, Wurst W, Cazalla D, Stein V, Deussing JM, Refojo D. MicroRNA-9 controls dendritic development by targeting REST. eLife. 2014;3:e2755. doi: 10.7554/eLife.02755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hájos N, Pálhalmi J, Mann EO, Németh B, Paulsen O, Freund TF. Spike timing of distinct types of GABAergic interneuron during hippocampal gamma oscillations in vitro. The Journal of Neuroscience. 2004;24:9127–9137. doi: 10.1523/JNEUROSCI.2113-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. He M, Liu Y, Wang X, Zhang MQ, Hannon GJ, Huang ZJ. Cell-type-based analysis of microRNA profiles in the mouse brain. Neuron. 2012;73:35–48. doi: 10.1016/j.neuron.2011.11.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Konopka W, Kiryk A, Novak M, Herwerth M, Parkitna JR, Wawrzyniak M, Kowarsch A, Michaluk P, Dzwonek J, Arnsperger T, Wilczynski G, Merkenschlager M, Theis FJ, Köhr G, Kaczmarek L, Schütz G. MicroRNA loss enhances learning and memory in mice. The Journal of Neuroscience. 2010;30:14835–14842. doi: 10.1523/JNEUROSCI.3030-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Korotkevich G, Sukhov V, Budin N, Shpak B, Artyomov MN, Sergushichev A. Fast Gene Set Enrichment Analysis. bioRxiv. 2021 doi: 10.1101/060012. [DOI]
  20. Kumar RA, Sudi J, Babatz TD, Brune CW, Oswald D, Yen M, Nowak NJ, Cook EH, Christian SL, Dobyns WB. A de novo 1p34.2 microdeletion identifies the synaptic vesicle gene RIMS3 as a novel candidate for autism. Journal of Medical Genetics. 2010;47:81–90. doi: 10.1136/jmg.2008.065821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lackinger M, Sungur AÖ, Daswani R, Soutschek M, Bicker S, Stemmler L, Wüst T, Fiore R, Dieterich C, Schwarting RK, Wöhr M, Schratt G. A placental mammal-specific microRNA cluster acts as a natural brake for sociability in mice. EMBO Reports. 2019;20:e46429. doi: 10.15252/embr.201846429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Leger M, Quiedeville A, Bouet V, Haelewyn B, Boulouard M, Schumann-Bard P, Freret T. Object recognition test in mice. Nature Protocols. 2013;8:2531–2537. doi: 10.1038/nprot.2013.155. [DOI] [PubMed] [Google Scholar]
  23. Lovett-Barron M, Kaifosh P, Kheirbek MA, Danielson N, Zaremba JD, Reardon TR, Turi GF, Hen R, Zemelman BV, Losonczy A. Dendritic inhibition in the hippocampus supports fear learning. Science (New York, N.Y.) 2014;343:857–863. doi: 10.1126/science.1247485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Markram H, Toledo-Rodriguez M, Wang Y, Gupta A, Silberberg G, Wu C. Interneurons of the neocortical inhibitory system. Nature Reviews. Neuroscience. 2004;5:793–807. doi: 10.1038/nrn1519. [DOI] [PubMed] [Google Scholar]
  25. McNeill E, Van Vactor D. MicroRNAs shape the neuronal landscape. Neuron. 2012;75:363–379. doi: 10.1016/j.neuron.2012.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Moreau MP, Bruse SE, David-Rus R, Buyske S, Brzustowicz LM. Altered microRNA expression profiles in postmortem brain samples from individuals with schizophrenia and bipolar disorder. Biological Psychiatry. 2011;69:188–193. doi: 10.1016/j.biopsych.2010.09.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Murray AJ, Sauer JF, Riedel G, McClure C, Ansel L, Cheyne L, Bartos M, Wisden W, Wulff P. Parvalbumin-positive CA1 interneurons are required for spatial working but not for reference memory. Nature Neuroscience. 2011;14:297–299. doi: 10.1038/nn.2751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nicodemus KK, Luna A, Vakkalanka R, Goldberg T, Egan M, Straub RE, Weinberger DR. Further evidence for association between ErbB4 and schizophrenia and influence on cognitive intermediate phenotypes in healthy controls. Molecular Psychiatry. 2006;11:1062–1065. doi: 10.1038/sj.mp.4001878. [DOI] [PubMed] [Google Scholar]
  29. Pelkey KA, Chittajallu R, Craig MT, Tricoire L, Wester JC, McBain CJ. Hippocampal GABAergic Inhibitory Interneurons. Physiological Reviews. 2017;97:1619–1747. doi: 10.1152/physrev.00007.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pouille F, Scanziani M. Enforcement of temporal fidelity in pyramidal cells by somatic feed-forward inhibition. Science (New York, N.Y.) 2001;293:1159–1163. doi: 10.1126/science.1060342. [DOI] [PubMed] [Google Scholar]
  31. Qiu F, Mao X, Liu P, Wu J, Zhang Y, Sun D, Zhu Y, Gong L, Shao M, Fan K, Chen J, Lu J, Jiang Y, Zhang Y, Curia G, Li A, He M. microRNA Deficiency in VIP+ Interneurons Leads to Cortical Circuit Dysfunction. Cerebral Cortex (New York, N.Y. 2020;30:2229–2249. doi: 10.1093/cercor/bhz236. [DOI] [PubMed] [Google Scholar]
  32. Que L, Lukacsovich D, Luo W, Földy C. Transcriptional and morphological profiling of parvalbumin interneuron subpopulations in the mouse hippocampus. Nature Communications. 2021;12:108. doi: 10.1038/s41467-020-20328-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Rico B, Marín O. Neuregulin signaling, cortical circuitry development and schizophrenia. Current Opinion in Genetics & Development. 2011;21:262–270. doi: 10.1016/j.gde.2010.12.010. [DOI] [PubMed] [Google Scholar]
  34. Robinson MD, Oshlack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biology. 2010;11:R25. doi: 10.1186/gb-2010-11-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sakamoto H, Ariyoshi T, Kimpara N, Sugao K, Taiko I, Takikawa K, Asanuma D, Namiki S, Hirose K. Synaptic weight set by Munc13-1 supramolecular assemblies. Nature Neuroscience. 2018;21:41–49. doi: 10.1038/s41593-017-0041-9. [DOI] [PubMed] [Google Scholar]
  36. Schratt GM, Tuebing F, Nigh EA, Kane CG, Sabatini ME, Kiebler M, Greenberg ME. A brain-specific microRNA regulates dendritic spine development. Nature. 2006;439:283–289. doi: 10.1038/nature04367. [DOI] [PubMed] [Google Scholar]
  37. Schratt G. microRNAs at the synapse. Nature Reviews. Neuroscience. 2009;10:842–849. doi: 10.1038/nrn2763. [DOI] [PubMed] [Google Scholar]
