Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Apr 1.
Published in final edited form as: Insecta mundi. 2022 Feb 25;2022(921):1409.

Taxonomic changes suggested by the genomic analysis of Hesperiidae (Lepidoptera)

Jing Zhang 1,*, Qian Cong 2,*, Jinhui Shen 3, Nick V Grishin 4
PMCID: PMC8975183  NIHMSID: NIHMS1790355  PMID: 35370352

Abstract

Our expanded efforts in genomic sequencing to cover additional skipper butterfly (Lepidoptera: Hesperiidae) species and populations, including primary type specimens, call for taxonomic changes to restore monophyly and correct misidentifications by moving taxa between genera and proposing new names. Reconciliation between phenotypic characters and genomic trees suggests three new tribes, two new subtribes, 23 new genera, 17 new subgenera and 10 new species that are proposed here: Psolosini Grishin, new tribe (type genus Psolos Staudinger, 1889), Ismini Grishin, new tribe (type genus Isma Distant, 1886), Eetionini Grishin, new tribe (type genus Eetion de Nicéville, 1895), Orphina Grishin, new subtribe (type genus Orphe Godman, 1901), Carystoidina Grishin, new subtribe (type genus Carystoides Godman, 1901), Fulvatis Grishin, new genus (type species Telegonus fulvius Plötz, 1882), Adina Grishin, new genus (type species Nascus adrastor Mabille and Boullet, 1912), Ornilius Grishin, new genus (type species Ornilius rotundus Grishin, new species), Tolius Grishin, new genus (type species Antigonus tolimus Plötz, 1884), Lennia Grishin, new genus (type species Leona lena Evans, 1937), Trida Grishin, new genus (type species Cyclopides barberae Trimen, 1873), Noxys Grishin, new genus (type species Oxynthes viricuculla Hayward, 1951), Gracilata Grishin, new genus (type species Enosis quadrinotata Mabille, 1889), Hermio Grishin, new genus (type species Falga ? hermione Schaus, 1913), Eutus Grishin, new genus (type species Cobalus rastaca Schaus, 1902), Gufa Grishin, new genus (type species Phlebodes gulala Schaus, 1902), Godmia Grishin, new genus (type species Euroto chlorocephala Godman, 1900), Rhomba Grishin, new genus (type species Eutychide gertschi Bell, 1937), Rectava Grishin, new genus (type species Megistias ignarus Bell, 1932), Contrastia Grishin, new genus (type species Hesperia distigma Plötz, 1882), Mit Grishin, new genus (type species Mnasitheus badius Bell, 1930), Picova Grishin, new genus (type species Vorates steinbachi Bell, 1930), Lattus Grishin, new genus (type species Eutocus arabupuana Bell, 1932), Gubrus Grishin, new genus (type species Vehilius lugubris Lindsey, 1925), Koria Grishin, new genus (type species Hesperia kora Hewitson, 1877), Corta Grishin, new genus (type species Eutychide lycortas Godman, 1900), Calvetta Grishin, new genus (type species Hesperia calvina Hewitson, 1866), Oz Grishin, new genus (type species Astictopterus ozias Hewitson, 1878), Praxa Grishin, new subgenus (type species Nascus prax Evans, 1952), Bron Grishin, new subgenus (type species Papilio broteas Cramer, 1780), Turis Grishin, new subgenus (type species Pyrgus (Scelothrix) veturius Plötz, 1884), Tiges Grishin, new subgenus (type species Antigonus liborius Plötz, 1884), Ocrypta Grishin, new subgenus (type species Notocrypta caerulea Evans, 1928), Tixe Grishin, new subgenus (type species Cobalus quadrata Herrich-Schäffer, 1869), Nycea Grishin, new subgenus (type species Pamphila hycsos Mabille, 1891), Nausia Grishin, new subgenus (type species Oenus [sic] nausiphanes Schaus, 1913), Flor Grishin, new subgenus (type species Stomyles florus Godman, 1900), Geia Grishin, new subgenus (type species Pamphila geisa Möschler, 1879), Rotundia Grishin, new subgenus (type species Enosis schausi Mielke and Casagrande, 2002), Volus Grishin, new subgenus (type species Eutocus volasus Godman, 1901), Pseudopapias Grishin, new subgenus (type species Papias tristissimus Schaus, 1902), Septia Grishin, new subgenus (type species Justinia septa Evans, 1955), Brasta Grishin, new subgenus (type species Lychnuchus brasta Evans, 1955), Bina Grishin, new subgenus (type species Cobalus gabina Godman, 1900), Balma Grishin, new subgenus (type species Carystoides balza Evans, 1955), Ornilius rotundus Grishin, new species (type locality in Brazil: Santa Catarina), Salantoia metallica Grishin, new species (type locality in Guyana: Acarai Mts.), Dyscophellus australis Grishin, new species (type locality in Paraguay: Sapucay), Dyscophellus basialbus Grishin, new species (type locality in Brazil: Rondônia), Telegonus subflavus Grishin, new species (type locality in Ecuador: Riobamba), Decinea colombiana Grishin, new species (type locality in Colombia: Bogota), Lerema lucius Grishin, new species (type locality in Panama: Colón), Cynea rope Grishin, new species (type locality in Nicaragua: Chontales), Lerodea sonex Grishin, new species (type locality in Peru: Cuzco), and Metiscus goth Grishin, new species (type locality in Costa Rica). Lectotypes are designated for the following 17 taxa: Telegonus gildo Mabille, 1888, Netrocoryne damias Plötz, 1882, Telegonus erythras Mabille, 1888, Telegonus galesus Mabille, 1888, Eudamus cretellus Herrich-Schäffer, 1869, Leucochitonea chaeremon Mabille, 1891, Antigonus aura Plötz, 1884, Pamphila voranus Mabille, 1891, Hesperia pupillus Plötz, 1882, Cobalus lumina Herrich-Schäffer, 1869, Cobalus stigmula Mabille, 1891, Megistias isus Godman, 1900, Cobalopsis latonia Schaus, 1913, Pamphila nubila Mabille, 1891, Metiscus atheas Godman, 1900, Mnasalcas amatala Schaus, 1902, and Hesperia ina Plötz, 1882. The lectotype of Hesperia infuscata Plötz, 1882 is invalid because it does not agree with the original description and illustration by Plötz, is not from the locality listed in the original description, and therefore is not a syntype. Neotypes are designated for the following five taxa: Telegonus corentinus Plötz, 1882, Hesperia dido Plötz, 1882, Hesperia distigma Plötz, 1882, Hesperia infuscata Plötz, 1882, and Hesperia pruinosa Plötz, 1882. As a result, the following five taxa are junior objective synonyms: Telegonus diophorus Möschler, 1883 of Telegonus corentinus Plötz, 1882, Pamphila puxillius Mabille, 1891 of Hesperia pupillus Plötz, 1882, Cobalus stigmula Mabille, 1891 of Hesperia distigma Plötz, 1882, Mnasalcas amatala Schaus, 1902 of Hesperia infuscata Plötz, 1882, and Hesperia pruinosa Plötz, 1882 of Hesperia uza Hewitson, 1877. Morys valerius valda Evans, 1955 is fixed as the type species of Morys Godman, 1900, and Pamphila compta Butler, 1877 is reaffirmed as the type species of Euroto Godman, 1900. Furthermore, the following taxonomic changes are suggested. Prosopalpus Holland, 1896, Lepella Evans, 1937, and Creteus de Nicéville, 1895 are placed in Aeromachini Tutt, 1906. Triskelionia Larsen and Congdon, 2011 is transferred from Celaenorrhinini Swinhoe, 1912 to Tagiadini Mabille, 1878. Kobelana Larsen and Collins, 2013 is transferred from Tagiadini Mabille, 1878 to Celaenorrhinini Swinhoe, 1912. The following nine genus-group names are resurrected from synonymy and treated as valid genera: Abaratha Moore, 1881 (not in Caprona Wallengren, 1857), Bibla Mabille, 1904 (not in Taractrocera Butler, 1870), Kerana Distant, 1886 and Tamela Swinhoe, 1913 (not in Ancistroides Butler, 1874), Metrocles Godman, 1900 (not in Metron Godman, 1900), Alerema Hayward, 1942 (not in Tigasis Godman, 1900), Metiscus Godman, 1900 (not in Enosis Mabille, 1889), Vistigma Hayward, 1939 (not in Phlebodes Hübner, [1819]), and Mnasalcas Godman, 1900 (not in Mnasitheus Godman, 1900). The genus-group names Daimio Murray, 1875 and Pterygospidea Wallengren, 1857 are resurrected from synonymy and treated as valid subgenera of Tagiades Hübner, [1819]. We confirm Apallaga Strand, 1911 as a valid genus. The following 24 genera are placed as subgenera, new status: Pseudonascus Austin, 2008 of Nascus Watson, 1893; Albiphasma Huang, Chiba, Wang and Fan, 2016 of Pintara Evans, 1932; Ctenoptilum de Nicéville, 1890 of Tapena Moore, [1881]; Odontoptilum de Nicéville, 1890 of Abaratha Moore, 1881; Caprona Wallengren, 1857 of Abantis Hopffer, 1855; Timochreon Godman and Salvin, 1896 of Zopyrion Godman and Salvin, 1896; Pulchroptera Hou, Fan and Chiba, 2021 of Heteropterus Duméril, 1806; Stimula de Nicéville, 1898 of Koruthaialos Watson, 1893; Udaspes Moore, [1881] and Notocrypta de Nicéville, 1889 of Ancistroides Butler, 1874; Cravera de Jong, 1983 of Xeniades Godman, 1900; Cobaloides Hayward, 1939 of Oligoria Scudder, 1872; Saniba O. Mielke and Casagrande, 2003 of Psoralis Mabille, 1904; Quinta Evans, 1955 of Cynea Evans, 1955; Styriodes Schaus, 1913 and Remella Hemming, 1939 of Mnasicles Godman, 1901; Repens Evans, 1955 of Eprius Godman, 1901; Morys Godman, 1900 of Lerema Scudder, 1872; Enosis Mabille, 1889 of Lychnuchus Hübner, [1831]; Penicula Evans, 1955 of Vistigma Hayward, 1939; Mnasinous Godman, 1900 of Methionopsis Godman, 1901; and Moeros Evans, 1955, Argon Evans, 1955, and Synale Mabille, 1904 of Carystus Hübner, [1819]. The following 20 genera are treated as junior subjective synonyms: Leucochitonea Wallengren, 1857 of Abantis Hopffer, 1855; Sapaea Plötz, 1879 and Netrobalane Mabille, 1903 of Caprona Wallengren, 1857; Parasovia Devyatkin, 1996 of Sebastonyma Watson, 1893; Pemara Eliot, 1978 of Oerane Elwes and Edwards, 1897; Ankola Evans, 1937 of Pardaleodes Butler, 1870; Arotis Mabille, 1904 of Mnaseas Godman, 1901; Chalcone Evans, 1955, Hansa Evans, 1955, and Propertius Evans, 1955 of Metrocles Godman, 1900; Jongiana O. Mielke and Casagrande, 2002 of Cobaloides Hayward, 1939; Pamba Evans, 1955 of Psoralis Mabille, 1904; Brownus Grishin, 2019 of Styriodes Schaus, 1913; Mnasilus Godman, 1900 of Papias Godman, 1900; Sucova Evans, 1955 of Mnasitheus Godman, 1900; Pyrrhocalles Mabille, 1904 and Asbolis Mabille, 1904 of Choranthus Scudder, 1872; Miltomiges Mabille, 1903 of Methionopsis Godman, 1901; Sacrator Evans, 1955 of Thracides Hübner, [1819]; and Lychnuchoides Godman, 1901 of Perichares Scudder, 1872. Arunena Swinhoe, 1919 is a junior subjective synonym of Stimula de Nicéville, 1898 (not of Koruthaialos Watson, 1893). The following 27 names are species-level taxa (some in new combinations) reinstated from synonymy: Salantoia gildo (Mabille, 1888) (not Salatis cebrenus (Cramer, 1777)), Bungalotis corentinus (Plötz, 1882) (not Bungalotis midas (Cramer, 1775)), Telegonus cretellus (Herrich-Schäffer, 1869) (not Telegonus cassander (Fabricius, 1793)), Santa palica (Mabille, 1888) (not Chiothion asychis (Stoll, 1780)), Camptopleura cincta Mabille and Boullet, 1917 (not Camptopleura auxo (Möschler, 1879)), Camptopleura orsus (Mabille, 1889) (not Nisoniades mimas (Cramer, 1775)), Metron voranus (Mabille, 1891) and Metron fasciata (Möschler, 1877) (not Metron zimra (Hewitson, 1877)), Limochores catahorma (Dyar, 1916) (not Limochores pupillus (Plötz, 1882)), Pares viridiceps (Mabille, 1889) (not Thoon modius (Mabille, 1889)), Tigasis wellingi (Freeman, 1969) (not Tigasis arita (Schaus, 1902)), Rectava sobrinus (Schaus, 1902) (not Papias phainis Godman, 1900), Nastra subsordida (Mabille, 1891) (not Adlerodea asema (Mabille, 1891), previously in Eutychide Godman, 1900), Lerema pattenii Scudder, 1872 (not Lerema accius (J. E. Smith, 1797)), Lerema (Morys) ancus (Möschler, 1879) (not Cymaenes tripunctus theogenis (Capronnier, 1874)), Cobalopsis zetus (Bell, 1942) (not Cobalopsis nero (Herrich-Schäffer, 1869)), Lerema (Geia) etelka (Schaus, 1902) (not Lerema (Geia) geisa (Möschler, 1879), previously in Morys Godman, 1900), Cymaenes isus (Godman, 1900) (not Cymaenes trebius (Mabille, 1891)), Vehilius labdacus (Godman, 1900) (not Vehilius inca (Scudder, 1872)), Papias amyrna (Mabille, 1891) (not Papias allubita (Butler, 1877), previously in Mnasilus Godman, 1900), Papias integra (Mabille, 1891) (not Papias subcostulata (Herrich-Schäffer, 1870)), Metiscus atheas Godman, 1900 (not Hesperia achelous Plötz, 1882), Dion agassus (Mabille, 1891) (not Dion uza (Hewitson, 1877), previously in Enosis Mabille, 1889), Picova incompta (Hayward, 1942) (not Lerema (Morys) micythus (Godman, 1900), previously in Morys Godman, 1900), Lucida melitaea (Draudt, 1923) (not Lucida lucia (Capronnier, 1874)), Methionopsis modestus Godman, 1901 (not Methionopsis ina (Plötz, 1882)), and Thargella (Volus) volasus (Godman, 1901) (not Eutocus facilis (Plötz, 1884)). The following 57 taxa are elevated from subspecies to species, new status (some in new combinations): Dyscophellus doriscus (Hewitson, 1867) (not Dyscophellus porcius (C. Felder and R. Felder, 1862), Phocides vida (A. Butler, 1872) (not Phocides urania (Westwood, 1852)), Tagiades (Daimio) ceylonica Evans, 1932 (not Tagiades litigiosa Möschler, 1878), Tagiades (Daimio) tubulus Fruhstorfer, 1910 (not Tagiades sambavana Elwes and Edwards, 1897), Tagiades (Daimio) kina Evans, 1934, Tagiades (Daimio) sheba Evans, 1934, Tagiades (Daimio) martinus Plötz, 1884, Tagiades (Daimio) sem Mabille, 1883, and Tagiades (Daimio) neira Plötz, 1885 (not Tagiades trebellius (Hopffer, 1874)), Tagiades (Daimio) korela Mabille, 1891 and Tagiades (Daimio) presbyter Butler, 1882 (not Tagiades nestus (C. Felder, 1860)), Tagiades obscurus Mabille, 1876, Tagiades ravi (Moore, [1866]), Tagiades atticus (Fabricius, 1793), Tagiades titus Plötz, 1884, Tagiades janetta Butler, 1870, Tagiades inconspicua Rothschild, 1915, and Tagiades hovia Swinhoe, 1904 (not Tagiades japetus (Stoll, [1781])), Tagiades silvia Evans, 1934 and Tagiades elegans Mabille, 1877 (not Tagiades gana (Moore, [1866])), Tapena bornea Evans, 1941 and Tapena minuscula Elwes and Edwards, 1897 (not Tapena thwaitesi Moore, [1881]), Darpa dealbata (Distant, 1886) (not Darpa pteria (Hewitson, 1868)), Perus manx (Evans, 1953) (not Perus minor (Schaus, 1902)), Canesia pallida (Röber, 1925) (not Carrhenes canescens (R. Felder, 1869)), Carrhenes conia Evans, 1953 (not Carrhenes fuscescens (Mabille, 1891)), Anisochoria extincta Hayward, 1933 and Anisochoria polysticta Mabille, 1876 (not Anisochoria pedaliodina (Butler, 1870)), Anisochoria verda Evans, 1953 (not Anisochoria minorella Mabille, 1898), Bralus alco (Evans, 1953) (not Bralus albida (Mabille, 1888)), Ephyriades jamaicensis (Möschler, 1879) (not Ephyriades brunnea (Herrich-Schäffer, 1865)), Koruthaialos (Stimula) frena Evans, 1949 (not Koruthaialos focula (Plötz, 1882)), Euphyes kiowah (Reakirt, 1866) (not Euphyes vestris (Boisduval, 1852)), Mnaseas inca Bell, 1930 (not Mnaseas bicolor (Mabille, 1889)), Metron hypochlora (Draudt, 1923) (not Metrocles schrottkyi (Giacomelli, 1911), previously in Metron Godman, 1900), Decinea huasteca (H. Freeman, 1969), Decinea denta Evans, 1955, and Decinea antus (Mabille, 1895) (not Decinea decinea (Hewitson, 1876)), Xeniades pteras Godman, 1900 (not Xeniades chalestra (Hewitson, 1866)), Xeniades difficilis Draudt, 1923 (not Xeniades orchamus (Cramer, 1777)), Xeniades hermoda (Hewitson, 1870) (not Tisias quadrata (Herrich-Schäffer, 1869)), Hermio vina (Evans, 1955) (not Hermio hermione (Schaus, 1913), previously in Lento Evans, 1955), Cymaenes loxa Evans, 1955, (not Cymaenes laureolus (Schaus, 1913)), Niconiades peri (Evans, 1955) (not Rhinthon bajula (Schaus, 1902), previously in Neoxeniades Hayward, 1938), Gallio danius (Bell, 1941) (not Vehilius seriatus (Mabille, 1891)), Gallio massarus (E. Bell, 1940) (not Gallio garima (Schaus, 1902) previously in Tigasis Godman, 1900), Cymaenes edata (Plötz, 1882), Cymaenes miqua (Dyar, 1913) and Cymaenes aequatoria (Hayward, 1940) (not Cymaenes odilia (Burmeister, 1878)), Lychnuchus (Enosis) demon (Evans, 1955) (not Lychnuchus (Enosis) immaculata (Hewitson, 1868), previously in Enosis Mabille, 1889), Naevolus naevus Evans, 1955 (not Naevolus orius (Mabille, 1883)), Lucida scopas (Mabille, 1891), Lucida oebasus (Godman, 1900), and Lucida leopardus (Weeks, 1901) (not Lucida lucia (Capronnier, 1874)), Corticea schwarzi (E. Bell, 1941) and Corticea sylva (Hayward, 1942) (not Corticea mendica (Mabille, 1898)), and Choranthus orientis (Skinner, 1920) (not Choranthus antiqua (Herrich-Schäffer, 1863), previously in Pyrrhocalles Mabille, 1904). Borbo impar bipunctata (Elwes and J. Edwards, 1897) is a valid subspecies, not a synonym of Borbo impar tetragraphus (Mabille, 1891), here placed in synonymy with Lotongus calathus (Hewitson, 1876), new synonym. We confirm the species status of Telegonus cassius (Evans, 1952) and Lerema (Morys) valda Evans, 1955. Euphyes chamuli Freeman, 1969 is placed as a subspecies of Euphyes kiowah (Reakirt, 1866), new status. The following 41 taxa are junior subjective synonyms, either newly proposed or transferred from synonymy with other species or subspecies: Telegonus mutius Plötz, 1882 of Euriphellus phraxanor (Hewitson, 1876), Telegonus erythras Mabille, 1888 of Dyscophellus damias (Plötz, 1882), Aethilla jaira Butler, 1870 of Telegonus cretellus (Herrich-Schäffer, 1869), Paches era Evans, 1953 of Santa palica (Mabille, 1888), Antigonus alburnea Plötz, 1884 of Tolius tolimus robigus (Plötz, 1884) (not of Echelatus sempiternus simplicior (Möschler, 1877)), Echelatus depenicillus Strand, 1921 of E. sempiternus simplicior (not of T. tolimus robigus), Antigonus aura Plötz, 1884 of Theagenes dichrous (Mabille, 1878) (not of Helias phalaenoides palpalis (Latreille, [1824])), Achlyodes impressus Mabille, 1889 of Camptopleura orsus (Mabille, 1889), Augiades tania Schaus, 1902 of Metron voranus (Mabille, 1891), Pamphila verdanta Weeks, 1906 of Metron fasciata (Möschler, 1877), Niconiades viridis vista Evans, 1955 of Niconiades derisor (Mabille, 1891), Pamphila binaria Mabille, 1891 of Conga chydaea (A. Butler, 1877) (not of Cynea cynea (Hewitson, 1876)), Psoralis concolor Nicolay, 1980 of Ralis immaculatus (Hayward, 1940), Hesperia dido Plötz, 1882 of Cynea (Quinta) cannae (Herrich-Schäffer, 1869) (not of Lerema lochius (Plötz, 1882)), Proteides osembo Möschler, 1883 of Cynea (Cynea) diluta (Herrich-Schäffer, 1869) (not of Cynea (Quinta) cannae (Herrich-Schäffer, 1869)), Cobalopsis brema E. Bell, 1959 of Eutus rastaca (Schaus, 1902), Psoralis panamensis Anderson and Nakamura, 2019 of Rhomba gertschi (Bell, 1937), Cobalus asella Herrich-Schäffer, 1869 of Amblyscirtes alternata (Grote and Robinson, 1867) (not of Amblyscirtes vialis (W. H. Edwards, 1862)), Papias trimacula Nicolay, 1973 of Nastra subsordida (Mabille, 1891), Pamphila bipunctata Mabille, 1889 and Sarega staurus Mabille, 1904 of Lerema pattenii Scudder, 1872 (not of Cymaenes lumina (Herrich-Schäffer, 1869), previously in Lerema Scudder, 1872), Hesperia aethra Plötz, 1886 of Lerema lineosa (Herrich-Schäffer, 1865) (not of Lerema (Morys) compta Butler, 1877), Megistias miaba Schaus, 1902 of Cobalopsis valerius (Möschler, 1879), Phanis sylvia Kaye, 1914 of Lerema etelka (Schaus, 1902) (not of Lerema (Geia) geisa (Möschler, 1879), previously in Morys Godman, 1900), Carystus odilia Burmeister, 1878, Pamphila trebius Mabille, 1891 and Megistias corescene Schaus, 1902 of Cymaenes lumina (Herrich-Schäffer, 1869), Hesperia phocylides Plötz, 1882 of Cymaenes edata (Plötz, 1882) (not of Lerema accius (J. E. Smith, 1797)), Pamphila xenos Mabille, 1898 of Vehilius inca (Scudder, 1872), Mnasilus guianae Lindsey, 1925 of Papias amyrna (Mabille, 1891), Pamphila nubila Mabille, 1891 of Papias integra (Mabille, 1891) (not of Cynea corisana (Plötz, 1882)), Enosis matheri H. Freeman, 1969 of Metiscus atheas Godman, 1900 (previously in Enosis Mabille, 1889), Hesperia infuscata Plötz, 1882 of Mnaseas derasa derasa (Herrich-Schäffer, 1870) (previously Arotis Mabille, 1904), (not of Papias subcostulata (Herrich-Schäffer, 1870)), Pamphila astur Mabille, 1891 of Metiscus angularis (Möschler, 1877) (not of Cymaenes tripunctus theogenis (Capronnier, 1874)), Anthoptus macalpinei H. Freeman, 1969 of Anthoptus inculta (Dyar, 1918), Methionopsis typhon Godman, 1901 of Methionopsis ina (Plötz, 1882), Methionopsis dolor Evans, 1955 of Thargella volasus (Godman, 1901), Hesperia cinica Plötz, 1882 of Dubiella dubius (Stoll, 1781), Cobalus disjuncta Herrich-Schäffer, 1869 of Dubiella dubius (Stoll, 1781) (not of Vettius lafrenaye (Latreille, [1824])), and Saliana vixen Evans, 1955 of Neoxeniades parna (Evans, 1955). The following are new and revised genus-species combinations: Euriphellus cebrenus (Cramer, 1777) (not Salatis Evans, 1952), Gorgopas extensa (Mabille, 1891) (not Polyctor Evans, 1953), Clytius shola (Evans, 1953) (not Staphylus Godman and Salvin, 1896), Perus narycus (Mabille, 1889) (not Ouleus Lindsey, 1925), Perus parvus (Steinhauser and Austin, 1993) (not Staphylus Godman and Salvin, 1896), Pholisora litus (Dyar, 1912) (not Bolla Mabille, 1903), Carrhenes decens (A. Butler, 1874) (not Antigonus Hübner, [1819]), Santa palica (Mabille, 1888) (not Chiothion Grishin, 2019), Bralus nadia (Nicolay, 1980) (not Anisochoria Mabille, 1876), Acerbas sarala (de Nicéville, 1889) (not Lotongus Distant, 1886), Caenides sophia (Evans, 1937) (not Hypoleucis Mabille, 1891), Hypoleucis dacena (Hewitson, 1876) (not Caenides Holland, 1896), Dotta tura (Evans, 1951) (not Astictopterus C. Felder and R. Felder, 1860), Nervia wallengrenii (Trimen, 1883) (not Kedestes Watson, 1893), Testia mammaea (Hewitson, 1876) (not Decinea Evans, 1955), Oxynthes trinka (Evans, 1955) (not Orthos Evans, 1955), Metrocles argentea (Weeks, 1901) (not Paratrytone Godman, 1900), Metrocles scitula (Hayward, 1951) (not Mucia Godman, 1900), Metrocles schrottkyi (Giacomelli, 1911) (not Metron Godman, 1900), Niconiades derisor (Mabille, 1891) (not Decinea Evans, 1955), Paratrytone samenta (Dyar, 1914) (not Ochlodes Scudder, 1872), Oligoria (Cobaloides) locutia (Hewitson, 1876) (not Quinta Evans, 1955), Psoralis (Saniba) laska (Evans, 1955) (not Vidius Evans, 1955), Psoralis (Saniba) arva (Evans, 1955) and Psoralis (Saniba) umbrata (Erschoff, 1876) (not Vettius Godman, 1901), Psoralis (Saniba) calcarea (Schaus, 1902) and Psoralis (Saniba) visendus (E. Bell, 1942) (not Molo Godman, 1900), Alychna gota (Evans, 1955) (not Psoralis Mabille, 1904), Adlerodea asema (Mabille, 1891) and Adlerodea subpunctata (Hayward, 1940) (not Eutychide Godman, 1900), Ralis immaculatus (Hayward, 1940) (not Mucia Godman, 1900), Rhinthon braesia (Hewitson, 1867) and Rhinthon bajula (Schaus, 1902) (not Neoxeniades Hayward, 1938), Cymaenes lochius Plötz, 1882 (not Lerema Scudder, 1872), Paracarystus ranka (Evans, 1955) (not Thoon Godman, 1900), Tricrista aethus (Hayward, 1951), Tricrista canta (Evans, 1955), Tricrista slopa (Evans, 1955), Tricrista circellata (Plötz, 1882), and Tricrista taxes (Godman, 1900) (not Thoon Godman, 1900), Gallio madius (E. Bell, 1941) and Gallio seriatus (Mabille, 1891) (not Vehilius Godman, 1900), Gallio garima (Schaus, 1902) (not Tigasis Godman, 1900), Tigasis corope (Herrich-Schäffer, 1869) (not Cynea Evans, 1955), Tigasis perloides (Plötz, 1882) (not Cymaenes Scudder, 1872), Amblyscirtes (Flor) florus (Godman, 1900) (not Repens Evans, 1955), Vidius fraus (Godman, 1900) (not Cymaenes Scudder, 1872), Nastra celeus (Mabille, 1891) (not Vehilius Godman, 1900), Nastra nappa (Evans, 1955) (not Vidius Evans, 1955), Vehilius warreni (Weeks, 1901) and Vehilius limae (Lindsey, 1925) (not Cymaenes Scudder, 1872), Cymaenes lumina (Herrich-Schäffer, 1869) (not Lerema Scudder, 1872), Cobalopsis valerius (Möschler, 1879) (not Cobalopsis Godman, 1900), Cobalopsis dictys (Godman, 1900) (not Papias Godman, 1900), Lerema (Morys) venias (Bell, 1942) (not Cobalopsis Godman, 1900), Papias latonia (Schaus, 1913) (not Cobalopsis Godman, 1900), Dion iccius (Evans, 1955) and Dion uza (Hewitson, 1877) (not Enosis Mabille, 1889), Vistigma (Vistigma) opus (Steinhauser, 2008) (not Thoon Godman, 1900), Saturnus fartuga (Schaus, 1902) (not Parphorus Godman, 1900), Phlebodes fuldai (E. Bell, 1930) (not Vettius Godman, 1901), Mnasitheus padus (Evans, 1955) (not Moeris Godman, 1900), Naevolus brunnescens (Hayward, 1939) (not Psoralis Mabille, 1904), Lamponia ploetzii (Capronnier, 1874) (not Vettius Godman, 1901), Mnestheus silvaticus Hayward, 1940 (not Ludens Evans, 1955), Rigga spangla (Evans, 1955) (not Sodalia Evans, 1955), Corticea vicinus (Plötz, 1884) (not Lento Evans, 1955), Mnasalcas thymoetes (Hayward, 1942) (not Mnasicles Godman, 1901), Mnasalcas boyaca (Nicolay, 1973) (not Pamba Evans, 1955), Vertica brasta (Evans, 1955) (not Lychnuchus Hübner, [1831]), Carystina discors Plötz, 1882 (not Cobalus Hübner, [1819]), Zetka irena (Evans, 1955) (not Neoxeniades Hayward, 1938), and Neoxeniades parna (Evans, 1955) (not Niconiades Hübner, [1821]). The following are new or revised species-subspecies combinations: Tagiades neira moti Evans, 1934, Tagiades neira canonicus Fruhstorfer, 1910, Tagiades sheba vella Evans, 1934, Tagiades sheba lola Evans, 1945, Tagiades korela biakana Evans, 1934, Tagiades korela mefora Evans, 1934, Tagiades korela suffusus Rothschild, 1915, Tagiades korela brunta Evans, 1949, Tagiades ravi ravina Fruhstorfer, 1910, Tagiades atticus carnica Evans, 1934, Tagiades atticus nankowra Evans, 1934, Tagiades atticus helferi C. Felder, 1862, Tagiades atticus balana Fruhstorfer, 1910, Tagiades inconspicua mathias Evans, 1934, Tagiades hovia kazana Evans, 1934, Tagiades elegans fuscata de Jong and Treadaway, 2007, Tagiades elegans semperi Fruhstorfer, 1910, Metron hypochlora tomba Evans, 1955, Decinea denta pruda Evans, 1955, and Choranthus orientis eleutherae (Bates, 1934) (previously in Pyrrhocalles Mabille, 1904). In addition to the abovementioned changes, the following new combinations involve newly proposed genus group names: Fulvatis fulvius (Plötz, 1882) and Fulvatis scyrus (E. Bell, 1934) (not Salatis Evans, 1952); Adina adrastor (Mabille and Boullet, 1912) (not Bungalotis Watson, 1893); Nascus (Praxa) prax Evans, 1952, Nascus (Bron) broteas (Cramer, 1780), and Nascus (Bron) solon (Plötz, 1882) (not Pseudonascus Austin, 2008); Chirgus (Turis) veturius (Plötz, 1884); Paches (Tiges) liborius (Plötz, 1884), and Paches (Tiges) mutilatus (Hopffer, 1874) (not Antigonus Hübner, [1819]); Paches (Tiges) exosa (A. Butler, 1877); Tolius tolimus (Plötz, 1884) and Tolius luctuosus (Godman & Salvin, 1894) (not Echelatus Godman and Salvin, 1894); Ancistroides (Ocrypta) caerulea (Evans, 1928), Ancistroides (Ocrypta) renardi (Oberthür, 1878), Ancistroides (Ocrypta) waigensis (Plötz, 1882), Ancistroides (Ocrypta) aluensis (Swinhoe, 1907), Ancistroides (Ocrypta) flavipes (Janson, 1886), and Ancistroides (Ocrypta) maria (Evans, 1949) (not Notocrypta de Nicéville, 1889); Lennia lena (Evans, 1937), Lennia binoevatus (Mabille, 1891), Lennia maracanda (Hewitson, 1876), and Lennia lota (Evans, 1937) (not Leona Evans, 1937); Trida barberae (Trimen, 1873) and Trida sarahae (Henning and Henning, 1998) (not Kedestes Watson, 1893); Noxys viricuculla (Hayward, 1951) (not Oxynthes Godman, 1900); Xeniades (Tixe) quadrata (Herrich-Schäffer, 1869), Xeniades (Tixe) rinda (Evans, 1955), Xeniades (Tixe) putumayo (Constantino and Salazar, 2013) (not Tisias Godman, 1901); Gracilata quadrinotata (Mabille, 1889) (not Styriodes Schaus, 1913); Hermio hermione (Schaus, 1913) (not Lento Evans, 1955); Cynea (Nycea) hycsos (Mabille, 1891), Cynea (Nycea) corisana (Plötz, 1882), Cynea (Nycea) popla Evans, 1955, Cynea (Nycea) iquita (E. Bell, 1941), Cynea (Nycea) robba Evans, 1955, Cynea (Nycea) melius (Geyer, 1832), and Cynea (Nycea) irma (Möschler, 1879); Eutus rastaca (Schaus, 1902) (not Eutychide Godman, 1900); Eutus yesta (Evans, 1955) (not Thoon Godman, 1900); Eutus mubevensis (E. Bell, 1932) (not Tigasis Godman, 1900); Gufa gulala (Schaus, 1902) (not Mucia Godman, 1900); Gufa fusca (Hayward, 1940) (not Tigasis Godman, 1900); Godmia chlorocephala (Godman, 1900) (not Onophas Godman, 1900); Rhomba gertschi (E. Bell, 1937) (not Justinia Evans, 1955); Mnasicles (Nausia) nausiphanes (Schaus, 1913) (not Tigasis Godman, 1900); Amblyscirtes (Flor) florus (Godman, 1900) (not Repens Evans, 1955); Rectava ignarus (E. Bell, 1932) (not Papias Godman, 1900); Rectava vorgia (Schaus, 1902) (not Cobalopsis Godman, 1900); Rectava nostra (Evans, 1955) (not not Vidius Evans, 1955); Lerema (Geia) geisa (Möschler, 1879) and Lerema (Geia) lyde (Godman, 1900) (not Morys Godman, 1900); Contrastia distigma (Plötz, 1882) (not Cymaenes Scudder, 1872); Mit (Mit) badius (E. Bell, 1930) (not Styriodes Schaus, 1913); Mit (Mit) gemignanii (Hayward, 1940), (not Mnasitheus Godman, 1900); Mit (Rotundia) schausi (Mielke and Casagrande, 2002), (not Enosis Mabille, 1889); Picova steinbachi (E. Bell, 1930) (not Saturnus Evans, 1955); Lattus arabupuana (E. Bell, 1932) (not Eutocus Godman, 1901); Gubrus lugubris (Lindsey, 1925) (not Vehilius Godman, 1900); Thargella (Pseudopapias) tristissimus (Schaus, 1902) (not Papias Godman, 1900); Koria kora (Hewitson, 1877) (not Justinia Evans, 1955); Justinia (Septia) septa Evans, 1955; Corta lycortas (Godman, 1900) (not Orthos Evans, 1955); Vertica (Brasta) brasta (Evans, 1955) (not Lychnuchus Hübner, [1831]); Calvetta calvina (Hewitson, 1866) (not Cobalus Hübner, [1819]); Neoxeniades (Bina) gabina (Godman, 1900) (not Orthos Evans, 1955); Oz ozias (Hewitson, 1878) and Oz sebastiani Salazar and Constantino, 2013 (not Lychnuchoides Godman, 1901); and Carystoides (Balma) balza Evans, 1955 and Carystoides (Balma) maroma (Möschler, 1877). Finally, unless stated otherwise, all subgenera, species, subspecies and synonyms of mentioned genera and species are transferred together with their parent taxa, and taxa not mentioned in this work remain as previously classified.