  38. Schröder J, Ansaloni S, Schilling M, Liu T, Radke J, Jaedicke M, Schjeide B-MM, Mashychev A, Tegeler C, Radbruch H, Papenberg G, Düzel S, Demuth I, Bucholtz N, Lindenberger U, Li S-C, Steinhagen-Thiessen E, Lill CM, Bertram L. MicroRNA-138 is a potential regulator of memory performance in humans. Frontiers in Human Neuroscience. 2014;8:501. doi: 10.3389/fnhum.2014.00501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Siegel G, Obernosterer G, Fiore R, Oehmen M, Bicker S, Christensen M, Khudayberdiev S, Leuschner PF, Busch CJL, Kane C, Hübel K, Dekker F, Hedberg C, Rengarajan B, Drepper C, Waldmann H, Kauppinen S, Greenberg ME, Draguhn A, Rehmsmeier M, Martinez J, Schratt GM. A functional screen implicates microRNA-138-dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. Nature Cell Biology. 2009;11:705–716. doi: 10.1038/ncb1876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Siegert S, Seo J, Kwon EJ, Rudenko A, Cho S, Wang W, Flood Z, Martorell AJ, Ericsson M, Mungenast AE, Tsai L-H. The schizophrenia risk gene product miR-137 alters presynaptic plasticity. Nature Neuroscience. 2015;18:1008–1016. doi: 10.1038/nn.4023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sohal VS, Rubenstein JLR. Excitation-inhibition balance as a framework for investigating mechanisms in neuropsychiatric disorders. Molecular Psychiatry. 2019;24:1248–1257. doi: 10.1038/s41380-019-0426-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Takada Y, Hirano M, Kiyonaka S, Ueda Y, Yamaguchi K, Nakahara K, Mori MX, Mori Y. Rab3 interacting molecule 3 mutations associated with autism alter regulation of voltage-dependent Ca(2)(+) channels. Cell Calcium. 2015;58:296–306. doi: 10.1016/j.ceca.2015.06.007. [DOI] [PubMed] [Google Scholar]
  43. Tan CL, Plotkin JL, Venø MT, von Schimmelmann M, Feinberg P, Mann S, Handler A, Kjems J, Surmeier DJ, O’Carroll D, Greengard P, Schaefer A. MicroRNA-128 governs neuronal excitability and motor behavior in mice. Science (New York, N.Y.) 2013;342:1254–1258. doi: 10.1126/science.1244193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tatro ET, Risbrough V, Soontornniyomkij B, Young J, Shumaker-Armstrong S, Jeste DV, Achim CL. Short-term recognition memory correlates with regional CNS expression of microRNA-138 in mice. The American Journal of Geriatric Psychiatry. 2013;21:461–473. doi: 10.1016/j.jagp.2012.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tian J, Geng F, Gao F, Chen Y-H, Liu J-H, Wu J-L, Lan Y-J, Zeng Y-N, Li X-W, Yang J-M, Gao T-M. Down-Regulation of Neuregulin1/ErbB4 Signaling in the Hippocampus Is Critical for Learning and Memory. Molecular Neurobiology. 2017;54:3976–3987. doi: 10.1007/s12035-016-9956-5. [DOI] [PubMed] [Google Scholar]
  46. Tian F, Yuan C, Yue H. MiR-138/SIRT1 axis is implicated in impaired learning and memory abilities of cerebral ischemia/reperfusion injured rats. Experimental Cell Research. 2018;367:232–240. doi: 10.1016/j.yexcr.2018.03.042. [DOI] [PubMed] [Google Scholar]
  47. Tuncdemir SN, Fishell G, Batista-Brito R. miRNAs are Essential for the Survival and Maturation of Cortical Interneurons. Cerebral Cortex (New York, N.Y. 2015;25:1842–1857. doi: 10.1093/cercor/bht426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Valluy J, Bicker S, Aksoy-Aksel A, Lackinger M, Sumer S, Fiore R, Wüst T, Seffer D, Metge F, Dieterich C, Wöhr M, Schwarting R, Schratt G. A coding-independent function of an alternative Ube3a transcript during neuronal development. Nature Neuroscience. 2015;18:666–673. doi: 10.1038/nn.3996. [DOI] [PubMed] [Google Scholar]
  49. Walgrave H, Balusu S, Snoeck S, Vanden Eynden E, Craessaerts K, Thrupp N, Wolfs L, Horré K, Fourne Y, Ronisz A, Silajdžić E, Penning A, Tosoni G, Callaerts-Vegh Z, D’Hooge R, Thal DR, Zetterberg H, Thuret S, Fiers M, Frigerio CS, De Strooper B, Salta E. Restoring miR-132 expression rescues adult hippocampal neurogenesis and memory deficits in Alzheimer’s disease. Cell Stem Cell. 2021;28:1805–1821. doi: 10.1016/j.stem.2021.05.001. [DOI] [PubMed] [Google Scholar]
  50. Wang H, Liu F, Chen W, Sun X, Cui W, Dong Z, Zhao K, Zhang H, Li H, Xing G, Fei E, Pan BX, Li BM, Xiong WC, Mei L. Genetic recovery of ErbB4 in adulthood partially restores brain functions in null mice. PNAS. 2018;115:13105–13110. doi: 10.1073/pnas.1811287115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Watanabe Y, Shibuya M, Nunokawa A, Kaneko N, Igeta H, Egawa J, Someya T, Hishimoto A, Mouri K, Sora I. A rare MIR138-2 gene variation is associated with schizophrenia in a Japanese population. Psychiatry Research. 2014;215:801–802. doi: 10.1016/j.psychres.2013.12.029. [DOI] [PubMed] [Google Scholar]
  52. Wen L, Lu YS, Zhu XH, Li XM, Woo RS, Chen YJ, Yin DM, Lai C, Terry AV, Vazdarjanova A, Xiong WC, Mei L. Neuregulin 1 regulates pyramidal neuron activity via ErbB4 in parvalbumin-positive interneurons. PNAS. 2010;107:1211–1216. doi: 10.1073/pnas.0910302107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Winterer J, Lukacsovich D, Que L, Sartori AM, Luo W, Földy C. Single-cell RNA-Seq characterization of anatomically identified OLM interneurons in different transgenic mouse lines. The European Journal of Neuroscience. 2019;50:3750–3771. doi: 10.1111/ejn.14549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zeisel A, Hochgerner H, Lönnerberg P, Johnsson A, Memic F, van der Zwan J, Häring M, Braun E, Borm LE, La Manno G, Codeluppi S, Furlan A, Lee K, Skene N, Harris KD, Hjerling-Leffler J, Arenas E, Ernfors P, Marklund U, Linnarsson S. Molecular Architecture of the Mouse Nervous System. Cell. 2018;174:999–1014. doi: 10.1016/j.cell.2018.06.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zerbi V, Floriou-Servou A, Markicevic M, Vermeiren Y, Sturman O, Privitera M, von Ziegler L, Ferrari KD, Weber B, De Deyn PP, Wenderoth N, Bohacek J. Rapid Reconfiguration of the Functional Connectome after Chemogenetic Locus Coeruleus Activation. Neuron. 2019;103:702–718. doi: 10.1016/j.neuron.2019.05.034. [DOI] [PubMed] [Google Scholar]

Editor's evaluation

John R Huguenard 1

The authors provide evidence for a role of the micro RNA – mi-138 – in synaptic inhibition and behavior in mice. They designed a novel transgenic model in which a miR-138 sponge is conditionally expressed to sequester endogenous miR-138 in a cell-type specific manner. Using this tool they show that sequestration of miR-138 in a major, parvalbumin-expressing inhibitory cell type results in enhanced inhibitory transmission, and deficits in memory.

Decision letter

Editor: John R Huguenard1

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

eLife. 2022 Mar 15;11:e74056. doi: 10.7554/eLife.74056.sa2

Author response


Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Daswani et al. study the role of miR-138-5p, a microRNA the authors previously found to regulated excitatory synapse function, in mutant mice. To this end they overexpress a miR-138 sponge construct first ubiquitously and find that short term memory is impaired. Gene-expression analysis points to a specific role in inhibitory neurons, which the authors confirm by repeating key experiments in mutant mice in which the miR-138 sponge is expressed in PV-inhibitory neurons. This is a very interesting study that pioneers the analysis of microRNAs in a cell-type specific manner in the CNS. The following point represent helpful suggestion the authors could address before submission.

- A question that may come up is related to the mutant mice the controls. One could argue that the better control would the transgenic mice expressing the "control sponge". At present the control group are mice that carry the construct but its not expressed, as far as I understood. The authors may want to address this issue upfront and discuss somewhere in the manuscript that their control animals are suitable.

We agree with this reviewer that an independent line expressing a “control sponge” construct might represent a “gold standard” control. However, we decided to take the current approach for two reasons: (1) considering the RRR principles of animal research, including an independent mouse line would have doubled the number of animals needed for experiments. (2) although a control sponge line addresses potential specificity issues of expressing a sponge transcript, it also has its own limitations since behavioural experiments cannot be done with littermates, which could also introduce variability. Nevertheless, we have rigorously validated the specificity of the miR-138 sponge construct by comparing it to a highly similar miR-138 control sponge construct in several assays: (i) miR-138 perfect binding site luciferase sensor assay (suppl. Figure 1A); (ii) dendritic spine size assay (suppl. Figure 1B); (iii) mIPSC electrophysiological recordings from hippocampal slices of intracerebrally injected mice (new Figure 4d, e); (iv) short-term memory assay in intracerebrally injected mice (new Figure 4b, c); (v) Erbb4 FISH in primary rat hippocampal neurons infected with Dlx-138-sponge (new Figure 3f). As suggested by this reviewer, we have discussed our approach in more detail in the revised manuscript (p.10-11, lines 307-316).