Keywords: Genomics, museomics, higher classification, taxonomy, biodiversity, phylogeny

Introduction

The skipper butterflies (Hesperiidae) are unusual due to their moth-like appearance caused by robust bodies (Watson 1893), fast wing beats and frequently dark colors and simple wing patterns. A number of Hesperiidae are crepuscular and could be attracted to light (Austin 2008). Nevertheless, DNA-based phylogenies suggest that they originated within the butterfly radiation, and it is the swallowtails (Papilionidae) not the skippers, which are a sister taxon to all other butterflies (Wahlberg et al. 2005; Kawahara and Breinholt 2014; Espeland et al. 2018; Kawahara et al. 2019).

Distributed worldwide, Hesperiidae diversified into more than 3500 described species, a number that may double with time, considering how recent work increases the known species richness of genera being revised (Austin and Mielke 1998; Henao et al. 2015; Medeiros et al. 2019; Siewert et al. 2020). Generally, Hesperiidae attracted less attention compared to other butterfly families. As of today, the latest comprehensive taxonomic account of worldwide fauna remains that of Evans, who developed identification keys to all known Hesperiidae species in six volumes (Evans 1937, 1949, 1951, 1952, 1953, 1955). Revision of Evans’ classification was stimulated by DNA sequencing and phylogenetic analysis. The pioneering work of Warren et al. (2008, 2009) put the higher classification of Hesperiidae on solid footing with revolutionary methodology to combine DNA sequences of several genes with traditionally scored morphological characters. A number of subsequent studies used many more genes in their analyses, ranging from dozens to hundreds (Sahoo et al. 2016, 2017; Toussaint et al. 2018). Then, genome-scale revisionary and phylogenetic work has followed (Cong et al. 2019b; Li et al. 2019; Zhang et al. 2019b,c; Toussaint et al. 2021a,b).

Genomic analyses reveal phylogenetic relationships that were either missed or not apparent from the perspective of morphology. Nevertheless, phenotypic characters can be retrospectively understood in the light of genomic phylogenies, thus yielding internally consistent classification guided largely by the analysis of genome-scale phylogenetic trees (Li et al. 2019; Zhang et al. 2019c). Recently, we carried out genomic sequencing of representative Hesperiidae species from all known genera (Cong et al. 2019b). Then, we expanded this work to cover nearly all Neotropical and a large number of Old World species. As in our previous study, we found a number of issues with placing species into genera and species misidentifications, and detected that some genera and tribes were not monophyletic. While the comprehensive phylogenetic analysis of Hesperiidae phylogenetic analysis based on genomic data and a more detailed revision of the family will be presented elsewhere, we take this opportunity to correct a large number of small classification errors and inconsistencies. Among other changes, 55 new taxa of Hesperiidae are proposed: three tribes, two subtribes, 23 genera, 17 subgenera, and ten species, supported by genome-scale phylogenetic trees combined with morphological considerations. The changes we propose are summarized in Table 1.

Table 1.

Tabular abstract of the proposed taxonomic changes, grouped by category. Abbreviations: jss., junior subjective synonym; jos., junior objective synonym.

Proposed name, combination or status Previously used attribution
new tribe (trib. n.)
Psolosini Grishin, trib. n. in Erionotini Distant, 1886 or in Incertae sedis
Ismini Grishin, trib. n. in Erionotini Distant, 1886 or in Incertae sedis
Eetionini Grishin, trib. n. in Erionotini Distant, 1886 or in Incertae sedis
new subtribe (subtr. n.)
Orphina Grishin, subtr. n. in Pericharini Grishin, 2019
Carystoidina Grishin, subtr. n. in Calpodina Clark, 1948 or in Carystina Mabille, 1878
new genus (gen. n.)
Fulvatis Grishin, gen. n. in Salatis Evans, 1952
Adina Grishin, gen. n. in Bungalotis midas (Cramer, 1775)
Ornilius Grishin, gen. n. “Salatis cebrenus” of Evans (1952), misidentification
Tolius Grishin, gen. n. in Echelatus Godman and Salvin, 1894
Lennia Grishin, gen. n. in Leona Evans, 1937
Trida Grishin, gen. n. in Kedestes Watson, 1893
Noxys Grishin, gen. n. in Oxynthes Godman, 1900
Gracilata Grishin, gen. n. in Styriodes Schaus, 1913
Hermio Grishin, gen. n. in Lento Evans, 1955
Eutus Grishin, gen. n. in Eutychide Godman, 1900, Thoon Godman, 1900 and Tigasis Godman, 1900
Gufa Grishin, gen. n. in Mucia Godman, 1900 and Tigasis Godman, 1900
Godmia Grishin, gen. n. in Onophas Godman, 1900
Rhomba Grishin, gen. n. in Justinia Evans, 1955
Rectava Grishin, gen. n. in Papias Godman, 1900, Cobalopsis Godman, 1900 and Vidius Evans, 1955
Contrastia Grishin, gen. n. in Cymaenes Scudder, 1872
Mit Grishin, gen. n. in Styriodes Schaus, 1913, Mnasitheus Godman, 1900 and Enosis Mabille, 1889
Picova Grishin, gen. n. in Saturnus Evans, 1955 and Morys Godman, 1900
Lattus Grishin, gen. n. in Eutocus Godman, 1901
Gubrus Grishin, gen. n. in Vehilius Godman, 1900
Koria Grishin, gen. n. in Justinia Evans, 1955
Corta Grishin, gen. n. in Orthos Evans, 1955
Calvetta Grishin, gen. n. in Cobalus Hübner, [1819]
Oz Grishin, gen. n. in Lychnuchoides Godman, 1901
new subgenus (subgen. n.)
Praxa Grishin, subgen. n. in Pseudonascus Austin, 2008
Bron Grishin, subgen. n. in Pseudonascus Austin, 2008
Turis Grishin, subgen. n. in Chirgus Grishin, 2019
Tiges Grishin, subgen. n. in Antigonus Hübner, [1819]
Ocrypta Grishin, subgen. n. in Notocrypta de Nicéville, 1889
Tixe Grishin, subgen. n. in Tisias Godman, 1901
Nycea Grishin, subgen. n. in Cynea Evans, 1955
Nausia Grishin, subgen. n. in Tigasis Godman, 1900
Flor Grishin, subgen. n. in Repens Evans, 1955
Geia Grishin, subgen. n. in Morys Godman, 1900
Rotundia Grishin, subgen. n. in Enosis Mabille, 1889
Volus Grishin, subgen. n. in Eutocus Godman, 1901
Pseudopapias Grishin, subgen. n. in Papias Godman, 1900
Septia Grishin, subgen. n. in Justinia Evans, 1955
Brasta Grishin, subgen. n. in Lychnuchus Hübner, [1831]
Bina Grishin, subgen. n. in Orthos Evans, 1955
Balma Grishin, subgen. n. in Carystoides Godman, 1901
new species (sp. n.)
Ornilius rotundus Grishin, sp. n. “Salatis cebrenus” of Evans (1952), misidentification
Salantoia metallica Grishin, sp. n. misidentified as Porphyrogenes sp.
Dyscophellus australis Grishin, sp. n. Dyscophellus “ramusis damias” of Evans (1952), misidentification
Dyscophellus basialbus Grishin, sp. n. Dyscophellus “diaphorus” of Evans (1952), misidentification
Telegonus subflavus Grishin, sp. n. infrasubspecific name Telegonus galesus form subflavus R. Williams, 1927 placed under Telegonus galesus Mabille, 1888
Decinea colombiana Grishin, sp. n. Decinea “decinea derisor” of Evans (1955), misidentification
Lerema (Lerema) lucius Grishin, sp. n. Lerema “lochius” of Evans (1955), misidentification
Cynea (Nycea) rope Grishin, sp. n. Cynea “corope” of Evans (1955), in part, misidentification
Lerodea sonex Grishin, sp. n. Lerodea “xenos” of Evans (1955), misidentification
Metiscus goth Grishin, sp. n. “Enosis angularis infuscata” of Evans (1955), misidentification
revised combinations involving new genera and subgenera (some with status change, as indicated)
Fulvatis fulvius (Plötz, 1882) Salatis fulvius (Plötz, 1882)
Fulvatis scyrus (E. Bell, 1934) Salatis scyrus (E. Bell, 1934)
Adina adrastor (Mabille and Boullet, 1912) jss. of Bungalotis midas (Cramer, 1775)
Nascus (Praxa) prax Evans, 1952 Pseudonascus prax (Evans, 1952)
Nascus (Bron) broteas (Cramer, 1780) Pseudonascus broteas (Cramer, 1780)
Nascus (Bron) solon (Plötz, 1882) Pseudonascus solon (Plötz, 1882)
Chirgus (Turis) veturius (Plötz, 1884) Chirgus veturius (Plötz, 1884)
Paches (Tiges) liborius (Plötz, 1884) Antigonus liborius Plötz, 1884
Paches (Tiges) mutilatus (Hopffer, 1874) Antigonus mutilatus (Hopffer, 1874)
Paches (Tiges) exosa (A. Butler, 1877) Paches exosa (A. Butler, 1877)
Tolius tolimus (Plötz, 1884) Echelatus tolimus (Plötz, 1884)
Tolius luctuosus (Godman and Salvin, 1894) Echelatus luctuosus Godman and Salvin, 1894
Ancistroides (Ocrypta) caerulea (Evans, 1928) Notocrypta caerulea Evans, 1928
Ancistroides (Ocrypta) renardi (Oberthür, 1878) Notocrypta renardi (Oberthür, 1878)
Ancistroides (Ocrypta) waigensis (Plötz, 1882) Notocrypta waigensis (Plötz, 1882)
Ancistroides (Ocrypta) aluensis (Swinhoe, 1907) Notocrypta aluensis Swinhoe, 1907
Ancistroides (Ocrypta) flavipes (Janson, 1886) Notocrypta flavipes (Janson, 1886)
Ancistroides (Ocrypta) maria (Evans, 1949) Notocrypta maria Evans, 1949
Lennia lena (Evans, 1937) Leona lena Evans, 1937
Lennia binoevatus (Mabille, 1891) Leona binoevatus (Mabille, 1891)
Lennia maracanda (Hewitson, 1876) Leona maracanda (Hewitson, 1876)
Lennia lota (Evans, 1937) Leona lota Evans, 1937
Trida barberae (Trimen, 1873) Kedestes barberae (Trimen, 1873)
Trida sarahae (Henning and Henning, 1998) Kedestes sarahae Henning and Henning, 1998
Noxys viricuculla (Hayward, 1951) Oxynthes viricuculla Hayward, 1951
Xeniades (Tixe) quadrata (Herrich-Schäffer, 1869) Tisias quadrata (Herrich-Schäffer, 1869)
Xeniades (Tixe) rinda (Evans, 1955) Tisias rinda Evans, 1955
Xeniades (Tixe) putumayo (Constantino and Salazar, 2013) Tisias putumayo Constantino and Salazar, 2013
Gracilata quadrinotata (Mabille, 1889) Styriodes quadrinotata (Mabille, 1889)
Hermio hermione (Schaus, 1913) Lento hermione (Schaus, 1913)
Hermio vina (Evans, 1955), stat. nov. Lento hermione vina Evans, 1955
Cynea (Nycea) hycsos (Mabille, 1891) Cynea hycsos (Mabille, 1891)
Cynea (Nycea) corisana (Plötz, 1882) Cynea corisana (Plötz, 1882)
Cynea (Nycea) popla Evans, 1955 Cynea popla Evans, 1955
Cynea (Nycea) iquita (E. Bell, 1941) Cynea iquita (E. Bell, 1941)
Cynea (Nycea) robba Evans, 1955 Cynea robba Evans, 1955
Cynea (Nycea) melius (Geyer, 1832) Cynea melius (Geyer, 1832)
Cynea (Nycea) irma (Möschler, 1879) Cynea irma (Möschler, 1879)
Eutus rastaca (Schaus, 1902) Eutychide rastaca (Schaus, 1902)
Eutus yesta (Evans, 1955) Thoon yesta Evans, 1955
Eutus mubevensis (E. Bell, 1932) Tigasis mubevensis (E. Bell, 1932)
Gufa gulala (Schaus, 1902) Mucia gulala (Schaus, 1902)
Gufa fusca (Hayward, 1940) Tigasis fusca (Hayward, 1940)
Godmia chlorocephala (Godman, 1900) Onophas chlorocephala (Godman, 1900)
Rhomba gertschi (E. Bell, 1937) Justinia gertschi (E. Bell, 1937)
Mnasicles (Nausia) nausiphanes (Schaus, 1913) Tigasis nausiphanes (Schaus, 1913)
Amblyscirtes (Flor) florus (Godman, 1900) Repens florus (Godman, 1900)
Rectava ignarus (E. Bell, 1932) Papias ignarus (E. Bell, 1932)
Rectava vorgia (Schaus, 1902) Cobalopsis vorgia (Schaus, 1902)
Rectava nostra (Evans, 1955) Vidius nostra Evans, 1955
Rectava sobrinus (Schaus, 1902), stat. rest. jss. of Papias phainis Godman, 1900
Lerema (Geia) geisa (Möschler, 1879) Morys geisa (Möschler, 1879)
Lerema (Geia) lyde (Godman, 1900) Morys lyde (Godman, 1900)
Lerema (Geia) etelka (Schaus, 1902), stat. rest. jss. of Morys geisa (Möschler, 1879)
Contrastia distigma (Plötz, 1882) Cymaenes distigma (Plötz, 1882)
Mit (Mit) badius (E. Bell, 1930) Styriodes badius (E. Bell, 1930)
Mit (Mit) gemignanii (Hayward, 1940) Mnasitheus gemignanii (Hayward, 1940)
Mit (Rotundia) schausi (Mielke and Casagrande, 2002) Enosis schausi Mielke and Casagrande, 2002
Picova steinbachi (E. Bell, 1930) Saturnus steinbachi (E. Bell, 1930)
Picova incompta (Hayward, 1942), stat. rest. jss. of Morys micythus (Godman, 1900)
Lattus arabupuana (E. Bell, 1932) Eutocus arabupuana E. Bell, 1932
Gubrus lugubris (Lindsey, 1925) Vehilius lugubris Lindsey, 1925
Thargella (Volus) volasus (Godman, 1901), stat. rest. jss. of Eutocus facilis (Plötz, 1884)
Thargella (Pseudopapias) tristissimus (Schaus, 1902) Papias tristissimus Schaus, 1902
Koria kora (Hewitson, 1877) Justinia kora (Hewitson, 1877)
Justinia (Septia) septa Evans, 1955 Justinia septa Evans, 1955
Corta lycortas (Godman, 1900) Orthos lycortas (Godman, 1900)
Vertica (Brasta) brasta (Evans, 1955) Lychnuchus brasta Evans, 1955
Calvetta calvina (Hewitson, 1866) Cobalus calvina (Hewitson, 1866)
Neoxeniades (Bina) gabina (Godman, 1900) Orthos gabina (Godman, 1900)
Oz ozias (Hewitson, 1878) Lychnuchoides ozias (Hewitson, 1878)
Oz sebastiani (Salazar and Constantino, 2013) Lychnuchoides sebastiani Salazar and Constantino, 2013
Carystoides (Balma) balza Evans, 1955 Carystoides balza Evans, 1955
Carystoides (Balma) maroma (Möschler, 1877) Carystoides maroma (Möschler, 1877)
junior objective synonyms (jos.) of valid species or junior subjective synonyms (jss.)
jos. of Bungalotis corentinus (Plötz, 1882) Bungalotis diophorus (Möschler, 1883)
jos. of Limochores pupillus (Plötz, 1882) Limochores puxillius (Mabille, 1891)
jos. of Contrastia distigma (Plötz, 1882) jss. Cobalus stigmula Mabille, 1891 of Cymaenes distigma (Plötz, 1882)
jos. of jss. Hesperia infuscata Plötz, 1882 jss. Mnasalcas amatala Schaus, 1902 of Arotis derasa derasa (Herrich- Schäffer, 1870)
jos. of Dion uza (Hewitson, 1877) Enosis uza pruinosa (Plötz, 1882)
genera placed in or transferred between tribes
placed in Aeromachini Tutt, 1906 Prosopalpus Holland, 1896 in Incertae sedis
placed in Aeromachini Tutt, 1906 Lepella Evans, 1937 in Incertae sedis
placed in Aeromachini Tutt, 1906 Creteus de Nicéville, 1895 in Incertae sedis
transferred to Tagiadini Mabille, 1878 Triskelionia Larsen and Congdon, 2011 in Celaenorrhinini Swinhoe, 1912
transferred to Celaenorrhinini Swinhoe, 1912 Kobelana Larsen and Collins, 2013 in Tagiadini Mabille, 1878
valid genus (gen.) from junior subjective synonym (jss.)
gen. Abaratha Moore, 1881 jss. of Caprona Wallengren, 1857
gen. Bibla Mabille, 1904 jss. of Taractrocera Butler, 1870
gen. Kerana Distant, 1886 jss. of Ancistroides Butler, 1874
gen. Tamela Swinhoe, 1913 jss. of Ancistroides Butler, 1874
gen. Metrocles Godman, 1900 jss. of Metron Godman, 1900
gen. Alerema Hayward, 1942 jss. of Tigasis Godman, 1900
gen. Metiscus Godman, 1900 jss. of Enosis Mabille, 1889
gen. Vistigma Hayward, 1939 jss. of Phlebodes Hübner, [1819]
gen. Mnasalcas Godman, 1900 jss. of Mnasitheus Godman, 1900
valid subgenus (subgen.) from junior subjective synonym (jss.)
subgen. Daimio Murray, 1875 jss. of Tagiades Hübner, [1819]
subgen. Pterygospidea Wallengren, 1857 jss. of Tagiades Hübner, [1819]
valid subgenus (subgen.) from valid genus (gen.)
subgen. of Nascus Watson, 1893 gen. Pseudonascus Austin, 2008
subgen. of Pintara Evans, 1932 gen. Albiphasma Huang, Chiba, Wang and Fan, 2016
subgen. of Tapena Moore, [1881] gen. Ctenoptilum de Nicéville, 1890
subgen. of Abaratha Moore, 1881 gen. Odontoptilum de Nicéville, 1890
subgen. of Abantis Hopffer, 1855 gen. Caprona Wallengren, 1857
subgen. of Zopyrion Godman and Salvin, 1896 gen. Timochreon Godman and Salvin, 1896
subgen. of Heteropterus Duméril, 1806 gen. Pulchroptera Hou, Fan and Chiba, 2021
subgen. of Koruthaialos Watson, 1893 gen. Stimula de Nicéville, 1898
subgen. of Ancistroides Butler, 1874 gen. Udaspes Moore, [1881]
subgen. of Ancistroides Butler, 1874 gen. Notocrypta de Nicéville, 1889
subgen. of Xeniades Godman, 1900 gen. Cravera de Jong, 1983
subgen. of Oligoria Scudder, 1872 gen. Cobaloides Hayward, 1939
subgen. of Psoralis Mabille, 1904 gen. Saniba O. Mielke and Casagrande, 2003
subgen. of Cynea Evans, 1955 gen. Quinta Evans, 1955
subgen. of Mnasicles Godman, 1901 gen. Styriodes Schaus, 1913
subgen. of Mnasicles Godman, 1901 gen. Remella Hemming, 1939
subgen. of Eprius Godman, 1901 gen. Repens Evans, 1955
subgen. of Lerema Scudder, 1872 gen. Morys Godman, 1900
subgen. of Lychnuchus Hübner, [1831] gen. Enosis Mabille, 1889
subgen. of Vistigma Hayward, 1939 gen. Penicula Evans, 1955
subgen. of Methionopsis Godman, 1901 gen. Mnasinous Godman, 1900
subgen. of Carystus Hübner, [1819] gen. Moeros Evans, 1955
subgen. of Carystus Hübner, [1819] gen. Argon Evans, 1955
subgen. of Carystus Hübner, [1819] gen. Synale Mabille, 1904
junior subjective synonym (jss.) from valid genus (gen.)
jss. of Abantis Hopffer, 1855 gen. Leucochitonea Wallengren, 1857
jss. of Caprona Wallengren, 1857 gen. Sapaea Plötz, 1879
jss. of Caprona Wallengren, 1857 gen. Netrobalane Mabille, 1903
jss. of Sebastonyma Watson, 1893 gen. Parasovia Devyatkin, 1996
jss. of Oerane Elwes and Edwards, 1897 gen. Pemara Eliot, 1978
jss. of Pardaleodes Butler, 1870 gen. Ankola Evans, 1937
jss. of Mnaseas Godman, 1901 gen. Arotis Mabille, 1904
jss. of Metrocles Godman, 1900 gen. Chalcone Evans, 1955
jss. of Metrocles Godman, 1900 gen. Hansa Evans, 1955
jss. of Metrocles Godman, 1900 gen. Propertius Evans, 1955
jss. of Cobaloides Hayward, 1939 gen. Jongiana O. Mielke and Casagrande, 2002
jss. of Psoralis Mabille, 1904 gen. Pamba Evans, 1955
jss. of Styriodes Schaus, 1913 gen. Brownus Grishin, 2019
jss. of Papias Godman, 1900 gen. Mnasilus Godman, 1900
jss. of Mnasitheus Godman, 1900 gen. Sucova Evans, 1955
jss. of Choranthus Scudder, 1872 gen. Pyrrhocalles Mabille, 1904
jss. of Choranthus Scudder, 1872 gen. Asbolis Mabille, 1904
jss. of Methionopsis Godman, 1901 gen. Miltomiges Mabille, 1903
jss. of Thracides Hübner, [1819] gen. Sacrator Evans, 1955
jss. of Perichares Scudder, 1872 gen. Lychnuchoides Godman, 1901
junior subjective synonym (jss.) transferred between genera
jss. of Stimula de Nicéville, 1898 jss. Arunena Swinhoe, 1919 of Koruthaialos Watson, 1893
valid species from junior subjective synonym (jss.) (some in new genus-species combinations)
Salantoia gildo (Mabille, 1888) jss. of Salatis cebrenus (Cramer, 1777)
Bungalotis corentinus (Plötz, 1882) jss. of Bungalotis midas (Cramer, 1775)
Telegonus cretellus (Herrich-Schäffer, 1869) jss. of Telegonus cassander (Fabricius, 1793)
Santa palica (Mabille, 1888) jss. of Chiothion asychis (Stoll, 1780)
Camptopleura cincta Mabille and Boullet, 1917 jss. of Camptopleura auxo (Möschler, 1879)
Camptopleura orsus (Mabille, 1889) jss. of Nisoniades mimas (Cramer, 1775)
Metron voranus (Mabille, 1891) jss. of Metron zimra (Hewitson, 1877)
Metron fasciata (Möschler, 1877) jss. of Metron zimra (Hewitson, 1877)
Limochores catahorma (Dyar, 1916) jss. of Limochores pupillus (Plötz, 1882)
Pares viridiceps (Mabille, 1889) jss. of Thoon modius (Mabille, 1889)
Tigasis wellingi (Freeman, 1969) jss. of Tigasis arita (Schaus, 1902)
Rectava sobrinus (Schaus, 1902) jss. of Papias phainis Godman, 1900
Nastra subsordida (Mabille, 1891) jss. of Eutychide asema (Mabille, 1891)
Lerema (Lerema) pattenii Scudder, 1872 jss. of Lerema accius (J. E. Smith, 1797)
Lerema (Morys) ancus (Möschler, 1879) jss. of Cymaenes tripunctus theogenis (Capronnier, 1874)
Cobalopsis zetus (Bell, 1942) jss. of Cobalopsis nero (Herrich-Schäffer, 1869)
Lerema (Geia) etelka (Schaus, 1902) jss. of Morys geisa (Möschler, 1879)
Cymaenes isus (Godman, 1900) jss. of Cymaenes trebius (Mabille, 1891)
Vehilius labdacus (Godman, 1900) jss. of Vehilius inca (Scudder, 1872)
Papias amyrna (Mabille, 1891) jss. of Mnasilus allubita (Butler, 1877)
Papias integra (Mabille, 1891) jss. of Papias subcostulata (Herrich-Schäffer, 1870)
Metiscus atheas Godman, 1900 jss. of Enosis achelous (Plötz, 1882)
Dion agassus (Mabille, 1891) jss. of Enosis uza (Hewitson, 1877
Picova incompta (Hayward, 1942) jss. of Morys micythus (Godman, 1900)
Lucida melitaea (Draudt, 1923) jss. of Lucida lucia (Capronnier, 1874)
Methionopsis (Methionopsis) modestus Godman, 1901 jss. of Methionopsis ina (Plötz, 1882)
Thargella (Volus) volasus (Godman, 1901) jss. of Eutocus facilis (Plötz, 1884)
valid species from valid subspecies (ssp.) (some in new genus-species combinations)
Dyscophellus doriscus (Hewitson, 1867) ssp. of Dyscophellus porcius (C. Felder and R. Felder, 1862
Phocides vida (A. Butler, 1872) ssp. of Phocides urania (Westwood, 1852)
Tagiades (Daimio) ceylonica Evans, 1932 ssp. of Tagiades litigiosa Möschler, 1878
Tagiades (Daimio) tubulus Fruhstorfer, 1910 ssp. of Tagiades sambavana Elwes and Edwards, 1897
Tagiades (Daimio) kina Evans, 1934 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) sheba Evans, 1934 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) martinus Plötz, 1884 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) sem Mabille, 1883 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) neira Plötz, 1885 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) korela Mabille, 1891 ssp. of Tagiades nestus (C. Felder, 1860)
Tagiades (Daimio) presbyter Butler, 1882 ssp. of Tagiades nestus (C. Felder, 1860)
Tagiades (Tagiades) obscurus Mabille, 1876 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) ravi (Moore, [1866]) ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) atticus (Fabricius, 1793) ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) titus Plötz, 1884 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) janetta Butler, 1870 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) inconspicua Rothschild, 1915 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) hovia Swinhoe, 1904 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) silvia Evans, 1934 ssp. of Tagiades gana (Moore, [1866])
Tagiades (Tagiades) elegans Mabille, 1877 ssp. of Tagiades gana (Moore, [1866])
Tapena (Tapena) bornea Evans, 1941 ssp. of Tapena thwaitesi Moore, [1881]
Tapena (Tapena) minuscula Elwes and Edwards, 1897 ssp. of Tapena thwaitesi Moore, [1881]
Darpa dealbata (Distant, 1886) ssp. of Darpa pteria (Hewitson, 1868)
Perus manx (Evans, 1953) ssp. of Perus minor (Schaus, 1902)
Canesia pallida (Röber, 1925) ssp. of Carrhenes canescens (R. Felder, 1869)
Carrhenes conia Evans, 1953 ssp. of Carrhenes fuscescens (Mabille, 1891)
Anisochoria extincta Hayward, 1933 ssp. of Anisochoria pedaliodina (Butler, 1870)
Anisochoria polysticta Mabille, 1876 ssp. of Anisochoria pedaliodina (Butler, 1870)
Anisochoria verda Evans, 1953 ssp. of Anisochoria minorella Mabille, 1898
Bralus alco (Evans, 1953) ssp. of Bralus albida (Mabille, 1888)
Ephyriades jamaicensis (Möschler, 1879) ssp. of Ephyriades brunnea (Herrich-Schäffer, 1865)
Koruthaialos (Stimula) frena Evans, 1949 ssp. of Koruthaialos focula (Plötz, 1882)
Euphyes kiowah (Reakirt, 1866) ssp. of Euphyes vestris (Boisduval, 1852)
Mnaseas inca Bell, 1930 ssp. of Mnaseas bicolor (Mabille, 1889)
Metron hypochlora (Draudt, 1923) ssp. of Metron schrottkyi (Giacomelli, 1911)
Decinea huasteca (H. Freeman, 1969) ssp. of Decinea decinea (Hewitson, 1876)
Decinea denta Evans, 1955 ssp. of Decinea decinea (Hewitson, 1876)
Decinea antus (Mabille, 1895) ssp. of Decinea decinea (Hewitson, 1876)
Xeniades (Xeniades) pteras Godman, 1900 ssp. of Xeniades chalestra (Hewitson, 1866)
Xeniades (Xeniades) difficilis Draudt, 1923 ssp. of Xeniades orchamus (Cramer, 1777)
Xeniades (Xeniades) hermoda (Hewitson, 1870) ssp. of Tisias quadrata (Herrich-Schäffer, 1869)
Hermio vina (Evans, 1955) ssp. of Lento hermione (Schaus, 1913)
Cymaenes loxa Evans, 1955 ssp. of Cymaenes laureolus (Schaus, 1913)
Niconiades peri (Evans, 1955) ssp. of Neoxeniades bajula (Schaus, 1902
Gallio danius (Bell, 1941) ssp. of Vehilius seriatus (Mabille, 1891)
Gallio massarus (E. Bell, 1940) ssp. of Tigasis garima (Schaus, 1902)
Cymaenes edata (Plötz, 1882) ssp. of Cymaenes odilia (Burmeister, 1878)
Cymaenes miqua (Dyar, 1913) ssp. of Cymaenes odilia (Burmeister, 1878)
Cymaenes aequatoria (Hayward, 1940) ssp. of Cymaenes odilia (Burmeister, 1878)
Lychnuchus (Enosis) demon (Evans, 1955) ssp. of Enosis immaculata (Hewitson, 1868)
Naevolus naevus Evans, 1955 ssp. of Naevolus orius (Mabille, 1883)
Lucida scopas (Mabille, 1891) ssp. of Lucida lucia (Capronnier, 1874)
Lucida oebasus (Godman, 1900) ssp. of Lucida lucia (Capronnier, 1874)
Lucida leopardus (Weeks, 1901) ssp. of Lucida lucia (Capronnier, 1874)
Corticea schwarzi (E. Bell, 1941) ssp. of Corticea mendica (Mabille, 1898)
Corticea sylva (Hayward, 1942) ssp. of Corticea mendica (Mabille, 1898)
Choranthus orientis (Skinner, 1920) ssp. of Pyrrhocalles antiqua (Herrich-Schäffer, 1863)
valid subspecies from junior subjective synonym (jss.)
Borbo impar bipunctata (Elwes and J. Edwards, 1897) jss. of Borbo impar tetragraphus (Mabille, 1891)
valid subspecies from valid species (sp.)
Euphyes kiowah chamuli Freeman, 1969 sp. of Euphyes Scudder, 1872
junior subjective synonym (jss.) from valid species or subspecies
jss. of Dyscophellus damias (Plötz, 1882) Dyscophellus erythras (Mabille, 1888)
jss. of Telegonus cretellus (Herrich-Schäffer, 1869) Telegonus jaira (A. Butler, 1870)
jss. of Santa palica (Mabille, 1888) Paches era Evans, 1953
jss. of Camptopleura orsus (Mabille, 1889) Camptopleura impressus (Mabille, 1889)
jss. of Lotongus calathus (Hewitson, 1876) Borbo impar tetragraphus (Mabille, 1891)
jss. of Metron voranus (Mabille, 1891) Chalcone tania (Schaus, 1902)
jss. of Niconiades derisor (Mabille, 1891) Niconiades viridis vista Evans, 1955
jss. of Ralis immaculatus (Hayward, 1940) Ralis concolor (Nicolay, 1980)
jss. of Eutus rastaca (Schaus, 1902) Cobalopsis brema E. Bell, 1959
jss. of Rhomba gertschi (Bell, 1937) Psoralis panamensis Anderson and Nakamura, 2019
jss. of Nastra subsordida (Mabille, 1891) Papias trimacula Nicolay, 1973
jss. of Cobalopsis valerius (Möschler, 1879) Cobalopsis miaba (Schaus, 1902)
jss. of Cymaenes lumina (Herrich-Schäffer, 1869) Cymaenes odilia (Burmeister, 1878)
jss. of Cymaenes lumina (Herrich-Schäffer, 1869) Cymaenes trebius (Mabille, 1891)
jss. of Vehilius inca (Scudder, 1872) Lerodea xenos (Mabille, 1898)
jss. of Papias amyrna (Mabille, 1891) Nastra guianae (Lindsey, 1925)
jss. of Metiscus atheas Godman, 1900 Enosis matheri H. Freeman, 1969
jss. of Anthoptus inculta (Dyar, 1918) Anthoptus macalpinei H. Freeman, 1969
jss. of Methionopsis (Methionopsis) ina (Plötz, 1882) Methionopsis typhon Godman, 1901
jss. of Thargella (Volus) volasus (Godman, 1901) Methionopsis dolor Evans, 1955
jss. of Dubiella dubius (Stoll, 1781) Tirynthia cinica (Plötz, 1882)
jss. of Neoxeniades (Neoxeniades) parna (Evans, 1955) Calpodes vixen (Evans, 1955)
junior subjective synonym (jss.) transferred between species
jss. of Euriphellus phraxanor (Hewitson, 1876) jss. Telegonus mutius Plötz, 1882 of Salatis cebrenus (Cramer, 1777)
jss. of Tolius tolimus robigus (Plötz, 1884) jss. Antigonus alburnea Plötz, 1884 of Echelatus sempiternus simplicior (Möschler, 1877)
jss. of Echelatus sempiternus simplicior (Möschler, 1877) jss. Echelatus depenicillus Strand, 1921 of Tolius tolimus robigus (Plötz, 1884)
jss. of Theagenes dichrous (Mabille, 1878) jss. Antigonus aura Plötz, 1884 of Helias phalaenoides palpalis (Latreille, [1824])
jss. of Metron fasciata (Möschler, 1877), jss. Pamphila verdanta Weeks, 1906 of Metron zimra (Hewitson, 1877)
jss. of Conga chydaea (A. Butler, 1877) jss. Pamphila binaria Mabille, 1891 of Cynea cynea (Hewitson, 1876)
jss. of Cynea (Quinta) cannae (Herrich-Schäffer, 1869) jss. Hesperia dido Plötz, 1882 of Lerema lochius (Plötz, 1882)
jss. of Cynea (Cynea) diluta (Herrich-Schäffer, 1869) jss. Proteides osembo Möschler, 1883 of Quinta cannae (Herrich-Schäffer, 1869)
jss. of Amblyscirtes (Amblyscirtes) alternata (Grote and Robinson, 1867) jss. Cobalus asella Herrich-Schäffer, 1869 of Amblyscirtes (Amblyscirtes) vialis (W. H. Edwards, 1862)
jss. of Lerema (Lerema) pattenii Scudder, 1872 jss. Pamphila bipunctata Mabille, 1889 of Lerema lumina (Herrich-Schäffer, 1869)
jss. of Lerema (Lerema) pattenii Scudder, 1872 jss. Sarega staurus Mabille, 1904 of Lerema lumina (Herrich-Schäffer, 1869)
jss. of Lerema (Lerema) lineosa (Herrich-Schäffer, 1865) jss. Hesperia aethra Plötz, 1886 of Morys compta Butler, 1877
jss. of Lerema (Geia) etelka (Schaus, 1902) jss. Phanis sylvia Kaye, 1914 of Morys geisa (Möschler, 1879)
jss. of Cymaenes lumina (Herrich-Schäffer, 1869) jss. Megistias corescene Schaus, 1902 of Cymaenes odilia odilia (Burmeister, 1878)
jss. of Cymaenes edata (Plötz, 1882) jss. Hesperia phocylides Plötz, 1882 of Lerema accius (J. E. Smith, 1797)
jss. of Papias integra (Mabille, 1891) jss. Pamphila nubila Mabille, 1891 of Cynea corisana (Plötz, 1882)
jss. of Mnaseas derasa derasa (Herrich-Schäffer, 1870) jss. Hesperia infuscata Plötz, 1882 of Papias subcostulata (Herrich-Schäffer, 1870)
jss. of Metiscus angularis (Möschler, 1877) jss. Pamphila astur Mabille, 1891 of Cymaenes tripunctus theogenis (Capronnier, 1874)
jss. of Dubiella dubius (Stoll, 1781) jss. Cobalus disjuncta Herrich-Schäffer, 1869 of Vettius lafrenaye (Latreille, [1824])
new and revised genus-species combinations
Euriphellus cebrenus (Cramer, 1777) sp. of Salatis Evans, 1952
Gorgopas extensa (Mabille, 1891) sp. of Polyctor Evans, 1953
Clytius shola (Evans, 1953) sp. of Staphylus Godman and Salvin, 1896
Perus narycus (Mabille, 1889) sp. of Ouleus Lindsey, 1925
Perus parvus (Steinhauser and Austin, 1993) sp. of Staphylus Godman and Salvin, 1896
Pholisora litus (Dyar, 1912) sp. of Bolla Mabille, 1903
Carrhenes decens (A. Butler, 1874) sp. of Antigonus Hübner, [1819]
Santa palica (Mabille, 1888) sp. of Chiothion Grishin, 2019
Bralus nadia (Nicolay, 1980) sp. of Anisochoria Mabille, 1876
Acerbas sarala (de Nicéville, 1889) sp. of Lotongus Distant, 1886
Caenides sophia (Evans, 1937) sp. of Hypoleucis Mabille, 1891
Hypoleucis dacena (Hewitson, 1876) sp. of Caenides Holland, 1896
Dotta tura (Evans, 1951) sp. of Astictopterus C. Felder and R. Felder, 1860
Nervia wallengrenii (Trimen, 1883) sp. of Kedestes Watson, 1893
Testia mammaea (Hewitson, 1876) sp. of Decinea Evans, 1955
Oxynthes trinka (Evans, 1955) sp. of Orthos Evans, 1955
Metrocles argentea (Weeks, 1901) sp. of Paratrytone Godman, 1900
Metrocles scitula (Hayward, 1951) sp. of Mucia Godman, 1900
Metrocles schrottkyi (Giacomelli, 1911) sp. of Metron Godman, 1900
Niconiades derisor (Mabille, 1891) sp. of Decinea Evans, 1955
Paratrytone samenta (Dyar, 1914) sp. of Ochlodes Scudder, 1872
Oligoria (Cobaloides) locutia (Hewitson, 1876) sp. of Quinta Evans, 1955
Psoralis (Saniba) laska (Evans, 1955) sp. of Vidius Evans, 1955
Psoralis (Saniba) arva (Evans, 1955) sp. of Vettius Godman, 1901
Psoralis (Saniba) umbrata (Erschoff, 1876) sp. of Vettius Godman, 1901
Psoralis (Saniba) calcarea (Schaus, 1902) sp. of Molo Godman, 1900
Psoralis (Saniba) visendus (E. Bell, 1942) sp. of Molo Godman, 1900
Alychna gota (Evans, 1955) sp. of Psoralis Mabille, 1904
Adlerodea asema (Mabille, 1891) sp. of Eutychide Godman, 1900
Adlerodea subpunctata (Hayward, 1940) sp. of Eutychide Godman, 1900
Ralis immaculatus (Hayward, 1940) sp. of Mucia Godman, 1900
Rhinthon braesia (Hewitson, 1867) sp. of Neoxeniades Hayward, 1938
Rhinthon bajula (Schaus, 1902) sp. of Neoxeniades Hayward, 1938
Cymaenes lochius Plötz, 1882 sp. of Lerema Scudder, 1872
Paracarystus ranka (Evans, 1955) sp. of Thoon Godman, 1900
Tricrista aethus (Hayward, 1951) sp. of Thoon Godman, 1900
Tricrista canta (Evans, 1955) sp. of Thoon Godman, 1900
Tricrista slopa (Evans, 1955) sp. of Thoon Godman, 1900
Tricrista circellata (Plötz, 1882) sp. of Thoon Godman, 1900
Tricrista taxes (Godman, 1900) sp. of Thoon Godman, 1900
Gallio madius (E. Bell, 1941) sp. of Vehilius Godman, 1900
Gallio seriatus (Mabille, 1891) sp. of Vehilius Godman, 1900
Gallio garima (Schaus, 1902) sp. of Tigasis Godman, 1900
Tigasis corope (Herrich-Schäffer, 1869) sp. of Cynea Evans, 1955
Tigasis perloides (Plötz, 1882) sp. of Cymaenes Scudder, 1872
Amblyscirtes (Flor) florus (Godman, 1900) sp. of Repens Evans, 1955
Vidius fraus (Godman, 1900) sp. of Cymaenes Scudder, 1872
Nastra celeus (Mabille, 1891) sp. of Vehilius Godman, 1900
Nastra nappa (Evans, 1955) sp. of Vidius Evans, 1955
Vehilius warreni (Weeks, 1901) sp. of Cymaenes Scudder, 1872
Vehilius limae (Lindsey, 1925) sp. of Cymaenes Scudder, 1872
Cymaenes lumina (Herrich-Schäffer, 1869) sp. of Lerema Scudder, 1872
Cobalopsis valerius (Möschler, 1879) sp. of Cobalopsis Godman, 1900
Cobalopsis dictys (Godman, 1900) sp. of Papias Godman, 1900
Lerema (Morys) venias (Bell, 1942) sp. of Cobalopsis Godman, 1900
Papias latonia (Schaus, 1913) sp. of Cobalopsis Godman, 1900
Dion iccius (Evans, 1955) sp. of Enosis Mabille, 1889
Dion uza (Hewitson, 1877) sp. of Enosis Mabille, 1889
Vistigma (Vistigma) opus (Steinhauser, 2008) sp. of Thoon Godman, 1900
Saturnus fartuga (Schaus, 1902) sp. of Parphorus Godman, 1900
Phlebodes fuldai (E. Bell, 1930) sp. of Vettius Godman, 1901
Mnasitheus padus (Evans, 1955) sp. of Moeris Godman, 1900
Naevolus brunnescens (Hayward, 1939) sp. of Psoralis Mabille, 1904
Lamponia ploetzii (Capronnier, 1874) sp. of Vettius Godman, 1901
Mnestheus silvaticus Hayward, 1940 sp. of Ludens Evans, 1955
Rigga spangla (Evans, 1955) sp. of Sodalia Evans, 1955
Corticea vicinus (Plötz, 1884) sp. of Lento Evans, 1955
Mnasalcas thymoetes (Hayward, 1942) sp. of Mnasicles Godman, 1901
Mnasalcas boyaca (Nicolay, 1973) sp. of Pamba Evans, 1955
Vertica (Brasta) brasta (Evans, 1955) sp. of Lychnuchus Hübner, [1831]
Carystina discors Plötz, 1882 sp. of Cobalus Hübner, [1819]
Zetka irena (Evans, 1955) sp. of Neoxeniades Hayward, 1938
Neoxeniades (Neoxeniades) parna (Evans, 1955) sp. of Niconiades Hübner, [1821]
new and revised species-subspecies combinations (one in a new genus-species combination)
Tagiades (Daimio) neira moti Evans, 1934 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) neira canonicus Fruhstorfer, 1910 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) sheba vella Evans, 1934 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) sheba lola Evans, 1945 ssp. of Tagiades trebellius (Hopffer, 1874)
Tagiades (Daimio) korela biakana Evans, 1934 ssp. of Tagiades nestus (C. Felder, 1860)
Tagiades (Daimio) korela mefora Evans, 1934 ssp. of Tagiades nestus (C. Felder, 1860)
Tagiades (Daimio) korela suffusus Rothschild, 1915 ssp. of Tagiades nestus (C. Felder, 1860)
Tagiades (Daimio) korela brunta Evans, 1949 ssp. of Tagiades nestus (C. Felder, 1860)
Tagiades (Tagiades) ravi ravina Fruhstorfer, 1910 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) atticus carnica Evans, 1934 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) atticus nankowra Evans, 1934 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) atticus helferi C. Felder, 1862 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) atticus balana Fruhstorfer, 1910 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) inconspicua mathias Evans, 1934 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) hovia kazana Evans, 1934 ssp. of Tagiades japetus (Stoll, [1781])
Tagiades (Tagiades) elegans fuscata de Jong and Treadaway, 2007 ssp. of Tagiades gana (Moore, [1866])
Tagiades (Tagiades) elegans semperi Fruhstorfer, 1910 ssp. of Tagiades gana (Moore, [1866])
Metron hypochlora tomba Evans, 1955 ssp. of Metron schrottkyi (Giacomelli, 1911)
Decinea denta pruda Evans, 1955 ssp. of Decinea decinea (Hewitson, 1876)
Choranthus orientis eleutherae (Bates, 1934) ssp. of Pyrrhocalles antiqua (Herrich-Schäffer, 1863)