- Moreover, as far as I understand it, the sponge construct will be expressed from early developmental stages in all cells of the body in the initial experiment. While the authors later study specifically PV neurons, this may also represent early neurodevelopmental effects. It might be helpful for the reader to explain the approach and rational in more detail. want the specifically focus on the role of miR-138 in neurodevelopmental diseases (schizophrenia is generally mentioned in the introduction) in which case the approach would make sense. However, I am not aware that miR-138 has been genetically linked yet to neurodevelopmental disease but I might have missed this. This could clarified specifically in the introduction.

We agree with this reviewer that the phenotypes we observe might have an early developmental origin, at least in the ubiquitous sponge mouse line. However, as pointed out by reviewer 2, expression of PV doesn’t kick in before the second postnatal week, arguing for a postnatal role of miR-138-5p in the PV-sponge model. Moreover, stereotactic injections of Dlx-138-sponge into the hippocampus (new Figure 4) were performed in young adult mice, providing further support that perturbing miR-138-5p at adult stages impacts physiology and behaviour. Our findings are thus in line with a link to a disease like schizophrenia whose onset is either during adolescence (early-onset) or in adulthood (late-onset). In fact, miR-138 has been linked to cognitive functions, and a rare variant in the miR-138-2 gene has been associated with schizophrenia (Watanabe et al., Psychiatry Res. 2014). We have now better clarified these links in the introduction and discussion of our revised manuscript. In addition, we have provided additional data showing a preferred deregulation of SCZ-associated genes in the miR-138 sponge model (new suppl. Figure 4d; see also below).

- Figure 1B. To convincingly demonstrate the functionality of the construct in vivo it may help to assay the regulation of some confirmed targets at the mRNA/Protein level or point already here to the exp. later shown in Figure 2.

We agree with this reviewer, that showing target gene regulation is imperical to confirm the functionality of the miR-138 loss-of-function approach. However, we want to stress that a number of experiments in this context were already included in our original manuscript. (1) Expression of the sponge in mice in vivo leads to a preferential upregulation of predicted miR-138 targets compared to non-targets (Figure 2b), which provides strong evidence that expression of the construct leads to a specific loss-of-function of miR-138. (2) Validation by qPCR confirmed upregulation of PV-enriched genes at the RNA level, e.g. Rims3 and Erbb4. (3) In the revised manuscript, we further included protein data for Erbb4 upregulation in the hippocampus of miR-138-spongeUb mice using Western blot (new Figure 3c). Unfortunately, we were unable to obtain conclusive Western blot results for Rims3 using several commercially available antibodies.

- Supplemental Figure 1.: n=1 for pGL3 CTR may not be sufficient for statistical analysis. Panel (A) Please explain this assay in greater detail. What is measured here?

In fact, this assay has been repeated 3 times. The lack of error bar in the control conditions is due to normalization. Statistical test could still be performed with a 1-sample t-test, which revealed a significant difference. The experiment measures the endogenous activity of miR-138 in hippocampal neurons (based on the extent of cleavage of the luciferase reporter).

- Supplemental Fig1d: No scale bar. Why show a small section of the cerebellum when later hippocampus is analyzed? I suggest to show a selection of brain regions with high quality images.

We agree and have now included a lacZ staining from the hippocampus in the revised manuscript (new suppl. Figure 1d).

- Figure 1. The authors may want to consider that no effect in the contextual fear conditioning may not be sufficient to claim that specifically short-term memory is affected in mutant mice. A more thorough behavioral characterization may be necessary or it should be discussed why this is not necessary in the context of the current manuscript.

In the revised manuscript, we have now further included CFC data from the PV-sponge mouse line (new Suppl. Figure 5d), which also didn’t reveal a significant genotype-dependent difference. That said, we fully agree that results from only one behavioural paradigm (CFC) are not sufficient to make general statements about the specific types of memories affected by miR-138 loss-of-function. However, since our laboratory is currently not set up to perform an extensive behavioural characterization of memory function using different tests, we consider such experiments beyond the scope of this revision. We therefore decided to tone down the statements in the manuscript related to short-term memory specificity accordingly.

- Figure 2: please explain in more detail (in the methods) the statistics behind the diff. expression analysis.

A more detailed statistical description has been included in the methods section of the revised manuscript (p. 18, l. 1074-1079).

- Figure 2d. To further strengthen the idea that DEG are enriched in inhibitory neurons, corresponding viol plots across cell types may help. The authors could plot for example selected genes are the eigen-vector expression of DEGs.

We agree with this reviewer that an alternative presentation of the DEG data could be helpful. We have therefore added another panel (new suppl. Figure 2c) illustrating the distribution of expression of the sponge-upregulated-DEGs in the different cell types. In our view, this presentation is more easily interpretable compared to viol plots.

- The selection of Erbb4 and Rims3 for further analysis could be explained better.

Based on the available data, we have now decided to prioritize on Erbb4 regulation in the revised manuscript (Rims3 data was moved to the supplement). We have further provided a more detailed rationale for studying Erbb4 in the context of inhibitory synaptic transmission and short-term memory.

- Figure 3B.Maybe show representative images.

Representative pictures have now been included in the revised manuscript (new Figure 5b, left panel).

- How about FC and other long-term memory assays in 138-spongePV´ mice?

We have now additionally performed CFC in 138-sponge-PV mice, and found no significant difference in memory performance between 138-sponge and control mice (new suppl. Figure 5d). As outlined above, additional memory assays are beyond the scope of this study.

- Please address the finding that behavior phenotypes are similar in 138-spongeub and 138-spongePV´ mice, while e-physiology differs (mini ipsc).

We assume that this is a misunderstanding, since we did not measure mIPSCs in pyramidal neurons of 138-spongeUb mice (in contrast to mEPSC, which surprisingly were not altered compared to control mice.)