Materials and Methods

All methods employed in this work follow our previously published protocols (Cong et al. 2015a,b, 2016a,b, 2017a,b, 2018, 2019a, 2021; Shen et al. 2015, 2016a,b, 2017; Zhang et al. 2017a,b, 2019a,b,e,f, 2020, 2021; Li et al. 2019). In particular, they are the same as used in the work of Cong et al. (2019b) that was quite similar in spirit. In brief, this study is mostly based on pinned specimens from museum collections (listed at the end of this section and in the Acknowledgments) that were used for DNA extraction. While more recently collected specimens were preferred, we made use of our protocols to extract and sequence whole genomic DNA of century-old specimens (Cong et al. 2021), most of which were primary types essential to justify our taxonomic conclusions. Data for sequenced specimens are provided in Table 2 and detailed in Table S1 in the supplemental file deposited at <https://osf.io/aesvy/>. For DNA extraction, we mostly used legs or pieces of muscle tissue pulled out from the thorax (using fine tweezers) through the abdomen attachment site (for previously dissected specimens). Muscle tissue is a viable alternative to legs when leg material is not sufficient or using a leg is not possible. The abdomen is utilized when genitalic dissection is needed. The details of protocols for DNA extraction, genomic library preparation, sequencing and analysis are identical to that of Li et al. (2019), Cong et al. (2019b) and Cong et al. (2021).

Table 2.

Data for 1190 sequenced Hesperiidae specimens. See Table S1 in the Supplemental file deposited at <https://osf.io/aesvy/> for detailed information about these specimens and Materials and Methods section for collection abbreviations. Type status abbreviations are: AT, allotype; HT, holotype; LT, lectotype; NT, neotype; PT, paratype; ST, syntype; T, type.

DNA voucher Taxon name Type Brief data Collection
NVG-17068G08 Abantis (Abantis) hindei Kenya, 1961 USNM
NVG-18054G05 Abantis (Abantis) levubu Namibia, 2002 ZMHB
NVG-17068G09 Abantis (Abantis) tettensis Kenya, 1956 USNM
NVG-18053A08 Abantis (Caprona) bicolor Africa, 1890 ZMHB
NVG-17068G05 Abantis (Caprona) canopus Kenya, 1961 USNM
NVG-18055G12 Abantis (Caprona) leucogaster ST Sierra Leone, old (around 1900) ZMHB
NVG-17108C07 Abantis (Caprona) pillaana South Africa, 1947 LACM
NVG-18055G09 Abantis (Caprona) venosa (=plerotica) ST Tanzania, old (around 1900) ZMHB
NVG-18105A07 Abaratha (Abaratha) agama agama no data, old (around 1900) USNM
NVG-18079D02 Abaratha (Abaratha) alida (=parvopunctata) T Vietnam, 1868 MNHP
NVG-17068G11 Abaratha (Abaratha) ransonnetii ransonnetii Ceylon, 1970 USNM
NVG-17069A05 Abaratha (Odontoptilum) abbreviata Philippines, 1965 USNM
NVG-7341 Abaratha (Odontoptilum) angulata angulata Myanmar, 2002 USNM
NVG-18093G06 Abaratha (Odontoptilum) corria PT Philippines, 1988 SMF
NVG-18093G05 Abaratha (Odontoptilum) helias helisa LT Philippines, prior to 1867 SMF
NVG-17069A07 Abaratha (Odontoptilum) pygela pygela Philippines, 1986 USNM
NVG-17069A02 Abraximorpha davidii China: Sichuan, old (around 1900) USNM
NVG-18081B11 Acerbas anthea anthea Malaysia, 1917, NHMUK_010430824, 0247275554 BMNH
NVG-17091E09 Acerbas duris duris Philippines, old (around 1900) USNM
NVG-18074B03 Acerbas sarala sarala India, 1890 ZMHB
NVG-18011F11 Achlyodes busirus busirus French Guiana, 1988 USNM
NVG-18081D02 Actinor radians India, 1885, NHMUK_010430809, 0247275546 BMNH
NVG-18086A10 Adina adrastor HT no data, 1887 MNHP
NVG-15035E10 Adlerodea asema ST Honduras, 1888 ZMHB
NVG-18015A06 Adlerodea petrovna T Brazil: RJ, old (around 1900) USNM
NVG-18026H06 Adlerodea subpunctata subpunctata HT Argentina, 1912 AMNH
NVG-7988 Adopaeoides prittwitzi USA: AZ, Santa Cruz Co., 1999 USNM
NVG-18023C06 Aegiale hesperiaris Mexico: DF, 1910 AMNH
NVG-18064E05 Aeromachus jhora creta Burma, 1956 USNM
NVG-7915 Aeromachus stigmata shanda Myanmar, 2002 USNM
NVG-94 Agathymus estelleae valverdiensis USA: TX, Uvalde Co., 2004 UTSW
NVG-214 Agathymus neumoegeni neumoegeni USA: AZ, Coconino Co., 2004 UTSW
NVG-18023A10 Agathymus rethon Mexico: Puebla, 1956 AMNH
NVG-18114C11 Aides aegita Venezuela, 1979 USNM
NVG-18114C09 Aides brino Guyana, 2000 USNM
NVG-18114C04 Aides duma argyrina Brazil: Rondonia, 1989 USNM
NVG-18054H04 Alenia namaqua South Africa, 2002 ZMHB
NVG-18026G11 Alerema simplex HT Brazil: SC, before 1930 AMNH
NVG-19021H09 Alerema simplex Brazil: Rio Grande do Sul, 1961 USNM
NVG-19021G12 Alychna degener Ecuador, 1975 USNM
NVG-18042G08 Alychna exclamationis LT Bolivia, prior to 1898 ZMHB
NVG-19021G08 Alychna gota Colombia, 1989 USNM
NVG-20017A12 Alychna victa Peru, 2016 MUSM
NVG-17111G09 Alychna zenus Ecuador, 1992 LACM
11-BOA-13384G02 Amblyscirtes (Amblyscirtes) alternata USA: TX, Sabine Co., 2012 NGrishin
NVG-18042H03 Amblyscirtes (Amblyscirtes) alternata (=asella) ST no data, prior to 1869 ZMHB
NVG-4336 Amblyscirtes (Amblyscirtes) vialis USA: IN, Newton Co., 2015 UTSW
NVG-9727 Amblyscirtes (Amblyteria) exoteria USA: AZ, Cochise Co., 2017 UTSW
NVG-19042H10 Amblyscirtes (Flor) florus Mexico: Jalisco, 1966 AMNH
NVG-18063H01 Amblyscirtes (Mastor) anubis Mexico: Chiapas, 1992 USNM
NVG-3524 Amblyscirtes (Stomyles) aesculapius USA: TX, San Jacinto Co., 2015 UTSW
NVG-7288 Ampittia dioscorides singa Sri Lanka, 1971 USNM
NVG-19071E03 Anastrus obscurus Brazil: SC, 1991 USNM
11-BOA-15607A01 Anaxas isidro HT Panama, 1970 USNM
NVG-19113E12 Anaxas obliqua Brazil: Paraiba, 1953 USNM
NVG-19113E09 Anaxas petius petius Brazil: Rondonia, 1989 USNM
NVG-18019C12 Ancistroides (Ancistroides) longicornis Indonesia, old (around 1900) AMNH
NVG-18075C02 Ancistroides (Notocrypta) clavata T Philippines, 1888 ZMHB
NVG-17119B09 Ancistroides (Notocrypta) curvifascia Myanmar, 2001 USNM
NVG-7340 Ancistroides (Notocrypta) feistamelii Myanmar, 2002 USNM
NVG-18101E04 Ancistroides (Notocrypta) paralysos Malaysia, 1990 USNM
NVG-18101D01 Ancistroides (Ocrypta) caerulea Papua New Guinea, 1983 USNM
NVG-18101E01 Ancistroides (Ocrypta) renardi Papua New Guinea, 1983 USNM
NVG-18101E03 Ancistroides (Ocrypta) waigensis waigensis Waigou, old (around 1900) USNM
NVG-7332 Ancistroides (Udaspes) folus Myanmar, 2001 USNM
NVG-19091G08 Anisochoria bacchus El Salvador, 1953 USNM
NVG-19091H03 Anisochoria extincta Brasil, 1991 USNM
NVG-19091H11 Anisochoria extincta Brazil: Minas Gerais, 1994 USNM
NVG-19091H10 Anisochoria minorella Argentina, 1979 USNM
NVG-15033E03 Anisochoria minorella ST Bolivia, old (around 1900) ZMHB
NVG-19091H01 Anisochoria pedaliodina Bolivia, 2003 USNM
NVG-19091H02 Anisochoria pedaliodina Brazil: Rondonia, 1993 USNM
NVG-18091C07 Anisochoria pedaliodina Ecuador, 2012 EBrockmann
NVG-7909 Anisochoria polysticta Costa Rica, 2004, 04-SRNP-15751 USNM
NVG-19091H04 Anisochoria polysticta Guyana, 2000 USNM
NVG-19091G09 Anisochoria polysticta Panama, 1978 USNM
NVG-18011G07 Anisochoria sublimbata Colombia, old (around 1900) USNM
NVG-19091H07 Anisochoria verda Ecuador, 1989 USNM
NVG-19091H08 Anisochoria verda Ecuador, 1989 USNM
NVG-17111E11 Anthoptus epictetus Brazil: SC, 1999 LACM
NVG-18015B03 Anthoptus inculta T Mexico: probably Veracruz, old (around
1900)
USNM
NVG-18026B12 Anthoptus inculta (=macalpinei) HT Mexico: Veracruz, 1966 AMNH
NVG-19122D10 Anthoptus insignis Costa Rica, 1908 USNM
NVG-10646 Antigonus emorsa Mexico: Michoacan, 1994 TAMU
NVG-7907 Antigonus erosus Costa Rica, 2013, 13-SRNP-56479 USNM
NVG-18014A03 Antigonus nearchus Costa Rica, 2006, 06-SRNP-32799 USNM
NVG-18011B09 Apallaga mokeezi South Africa, 1978 USNM
NVG-18079E08 Apallaga oreas HT Cameroon, 1989 MNHP
NVG-18012F08 Apaustus menes Peru, 2011 USNM
NVG-17069C12 Apostictopterus fuliginosus China: Sichuan, old (around 1900) USNM
NVG-18073A11 Argemma argyrosticta argyrosticta (=limbana) ST Equatorial Guinea, 1906 ZMHB
NVG-18073A10 Argemma aurea (=guineensis) ST Equatorial Guinea, 1906 ZMHB
NVG-18019B09 Arnetta atkinsoni India, 1927 AMNH
NVG-5065 Aroma aroma Costa Rica, 2004, 04-SRNP-1707 USNM
NVG-17091G03 Arrhenes marnas marnas Papua New Guinea, 1944 USNM
NVG-18012H06 Artines aquilina Brazil: SC, 1999 USNM
NVG-17092F01 Artines rica Costa Rica, 2015, 15-SRNP-65094 USNM
NVG-7755 Artitropa comus comus Liberia, 1988 USNM
NVG-17092B07 Artitropa erinnys nyasae Zimbabwe, 1947 USNM
NVG-19022F05 Artonia artona Guyana, 2000 USNM
NVG-7394 Astictopterus jama jama Myanmar, 2001 USNM
NVG-17091G10 Aurivittia aurivittata Myanmar, 2002 USNM
NVG-18014E05 Avestia avesta Malaysia, old (around 1900) USNM
NVG-17091G11 Baoris oceia Phillipines, 1914 USNM
NVG-19067B01 Baracus vittatus Sri Lanka, 1999 UCDC
NVG-18089F07 Barca bicolor China: Shaanxi, 2009 EBrockmann
NVG-18026C12 Barrolla barroni (=molla) HT Ecuador, before 1959 AMNH
NVG-19066H05 Bibla papyria agraulia Australia, 1979 UCDC
NVG-18011A07 Bibla papyria papyria Australia, old (around 1900) USNM
NVG-18049C03 Bolla catharina Brazil: RJ, 1995 USNM
NVG-18049B04 Bolla cylindus Panama, 1984 USNM
NVG-18049E01 Bolla imbras Mexico: Veracruz, 1979 USNM
NVG-18054G08 Borbo borbonica Namibia, 1993 ZMHB
NVG-18079C10 Borbo gemella T Madagascar, prior to 1884 MNHP
NVG-20087C12 Borbo impar bipunctata Seram, 1984 KMaruyama
NVG-18074H04 Borbo impar bipunctata T Indonesia, 1893 ZMHB
NVG-15033E01 Bralus albida T Peru, old (around 1900) ZMHB
NVG-18057B07 Bralus alco Bolivia, prior to 1888 ZSMC
NVG-19091G06 Bralus nadia Ecuador, 2002 USNM
NVG-19091G07 Bralus nadia PT Ecuador, 1975 USNM
NVG-17104A09 Bungalotis borax French Guiana, old (around 1900) USNM
NVG-17104D08 Bungalotis corentinus French Guiana, old (around 1900) USNM
NVG-15031G10 Bungalotis corentinus (& =diophorus) NT,HT Suriname, old (around 1900) ZMHB
NVG-5741 Bungalotis erythus Costa Rica, 2008, 08-SRNP-65224 USNM
NVG-15026B10 Bungalotis gagarini Brazil: Rondonia, 1995 MGCL
NVG-17104A08 Bungalotis lactos Guyana, 1927 USNM
NVG-17103H08 Bungalotis midas Ecuador, 1998 USNM
NVG-17104E07 Bungalotis quadratum Costa Rica, 2008, 08-SRNP-1750 USNM
NVG-17104D12 Bungalotis sipa Guyana, 1999 USNM
NVG-18018E04 Burnsius communis USA: AZ, Cochise Co., 1974 USNM
NVG-3542 Burnsius oileus USA: TX, Hidalgo Co., 2015 UTSW
NVG-3375 Burnsius philetas USA: TX, Starr Co., 2015 UTSW
NVG-16108G04 Butleria flavomaculatus valdivianus Chile, 1979 USNM
NVG-7754 Caenides dacela Liberia, 1988 USNM
NVG-19043C11 Caenides sophia Uganda, 1954 AMNH
NVG-18075C08 Caenides soritia (=xantho) T Cameroon, prior to 1891 ZMHB
NVG-18075C09 Caenides xychus T Sierra Leone, 1888 ZMHB
NVG-17068H02 Calleagris jamesoni jamesoni Tanzania, 1958 USNM
NVG-19016F10 Callimormus (Callimormus) alsimo Guyana, 2000 USNM
NVG-19016G05 Callimormus (Callimormus) corades Brazil: RJ, 1994 USNM
NVG-18025G03 Callimormus (Callimormus) corus HT Brazil: Para, before 1941 AMNH
NVG-19016F12 Callimormus (Callimormus) interpunctata Brazil: RJ, 1995 USNM
NVG-19016G04 Callimormus (Callimormus) juventus Guyana, 1999 USNM
NVG-19016F06 Callimormus (Callimormus) radiola radiola Ecuador, 1990 USNM
NVG-19016G10 Callimormus (Callimormus) rivera (=beda) Brazil: Parana, 1959 USNM
NVG-19016G07 Callimormus (Callimormus) saturnus Guyana, 2000 USNM
NVG-4591 Calpodes ethlius USA: TX, Cameron Co., 2015 UTSW
NVG-18012E03 Calpodes salius Guyana, 2000 USNM
NVG-18112B02 Calvetta calvina Brazil: Rondonia, 1991 USNM
NVG-18112B01 Calvetta calvina Guyana, 2000 USNM
NVG-15033B06 Camptopleura auxo T Colombia, old (around 1900) ZMHB
NVG-18078D02 Camptopleura cincta ST Bolivia, 1905 MNHP
NVG-18032C09 Camptopleura orsus Panama, 1981 USNM
NVG-18032C04 Camptopleura orsus Venezuela, no date?1970 USNM
NVG-15034D08 Camptopleura orsus HT Venezuela, old (around 1900) ZMHB
NVG-15033A11 Camptopleura orsus (=impressus) ST Panama, old (around 1900) ZMHB
NVG-15033B07 Camptopleura termon T Peru, old (around 1900) ZMHB
NVG-18013G01 Camptopleura theramenes Costa Rica, 2015, 15-SRNP-45798 USNM
NVG-19088F05 Canesia callipetes Guatemala, old (around 1900) USNM
NVG-7905 Canesia canescens Costa Rica, 2014, 14-SRNP-1649 USNM
NVG-19088E05 Canesia canescens Honduras, 1979 USNM
NVG-17116B06 Canesia canescens Mexico: Tamaulipas, 1974 TAMU
NVG-19088F02 Canesia leada Bolivia, 1987 USNM
NVG-18013H12 Canesia meridensis Costa Rica, 1997, 97-SRNP-1522 USNM
NVG-18094F04 Canesia pallida HT Brazil: Rio Grande do Sul, old (around 1900) MTD
NVG-19088E10 Canesia pallida Brazil: Rio Grande do Sul, 1962 USNM
NVG-19088F03 Canesia recurva Brasil, 1991 USNM
NVG-18012F05 Cantha calva Peru, 1986 USNM
NVG-19016D07 Cantha zara Peru, 2002 USNM
NVG-18033B07 Capila phanaeus decoloris Cambodia, 2006 MWalker
NVG-17119A07 Capila pieridoides Brahmaputra, old (around 1900) USNM
NVG-15033B09 Carrhenes chaeremon LT Brazil: Amazonas, old (around 1900) ZMHB
NVG-19088E02 Carrhenes chaeremon Ecuador, 1992 USNM
NVG-19088D10 Carrhenes conia Brasil, 1991 USNM
NVG-18057B05 Carrhenes conia Peru, around 1896 ZSMC
NVG-15033B10 Carrhenes conia Brazil: Amazonas, old (around 1900) ZMHB
NVG-18017D06 Carrhenes decens Peru, 2012 USNM
NVG-18014A02 Carrhenes fuscescens Costa Rica, 1995, 95-SRNP-6819 USNM
NVG-18123A05 Carterocephalus abax China, old (around 1900) USNM
NVG-17067B09 Carterocephalus palaemon palaemon Russia, 2003 CSUC
NVG-18012D09 Carystina lysiteles Peru, 1999 USNM
NVG-18014H06 Carystoides (Balma) balza Ecuador, 1974 USNM
NVG-18022B01 Carystoides (Balma) maroma Peru, 1930 AMNH
NVG-18021H04 Carystoides (Carystoides) alda Brazil: SC, 1938 AMNH
NVG-18072B05 Carystoides (Carystoides) basoches Costa Rica, 2015, 15-SRNP-70059 USNM
NVG-18039E10 Carystoides (Carystoides) cathaea Guyana, 2003 FMNH
NVG-18072C06 Carystoides (Carystoides) hondura Costa Rica, 2015, 14-SRNP-47794 USNM
NVG-18022D10 Carystoides (Carystoides) mexicana HT Mexico: San Luis Potosi, 1966 AMNH
NVG-18014H12 Carystoides (Carystoides) noseda Brazil: Para, 1986 USNM
NVG-18072C05 Carystoides (Carystoides) sicania orbius Costa Rica, 2015, 15-SRNP-65210 USNM
NVG-7921 Carystus (Argon) lota Costa Rica, 2007, 07-SRNP-55877 USNM
NVG-18012D05 Carystus (Carystus) hocus Colombia, 1971 USNM
NVG-18026G05 Carystus (Carystus) jolus (=santus) HT French Guiana, before 1940 AMNH
NVG-18111H09 Carystus (Carystus) periphas periphas Panama, 1969 USNM
NVG-15035H06 Carystus (Carystus) superbiens T Brazil: Amazonas, old (around 1900) ZMHB
NVG-15036C07 Carystus (Moeros) moeros T Suriname, 1874 ZMHB
NVG-7924 Carystus (Synale) cynaxa Costa Rica, 2008, 08-SRNP-37249 USNM
NVG-18111H07 Carystus (Synale) elana elana Brazil: Mato Grosso, 1969 USNM
NVG-18012D04 Carystus (Synale) hylaspes Argentina, 1998 USNM
NVG-18111H08 Carystus (Synale) metella Brazil: Mato Grosso, 1990 USNM
NVG-7925 Carystus (Synale) phorcus phorcus Costa Rica, 2007, 07-SRNP-57133 USNM
NVG-18111H12 Carystus (Synale) ploetzi Ecuador, 2002 USNM
NVG-18013G07 Celaenorrhinus eligius eligius Costa Rica, 2010, 10-SRNP-20588 USNM
NVG-18079E06 Celaenorrhinus elmina NT Cameroon, 1997 MNHP
NVG-7993 Celaenorrhinus syllius Ecuador, 2002 USNM
NVG-19012E04 Celotes limpia USA: TX, Jeff Davis Co., 2018 WDempwolf
NVG-3956 Celotes nessus USA: TX, Hidalgo Co., 2015 UTSW
NVG-7758 Cephrenes augiades sperthias Australia, 1995 USNM
NVG-18099D12 Ceratrichia brunnea brunnea Kenya, 1956 USNM
NVG-18099E01 Ceratrichia flava flava Uganda, 1961 USNM
NVG-18099E02 Ceratrichia hollandi hollandi Uganda, 1957 USNM
NVG-18053E03 Ceratrichia nothus no data, old (around 1900) ZMHB
NVG-18099E04 Ceratrichia wollastoni wollastoni Uganda, 1952 USNM
NVG-18089G07 Cerba martini Malaysia, 1993 EBrockmann
NVG-18089G09 Chaetocneme helirius Indonesia, 2002 EBrockmann
NVG-17069A11 Chamunda chamunda India, old (around 1900) USNM
NVG-14103A02 Chiothion asychis asychis Suriname, 1982 USNM
NVG-17069B09 Chirgus (Chirgus) bocchoris bocchoris Argentina, old (around 1900) USNM
NVG-14102F04 Chirgus (Chirgus) fides Chile, 1961 FMNH
NVG-15033H08 Chirgus (Chirgus) limbata (=biseriatus) T Bolivia, old (around 1900) ZMHB
NVG-14102E12 Chirgus (Chirgus) nigella Peru, 1939 FMNH
11-BOA-13382F11 Chirgus (Turis) veturius Brazil: Bahia, 1991 USNM
NVG-18025D04 Chitta chittara (=alis) HT Brazil: SC, before 1959 AMNH
NVG-5271 Choaspes hemixanthus furcata China: Sichuan, 2015 UTSW
NVG-17069G10 Chondrolepis niveicornis Kenya, 1951 USNM
NVG-8060 Choranthus antiqua Dominican Republic, 1994 USNM
NVG-21012F05 Choranthus antiqua Haiti, 1977 CMNH
NVG-18094E07 Choranthus antiqua (=kruegeri) LT Dominican Republic, 1925 MTD
NVG-18025E08 Choranthus borincona HT Puerto Rico, 1915 AMNH
NVG-18117E11 Choranthus borincona Puerto Rico, 1982 USNM
NVG-18057A05 Choranthus capucinus Cuba, 2013 ZSMC
NVG-4881 Choranthus capucinus USA: FL, Monroe Co., 2015 UTSW
NVG-15095H05 Choranthus haitensis T Haiti, old (around 1900) CMNH
NVG-10491 Choranthus jamaicensis Jamaica, 2017 UTSW
NVG-18021F05 Choranthus lilliae Jamaica, 1959 AMNH
NVG-18026B09 Choranthus lilliae HT Jamaica, 1931 AMNH
NVG-19044C12 Choranthus melissa Dominican Republic, about 1990 AMNH
NVG-18117D02 Choranthus orientis eleutherae Bahamas, 1978 USNM
NVG-18117D03 Choranthus orientis eleutherae Bahamas, 1978 USNM
NVG-15095F10 Choranthus orientis orientis HT Cuba, 1910 CMNH
NVG-21012F07 Choranthus orientis orientis Cuba, 1930 CMNH
NVG-18117F01 Choranthus radians Cuba, 2010 USNM
NVG-15096F11 Choranthus richmondi HT Bahamas, old (around 1900) CMNH
NVG-18033G06 Choranthus vitellius Puerto Rico, 2015 MWalker
NVG-17108F02 Clytius clytius USA: AZ, Santa Cruz Co., 1991 LACM
NVG-15111G10 Clytius shola Venezuela, 1907 AMNH
NVG-18013A06 Cobalopsis autumna Costa Rica, old (around 1900) USNM
NVG-15035A06 Cobalopsis autumna ST Panama, 1876 ZMHB
NVG-15035D09 Cobalopsis autumna (=edda) ST Panama, old (around 1900) ZMHB
NVG-18064B10 Cobalopsis dictys Costa Rica, 2012, 12-SRNP-22065 USNM
NVG-21013C10 Cobalopsis dictys Guatemala, old (around 1900) CMNH
NVG-19021D02 Cobalopsis nero French Guiana, 1993 USNM
NVG-15034H09 Cobalopsis nero ST no data, old (around 1900) ZMHB
NVG-15035D11 Cobalopsis nero (=dyscritus) T Colombia, old (around 1900) ZMHB
NVG-19021D10 Cobalopsis valerius French Guiana, 1993 USNM
NVG-19021D09 Cobalopsis valerius Venezuela, 1985 USNM
NVG-15035E03 Cobalopsis valerius HT Colombia, 1876 ZMHB
NVG-18025H04 Cobalopsis valerius (=elegans) HT Ecuador, 1939 AMNH
NVG-18116A03 Cobalopsis valerius (=miaba) ST no data, prior to 1902 USNM
NVG-15096B09 Cobalopsis valerius (=potaro) HT Guyana, old (around 1900) CMNH
NVG-18027A08 Cobalopsis zetus HT Mexico: Guerrero, 1911 AMNH
NVG-18112A09 Cobalus fidicula Panama, 1984 USNM
NVG-7927 Cobalus virbius virbius Costa Rica, 2012, 12-SRNP-22162 USNM
NVG-18044A12 Coladenia indrani tessa Sri Lanka, 1973 USNM
NVG-18093F11 Coladenia ochracea HT Philippines, 1988 SMF
NVG-18055C01 Coladenia palawana ST Palawan, 1888 ZMHB
NVG-18091C10 Conga chydaea Ecuador, 2012 EBrockmann
NVG-19012H09 Conga chydaea USA: TX, Hidalgo Co., 1973 TAMU
NVG-15036F12 Conga chydaea (=binaria) ST Venezuela, old (around 1900) ZMHB
NVG-18119E02 Conga immaculata Brazil: RJ, 1995 USNM
NVG-18119E01 Conga urqua Brazil: SC, 1973 USNM
NVG-18119E05 Conga zela Brazil: Rio Grande do Sul, 1962 USNM
NVG-18052D05 Contrastia distigma (=stigmula) ST no data, prior to 1891 ZMHB
NVG-19012H07 Corta lycortas Mexico: Tamaulipas, 1974 TAMU
NVG-17092F04 Corticea corticea Costa Rica, 2012, 12-SRNP-70085 USNM
NVG-18026A01 Corticea graziellae HT Brazil: Paraiba, 1954 AMNH
NVG-18114H07 Corticea lysias lysias Panama, 1981 USNM
NVG-18043C03 Corticea mendica ?PLT Bolivia, 1894 ZMHB
NVG-18026G09 Corticea schwarzi HT Colombia, 1935 AMNH
NVG-18114H10 Corticea schwarzi Ecuador, 1988 USNM
NVG-18026G10 Corticea similea HT Mexico: Guerrero, before 1947 AMNH
NVG-15096A02 Corticea sylva ST Ecuador, old (around 1900) CMNH
NVG-18114H08 Corticea sylva Ecuador, 1993 USNM
NVG-18096C08 Corticea vicinus Colombia, old (around 1900) MTD
NVG-21012E11 Corticea vicinus Colombia, 1915 CMNH
NVG-20114G08 Creteus cyrina cyrina Thailand, 1980 KMaruyama
NVG-17092G08 Cumbre cumbre Brazil: RJ, 1994 USNM
NVG-15104C10 Cymaenes aequatoria HT Ecuador, 1938 AMNH
NVG-19018F09 Cymaenes edata Colombia, 1972 USNM
NVG-19018F08 Cymaenes edata Venezuela, 1981 USNM
NVG-19018F07 Cymaenes isus Panama, 1985 USNM
NVG-3401 Cymaenes isus USA: TX, Hidalgo Co., 2015 UTSW
NVG-18043C06 Cymaenes lumina LT no data, prior to 1869 ZMHB
NVG-18113D03 Cymaenes lumina (=corescene) ST Brazil: Parana, prior to 1902 USNM
NVG-19018F12 Cymaenes lumina (=odilia) Brazil: Parana, 1971 USNM
NVG-19018G03 Cymaenes lumina (=odilia) Brazil: Rio Grande do Sul, 1956 USNM
NVG-19018G04 Cymaenes lumina (=odilia) Paraguay, old (around 1900) USNM
NVG-15034E04 Cymaenes lumina (=trebius) T Colombia, old (around 1900) ZMHB
NVG-17102E10 Cymaenes miqua T Peru, 1911 USNM
NVG-19093C05 Cymaenes psyllus Peru, 2001 USNM
NVG-19017H05 Cymaenes tripunctus tripunctus British Virgin Islands, 1986 USNM
NVG-19017H02 Cymaenes tripunctus tripunctus Cuba, 2010 USNM
NVG-10329 Cymaenes tripunctus tripunctus Jamaica, 2017 UTSW
NVG-4842 Cymaenes tripunctus tripunctus USA: FL, Collier Co., 2015 UTSW
NVG-7960 Cynea (Cynea) cynea Costa Rica, 2010, 10-SRNP-35740 USNM
NVG-18119B12 Cynea (Cynea) cyrus rhino Guyana, 2000 USNM
NVG-18119D04 Cynea (Cynea) diluta Guyana, 2000 USNM
NVG-15035D08 Cynea (Cynea) diluta (=osembo) HT Suriname, 1876 ZMHB
NVG-18119C09 Cynea (Nycea) corisana Guyana, 1999 USNM
NVG-18119C10 Cynea (Nycea) hycsos hycsos Guyana, 1999 USNM
NVG-18119C05 Cynea (Nycea) iquita Peru, 1986 USNM
NVG-19024H03 Cynea (Nycea) irma Costa Rica, 2015, 15-SRNP-20106 USNM
NVG-18119C04 Cynea (Nycea) melius Brazil: RJ, 1996 USNM
NVG-20086E05 Cynea (Nycea) robba Ecuador, 2019 KMaruyama
NVG-7959 Cynea (Quinta) cannae Costa Rica, 2012, 12-SRNP-75508 USNM
NVG-18014F05 Dalla caicus inca Peru, 2011 USNM
NVG-18014F03 Dalla frater Peru, 2013 USNM
NVG-18017B12 Dalla semiargentea Colombia, 1965 USNM
NVG-17111B10 Damas clavus Brazil: Rondonia, 1993 LACM
NVG-18055F11 Darpa dealbata ST Malacca, old (around 1900) ZMHB
NVG-17119A11 Darpa hanria India, 1890 USNM
NVG-18104D02 Darpa pteria Phillippines, 1985 USNM
NVG-7330 Darpa striata striata Malaysia, old (around 1900) USNM
NVG-17095D05 Decinea antus Brazil: SC, 1991 USNM
NVG-18026A05 Decinea antus (=huntingtoni) HT Brazil: SC, 1930 AMNH
NVG-20087B07 Decinea colombiana sp. n. Colombia, 2017 KMaruyama
NVG-18021C01 Decinea decinea Brazil: SC, old (around 1900) AMNH
NVG-17095C10 Decinea decinea (=fortis) Brazil: Parana, 1995 USNM
NVG-18118B08 Decinea denta denta Ecuador, 1990 USNM
NVG-17095C12 Decinea denta denta Peru, 1989 USNM
NVG-17109H09 Decinea huasteca Mexico: Hidalgo, 1981 LACM
NVG-18026A04 Decinea huasteca HT Mexico: San Luis Potosi, 1966 AMNH
11-BOA-13385E10 Diaeus lacaena Brazil: RJ, 1996 USNM
NVG-19023F09 Dion carmenta Ecuador, 1973 USNM
NVG-18013B08 Dion gemmatus Panama, 1983 USNM
NVG-19023H01 Dion iccius Peru, 1987 USNM
NVG-18021B04 Dion meda Brazil: SC, 1920 AMNH
NVG-7919 Dion uza Costa Rica, 2008, 08-SRNP-40522 USNM
NVG-18054F12 Dotta callicles Namibia, 1992 ZMHB
NVG-17093B03 Dotta stellata stellata Kenya, 1957 USNM
NVG-17093A12 Dotta tura Tanzania, 1954 USNM
NVG-8038 Dubia dubia Guyana, 1999 USNM
NVG-18012D08 Dubiella dubius Peru, 1989 USNM
NVG-17098F01 Duroca duroca duroca Brazil: RJ, 1996 USNM
NVG-15026C05 Dyscophellus basialbus sp. n. HT Brazil: Rondonia, 1993 MGCL
NVG-15026C06 Dyscophellus basialbus sp. n. PT Brazil: Rondonia, 1993 MGCL
NVG-15031F05 Dyscophellus damias LT Brazil: Para, old (around 1900) ZMHB
NVG-15031F12 Dyscophellus damias (=erythras) LT Brazil: Para, old (around 1900) ZMHB
NVG-17104D04 Dyscophellus damias (=erythras) Colombia, 1971 USNM
NVG-18025C02 Dyscophellus damias (=tarquinius) HT Peru, 1926 AMNH
NVG-18086A07 Dyscophellus diaphorus HT Suriname, 1910 MNHP
NVG-15026C09 Dyscophellus mielkei PT Brazil: Rondonia, 1992 MGCL
NVG-17104E12 Dyscophellus porcius Venezuela, 1984 USNM
NVG-15104B04 Dyscophellus porsena HT Peru, 1931 AMNH
NVG-18101G09 Dyscophellus ramon Mexico: Veracruz, 1941 AMNH
NVG-17104C07 Dyscophellus ramusis French Guiana, old (around 1900) USNM
NVG-17104D06 Dyscophellus sebaldus Brazil: Amazonas, 1970 USNM
NVG-17119A02 Eagris sabadius andracne Madagascar, 1988 USNM
NVG-18074B06 Eagris tetrastigma tetrastigma Neukamerun, 1914 ZMHB
NVG-18111G10 Ebusus ebusus ebusus Peru, 2015 USNM
NVG-19113D07 Echelatus sempiternus dilloni Dominican Republic, 1981 USNM
NVG-7884 Echelatus sempiternus sempiternus Costa Rica, 2007, 07-SRNP-12147 USNM
NVG-19113C10 Echelatus sempiternus simplicior Venezuela, 1988 USNM
NVG-7869 Eetion elia Malaysia, 1990 USNM
NVG-18067C08 Emmelus purpurascens Peru, 2001 EBrockmann
NVG-18019B11 Eogenes alcides Turkey, old (around 1900) AMNH
NVG-17093E07 Ephyriades arcas philemon St. Croix, 1996 USNM
NVG-15032B08 Ephyriades brunnea brunnea ST Cuba, prior to 1865 ZMHB
NVG-17093D12 Ephyriades brunnea brunnea Cuba, 2010 USNM
NVG-15032B07 Ephyriades brunnea brunnea ST Cuba?, prior to 1865 ZMHB
NVG-17095E06 Ephyriades brunnea floridensis USA: FL, Monroe Co., 1987 USNM
NVG-17095E09 Ephyriades dominicensis Dominica, 1965 USNM
NVG-18024F07 Ephyriades dominicensis HT Dominica, 1929 AMNH
NVG-10476 Ephyriades jamaicensis Jamaica, 2017 UTSW
NVG-15032B05 Ephyriades jamaicensis ST Jamaica, 1876 ZMHB
NVG-15032B06 Ephyriades jamaicensis ST Jamaica, 1876 ZMHB
NVG-17095E01 Ephyriades zephodes Dominican Republic, 1981 USNM
NVG-18081A02 Eprius (Repens) repens PT Paraguay, 1904, NHMUK_010430831, 0247279233 BMNH
NVG-17092F09 Eprius (Eprius) veleda Costa Rica, 2006, 06-SRNP-47351 USNM
NVG-17069B02 Eretis melania Tanzania, 1963 USNM
NVG-7910 Erionota thrax USA: HI, Molokai, 2005 USNM
NVG-20049A12 Euphyes antra Belize, 2000 JShuey
PAO-1422 Euphyes kiowah USA: CO, Jefferson Co., 2020 UTSW
NVG-8380 Euphyes kiowah USA: TX, Blanco Co., 2017 UTSW
NVG-8743 Euphyes kiowah USA: TX, Randall Co., 2017 UTSW
NVG-15102B04 Euphyes kiowah USA: NM, Otero Co., 1986 USNM
NVG-18025F07 Euphyes kiowah chamuli HT Mexico: Chiapas, 1965 AMNH
NVG-19024F10 Euphyes peneia Costa Rica, 2011, 11-SRNP-69003 USNM
NVG-10408 Euphyes singularis insolata Jamaica, 2017 UTSW
NVG-15102B02 Euphyes vestris harbisoni PT USA: CA, San Diego Co., 1982 USNM
NVG-3252 Euphyes vestris metacomet USA: OH, Pauling Co., 1971 TAMU
NVG-4200 Euphyes vestris metacomet USA: TX, Dallas Co., 2015 UTSW
NVG-4614 Euphyes vestris metacomet USA: FL, Sumter Co., 2015 UTSW
PAO-444 Euphyes vestris vestris USA: CA, Plumas Co., 2017 UTSW
NVG-14063E01 Euriphellus euribates Peru, 2013 USNM
NVG-17103G01 Euriphellus marian Peru, 1994 USNM
NVG-18052E06 Euriphellus phraxanor Panama, 1896 ZMHB
NVG-15103B05 Euschemon rafflesia rafflesia Australia, probably around 1946 USNM
NVG-18064B09 Eutocus facilis Costa Rica, 2006, 06-SRNP-47959 USNM
NVG-20086E11 Eutocus quichua Peru, 2018 KMaruyama
NVG-18043G11 Eutocus vetulus ST Panama, prior to 1883 ZMHB
NVG-18026D05 Eutus mubevensis HT Paraguay, before 1932 AMNH
NVG-18116C07 Eutus rastaca ST Brazil: RJ, prior to 1902 USNM
NVG-18025E10 Eutus rastaca (=brema) HT Brazil: SC, 1923 AMNH
NVG-7942 Eutychide paria Costa Rica, 2006, 06-SRNP-34336 USNM
NVG-19023E01 Eutychide physcella Brazil: Minas Gerais, 1990 USNM
NVG-18012E10 Falga jeconia jeconia Venezuela, 1985 USNM
NVG-18031H08 Festivia festiva Brazil: Rondonia, 1989 USNM
NVG-17092F07 Flaccilla aecas Costa Rica, 2015, 15-SRNP-45377 USNM
NVG-18073A06 Flandria weberi Gabun, old (around 1900) ZMHB
NVG-7762 Fulda coroller Madagascar, 1991 USNM
NVG-15031G03 Fulvatis fulvius Brazil: Para, old (around 1900) ZMHB
NVG-15031G04 Fulvatis fulvius ST Brazil: Para, old (around 1900) ZMHB
NVG-15104A06 Fulvatis scyrus HT Peru, 1931 AMNH
NVG-7808 Galerga hyposticta Madagascar, 1990 USNM
NVG-18113C04 Gallio carasta ST Brazil: RJ, prior to 1902 USNM
NVG-18025G08 Gallio danius HT Brazil: SC, before 1941 AMNH
NVG-18113E09 Gallio garima garima ST Trinidad and Tobago, prior to 1902 USNM
NVG-18026C07 Gallio garima massarus HT Brazil: SC, before 1940 AMNH
NVG-19021H07 Gallio garima massarus Brazil: RJ, 1994 USNM
NVG-18026C04 Gallio madius HT Brazil: SC, before 1941 AMNH
NVG-18043G01 Gallio seriatus ST Venezuela, prior to 1891 ZMHB
NVG-18099H10 Gamia shelleyi Uganda, 1953 USNM
NVG-16108F09 Gangara thyrsis Philippines, 1987 USNM
NVG-18057H08 Ge geta no data, 1894 ZSMC
NVG-18054G09 Gegenes pumilio Namibia, 1992 ZMHB
NVG-17119G09 Gerosis phisara Myanmar, 2002 USNM
NVG-19017D01 Ginungagapus bocus Brazil: RJ, 1995 USNM
NVG-19017D03 Ginungagapus ranesus Brazil: Minas Gerais, 1990 USNM
NVG-19017D02 Ginungagapus schmithi Brazil: Parana, 1995 USNM
NVG-15035F09 Godmia chlorocephala ST Panama, old (around 1900) ZMHB
NVG-15033D06 Gorgopas agylla ST Bolivia, old (around 1900) ZMHB
11-BOA-13383B01 Gorgopas chlorocephala chlorocephala Peru, 2009 USNM
NVG-15034D01 Gorgopas extensa ST Peru, 1887 ZMHB
NVG-17093D09 Gorgopas petale Brazil: RJ, 1995 USNM
NVG-7975 Gorgopas trochilus Peru, 2008 USNM
NVG-19018H04 Gracilata quadrinotata Panama, 1981 USNM
NVG-18019F12 Gretna cylinda Uganda, 1953 AMNH
NVG-21013F02 Gubrus lugubris Brazil: Para, 1918 CMNH
NVG-21013F01 Gubrus lugubris PT Peru, 1920 CMNH
NVG-18025H09 Gufa fusca HT Brazil: SC, 1925 AMNH
NVG-18113F02 Gufa gulala ST Brazil: Parana, prior to 1902 USNM
NVG-18013A12 Halotus angellus Panama, 1976 USNM
NVG-19021H12 Halotus rica Mexico: Puebla, 1991 USNM
NVG-17119G01 Halpe porus Myanmar, 2001 USNM
NVG-18052D09 Haza hazarma LT no data, prior to 1877 ZMHB
NVG-7886 Helias cama Costa Rica, 2008, 08-SRNP-2560 USNM
NVG-18032C05 Helias phalaenoides palpalis Brazil: RJ, 1994 USNM
NVG-17109G07 Heliopetes alana Guatemala, 2003 LACM
NVG-5229 Heliopetes domicella domicella USA: TX, Starr Co., 2015 UTSW
11-BOA-13385C12 Heliopetes ericetorum USA: AZ, Gila Co., 2012 NGrishin
NVG-3338 Heliopetes laviana laviana USA: TX, Cameron Co., 2015 UTSW
NVG-5250 Heliopetes macaira USA: TX, Cameron Co., 2015 UTSW
NVG-14114E04 Heliopetes sublinea USA: TX, Hidalgo Co., 2014 TLS
NVG-18072H06 Herila herilus Tanzania, 1887 ZMHB
NVG-19016C09 Hermio hermione Panama, 1977 USNM
NVG-18068A06 Hesperia comma lena Russia, 1990 EBrockmann
NVG-17067A11 Hesperopsis alpheus alpheus USA: NM, Sandoval Co., 1984 CSUC
NVG-17067A09 Hesperopsis libya libya USA: CA, Inyo Co., 2009 CSUC
NVG-17069E08 Heteropterus (Heteropterus) morpheus France, 1966 USNM
NVG-18089B03 Heteropterus (Pulchroptera) pulchra China: Yunnan, 1988 EBrockmann
NVG-7823 Hidari irava Singapore, 1989 USNM
NVG-18072H08 Hollandus xanthopeplus Cameroon, 1895 ZMHB
NVG-18072H07 Hollandus xanthopeplus Equatorial Guinea, 1906 ZMHB
NVG-18015D07 Hoodus jason Gyuana, 1999 USNM
NVG-7882 Hoodus pelopidas Costa Rica, 2008, 08-SRNP-55556 USNM
NVG-7767 Hovala pardalina Madagascar, 1988 USNM
NVG-19044C06 Hypoleucis dacena Uganda, 1953 AMNH
NVG-18075D02 Hypoleucis dacena (=leucopogon) T Cameroon, 1889 ZMHB
NVG-19043C09 Hypoleucis ophiusa ophiusa Ghana, 1969 AMNH
NVG-17091H02 Hypoleucis tripunctata draga Uganda, 1960 USNM
NVG-7376 Iambrix salsala Myanmar, 2003 USNM
NVG-7806 Idmon distanti Malaysia, 1990 USNM
NVG-17091E06 Ilma irvina Indonesia, old (around 1900) USNM
NVG-18059B11 Incisus incisus Brazil: RJ, 1995 USNM
NVG-17091D04 Isma obscura purpurascens Malaysia, 1966 USNM
NVG-18067G09 Isoteinon abjecta Ghana, 1979 EBrockmann
NVG-17091A07 Isoteinon lamprospilus formosanus Taiwan, 1980 USNM
NVG-7953 Joanna joanna Costa Rica, 2004, 04-SRNP-14377 USNM
NVG-19023D08 Justinia (Justinia) gava Guyana, 2000 USNM
NVG-19023D07 Justinia (Justinia) justinianus justinianus Brazil: Mato Grosso, 1991 USNM
NVG-7949 Justinia (Justinia) norda Costa Rica, 2011, 11-SRNP-33301 USNM
NVG-18026C02 Justinia (Septia) maculata HT Bolivia, before 1930 AMNH
NVG-18053B08 Katreus johnstonii apicalis Sierra Leone, 1887 ZMHB
NVG-17108F10 Kedestes lepenula South Africa, 1943 LACM
NVG-17119C03 Kerana armatus Malaysia, 1983 USNM
NVG-18101C09 Kerana gemmifer dombya Sarawak, 1966 USNM
NVG-17069F06 Kobelana kobela South Africa, 1978 USNM
NVG-18063C05 Kobrona kobros ST Indonesia, 1883 ZSMC
NVG-15035H09 Koria kora T Brazil: RJ, old (around 1900) ZMHB
NVG-18101C05 Koruthaialos (Koruthaialos) rubecula hector Myanmar, 2003 USNM
NVG-18095B09 Koruthaialos (Stimula) butleri India, old (around 1900) MTD
NVG-18095B10 Koruthaialos (Stimula) butleri India, old (around 1900) MTD
NVG-18101B07 Koruthaialos (Stimula) focula focula Java, old (around 1900) USNM
NVG-18101B08 Koruthaialos (Stimula) focula kerala Sumatra, old (around 1900) USNM
NVG-18101B09 Koruthaialos (Stimula) frena Malaysia, old (around 1900) USNM
NVG-18101C03 Koruthaialos (Stimula) sindu sindu Malaysia, old (around 1900) USNM
NVG-18063C02 Koruthaialos (Stimula) swinhoei swinhoei India, old (around 1900) ZSMC
NVG-18014F02 Ladda eburones eburones Peru, 2008 USNM
NVG-18014F01 Ladda monospila Peru, 2010 USNM
NVG-18014E10 Ladda quadristriga Peru, 2013 USNM
NVG-8041 Lamponia lamponia Brazil: Parana, 1995 USNM
NVG-19022G06 Lamponia ploetzii morretesi Brazil, old (around 1900) USNM
NVG-19023F03 Lamponia ploetzii ploetzii Brazil: RJ, 1996 USNM
NVG-19022G07 Lamponia ploetzii ploetzii no data [SE Brazil], old (around 1900) USNM
NVG-18025D08 Lattus arabupuana HT Brazil: Roraima, 1927 AMNH
NVG-18075C11 Lennia binoevatus T Gabon, 1888 ZMHB
NVG-18087A07 Lennia lena Ivory Coast, 1963 MNHP
NVG-18096E03 Lennia maracanda Congo, old (around 1900) MTD
NVG-18012F03 Lento lento Brazil: Mato Grosso, 1991 USNM
NVG-18087A09 Leona leonora leonora Gabon, 1969 MNHP
NVG-18075D01 Leona stoehri T Togo, prior to 1893 ZMHB
NVG-17093A04 Lepella lepeletier Uganda, 1951 USNM
NVG-18089G10 Leptalina unicolor Japan, 1986 EBrockmann
NVG-19021F01 Lerema (Geia) etelka Brazil: RJ, old (around 1900) USNM
NVG-19017H11 Lerema (Geia) etelka Guyana, 1989 USNM
NVG-18113E06 Lerema (Geia) etelka ST Trinidad and Tobago, prior to 1902 USNM
NVG-15035F08 Lerema (Geia) geisa ST Colombia, old (around 1900) ZMHB
NVG-19021E12 Lerema (Geia) geisa Ecuador, 1990 USNM
NVG-19021E11 Lerema (Geia) geisa Panama, 1981 USNM
NVG-19021E09 Lerema (Geia) lyde Costa Rica, 2003 USNM
NVG-21013E01 Lerema (Geia) lyde ST Mexico: Veracruz, old (around 1900) CMNH
NVG-21013E02 Lerema (Geia) lyde ST Mexico: Tabasco, old (around 1900) CMNH
NVG-4792 Lerema (Lerema) accius USA: FL, Levy Co., 2015 UTSW
NVG-7253 Lerema (Lerema) ancillaris Brazil: Amazonas, 1993 USNM
NVG-19021E06 Lerema (Lerema) bipunctata Colombia, 1992 USNM
NVG-15035G01 Lerema (Lerema) bipunctata T Panama, old (around 1900) ZMHB
NVG-7738 Lerema (Lerema) lineosa Brazil: Mato Grosso, 1991 USNM
NVG-18052A07 Lerema (Lerema) lineosa (=aethra) ST Suriname, 1882 ZMHB
NVG-3194 Lerema (Lerema) liris Mexico: Tamaulipas, 1973 TAMU
NVG-7737 Lerema (Lerema) lucius sp. n. HT Panama, 1973 USNM
NVG-15036E08 Lerema (Morys) ancus ST Colombia, old (around 1900) ZMHB
NVG-18115D01 Lerema (Morys) ancus Guyana, 2000 USNM
NVG-19021F09 Lerema (Morys) compta Guyana, 2000 USNM
NVG-19021F06 Lerema (Morys) micythus Mexico: Guerrero, 1989 USNM
NVG-19021G01 Lerema (Morys) subgrisea subgrisea Brazil: Mato Grosso, 1990 USNM
NVG-19021F12 Lerema (Morys) valda Panama, 1976 USNM
NVG-18026H11 Lerema (Morys) venias HT Venezuela, before 1942 AMNH
NVG-4062 Lerodea eufala USA: TX, Dallas Co, 2015 UTSW
NVG-18013D11 Libra aligula aligula Brazil: RJ, 1995 USNM
NVG-18115C09 Limochores catahorma Mexico: Puebla, 1952 USNM
NVG-18115C10 Limochores catahorma Mexico: Oaxaca, 1990 USNM
NVG-18094H05 Limochores catahorma Mexico, old (around 1900) MTD
NVG-18113C05 Limochores catahorma HT Mexico: Guerrero, 1913 USNM
NVG-4547 Limochores origenes origenes USA: OK, Atoka Co., 2015 UTSW
NVG-18013C08 Limochores pupillus Mexico: Durango, 1972 USNM
NVG-18013C09 Limochores pupillus Mexico: Durango, 1964 USNM
NVG-18052A04 Limochores pupillus (& =puxillius) LT,HT Mexico, prior to 1882 ZMHB
NVG-18067H07 Lindra simulius Ecuador, 2012 EBrockmann
NVG-19043E01 Lissia lissa lima Uganda, 1954 AMNH
NVG-7373 Lotongus calathus balta Myanmar, 2003 USNM
NVG-18075G04 Lotongus calathus parthenope (=tetragraphus) ST Amboina, 1886 ZMHB
NVG-18094A09 Lotongus calathus shigeoi PT Philippines, 1994 SMF
NVG-18074B02 Lotongus calathus taprobanus ST Indonesia, 1882 ZMHB
NVG-19018H02 Lucida leopardus Bolivia, 2003 USNM
NVG-8026 Lucida lucia Brazil: Minas Gerais, 1994 USNM
NVG-18093B11 Lucida melitaea LT Colombia, prior to 1923 SMF
NVG-19017C10 Lucida oebasus Panama, 1985 USNM
NVG-15033D05 Lucida scopas ST Venezuela, old (around 1900) ZMHB
NVG-8015 Ludens levina Brazil: RJ, 1995 USNM
NVG-7940 Ludens ludens Costa Rica, 2012, 11-SRNP-33493 USNM
NVG-19017B11 Ludens petrovna Guyana, 2000 USNM
NVG-19019F07 Lurida lurida Brazil: Minas Gerais, 1994 USNM
NVG-19093F10 Lycas argentea Costa Rica, 2018, 18-SRNP-71129 USNM
NVG-18111A08 Lycas godart boisduvalii Peru, 2013 USNM
NVG-19023F12 Lychnuchus (Enosis) aphilos Peru, 1998 USNM
NVG-19023H02 Lychnuchus (Enosis) blotta Guyana, 2000 USNM
NVG-19021D06 Lychnuchus (Enosis) demon Peru, 1983 USNM
NVG-18066C01 Lychnuchus (Enosis) dognini Peru, 2003 EBrockmann
NVG-7969 Lychnuchus (Enosis) immaculata Costa Rica, 2008, 08-SRNP-40702 USNM
NVG-17069F01 Lychnuchus (Enosis) topo Peru, 2009 USNM
NVG-2076 Lychnuchus (Lychnuchus) celsus Brazil: Parana, 2011 MEM
NVG-18019F03 Malaza carmides Madagascar, old (around 1900) AMNH
NVG-7787 Matapa aria Philippines, 1986 USNM
NVG-1461 Megathymus streckeri streckeri USA: AZ, Apache Co., 2013 UTSW
NVG-1528 Megathymus ursus ursus USA: AZ, Pima Co., 2013 UTSW
NVG-1185 Megathymus yuccae yuccae USA: SC, Aiken Co., 2013 UTSW
NVG-17108A04 Methion melas Guatemala, 1963 BMUW
NVG-19019D10 Methion melas Mexico: Chiapas, 1975 USNM
NVG-8043 Methionopsis (Methionopsis) cinnamomea Brazil: RJ, 1995 USNM
NVG-18052A01 Methionopsis (Methionopsis) ina LT Panama, 1876 ZMHB
NVG-18064B11 Methionopsis (Methionopsis) ina (=typhon) Costa Rica, 2010, 10-SRNP-43176 USNM
NVG-19099G06 Methionopsis (Methionopsis) ina (=typhon) Panama, 1972 USNM
NVG-7966 Methionopsis (Methionopsis) modestus Costa Rica, 2007, 07-SRNP-23257 USNM
NVG-19012G01 Methionopsis (Methionopsis) modestus Mexico: Tamaulipas, 1974 TAMU
NVG-18026F05 Methionopsis (Methionopsis) purus HT Peru, 1929 AMNH
NVG-8030 Methionopsis (Mnasinous) patage Panama, 1996 USNM
NVG-19023G09 Metiscus angularis Peru, 1984 USNM
NVG-15036E09 Metiscus angularis HT Suriname, old (around 1900) ZMHB
NVG-15036F08 Metiscus angularis (=astur) T Brazil: Amazonas, old (around 1900) ZMHB
NVG-21013D10 Metiscus atheas Colombia, old (around 1900) CMNH
NVG-7947 Metiscus atheas Costa Rica, 2004, 04-SRNP-14922 USNM