- I guess an obvious question could be to show the regulation of miR-138 target genes in PV neurons and /or study the transcriptome in PV-neurons as a result of sponge expression.

We agree that assessing the transcriptome specifically of PV neurons would be a logical next step. However, this is technically rather challenging, either involving FACS sorting of PV-positive neurons or single-cell RNAseq approaches, both of which are currently not established in the laboratory. We therefore feel that such experiments, also considering the limited new insight that would be expected from them, are beyond the scope of this revision.

- The discussion is comparatively short. The specific reference to miR-138 as a target for schizophrenia and ASD provokes the question of more detailed analysis, e.g behavioral phenotypes for ASD and schizophrenia in mutant mice or comparing the DEG to genes de-regulated in other mouse models for these diseases.

We agree that making more functional connections to ASD/schizophrenia would be exciting. However, this would involve a battery of additional mouse behavioural experiments, which is in our view clearly beyond the scope of this revision. Concerning the second point, we have performed a comparison between DEGs deregulated in the miR138 sponge model and a previous study about schizophrenia (Gandal et al., Science 2018). Excitingly, we found that the genes upregulated in the 138-sponge (at FDR<0.05) are significantly enriched for genes found upregulated in the brain of SCZ patients (p~0.00884; new suppl. Figure 4d), which provides additional correlative evidence for an involvement of miR-138 in SCZ. Moreover, we have elaborated more on the role of miR-138 in cognition and SCZ in the discussion (p. 11-12, l. 339-351).

- Given that the literature suggests of role for miR-138 also excitatory neurons, the phenotypes should be discussed in more detail. Why are mainly genes in inhibitory neurons affected in 138-spongeub mice?

Based on our new results from a cell-type specific miR-138 sensor assay (new suppl. Figure 4c) we speculate that the reason for the preferential regulation in inhibitory neurons is the more efficient miR-138 inhibition in this cell type. This is now discussed in more detail (p. 10, l. 299-306). Please see also our comments to the other reviewers regarding this topic.

Reviewer #1 (Significance (Required)): Generally this study addresses the cell-type specific role of microRNAs in the CNS, which is important to still innovative.

The finding that miR-138 controls specific functions in inhibitory neurons and that this is linkned to behavioral alterations is novel

The data will be mainly intersting for the neuroscientific community

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

Understanding the role of miRNAs in different neuronal cell types remains a paramount goal in neuroscience. Using a conditional miR-138 sponge transgenic line, Daswani and colleagues demonstrate that miR-138 in parvalbumin+ (PV) GABAergic neurons is necessary for short-term memory. Further, they identify a possible cellular mechanism underlying this behavioral deficit: CA1 pyramidal neurons receive more inhibition from neighboring PVs. This work is timely, impactful, and an important contribution to the field. However, there are important aspects that needs to be addressed before publication:

Major:

It is surprising that the miR-138 sponge has no effect in pyramidal neurons. The authors' laboratory has published beautiful work showing that miR-138 has important roles for synaptogenesis in this cell type. The authors hypothesize that the expression levels of the miR-138 sponge might not be high enough for pyramidal neurons (where miR-138 is highly expressed) and instead it is sufficient for PVs. However, sensor data in Figure 1b and spines data in Sup Figure 1c are from pyramidal neurons. For the miR-138 sponge to be credible, the authors must demonstrate that, as they claim, the sponge is effectively working in PVs and only partially in pyramidal neurons. This could be achieved by showing that miR-138 is expressed at different levels in the two cell types: (i) analysis of miR-138 expression levels from He et al. (2012) in different cell types; (ii) FACS of PVs and pyramidal neurons and assessing miR-138 levels; (iii) quantifying miRNA FISH in different cell types. In addition, the authors should demonstrate that the miR-138 has different levels of efficacy in the two cell types, i.e. analyzing sensor data in PNs vs PVs (from cortical cultures or in vivo). If the results from this further analysis don't support the original hypothesis, the authors must find a plausible reason and validate it.

We fully agree with this reviewer that the absence of phenotype in pyramidal neurons is surprising and that we do not have a full explanation for this yet. To further test our hypothesis of an incomplete miR-138 inhibition in excitatory pyramidal neurons of the miR-138 sponge line, we have now performed a series of new experiments, largely following the suggestions made by this reviewer: (i) we monitored miR-138 expression from a published small RNA-seq study (He et al., 2012) (new suppl. Figure 3b). (Ii) we quantified miR-138 signal in already existing smFISH datasets from hippocampal neurons containing PNs and PVs (new suppl. Figure 3a). (Iii) we quantified mir-138 sensor activity in PNs and PVs in hippocampal slices stained for PN and PV markers (new suppl. Figure 4c). Altogether, this analysis suggests that while miR-138 is expressed to a similar level in PNs and PVs, its activity is markedly higher in PVs and more robustly inhibited in PVs by expression of a miR-138 sponge. Although the mechanistical underpinnings are unknown, these observations might explain why we preferentially observed miR-138-5p dependent regulation of interneuron-enriched genes in miR-138Ub sponge mice.

Minor:

The sensor data are somewhat confusing. It would benefit to add schemes of the sensor and sponge constructs and to represent the data in Figure 1b with a bar graph. To further support the claims of incomplete effects of the miR-138 sponge, the authors should have a mutated MRE sensor (maximum de-repression) and express the effect of the sponge in different cell types as percentage of maximum de-repression. Please also add text explaining the sensor experiments in more detail so that the non-specialist can follow.