NVG-18021B06 Metiscus atheas Mexico: Veracruz, 1942 AMNH
NVG-21013E08 Metiscus atheas ST Mexico: Tabasco, old (around 1900) CMNH
NVG-21013E09 Metiscus atheas ST Mexico: Tabasco, old (around 1900) CMNH
NVG-18026C08 Metiscus atheas (=matheri) HT Mexico: Veracruz, 1963 AMNH
NVG-17093A11 Metisella meninx South Africa, 1949 USNM
NVG-17093A02 Metisella metis paris Uganda, 1958 USNM
NVG-18118A04 Metrocles argentea Bolivia, 1946 USNM
NVG-17092D11 Metrocles briquenydan chalcone Brazil: RJ, 1995 USNM
NVG-18098F12 Metrocles devergens devergens French Guiana, 2015 BHermier
NVG-18013D12 Metrocles hyboma Paraguay, old (around 1900) USNM
NVG-18013E04 Metrocles leucogaster leucogaster Panama, 1977 USNM
NVG-17092E04 Metrocles propertius Peru, 2012 USNM
NVG-18026G04 Metrocles santarus HT Brazil: SC, before 1940 AMNH
NVG-18117A02 Metrocles scitula Brazil: Mato Grosso, 1991 USNM
NVG-7957 Metron chrysogastra chrysogastra Costa Rica, 2013, 13-SRNP-22628 USNM
NVG-15035G02 Metron fasciata HT Suriname, old (around 1900) ZMHB
NVG-18117A12 Metron fasciata (=verdanta) Venezuela, 1985 USNM
NVG-17092E05 Metron hypochlora hypochlora Peru, 2008 USNM
NVG-18013E09 Metron noctis Ecuador, 1989 USNM
NVG-18043D01 Metron oropa ST Brazil, prior to 1877 ZMHB
NVG-18043H03 Metron voranus LT Colombia, prior to 1891 ZMHB
NVG-18111C09 Metron voranus (=anita) ST Brazil: RJ, prior to 1902 USNM
NVG-18116H12 Metron voranus (=tania) ST Brazil: RJ, prior to 1902 USNM
NVG-18117B02 Metron zimra Peru, 2016 USNM
NVG-19043C12 Meza meza meza no data, old (around 1900) AMNH
NVG-18057A07 Mielkeus diana diana LT Brazil, prior to 1886 ZSMC
NVG-19022F12 Mielkeus klugi Guyana, 1999 USNM
NVG-19022G02 Mielkeus lucretius Peru, 2000 USNM
NVG-19113G07 Mielkeus tertianus Ecuador, 2002 USNM
NVG-7814 Miraja varians Madagascar, 1988 USNM
NVG-17069F02 Misius misius Guyana, 2001 USNM
NVG-18025D11 Mit (Mit) badius HT Bolivia, before 1930 AMNH
NVG-18025H10 Mit (Mit) gemignanii HT Argentina, 1907 AMNH
NVG-19023G10 Mit (Rotundia) schausi Brazil: RJ, 1977 USNM
NVG-18025E09 Mnasalcas boyaca HT Colombia, 1971 AMNH
NVG-19019E03 Mnasalcas ritans Brazil: RJ, 1996 USNM
NVG-18013A04 Mnasalcas simplicissima Panama, 1984 USNM
NVG-20086D11 Mnasalcas thymoetes Ecuador, 2019 KMaruyama
NVG-19019F06 Mnaseas bicolor Guatemala, old (around 1900) USNM
NVG-18116H03 Mnaseas bryna Colombia, 1972 USNM
NVG-18116H07 Mnaseas derasa derasa Brazil: RJ, 1995 USNM
NVG-18116H08 Mnaseas derasa derasa Brazil, old (around 1900) USNM
NVG-18111C07 Mnaseas derasa derasa (=amatala, =infuscata) LT,NT Brazil: RJ, old (around 1900) USNM
NVG-15034H04 Mnaseas derasa derasa (=gagatina) ST Brazil: RJ, old (around 1900) ZMHB
NVG-18098E11 Mnaseas evansi French Guiana, 1993 BHermier
NVG-18012H10 Mnaseas inca Venezuela, 1985 USNM
NVG-18013D07 Mnaseas kayei Guyana, 1999 USNM
NVG-19087A03 Mnaseas macia Colombia, 1985 USNM
NVG-18026C05 Mnaseas mapirica HT Bolivia, before 1930 AMNH
NVG-18013D09 Mnaseas pandora Brazil: Mato Grosso, 1992 USNM
NVG-8054 Mnaseas sirene Brazil: RJ, 1994 USNM
NVG-19069A06 Mnasicles (Mnasicles) geta Mexico: Tamaulipas, 1972 TMMC
NVG-8028 Mnasicles (Mnasicles) hicetaon Guyana, 1999 USNM
NVG-19016H11 Mnasicles (Nausia) nausiphanes Panama, 1977 USNM
NVG-17092C08 Mnasicles (Remella) remus Costa Rica, 2006, 06-SRNP-6640 USNM
NVG-18071D02 Mnasicles (Remella) rita Costa Rica, 2002, 02-SRNP-18003 USNM
NVG-19017A08 Mnasicles (Remella) vopiscus Venezuela, 1981 USNM
NVG-17095E11 Mnasicles (Styriodes) browni Costa Rica, 2006 USNM
NVG-19087A05 Mnasicles (Styriodes) lyco Panama, old (around 1900) USNM
NVG-19122D06 Mnasitheus chrysophrys (=cephis) Costa Rica, old (around 1900) USNM
NVG-19019E01 Mnasitheus nitra Panama, 1976 USNM
NVG-19019F02 Mnasitheus padus Peru, 2001 USNM
NVG-19019E06 Mnasitheus submetallescens Peru, 1986 USNM
NVG-19019D09 Mnasitheus sucova ST Brazil: RJ, old (around 1900) USNM
NVG-19122C10 Mnasitheus sucova Brazil: Rio Grande do Sul, 1961 USNM
NVG-19017E06 Mnestheus damma Ecuador, 1988 USNM
NVG-19017E07 Mnestheus ittona Panama, 1977 USNM
NVG-20017B04 Mnestheus silvaticus Peru, 2011 MUSM
NVG-18012H12 Moeris striga Brazil: RJ, 1995 USNM
NVG-8031 Molla molla Brazil: Parana, 1971 USNM
NVG-18117B04 Molo mango Guyana, 1999 USNM
NVG-18012D03 Molo pelta Peru, 2012 USNM
NVG-18019F10 Moltena fiara Natal, 1924 AMNH
NVG-17092G12 Monca crispinus Costa Rica, 2006, 06-SRNP-55847 USNM
NVG-18074G10 Monza alberti (=‡ab. alenicola) T Equatorial Guinea, 1906 ZMHB
NVG-17069H12 Monza cretacea Nigeria, 1951 USNM
NVG-18101A12 Monza punctata punctata Tanzania, 1954 USNM
NVG-18094B09 Mooreana princeps ST Philippines, old (around 1900) SMF
NVG-17069H09 Mopala orma Cameroon, old (around 1900) USNM
NVG-19024D07 Mucia zygia Ecuador, 1988 USNM
NVG-18088H04 Mylon maimon Peru, 2001 EBrockmann
NVG-19021G05 Naevolus brunnescens Ecuador, 1993 USNM
NVG-19023F05 Naevolus naevus Ecuador, 1976 USNM
NVG-7950 Naevolus orius Costa Rica, 2010, 10-SRNP-72281 USNM
NVG-17104F08 Nascus (Bron) broteas Costa Rica, 2008, 08-SRNP-66188 USNM
NVG-18088H10 Nascus (Bron) solon solon Brazil: Amazonas, 2007 EBrockmann
NVG-17104F12 Nascus (Nascus) phintias Costa Rica, 2005, 05-SRNP-2532 USNM
NVG-17103E10 Nascus (Nascus) phocus Venezuela, 1985 USNM
NVG-18098E12 Nascus (Praxa) prax French Guiana, 1996 BHermier
NVG-5736 Nascus (Pseudonascus) paulliniae Costa Rica, 2013, 13-SRNP-79622 USNM
NVG-15036G05 Nastra celeus ST Brazil: Para, old (around 1900) ZMHB
NVG-18091E04 Nastra celeus Ecuador, 2012 EBrockmann
NVG-19019B01 Nastra celeus Guyana, 2000 USNM
NVG-15036G06 Nastra chao LT Bolivia, old (around 1900) ZMHB
NVG-19017G08 Nastra ethologus Bolivia, 1987 USNM
NVG-18063A10 Nastra ethologus Paraguay, 2011 EBrockmann
NVG-3478 Nastra julia USA: TX, Duval Co., 2015 UTSW
NVG-17106A10 Nastra leucone leucone Costa Rica, 2012, 12-SRNP-76600 USNM
NVG-7567 Nastra leucone leucone Mexico: Tamaulipas, 1975 TAMU
NVG-3924 Nastra lherminier USA: AR, Montgomery Co., 2015 UTSW
NVG-19017G07 Nastra nappa Bolivia, 1987 USNM
NVG-4747 Nastra neamathla USA: FL, Levy Co., 2015 UTSW
NVG-17111E05 Nastra perigenes USA: TX, Cameron Co., 1963 LACM
NVG-15035E09 Nastra subsordida T Honduras, 1988 ZMHB
NVG-18026H08 Nastra subsordida (=trimacula) HT Panama, 1963 AMNH
NVG-18119E12 Neoxeniades (Bina) gabina Costa Rica, 1965 USNM
NVG-18119G09 Neoxeniades (Neoxeniades) Burns04 Costa Rica, 2004, 04-SRNP-55335 USNM
NVG-17095F04 Neoxeniades (Neoxeniades) ethoda Brazil: SC, 1991 USNM
NVG-18069F02 Neoxeniades (Neoxeniades) luda Costa Rica, 2014, 14-SRNP-20072 USNM
NVG-18082E06 Neoxeniades (Neoxeniades) musarion Brazil: RJ, old (around 1900), NHMUK_012824133, 0247279800 BMNH
NVG-19022C12 Neoxeniades (Neoxeniades) parna Colombia, 1969 USNM
NVG-18069F11 Neoxeniades (Neoxeniades) pluviasilva Costa Rica, 2016, 15-SRNP-32087 USNM
NVG-18114E01 Neoxeniades (Neoxeniades) scipio scipio Brazil: RJ, 1984 USNM
NVG-18066A05 Neoxeniades (Neoxeniades) turmada Peru, 2002 EBrockmann
NVG-17091A12 Nervia chaca Rhodesia, 1954 USNM
NVG-17091B06 Nervia nancy Kenya, 1960 USNM
NVG-18074G02 Nervia protensa (=chacoides) ST Cameroon, 1913 ZMHB
NVG-20126F09 Nervia wallengrenii wallengrenii South Africa, old (around 1900) CMNH
NVG-16106A03 Netrocoryne repanda Australia, 1963 LACM
NVG-17104C09 Nicephellus nicephorus Brazil: Paraiba, 1952 USNM
NVG-5740 Nicephellus nicephorus Costa Rica, 2002, 02-SRNP-27687 USNM
NVG-19022C03 Niconiades comitana Mexico: Veracruz, 1972 USNM
NVG-8066 Niconiades cydia Brazil, 1999 USNM
NVG-18042G06 Niconiades derisor ST Venezuela, prior to 1891 ZMHB
NVG-19022C10 Niconiades derisor (=vista) Venezuela, 1978 USNM
NVG-19022C08 Niconiades merenda Brazil: Parana, 1991 USNM
NVG-19022C11 Niconiades viridis viridis Peru, 2013 USNM
NVG-18013B02 Niconiades xanthaphes Guyana, 2000 USNM
NVG-20017C02 Noxys viricuculla Peru, 2012 MUSM
NVG-20013G10 Noxys viricuculla Peru, 2019 WDempwolf
NVG-4070 Nyctelius nyctelius USA: TX, Hidalgo Co., 2015 UTSW
NVG-18119A10 Nyctelius paranensis Brazil: SC, 1989 USNM
NVG-17106A11 Nyctus hiarbas Costa Rica, 2013, 12-SRNP-31778 USNM
NVG-17068C03 Oarisma poweshiek USA: MN, Pipestone Co., 1986 CSUC
PAO-23 Ochlodes agricola USA: CA, Sierra Co., 2016 UTSW
PAO-263 Ochlodes sylvanoides napa USA: CO, Larimer Co., 2016 UTSW
NVG-7746 Ochlodes venata venata Japan, 1933 USNM
NVG-19066H07 Ocybadistes walkeri sothis Australia, 1977 UCDC
NVG-18014F09 Oenides vulpina Peru, 2016 USNM
NVG-18021D06 Oeonus pyste Mexico: San Luis Potosi, 1967 AMNH
NVG-18014D12 Oerane microthyrus Philippines, 1984 USNM
NVG-17121C12 Oerane pugnans Sumatra, 1989 KMaruyama
NVG-8005 Oligoria (Cobaloides) argus Brazil: DF, 1969 USNM
NVG-18089H02 Oligoria (Cobaloides) locutia Brazil, 1997 EBrockmann
NVG-18098F03 Oligoria (Cobaloides) unica French Guiana, 2000 BHermier
NVG-18098F10 Oligoria (Oligoria) lucifer French Guiana, 2013 BHermier
NVG-8159 Oligoria (Oligoria) maculata USA: FL, Miami-Dade Co., 2017 UTSW
NVG-3761 Oligoria (Oligoria) percosius USA: TX, Hidalgo Co., 2015 UTSW
NVG-18031F01 Oligoria (Oligoria) rindgei HT Mexico: Oaxaca, 1961 AMNH
NVG-15117B01 Onenses hyalophora Mexico: Tamaulipas, 2003 CSUC
NVG-18118E02 Onespa nubis Mexico: Oaxaca, 1961 USNM
NVG-19023E10 Onophas columbaria columbaria Guyana, 2000 USNM
NVG-18081C10 Onryza meiktila Myanmar, 1926, NHMUK_010430878, 0247274748 BMNH
NVG-17104C01 Ornilius rotundus gen. n. et sp. n. Brazil: SC, 1990 USNM
NVG-17109G08 Orphe gerasa Venezuela, 1993 LACM
NVG-18112D04 Orphe vatinius Peru, 2015 USNM
NVG-18105H11 Orses cynisca Brazil: SC, 1989 USNM
NVG-18111A01 Orses itea Brazil: RJ, 1995 USNM
NVG-18026A06 Orthos orthos hyalinus HT Brazil: SC, 1930 AMNH
NVG-18119E10 Orthos orthos orthos Peru, 2016 USNM
NVG-18011G05 Ouleus fridericus fridericus Guyana, 2000 USNM
NVG-18119A12 Oxynthes corusca Panama, 1974 USNM
NVG-20087B06 Oxynthes trinka Peru, 2018 KMaruyama
NVG-8009 Oz ozias ozias Brazil: RJ, 1995 USNM
NVG-18111G02 Oz ozias ozina Peru, 2016 USNM
NVG-7899 Paches (Paches) loxus gloriosus Costa Rica, 2003, 03-SRNP-30995 USNM
NVG-19086D08 Paches (Tiges) exosa Peru, 2002 USNM
NVG-15033A05 Paches (Tiges) liborius liborius T Brazil: Bahia, old (around 1900) ZMHB
NVG-18017D09 Paches (Tiges) mutilatus Peru, 1982 USNM
NVG-18026E10 Panca paulo HT Brazil: Roraima, 1927 AMNH
NVG-18081A11 Panca subpunctuli Brazil: RS, 1973, NHMUK_010430832, 0247274599 BMNH
NVG-4155 Panoquina panoquin USA: TX, Jefferson Co., 2015 UTSW
NVG-19122C09 Papias allubita Brazil: Para, 1964 USNM
NVG-7968 Papias allubita Costa Rica, 2002, 02-SRNP-13739 USNM
NVG-18012C07 Papias allubita Peru, 2000 USNM
NVG-15036F04 Papias amyrna T Venezuela, old (around 1900) ZMHB
NVG-19043B01 Papias amyrna (=guianae) Guyana, 1933 AMNH
NVG-19019H07 Papias integra Colombia, 1969 USNM
NVG-19019H08 Papias integra Ecuador, 1990 USNM
NVG-20086F04 Papias integra Ecuador, 2017 KMaruyama
NVG-18021B07 Papias integra Guatemala, 1963 AMNH
NVG-15035E12 Papias integra LT Honduras, 1888 ZMHB
NVG-17111G07 Papias integra Mexico: Hidalgo, 1981 LACM
NVG-19019H06 Papias integra Panama, 1975 USNM
NVG-19093B07 Papias integra Panama, 1982 USNM
NVG-18043C11 Papias integra (=nubila) LT Venezuela, prior to 1891 ZMHB
NVG-18113G07 Papias latonia LT Costa Rica, prior to 1913 USNM
NVG-19021C11 Papias latonia Panama, 1979 USNM
NVG-18064B05 Papias phainis Costa Rica, 2005, 05-SRNP-20156 USNM
NVG-18064C05 Papias sp. (near quigua) Costa Rica, 2002, 02-SRNP-14500 USNM
NVG-18091D06 Papias subcostulata Ecuador, 2012 EBrockmann
NVG-20086C11 Papias subcostulata Ecuador, 2019 KMaruyama
NVG-19019H12 Papias subcostulata Peru, 1986 USNM
NVG-15035E11 Papias subcostulata Suriname, 1876 ZMHB
NVG-19022H07 Paracarystus evansi Brazil: RJ, 1994 USNM
NVG-8037 Paracarystus hypargyra Peru, 2013 USNM
NVG-19022H06 Paracarystus menestries menestries Brazil: Bahia, 1991 USNM
NVG-17069E11 Paracarystus ranka Peru, 2012 USNM
NVG-18118C09 Paratrytone aphractoia Mexico: Pueblo, 1990 USNM
NVG-18118D01 Paratrytone polyclea Mexico: Oaxaca, 1992 USNM
NVG-18015E01 Paratrytone rhexenor Mexico: Veracruz, old (around 1900) USNM
NVG-18118E07 Paratrytone samenta ST Mexico: Guerrero, 1912 USNM
NVG-18118E08 Paratrytone samenta ST Mexico: Jalisco, prior to 1914 USNM
PAO-148 Paratrytone snowi USA: CO, Jefferson Co., 2016 UTSW
NVG-7821 Pardaleodes bule Cameroon, 1989 USNM
NVG-17108G05 Pardaleodes edipus Zaire, 1981 LACM
NVG-19043B11 Pardaleodes fan Cameroon, old (around 1900) AMNH
NVG-20125B03 Pardaleodes fan HT Cameroon, old (around 1900) CMNH
NVG-17069F11 Pardaleodes fan Kenya, 1955 USNM
NVG-19067A03 Pardaleodes incerta incerta Kenya, 1987 UCDC
NVG-18099E10 Pardaleodes sator pusiella Uganda, 1949 USNM
NVG-19022H11 Pares maritza Peru, 1982 USNM
NVG-18026E08 Pares pares HT Paraguay, before 1959 AMNH
NVG-17095F05 Pares viridiceps Panama, 1979 USNM
NVG-7290 Parnara guttatus Myanmar, 2002 USNM
NVG-19019F11 Parphorus decora Panama, 1976 USNM
NVG-19019G01 Parphorus felta Ecuador, 2002 USNM
NVG-19019F08 Parphorus storax Panama, 1973 USNM
NVG-18082E01 Pastria pastria Papua New Guinea, 1982, NHMUK_010430882, 0247277187 BMNH
NVG-17091A04 Pedesta masuriensis India?, 1883 USNM
NVG-18065F12 Perichares butus Peru, 2015 EBrockmann
NVG-18105G09 Perichares chima Ecuador, 1984 USNM
NVG-19093F12 Perichares deceptus Costa Rica, 2011, 11-SRNP-35558 USNM
NVG-7986 Perichares haworthiana Brazil: Rondonia, 1992 USNM
NVG-19093F11 Perichares lotus Costa Rica, 2011, 11-SRNP-70355 USNM
NVG-10247 Perichares philetes Jamaica, 2017 UTSW
NVG-10343 Perichares philetes Jamaica, 2017 UTSW
NVG-18111A04 Perichares romeroi Venezuela, 2003 USNM
NVG-18111G04 Perichares saptine Guatemala, old (around 1900) USNM
NVG-18111G03 Perichares saptine Panama, 1976 USNM
NVG-18105H01 Perichares seneca seneca Brazil: Mato Grosso, 1991 USNM
NVG-15033G01 Perus coecatus T Brazil: RJ, old (around 1900) ZMHB
NVG-18058H07 Perus coecatus (=tadus) ST Brazil: RJ, prior to 1902 USNM
NVG-7826 Perus cordillerae Peru, 1999 USNM
NVG-20086G07 Perus manx Colombia, 2017 KMaruyama
NVG-18059B09 Perus manx Colombia, 1969 USNM
NVG-18059C09 Perus minor Ecuador, 1988 USNM
NVG-18059B05 Perus minor ST Peru, prior to 1902 USNM
NVG-19076F06 Perus narycus Ecuador, 2003 USNM
NVG-15032F04 Perus narycus T Peru, prior to 1889 ZMHB
NVG-18059A08 Perus parvus Costa Rica, 1971 USNM
NVG-19017D07 Phanes aletes Guyana, 1999 USNM
NVG-18012F07 Pheraeus odilia epidius Panama, 1982 USNM
NVG-18025F03 Phlebodes campo campo HT Brazil: RJ, 1947 AMNH
NVG-18025H08 Phlebodes fuldai HT Colombia, 1929 AMNH
NVG-19022F10 Phlebodes fuldai Suriname, old (around 1900) USNM
NVG-18013C03 Phlebodes pertinax Brazil: Amazonas, 1993 USNM
NVG-18043F10 Phlebodes sameda ST no data, prior to 1869 ZMHB
NVG-5316 Phocides batabano okeechobee USA: FL, Monroe Co., 2015 UTSW
NVG-17099D07 Phocides distans licinus Panama, 1969 USNM
NVG-18024H04 Phocides johnsoni HT Colombia, 1946 AMNH
NVG-17113G02 Phocides lilea USA: TX, Cameron Co., 1986 TAMU
NVG-17098H10 Phocides padrona Bolivia, 1958 USNM
NVG-18039D06 Phocides perillus Colombia, old (around 1900) FMNH
NVG-19039F06 Phocides perkinsi Jamaica, 1962 AMNH
NVG-18094F05 Phocides pialia pialia (=parvus) LT Brazil, old (around 1900) MTD
NVG-18087C02 Phocides urania Guatemala, 1966 EBrockmann
NVG-17109E09 Phocides urania Mexico: San Luis Potosi, 1981 LACM
NVG-17113G05 Phocides urania Mexico: Nuevo Leon, 1980 TAMU
NVG-18033E07 Phocides urania Mexico: Tamaulipas, 2003 MWalker
NVG-15034D12 Phocides vida Panama, 1892 ZMHB
NVG-15034E01 Phocides vida Panama, 1892 ZMHB
NVG-17099B08 Phocides vida Panama, 1976 USNM
NVG-18025C08 Phocides vulcanides (=xenocrates) HT Colombia, before 1932 AMNH
NVG-18031C04 Phocides yokhara inca Ecuador, 2002 USNM
NVG-4278 Pholisora catullus USA: IN, Montgomery Co., 2015 UTSW
NVG-21021D03 Pholisora catullus USA: CA, Mono Co., 2021 UTSW
NVG-19083E02 Pholisora crestar HT USA: CA, Tulare Co., 2013 CSUC
NVG-20038E10 Pholisora crestar USA: CA, Kern Co., 2016 UTSW
NVG-18049H10 Pholisora litus Mexico: Guerrero, 1906 USNM
NVG-19013D12 Pholisora mejicanus Mexico: Nuevo Leon, 1978 TAMU
NVG-19013D11 Pholisora mejicanus USA: CO, EI Paso Co., 1982 TAMU
NVG-15096G05 Picova incompta HT Ecuador, old (around 1900) CMNH
NVG-18026H02 Picova steinbachi HT Bolivia, before 1930 AMNH
NVG-18073G05 Pintara (Albiphasma) heringi HT China: N. Guangdong, prior to 1922 ZMHB
NVG-18095B08 Pintara (Pintara) pinwilli Borneo, old (around 1900) MTD
NVG-18089G06 Pirdana hyela Malaysia, 1987 EBrockmann
NVG-17068A11 Piruna aea mexicana USA: AZ, Santa Cruz Co., 2016 CSUC
NVG-6454 Piruna pirus USA: CO, Grand Co., 2016 UTSW
NVG-18033A06 Pithauria murdava Malaysia, 2003 MWalker
NVG-17121F06 Plastingia flavescens Sulawesi, 1987 KMaruyama
NVG-18094C01 Plastingia viburnia HT Philippines, old (around 1900) SMF
NVG-18053C07 Ploetzia amygdalis Madagascar, old (around 1900) ZMHB
NVG-7982 Plumbago plumbago Brazil: Rondonia, 1989 USNM
NVG-17114B07 Poanes massasoit chermocki USA: MD, Dorchester Co., 1976 CSUC
NVG-4276 Polites peckius peckius USA: IN, Montgomery Co., 2015 UTSW
NVG-7875 Polyctor polyctor Costa Rica, 2012, 12-SRNP-4870 USNM
NVG-5719 Porphyrogenes peterwegei Costa Rica, 2013, 13-SRNP-65288 USNM
NVG-14064H07 Potamanaxas flavofasciata flavofasciata Peru, 1982 USNM
NVG-14064H02 Potamanaxas laoma laoma Ecuador, 1984 USNM
NVG-15031A07 Potamanaxas okroogly Peru, old (around 1900) ZMHB
NVG-18088F08 Potamanaxas paralus Peru, 2001 EBrockmann
NVG-14064F06 Potamanaxas thoria Ecuador, 2002 USNM
NVG-7388 Potanthus omaha omaha Malaysia, 1990 USNM
NVG-18114H04 Propapias sipariana French Guiana, 1993 USNM
NVG-17092H04 Prosopalpus debilis Uganda, 1957 USNM
NVG-7331 Pseudocoladenia dan fabia Myanmar, 2001 USNM
NVG-18113B05 Pseudorphe pyrex Peru, 1992 USNM
NVG-7379 Psolos fuligo Myanmar, 2003 USNM
NVG-18021B02 Psoralis (Psoralis) idee Bolivia, old (around 1900) AMNH
NVG-18012H02 Psoralis (Psoralis) pamba Ecuador, 1975 USNM
NVG-19021G10 Psoralis (Psoralis) stacara Brazil: RJ, 1995 USNM
NVG-18117B12 Psoralis (Saniba) calcarea calcarea Guyana, 2000 USNM
NVG-19022G05 Psoralis (Saniba) laska Peru, 1989 USNM
NVG-8024 Psoralis (Saniba) sabina Brazil: RJ, 1996 USNM
NVG-19022G04 Psoralis (Saniba) umbrata Brazil: RJ, 1995 USNM
NVG-18117B11 Psoralis (Saniba) visendus Ecuador, 1990 USNM
NVG-18101A01 Pteroteinon caenira Uganda, 1956 USNM
NVG-19043E05 Pteroteinon capronnieri Uganda, 1953 AMNH
NVG-7753 Pteroteinon iricolor Liberia, 1988 USNM
NVG-7757 Pteroteinon laufella Liberia, 1988 USNM
NVG-17069B07 Pyrgus centaureae dzekh USA: AK, 1991 USNM
NVG-7771 Pyrgus malvae Greece, 1992 USNM
NVG-17067G07 Pyrgus ruralis ruralis USA: CA, Mariposa Co., 2009 CSUC
PAO-187 Pyrgus scriptura USA: UT, Garfield Co., 2016 UTSW
NVG-17067H09 Pyrgus xanthus USA: CO, San Juan Co., 2002 CSUC
NVG-17094C09 Pyrrhopyge hadassa pseudohadassa Peru, 2013 USNM
NVG-8059 Racta apella raza Peru, 2012 USNM
NVG-18117C11 Racta chiria Peru, 2009 USNM
NVG-18041H09 Racta dalla Ecuador, 2013 EBrockmann
NVG-18012A12 Racta plasma Peru, 2011 USNM
NVG-18066F10 Racta racta Peru, 2012 EBrockmann
NVG-17092G01 Radiatus bradus Guyana, 1999 USNM
NVG-19021G07 Ralis coyana Brazil: RJ, 1994 USNM
NVG-19069D04 Ralis immaculatus Ecuador, 1977 USNM
NVG-18091D12 Ralis immaculatus (=concolor) Ecuador, 2012 EBrockmann
NVG-18026A08 Rectava ignarus HT Bolivia, before 1932 AMNH
NVG-19093D04 Rectava nostra nostra Brazil: Mato Grosso, 1990 USNM
NVG-18116D05 Rectava sobrinus ST Brazil: RJ, prior to 1902 USNM
NVG-19019H09 Rectava sobrinus ST Brazil: RJ, old (around 1900) USNM
NVG-19021D05 Rectava vorgia ST Brazil: RJ, old (around 1900) USNM
NVG-18111D08 Rhinthon bajula bajula ST Brazil: RJ, prior to 1902 USNM
NVG-18119F08 Rhinthon braesia braesia Brazil: Rondonia, 1995 USNM
NVG-18013C05 Rhinthon cubana Cuba, old (around 1900) USNM
NVG-18119F06 Rhinthon molion Costa Rica, 2007, 07-SRNP-35927 USNM
NVG-18119F04 Rhinthon osca Costa Rica, 2008, 08-SRNP-36378 USNM
NVG-18025H11 Rhomba gertschi HT Panama, 1936 AMNH
NVG-18093C02 Rigga auristriga HT Bolivia, prior to 1923 SMF
NVG-19019G07 Rigga auristriga Bolivia, 2003 USNM
NVG-19019G04 Rigga hesia Ecuador, 2002 USNM
NVG-19019G05 Rigga oeagrus Panama, 1982 USNM
NVG-18026E07 Rigga paramus HT Colombia, 1945 AMNH
NVG-18092C08 Rigga spangla Ecuador, 2011 EBrockmann
NVG-19067A02 Sabera caesina albifascia Australia, 1991 UCDC
NVG-14063C05 Salantoia eriopis Brazil: Para, 1986 USNM
NVG-18088H07 Salantoia eriopis Peru, 1990 EBrockmann
NVG-15031H01 Salantoia gildo LT Brazil: Amazonas, old (around 1900) ZMHB
NVG-2683 Salantoia metallica sp. n. HT Guyana, 2000 USNM
NVG-5737 Salatis canalis Costa Rica, 2013, 13-SRNP-70310 USNM
NVG-15095C12 Salatis canalis HT Panama, old (around 1900) CMNH
NVG-17104B09 Salatis salatis Guyana, 2000 USNM
NVG-17104B10 Salatis salatis Suriname, old (around 1900) USNM
NVG-15032B09 Santa palica HT Peru, old (around 1900) ZMHB
NVG-20017A04 Santa palica (=era) Peru, 1995 MUSM
NVG-19088F08 Santa santes Ecuador, 2001 USNM
NVG-18025B08 Santa santes HT Peru, 1924 AMNH
11-BOA-13382F10 Santa trifasciatus Guyana, 2000 USNM
NVG-19088D05 Santa trifasciatus Peru, 2012 USNM
NVG-7345 Sarangesa dasahara Myanmar, 2001 USNM
NVG-14063C03 Sarmientoia browni Brazil: Mato Grosso, 1991 USNM
NVG-18088H08 Sarmientoia faustinus Paraguay, 2011 EBrockmann
NVG-19099F05 Sarmientoia haywardi Argentina, old (around 1900) USNM
NVG-14063C02 Sarmientoia similis Brazil: Mato Grosso, 1990 USNM
NVG-18113E07 Saturnus fartuga ST Brazil: RJ, prior to 1902 USNM
NVG-18026D12 Saturnus fartuga (=nemorus) HT Brazil: SC, before 1941 AMNH
NVG-18116A01 Saturnus metonidia ST Brazil: Parana, prior to 1902 USNM
NVG-19024A10 Saturnus metonidia ST Brazil: RJ, old (around 1900) USNM
NVG-19024B08 Saturnus reticulata obscurus Panama, 1976 USNM
NVG-18013C01 Saturnus saturnus saturnus Guyana, 2000 USNM
NVG-18019C05 Scobura cephala India, 1927 AMNH
NVG-17091A01 Sebastonyma dolopia India, old (around 1900) USNM
NVG-18053B12 Sebastonyma perbella T China, 1911 ZMHB
NVG-7803 Semalea pulvina Cameroon, 1989 USNM
NVG-19017E04 Sodalia argyrospila Brazil: RJ, 1978 USNM
NVG-18113D02 Sodalia coler HT Brazil: RJ, prior to 1902 USNM
NVG-19017E02 Sodalia petiti Ecuador, 1988 USNM
NVG-19017E05 Sodalia sodalis Brazil: Mato Grosso, 1990 USNM
NVG-18011H10 Sostrata bifasciata bifasciata Brazil: RJ, 1995 USNM
NVG-16108H11 Sovia lucasii lucasii China: Sichuan, old (around 1900) USNM
NVG-18024B10 Stallingsia maculosus PT USA: TX, Hidalgo Co., 1953 AMNH
NVG-18013G06 Staphylus ascalaphus Costa Rica, 2008, 08-SRNP-55975 USNM
NVG-18011H08 Staphylus vincula (=opites) Mexico: Oaxaca, 1988 USNM
NVG-17108H04 Suastus gremius gremius India, 1962 LACM
NVG-7792 Suastus migreus Philippines, 1987 USNM
NVG-18093H03 Suastus minuta compactus HT Philippines, 1991 SMF
NVG-18075F11 Suniana lascivia neocles ST Australia, prior to 1891 ZMHB
NVG-7937 Synapte salenus Costa Rica, 2007, 07-SRNP-21744 USNM
NVG-18114G04 Synapte silius Brazil: Rondonia, 1991 USNM
NVG-3621 Systasea pulverulenta USA: TX, Duval Co., 2015 UTSW
NVG-18104F09 Tagiades (Daimio) calligana Sarawak, 1966 USNM
NVG-18104H05 Tagiades (Daimio) ceylonica Sri Lanka, 1973 USNM
NVG-18104F10 Tagiades (Daimio) cohaerens cynthia India, old (around 1900) USNM
NVG-17108E06 Tagiades (Daimio) korela korela Indonesia, 1998 LACM
NVG-7333 Tagiades (Daimio) litigiosa litigiosa Myanmar, 2001 USNM
NVG-18104F11 Tagiades (Daimio) litigiosa litigiosa Myanmar, 2001 USNM
NVG-18104H10 Tagiades (Daimio) litigiosa litigiosa Myanmar, 2003 USNM
NVG-18104H08 Tagiades (Daimio) menaka mantra China: Sichuan, old (around 1900) USNM
NVG-18104H09 Tagiades (Daimio) menaka menaka India, old (around 1900) USNM
NVG-18116A12 Tagiades (Daimio) neira neira ST Indonesia, 1905 USNM
NVG-18104H11 Tagiades (Daimio) nestus gilolensis Indonesia, old (around 1900) USNM
NVG-18087B07 Tagiades (Daimio) nestus gilolensis
(=ternatensis)
T Ternate Island, 1891 MNHP
NVG-18095G12 Tagiades (Daimio) presbyter (=gracilentus) Papua New Guinea, old (around 1900) MTD
NVG-18104H07 Tagiades (Daimio) sambavana Indonesia, 1886 USNM
NVG-18039C05 Tagiades (Daimio) tethys Japan, old (around 1900) FMNH
NVG-18038G03 Tagiades (Daimio) tethys Russia, 2016 UTSW
NVG-18104H12 Tagiades (Daimio) trebellius trebellius Indonesia, 1985 USNM
NVG-18104H06 Tagiades (Daimio) tubulus Java, old (around 1900) USNM
NVG-18055D11 Tagiades (Daimio) ultra Malasya, 1886 ZMHB
NVG-17119A01 Tagiades (Pterygospidea) flesus South Africa, 1950 USNM
NVG-18104G04 Tagiades (Pterygospidea) insularis Madagascar, 1988 USNM
NVG-18104G05 Tagiades (Tagiades) atticus atticus Thailand, old (around 1900) USNM
NVG-18104G08 Tagiades (Tagiades) atticus balana Malaysia, old (around 1900) USNM
NVG-18104G09 Tagiades (Tagiades) atticus nankowra Nicobar Islands, old (around 1900) USNM
NVG-18033B09 Tagiades (Tagiades) elegans elegans Philippines, 2005 MWalker
NVG-18104G03 Tagiades (Tagiades) elegans elegans Philippines, 1986 USNM
NVG-18093G03 Tagiades (Tagiades) elegans fuscata HT Philippines, 1997 SMF
NVG-18041A11 Tagiades (Tagiades) gana gana Malaysia, 2018 UTSW
NVG-17119B06 Tagiades (Tagiades) gana gana Singapore, 1989 USNM
NVG-7335 Tagiades (Tagiades) gana meetana Myanmar, 2003 USNM
NVG-17119B03 Tagiades (Tagiades) hovia hovia Solomon Islands, 1972 USNM
NVG-18104H03 Tagiades (Tagiades) inconspicua inconspicua Papua New Guinea, 1944 USNM
NVG-18095H01 Tagiades (Tagiades) janetta Aru Is., old (around 1900) MTD
NVG-18104H01 Tagiades (Tagiades) japetus brasidas Sambawa Island, 1886 USNM
NVG-18104G10 Tagiades (Tagiades) japetus engnanicus Java, old (around 1900) USNM
NVG-18079D05 Tagiades (Tagiades) japetus engnanicus (=guineensis) T Java?, 1905 MNHP
NVG-17119B01 Tagiades (Tagiades) japetus japetus Indonesia, old (around 1900) USNM
NVG-17119B02 Tagiades (Tagiades) japetus japetus Indonesia, old (around 1900) USNM
NVG-18055E02 Tagiades (Tagiades) japetus obscurata LT Indonesia, old (around 1900) ZMHB
NVG-18104G12 Tagiades (Tagiades) japetus prasnaja no data, old (around 1900) USNM
NVG-18055D12 Tagiades (Tagiades) japetus xarea LT Timor Island, old (around 1900) ZMHB
NVG-18104G07 Tagiades (Tagiades) obscurus Sri Lanka, 1966 USNM
NVG-18079D03 Tagiades (Tagiades) parra parra (=elongata) T Indonesia, 1909 MNHP
NVG-18104G06 Tagiades (Tagiades) ravi ravi India, old (around 1900) USNM
NVG-18055E01 Tagiades (Tagiades) ravi ravina India, old (around 1900) ZMHB
NVG-18104G01 Tagiades (Tagiades) silvia India, old (around 1900) USNM
NVG-18104G11 Tagiades (Tagiades) titus Philippines, 1987 USNM
NVG-7922 Talides sergestus Costa Rica, 2007, 07-SRNP-56563 USNM
NVG-18101C11 Tamela nigrita maura Malaysia, 1989 USNM
NVG-18053B11 Tamela nigrita othonias Borneo, 1889 ZMHB
NVG-17119B05 Tapena (Ctenoptilum) vasava vasava India, 1892 USNM
NVG-18073F07 Tapena (Tapena) bornea Malaysia, old (around 1900) ZMHB
NVG-18019A08 Tapena (Tapena) thwaitesi Sri Lanka, 1925 AMNH
NVG-17091F09 Taractrocera dolon Papua New Guinea, old (around 1900) USNM
NVG-7375 Taractrocera maevius sagara Myanmar, 2003 USNM
NVG-18012H04 Tarmia monastica Peru, 1952 USNM
NVG-18057C04 Telegonus cassander Cuba, 2013 ZSMC
NVG-19075F09 Telegonus cassander Cuba, old (around 1900) USNM
NVG-14103B11 Telegonus cassius Costa Rica, 1985 USNM
NVG-14103B12 Telegonus cassius Costa Rica, 1979 USNM
NVG-18057C03 Telegonus cassius Panama, prior to 1888 ZSMC
NVG-14061D07 Telegonus cellus USA: AL, Marion Co., 1974 USNM
NVG-15031C03 Telegonus cretellus LT no data, old (around 1900) ZMHB
NVG-10323 Telegonus cretellus (=jaira) Jamaica, 2017 UTSW
NVG-15096B01 Telegonus cretellus (=jamaicensis) AT Jamaica, old (around 1900) CMNH
NVG-15096C01 Telegonus cretellus (=jamaicensis) HT Jamaica, 1902 CMNH
NVG-18056D10 Telegonus galesus Bolivia, old (around 1900) ZfBS
NVG-15031B07 Telegonus galesus LT Peru, old (around 1900) ZMHB
NVG-18056D07 Telegonus subflavus sp. n. PT Colombia, old (around 1900) ZfBS
NVG-15096B05 Telegonus subflavus sp. n. HT Ecuador, old (around 1900) CMNH
NVG-18028H03 Telegonus subflavus sp. n. PT Peru, 2011 USNM
NVG-18103E12 Telicota colon argeus Australia, 1985 USNM
NVG-18118B11 Testia mammaea Brazil: RJ, old (around 1900) USNM
NVG-18026F01 Testia potesta HT Peru, 1931 AMNH
NVG-18119F01 Testia potesta Peru, 1983 USNM
NVG-18116E04 Thargella (Pseudopapias) tristissimus ST Peru, prior to 1902 USNM
NVG-8021 Thargella (Thargella) caura caura Guyana, 2000 USNM
NVG-18114G06 Thargella (Thargella) caura occulta Paraguay, 1980 USNM
NVG-15036A12 Thargella (Volus) volasus HT Panama, old (around 1900) ZMHB
NVG-18064B06 Thargella (Volus) volasus (=dolor) Costa Rica, 2006, 06-SRNP-22491 USNM
NVG-19099G01 Thargella (Volus) volasus (=dolor) Panama, 1975 USNM
11-BOA-13386C12 Theagenes aegides Costa Rica, 1980 USNM
NVG-19112H09 Theagenes aegides El Salvador, 1952 USNM
NVG-19112H10 Theagenes aegides Panama, 1979 USNM
NVG-19113A03 Theagenes albiplaga Argentina, 1977 USNM
NVG-19112H11 Theagenes albiplaga Colombia, 1992 USNM
11-BOA-13386C11 Theagenes albiplaga Peru, 2008 USNM
NVG-19113A04 Theagenes dichrous Brazil: RJ, 1995 USNM
NVG-19113A06 Theagenes dichrous Brazil: Mato Grosso, 1998 USNM
NVG-15033E04 Theagenes dichrous (=aura) LT Brazil, old (around 1900) ZMHB
NVG-19022H10 Thoon modius Colombia, 1969 USNM
NVG-7383 Thoressa masoni Myanmar, 2001 USNM
NVG-7934 Thracides arcalaus Costa Rica, 2009, 09-SRNP-20175 USNM
NVG-18114B06 Thracides cilissa Peru, 2014 USNM
NVG-18114A06 Thracides cleanthes cleanthes Paraguay, 1980 USNM
NVG-18114A11 Thracides joannisii Ecuador, 2002 USNM
NVG-18114B04 Thracides nanea Peru, 2016 USNM
NVG-18114B08 Thracides phidon Guyana, 1999 USNM
NVG-18068E05 Thracides polites pilla Peru, 2004 EBrockmann
NVG-18093C05 Thracides sacrator (=stupenda) HT Colombia, prior to 1923 SMF
NVG-18114A07 Thracides thrasea Brazil: Rondonia, 1994 USNM
NVG-18022H12 Thymelicus acteon acteon Spain, 1953 AMNH
NVG-18111D01 Tigasis arita ST Trinidad, prior to 1902 USNM
NVG-18025F12 Tigasis colomus HT Colombia, before 1941 AMNH
NVG-15035A02 Tigasis corope ST no data, old (around 1900) ZMHB
NVG-15035A03 Tigasis corope ST no data, old (around 1900) ZMHB
NVG-19018G05 Tigasis perloides Brazil: RJ, 1995 USNM
NVG-18113D11 Tigasis perloides (=diduca) ST Brazil: RJ, prior to 1902 USNM
NVG-7944 Tigasis wellingi Costa Rica, 2011, 11-SRNP-32281 USNM
NVG-18027A03 Tigasis wellingi HT Mexico: Oaxaca, 1961 AMNH
NVG-18013A11 Tigasis zalates Ecuador, 1977 USNM
NVG-18118A08 Tirynthia conflua Brazil: RJ, 1995 USNM
NVG-18112A08 Tisias carystoides Ecuador, 1976 USNM
NVG-18112D05 Tisias lesueur Brazil: SC, 1999 USNM
NVG-18118B03 Tisias myna Costa Rica, 2008, 07-SRNP-66151 USNM
NVG-19113E02 Tolius luctuosus Mexico: Colima, 1953 USNM
NVG-19113E03 Tolius tolimus robigus Suriname, 1971 USNM
NVG-15032H11 Tolius tolimus robigus (=alburnea) ST Brazil: Para, old (around 1900) ZMHB
NVG-19113D12 Tolius tolimus tolimus Colombia, old (around 1900) USNM
NVG-15032H09 Tolius tolimus tolimus Panama, old (around 1900) ZMHB
NVG-18057A09 Tolius tolimus tolimus Panama, prior to 1883 ZSMC
NVG-16106A10 Trapezites symmomus Australia, 1963 LACM
NVG-19023C11 Tricrista advena advena Guyana, 2000 USNM
NVG-19023C09 Tricrista aethus Peru, 1986 USNM
NVG-19022H09 Tricrista canta French Guiana, 1993 USNM
NVG-19023C05 Tricrista circellata Brazil: RJ, 1995 USNM
NVG-8049 Tricrista crista Guyana, 2000 USNM
NVG-18025G05 Tricrista cristatus HT Brazil: SC, before 1930 AMNH
NVG-19022H12 Tricrista taxes Brazil: Mato Grosso, 1990 USNM
NVG-20126F11 Trida barberae barberae South Africa, old (around 1900) CMNH
NVG-18055E03 Triskelionia tricerata ST Sierra Leone, old (around 1900) ZMHB
NVG-18055E04 Triskelionia tricerata ST Sierra Leone, old (around 1900) ZMHB
NVG-18019E10 Tsitana tsita South Africa, 1924 AMNH
NVG-18111G08 Turesis basta Guyana, 2000 USNM
NVG-18111G06 Turesis complanula Guyana, 2000 USNM
NVG-18111G07 Turesis theste Costa Rica, 1965 USNM
NVG-18082D06 Turmosa camposa Brazil: RJ, 1883, NHMUK_012824124, 0247279797 BMNH
YPM-ENT-778800 Turnerina hazelae HT Mexico: Guerrero, 1956 PMNH
NVG-18089G08 Unkana ambasa Thailand, 1988 EBrockmann
NVG-18089G05 Unkana ambasa ambasa (=palawana) Philippines, 1985 EBrockmann
NVG-18081C02 Unkana mytheca Indonesia, 1914, NHMUK_010430823, 0247278996 BMNH
NVG-4894 Urbanus proteus proteus USA: FL, Miami-Dade Co., 2015 UTSW
NVG-18092C10 Vacerra hermesia hermesia Ecuador, 2015 EBrockmann
NVG-17095C06 Vacerra litana Venezuela, 1975 USNM
NVG-19019B07 Vehilius clavicula Brazil: RJ, 1995 USNM
NVG-19019A12 Vehilius inca Brazil: Amazonas, 1993 USNM
NVG-19019B06 Vehilius inca Brazil: Rondonia, 1991 USNM
NVG-18113C09 Vehilius inca (=chinta) ST Brazil: RJ, prior to 1902 USNM
NVG-18043H06 Vehilius inca (=xenos) ST Bolivia, 1894 ZMHB
NVG-18043H07 Vehilius inca (=xenos) ST Bolivia, 1894 ZMHB
NVG-18014D11 Vehilius labdacus Costa Rica, 2006, 06-SRNP-33594 USNM
NVG-19012G08 Vehilius labdacus Mexico: Tamaulipas, 1975 TAMU
NVG-21013F05 Vehilius labdacus ST Mexico: Guerrero, old (around 1900) CMNH
NVG-19019G10 Vehilius limae Ecuador, 2002 USNM
NVG-19018G07 Vehilius limae Peru, 2000 USNM
NVG-18026F06 Vehilius putus HT Peru, 1931 AMNH
NVG-19019A06 Vehilius stictomenes illudens Panama, 1985 USNM
NVG-19019B03 Vehilius vetula Guyana, 2000 USNM
NVG-19018H10 Vehilius warreni Brazil: Mato Grosso, 1992 USNM
NVG-8022 Venas evans Guyana, 2000 USNM
NVG-20058E11 Vertica (Brasta) brasta Peru, 2019 KShiraiwa
NVG-15036A01 Vertica (Vertica) umber (=optata) T Brazil: RJ, old (around 1900) ZMHB
NVG-19024A02 Vertica (Vertica) verticalis Brazil: Rondonia, 1996 USNM
NVG-18014G01 Vettius phyllus phyllus Guyana, 2001 USNM
NVG-19022D05 Vettius triangularis Guyana, 2000 USNM
NVG-19017F01 Vidius felus Brazil: Golias, 1969 USNM
NVG-19018G08 Vidius fraus Guatemala, old (around 1900) USNM
NVG-18012H07 Vidius vidius Paraguay, old (around 1900) USNM
NVG-8018 Virga virginius Brazil: Rondonia, 1990 USNM
NVG-18026H05 Viridina subviridis HT Ecuador, 1938 AMNH
NVG-18125E10 Viridina viridenex Peru, 2017 WDempwolf
NVG-15104C11 Viridina viridis HT Ecuador, 1938 AMNH
NVG-18013C07 Vistigma (Penicula) bryanti Ecuador, 2001 USNM
NVG-18011F04 Vistigma (Penicula) subviridis Brazil: SC, 1990 USNM
NVG-19024C05 Vistigma (Vistigma) opus Peru, 1983 USNM
NVG-15035H12 Vistigma (Vistigma) vira (=ochroneura) T Brazil: Amazonas, old (around 1900) ZMHB
NVG-19024C04 Vistigma (Vistigma) virgo Peru, 1995 USNM
NVG-18021B09 Vistigma (Vistigma) xanthobasis Argentina, 1907 AMNH
NVG-18079C02 Willema tsadicus (=birbiranus) T Ethiopia, 1925 MNHP
NVG-17093A10 Willema willemi South Africa, 1968 USNM
NVG-7765 Xanthodisca vibius Cameroon, 1987 USNM
NVG-17121F10 Xanthoneura corissa corissa Sabah, 1985 KMaruyama
NVG-18064D07 Xanthonymus xanthioides Cameroon, old (around 1900) USNM
NVG-18093D09 Xeniades (Cravera) laureatus HT Bolivia, prior to 1923 SMF
NVG-18015B11 Xeniades (Cravera) laureatus Brazil: Mato Grosso, 1991 USNM
NVG-18112A05 Xeniades (Tixe) quadrata hermoda Colombia, 1992 USNM
NVG-15036C04 Xeniades (Tixe) quadrata quadrata ST no data, old (around 1900) ZMHB
NVG-15035B01 Xeniades (Xeniades) chalestra chalestra (=concors) ST no data, old (around 1900) ZMHB
NVG-18067H06 Xeniades (Xeniades) chalestra corna Brazil: Sao Paulo, 2007 EBrockmann
NVG-18093D12 Xeniades (Xeniades) difficilis HT Bolivia, prior to 1923 SMF
NVG-18119B05 Xeniades (Xeniades) difficilis Peru, 2015 USNM
NVG-19024H09 Xeniades (Xeniades) orchamus Costa Rica, 2010, 10-SRNP-75001 USNM
NVG-18119B04 Xeniades (Xeniades) orchamus Panama, 1975 USNM
NVG-7961 Xeniades (Xeniades) pteras Costa Rica, 2013, 13-SRNP-22562 USNM
NVG-18119B02 Xeniades (Xeniades) pteras Panama, 1977 USNM
NVG-18119B08 Xeniades (Xeniades) victoria Brazil: RJ, 1995 USNM
NVG-7906 Xenophanes tryxus Costa Rica, 2010, 10-SRNP-103428 USNM
NVG-18089H11 Zalomes biforis Ecuador, 2013 EBrockmann
NVG-18126A05 Zela zeus optima Langkawi, 2018 UTSW
NVG-18119G08 Zetka Burns03 Costa Rica, 2006, 06-SRNP-32471 USNM
NVG-18027A07 Zetka zeteki HT Panama, 1928 AMNH
NVG-15104C01 Zobera albopunctata HT Mexico: Colima, 1967 AMNH
NVG-18075D06 Zophopetes cerymica (=weiglei) T Ghana, 1883 ZMHB
NVG-18099H09 Zophopetes dysmephila Kenya, 1958 USNM
NVG-18075D05 Zophopetes nobilior T Gabun, 1892 ZMHB
NVG-7908 Zopyrion (Timochreon) satyrus satyrus Costa Rica, 2007, 07-SRNP-58884 USNM
NVG-19091F10 Zopyrion (Zopyrion) reticulata Brazil, 1992 USNM
NVG-19091F01 Zopyrion (Zopyrion) sandace Honduras, 1981 USNM
NVG-19091F12 Zopyrion (Zopyrion) subvariegata subvariegata Ecuador, 2002 USNM
NVG-1670 Pterourus glaucus glaucus USA: TX, Denton Co., 2013 USNM