As suggested by this reviewer, we have now added a scheme of the sensor and presented the data in Figure 1b as a bar graph. In addition, we have performed the sensor analysis separately for PNs and PVs (new suppl. Figure 4c). This analysis clearly shows that the degree of inhibition exerted by the 138-sponge is more pronounced in PV+ interneurons compared to PV- neurons, thereby supporting our model that transgenic expression of the miR-138 sponge preferentially de-represses miR-138-5p target genes in interneurons.

The choice of PV-Cre is interesting. PV-Cre does not kick in until the second postnatal week, it is notoriously not a very efficient Cre line, and although it correlates well in the cortex with basket cells, it turns on also in cerebellar purkinje cells and in the peripheral nervous system. Some of these limitations should be discussed, considering that behavior is used as readout.

The point about ectopic expression of PV-Cre in PV- cells in cerebellar purkinje cells and the peripheral nervous system is well taken. We therefore decided to perform a complementary approach where we delivered 138-sponge and control-sponge specifically to hippocampal interneurons by stereotactic injection of a rAAV-Dlx5/6 construct (new Figure 4). Intriguingly, the miR-138-sponge associated behavioural and electrophysiological phenotypes were fully recapitulated by this approach. Together with our detailed electrophysiological characterization of hippocampal PV+ interneurons in paired recordings (Figure 6), we are confident that hippocampal PV dysfunction contributes in an important way to the observed phenotypes.

The authors should remove emphasis from E/I. The physiology experiments performed don't assess E/I but E and I in isolation. It is the opinion of this reviewer that the work is impactful because it reveals novel miRNA mechanisms in GABAergic cells, no need to claiming anything else.

We agree that our claims about E/I are currently overstated, and have now toned down the respective statements in the revised manuscript (e.g. by removing emphasis from E/I in the introduction).

Sup Figure 1c. Should the y axes say something like Spines Density?

We have added the y-axes label as suggested.

Sup Figure 1d. Why did the authors choose the cerebellum to show CMV-Cre efficacy? The rest of the paper focuses on the hippocampus.

We have now provided a new lacZ staining from the hippocampus to illustrate efficient Cre-mediated recombination in this region (new suppl. Figure 1d).

In the introduction, the Tan et al. paper from the Schaefer lab should be mentioned, considering that miR-128 was knocked out in GABAergic cells (MSNs).

We thank the reviewer for this reminder and have now referenced this paper in the introduction.

Reviewer #2 (Significance (Required)): Identifying cell type-specific roles of miRNAs has eluded the field, specifically in the case of rare cell types, i.e GABAergic interneurons. The paper from Daswani and colleagues is an important step forward in this direction. Somewhat serendipitously, the authors have found that miR-138 targets preferentially genes enriched in GABAergic interneurons. Indeed, PV-specific knockout of miR-138 recapitulates behavioral deficits induced by global miR-138 knockout. The only similar contributions are well referenced in the introduction: (i) Tuncdemir et al. (Fishell lab) performed MGE-specific Dicer knockout and found defects in GABAergic interneuron survival, migration, and lamination; (ii) Qiu et al. (Miao He lab) showed that Dicer ko in VIP cells induces long-term dysfunction in GABAergic interneuron computations and survival.

This manuscript should be of interest to both the miRNA field and the synaptic plasticity, learning and memory fields.

I am a neurobiologist that studies the roles of miRNAs in instructing network formation.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Daswani et al. report an interesting role for miR-138-5p in the control of short-term memory and inhibitory synaptic transmission. They notably built on an elegant transgenic model in which a miR-138 sponge is conditionally expressed using the Cre-Lox system and allows the sequestering of endogenous miR-138 in a cell-type specific manner. Using this model, the authors provide evidence that miR-138-5p expressed in parvalbumin-expressing neurons controls short-term memory as well as inhibitory synaptic input onto CA1 pyramidal neurons. Using RNAseq and qrtPCR, they identify presynaptic genes whose expression is regulated by miR-138 and possibly accounting for inhibitory synaptic alterations. Overall, the experiments are well conducted. The data are interesting, solid and logically presented and the methods are sufficiently described. However, there are some concerns that should be considered prior publication:

Major concerns:

(1) In the abstract, the authors' claim that "miR-138-5p regulates the expression of presynaptic genes in hippocampal parvalbumin-expressing inhibitory interneurons to control short-term memory" is overstated. Indeed, while the authors provide compelling evidence that miR-138 sponge controls short-term memory, the causal evidence to demonstrate that this is going through the regulation of presynaptic genes expression is missing. Moreover, because they are using a transgenic model in which the 138-sponge is constitutively expressed in any cell types and brain areas, the short-term memory deficits found by the authors are not necessarily resulting from hippocampal synaptic alterations. Therefore, the authors should either tone down this claim or perform additional experiments to support their model (see points 3 and 4).

We largely agree with these statements and specifically address them under points 3 and 4.

(2) While the authors provide convincing data demonstrating the efficiency of the miR-138 sponge both in cultured neurons and in vivo using sensor constructs and luciferase assays, the only evidence that the 138-sponge specifically inhibits miR-138 is by using a control sponge in cultured neurons and by measuring luciferase activity from sensors or spine size. To better support the specificity of the 138-sponge, it is important to demonstrate the absence of effect of the control sponge on inhibitory synaptic transmission, at least in cultured neurons.

As suggested by this reviewer, we have now performed additional experiments to support the specificity of the 138-sponge in interneurons. Therefore, we generated rAAV expressing 138-sponge selectively in interneurons due to the presence of a Dlx5/6 promoter (Dlx-138-sponge). (i) expression of Dlx-138-sponge, but not Dlx-control-sponge, elevated Erbb4 expression in rat hippocampal interneurons in culture as assessed by smFISH (new Figure 3f); (ii) stereotactic injection into the adult mouse hippocampus of Dlx-138-sponge, but not Dlx-control-sponge, impairs short-term memory (new Figure 4b, c) and inhibitory synaptic transmission in pyramidal neurons (new Figure 4d, e).