We use all protein-coding genes as annotated in our reference genome of Cecropterus lyciades (Geyer, 1832) (Shen et al. 2017), nearly 16,000 genes covering about 18,000,000 base pairs. Because a large number of specimens were sequenced, the phylogenetic trees were constructed for smaller phylogenetic groups such as subfamilies, tribes and subtribes (Fig. 1, 3–11, 13–17). First, whole-genome shotgun datasets of each specimen included in the tree were mapped to the protein set of the reference genome, and positions in the resulting alignments were used in further analyses. Second, we removed codons present in less than 30% of the specimens. Due to low sequence coverage and DNA degradation in older specimens, certain sequence regions were not present in some specimens. Therefore, the poorly covered codons were removed from the analysis. Even after this removal, which discards about 20% of codons, the datasets were still very large to analyze time-efficiently, ranging from 13 to 17 million base pairs. Third, for the tree construction, we randomly sampled 100,000 codons (0.3 million bp, about 2% of the total) from the set of all available codons. The sampling was done by codon rather than by gene, so that all genes had a chance to be sampled to generate a balanced and representative dataset. Fourth, the maximum-likelihood tree was constructed using IQ-TREE v1.6.12 under a GTR+GAMMA model (Nguyen et al. 2015). To estimate the confidence of each node, we generated 100 replicates of 10,000 codons randomly sampled from the total set of codons and constructed maximum-likelihood trees for each replicate. The support values of each node were summarized from these replicate trees using the sumtrees routine in the dendropy package (Sukumaran and Holder 2010).

Figure 1.

Figure 1.

Genomic tree of Eudaminae. The tree is constructed from protein-coding regions. The tree is rooted with Pterourus glaucus (Linnaeus, 1758) (NVG-1670), not shown. Statistical support values are shown on nodes. For each specimen, its name adopted in this work is given first, and a previously used name is listed in square brackets (if different), supplemented with the DNA sample number, type status (see Table 2 caption for abbreviations) and general locality. See Table S1 in the Supplemental file for additional data about these specimens. Synonyms are given in parentheses preceded by “=”, and in addition by “‡” for unavailable names. The type status refers to this synonym, if the synonym name is provided. Clades corresponding to new genera, subgenera and species are colored in red, orange and green, respectively, and the names of new taxa are highlighted accordingly. Names of selected tribes, subtribes, genera, and subgenera are labeled at their clades. Clades corresponding to some genera are highlighted in yellow to compare their genetic diversifications (length of the highlight in horizontal dimension) with each other. Groups of similar genetic diversification would ideally correspond to genera. The same notations are used in Fig. 3–11 and 13–17.

Figure 3.

Figure 3.

Genomic tree of Tagiadinae. See Fig. 1 legend for notations.

Figure 11.

Figure 11.

Genomic tree of Hesperiina and relatives. See Fig. 1 legend for notations.

Figure 13.

Figure 13.

Genomic tree of Moncina, part 1, and relatives. See Fig. 1 legend for notations.

Figure 17.

Figure 17.

Genomic tree of Carystina, Pericharini, Megathymini and relatives. Clades corresponding to new subtribes described in this work are highlighted in green. See Fig. 1 legend for other notations.

Type species, or their close relatives, of all available genus-group names were used in the trees to ensure that the names are applied correctly. Statistical support values and branch lengths were taken into consideration to judge the validity of each observed clade. When a strongly supported clade without an available name was found, identification of specimens in the clade was confirmed by the analysis of their wing patterns and genitalia. These new clades were rationalized in terms of genitalic morphology and wing patterns to search for diagnostic characters in phenotype. Finally, genitalia and wing patterns were used to determine generic placement of species for which DNA sequences were not available.

DNA characters listed in diagnoses of new taxa were found in nuclear genomic sequences using the procedure that we have developed previously (see SI Appendix to Li et al. 2019). The logic of how the characters were found was also explained in Cong et. al (Cong et al. 2019b). The character states are provided in diagnoses below as abbreviations. For example, aly728.44.1:G672C means position 672 in exon 1 of gene 44 from scaffold 728 of Cecropterus lyciades (Geyer, 1832) (formerly in Achalarus Scudder, 1872, thus aly) reference genome (Shen et al. 2017) is C, changed from G in the ancestor. When characters were found for the sister clade of the diagnosed taxon, the following statement was used: aly5294.20.2:A548A (not C), which means that position 547 in exon 2 of gene 20 on scaffold 5294 is occupied by the ancestral base pair A, which was changed to C in the sister clade (so it is not C in the diagnosed taxon). The sequences of exons from the reference genome with the positions used as character states highlighted in green are given in the supplemental file deposited at <https://osf.io/aesvy/>. Linking to these DNA sequences from this publication ensures that the numbers given in the diagnoses can be readily associated with actual sequences. All new names have been registered with ZooBank.

Specimens were obtained from the following collections: American Museum of Natural History, New York, NY, USA (AMNH), Natural History Museum, London, UK (BMNH), Burke Museum of Natural History and Culture, Seattle, WA, USA (BMUW), Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), Colorado State University Collection, Fort Collins, CO, USA (CSUC), Field Museum of Natural History, Chicago, FL, USA (FMNH), Los Angeles County Museum of Natural History, Los Angeles, CA, USA (LACM), Mississippi Entomological Museum, Starkville, MS, USA (MEM), McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA (MGCL), Muséum National d’Histoire Naturelle, Paris, France (MNHP), Museum für Tierkunde, Dresden, Germany (MTD), Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru (MUSM), Peabody Museum of Natural History, Yale University, New Haven, CT, USA (PMNH), Natural History Museum, Frankfurt, Germany (SMF), Texas A&M University Insect Collection, College Station, TX, USA (TAMU), Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), Bohart Museum of Entomology, University of California, Davis, CA, USA (UCDC), National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), University of Texas Southwestern, freezers of the Grishin lab, Dallas, TX, USA (UTSW), Zentrum fur Biodokumentation des Saarlandes, Schiffweiler, Germany (ZfBS), Museum für Naturkunde, Berlin, Germany (ZMHB), Zoologische Staatssammlung München, Germany (ZSMC), and research collections of Ernst Brockmann, Germany (EBrockmann), Bill Dempwolf, USA (WDempwolf), Nick V. Grishin, USA (NGrishin), Bernard Hermier, French Guiana (BHermier), Kiyoshi Maruyama, Japan (KMaruyama), Kojiro Shiraiwa, USA (KShiraiwa), John A. Shuey, USA (JShuey), Texas Lepidoptera Survey, Houston, TX, USA (TLS, subsequently acquired by the MGCL), and Mark Walker, USA (MWalker).

Results and Discussion

Inspection of Hesperiidae genomic trees reveals a large number of inconsistencies with the currently adopted classification. Most importantly, after sequencing additional species, many genera were still found to be para- and polyphyletic, despite our previous effort to restore monophyly (Cong et al. 2019b). Additional research into type specimens, original descriptions and illustrations suggests a number of misidentifications made by Evans (1952, 1955). We correct these problems by proposing new names for the taxa that do not have them. Our logic about the taxonomic ranks (genus vs. subgenus) is discussed elsewhere (Cong et al. 2019b; Li et al. 2019; Zhang et al. 2019d, 2020, 2021) and is adopted here. In brief, a genus corresponds to a prominent monophyletic group similar in genetic diversification within this group to other genera of its relatives. Less prominent groups that originated more recently are defined as subgenera.

This work gives standardized descriptions of new taxa found during this analysis. The genus-group names were chosen to be short, and frequently either reflect names or properties of their type species to facilitate memorization, or are fusions of other names, euphonized and shortened. The type species name is listed in its original genus combination and spelling, followed by the author and year the name was made available (not a bibliographic reference, but part of the name). The definition section indicates closest genera, states the generic placements prior to this study (type species are given where appropriate to help assign a clade to a genus), gives reference to diagnostic characters as they are given in previous publications, mostly in Evans (1937, 1949, 1951, 1952, 1953, 1955). It was almost always possible to trace the genus observed in the phylogenetic trees to the morphological characters given in Evans’ identification keys. We believe that referencing the keys rather than comprehensively listing all the characters would facilitate identification. Nevertheless, a brief morphological diagnosis for each genus is provided, summarizing the most indicative phenotypic traits. DNA characters found by our recently described method to maximize the chance that they would withstand addition of the new species (Zhang et al. 2019c) are given at the end of the definition. Then the gender of the name and an explanation about its origin is provided, species placed in the genus are listed (in their original genus-species name combinations with authors and dates), a parent taxon (a genus, subtribe, tribe, or subfamily) is given, at times followed by comments about species involved.

All proposed changes to taxonomic status are propagated to all names currently treated as subspecies (for species), subgenera (for genera) and synonyms of mentioned taxa; for example, if a species is placed in a genus, it means that all the subspecies and their synonymic names are placed together with their parent species. Finally, taxa not mentioned in this work are considered to remain at the ranks and in the taxonomic groups they have been previously assigned to (Evans 1937, 1949, 1951, 1952, 1953, 1955; Mielke 2005; Cong et al. 2019b; Li et al. 2019; Zhang et al. 2019b,d, 2020, 2021). The following sections are standardized in format and are either new taxon descriptions or taxonomic changes to existing taxa, as stated in the titles of these sections. These sections are mostly arranged in the taxonomic order of taxa mentioned in them with some exceptions dictated by the logic of presentation.

Fulvatis Grishin, new genus

http://zoobank.org/392495C5-8B7F-43BB-84BB-E759562E2B86

Type species.

Telegonus fulvius Plötz, 1882.

Definition.

Species in this genus were previously placed in Salatis Evans, 1952 (type species Papilio salatis Stoll, 1782), but are not monophyletic with it and instead form a clade sister to Bungalotis Watson, 1893 (type species Papilio midas Cramer, 1775) (Fig. 1). Keys to D.2.4a in Evans (1952). Distinguished from its relatives by the following characters: cheeks and palpi below tawny, not white, wings in males fulvous above; compared to Salatis: more produced forewings, costal fold either absent or shorter than half of costal margin, broader and rounder uncus in ventral view, more elongated and gracile valva. In DNA, a combination of the following base pairs is diagnostic: aly876.15.1:C294T, aly909.2.2:C319A, aly1450.14.11:A1002G, aly50.31.2:A2011C, and aly909.2.2:C264T.

Etymology.

The name is a masculine noun (to agree in gender with the names of species in this genus) in the nominative singular, a fusion of