Moreover, it would be reassuring to see that not all miRNAs are regulated by miR-138 (for instance by using sensors for distinct miRNAs).

A priori, one cannot rule out that miR-138 inactivation indirectly regulates the expression and/or activity of other miRNAs, for example by regulating targets which control miRNA biogenesis. Therefore, the proposed sensor experiments for selected miRNA candidates are in our view not suitable to unequivocally judge the specificity of the miR-138 sponge approach. Moreover, such experiments would have required the stereotactic injection of at least two additional cohorts of mice, which was not covered by our currently approved animal experimentation license. Finally, only a low number of miRNAs could be screened with such an in vivo approach, making general conclusions difficult. By weighing all these arguments, we decided not to perform sensor experiments for additional miRNAs and instead added further experiments which support the specificity of the 138-sponge approach (see above).

(3) The authors propose that miR-138 expression in the hippocampus regulates short-term memory. Although there is evidence from previous studies that hippocampal PV+ interneurons are involved in short-term memory, the data do not directly address this point. Specific involvement of miR-138 in hippocampal PV+ interneurons could be easily tested through stereotaxic injections of rAAVs carrying PV-Cre in 138-floxed mice in order to drive the expression of miR-138 sponge selectively in CA1 hippocampal interneurons.

We agree that the data presented in the original manuscript didn’t provide direct evidence for a role of the hippocampus in miR-138-dependent regulation of short-term memory. Therefore, we now inactivated miR-138-5p specifically in hippocampal interneurons by stereotactic injection of a Dlx-138-sponge rAAV construct (new Figure 4a, see above). This led to a similar impairment in both short-term memory (new. Figure 4b, c) and inhibitory synaptic transmission (new Figure 4d, e) as observed in 138-spongeUb and 138-spongePV mice. We did not pursue the PV-Cre injections into 138-floxed mice, since viral expression of PV-Cre (as opposed to transgenic expression in PV-Cre mice) apparently is not very specific and therefore not frequently used (personal communication).

(4) Although not required for the paper as it is, experiments addressing the causal link between (1) the miR-138-dependent regulation of ErbB4 and/or RimS3 in CA1 interneurons and (2) the role of miR-138 in inhibitory synaptic transmission and/or short-term memory would considerably strengthen the model proposed. To address that, the authors could alter the expression/function of the candidate genes in their transgenic model. Alternatively, strategies could be used to selectively protect putative target from the action of miR-138-5p (e.g., using LNAs or 3'UTR mutants).

Addressing the molecular mechanism underlying impaired short-term memory and inhibitory transmission is clearly the next step in this project, but beyond the scope of the current manuscript, as also pointed out by this reviewer.

(5) Description of statistics require clarifications: - n should be clearly defined in all figure legends (cells, cultures, animals, experiments?).

- The authors should indicate whether and how they tested for normal distribution of their data.

—figure supplement Figure 1a-c and Suppl. Figure 3a : a non-parametric test should be used to compare the different conditions, considering the too low n number which does not allow to conclude on a normal distribution.

We have now addressed these statistical issues in the revised manuscript. (i) we have now clearly defined n in all figure legends. (ii) normal distribution of the data was tested with the Shapiro-Wilk test in GraphPad (stated in the Methods section). When normal distribution was not observed, non-parametric tests were used (e.g. Mann-Whitney, Kolmogorov-Smirnov). (iii) we agree with this reviewer that the n for the indicated experiments is too low to conclude on a normal distribution with a common test. However, visual inspection of the data suggested normal distribution for luciferase assays presented in Suppl. Figure 1a-c, considering our long-term experience with these assays. We therefore did not see the necessity to use non-parametric tests in this case. Concerning the PV+ cell density count (previous Suppl. Figure 3a, new suppl. Figure 6e), we now applied the Mann-Whitney test.

Minor issues: (1) The fact that excitatory synapses onto pyramidal neurons are unaffected in 138-sponge mice is puzzling when considering the previous study from the same authors (Siegel et al., 2009) as well as the results obtained in cultured neurons to validate the sponge (spine size measurements, Suppl. Figure 1). While the authors propose that 'the absence of changes in excitatory synaptic transmission in the hippocampus of 138-sponge-ub mice might be due to ineffective silencing of the highly abundant miR-138-5p in pyramidal neurons' they could actually refine their analysis to give support this hypothesis:

- By quantifying the signal from single-molecule FISH for miR-138 in Camk2a+ neurons versus Erbb4+ neurons (Figure 2e). In the images shown, it is not evident that excitatory neurons express more miR-138 in comparison to inhibitory ones.

- By quantifying the degree of inhibition of miR-138 in pyramidal neurons versus interneurons using the dual sensor system (GFP/mcherry signal). In Figure 1b, the authors do not discriminate between cell types. A lack of increase of the GFP signal in pyramidal cells may indicate an inability of those cells to express the sponge.

- By checking whether APT1, a known miR-138 target that they previously identified in excitatory neurons (Siegel et al., 2009) is also a regulated gene in 138-sponge mice. If APT1 expression remains unchanged, this could give support to the fact that the sponge is indeed ineffective in excitatory neurons.

We agree with the comments made by this reviewer, which are also in agreement with those from reviewer 2 (see also our comments there). Concerning the last point of reviewer 3, we now checked the expression APT1 (new nomenclature LYPLA1), as well as two other validated miR-138 targets from excitatory neurons (SIRT1, Reln) in our RNA-seq data. None of these targets was differentially expressed (new suppl. Figure 2e). Together, this data supports our hypothesis that miR-138 is not effectively inhibited by the sponge transgene in PNs.

(2) The analysis of VGAT signal intensity in individual PV+ boutons may provide useful information about the content in vesicles per bouton. One could expect a higher VGAT intensity/bouton in 138-sponge mice, correlated with an increase number of release sites per bouton (as proposed by the authors) or a similar trend as for increased success rate or decreased PPR.

We agree that the analysis of VGAT signal intensity might provide additional information regarding the observed inhibitory synapse phenotype and therefore performed the respective analysis (new Figure 6b, right panel). However, this didn’t reveal any significant differences between miR-138-spongePV and control mice, suggesting that the gross morphology of inhibitory release sites is unchanged. Further ultrastructural investigation of synaptic release sites will require super-resolution microscopy, which is currently not established in the laboratory and therefore beyond the scope of this revision.

(3) For the following data, titles of the graph axis are not accurate and the authors should indicate more precisely what are the exact parameters measured: Figure 1b, Suppl. Figure 1a, Suppl. Figure 1c, Suppl. Figure 3b.

We have fixed these issues in the revised manuscript.

(4) Figure 3j: "Coefficient of variance" should be corrected for "coefficient of variation".

We have changed this expression accordingly.

(5) Results – L70: the use of the miR-138 sponge is critical for the key findings of the study. It is therefore important to detail within the text how the specificity and the efficiency of the sponge were tested.

Please refer to our comments for reviewer 1 and 2 regarding miR-138 sponge validation in vitro and in vivo. In addition, we have provided more discussion of the sponge strategy in the text (p. 10-11, l. 307-316).

(6) Results – L75: the authors should introduce briefly how the dual sensor works and why an increase of the GFP signals indicate efficient sequestering of endogenous miR-138.

We have now explained the sensor strategy in more detail in the Results section (p.4, l.98-106) and in addition provided a schematic (new suppl. Figure 1e)

(7) Supplementary figure 1d: to illustrate the 'penetrant expression' of the sponge, the authors should provide an image representative of the hippocampus not the cerebellum.

We have now provided a representative picture of the hippocampus (new suppl. Figure 1d).

(8) Suppl. Figure 1g and Suppl. Figure 3B: the use of a single two-way ANOVA test with a single P value is not clear to me as two different parameters are measured (distance and time).

We apologize for the confusion. The two parameters have now been plotted as individual panels (new suppl. Figure 1g, h; suppl. Figure 5a, b) and separately analyzed with heteroscedastic t-tests.

(9) Suppl. Figure 1i,j and suppl. Figure 3d: the authors should mention whether a statistical test was used to compare the two conditions. n values (cells) should be indicated.

The respective figures correspond to bar graphs in the main manuscript (Figure 1, 6), for which a statistical test was provided. However, we now also provided a statistical assessment of the cumulative graphs (using KS-test) in the revised manuscript.

Reviewer #3 (Significance (Required)): This study provides important findings that will be of interest for a large audience of neuroscientists interested in synaptic physiology and pathologies:

(1) The authors developed an elegant transgenic model allowing to address the role of miR-138 in a cell specific manner and which allows to correlate synaptic alterations to the behavior.

(2) While the majority of studies have investigated the role of miRNAs at excitatory synapses, this study provides important insight about the role of one identified miRNA, miR-138, at inhibitory synapses. Interestingly, because miR-138 was also shown to regulate excitatory synapses, the data suggest a central role of miR-138 in regulating E-I balance in hippocampal circuits.

(3) The study further shows that alterations in inhibitory synaptic transmission resulting from miR-138 inhibition are correlated with deficits in working memory. Because miR-138 as well as its targets are associated with cognitive deficits and neuropsychiatric disorders such as autism and schizophrenia (Kumar et al., 2010; Nicodemus et al., 2006), this study thus suggests a critical role of miR-138 in disorders with altered E/I balance.

I have expertise in the role of microRNAs in synaptic development and plasticity. While I have little expertise regarding behavioral investigations in general, I feel that the behavioral data shown in the present paper are easily accessible and straightforward.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Daswani R, Dieterich C, Schratt G. 2021. miR-138 controls interneuron function and short-term memory. NCBI Gene Expression Omnibus. GSE173982 [DOI] [PMC free article] [PubMed]

    Supplementary Materials

    Figure 1—source data 1. This file contains the raw data on which the graphs in Figure 1 are based.
    Figure 1—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 1—figure supplement 1 are based.
    Figure 2—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 2—figure supplement 1 are based.
    Figure 3—source data 1. This file contains the raw data on which the graphs in Figure 3 are based.
    Figure 3—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 3—figure supplement 1 are based.
    Figure 4—source data 1. This file contains the raw data on which the graphs in Figure 4 are based.
    Figure 4—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 4—figure supplement 1 are based.
    Figure 5—source data 1. This file contains the raw data on which the graphs in Figure 5 are based.
    Figure 5—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 5—figure supplement 1 are based.
    Figure 6—source data 1. This file contains the raw data on which the graphs in Figure 6 are based.
    Figure 6—figure supplement 1—source data 1. This file contains the raw data on which the graphs in Figure 6—figure supplement 1 are based.
    Transparent reporting form

    Data Availability Statement

    RNA-seq data has been deposited to GEO (accession no. GSE173982).

    The following dataset was generated:

    Daswani R, Dieterich C, Schratt G. 2021. miR-138 controls interneuron function and short-term memory. NCBI Gene Expression Omnibus. GSE173982


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES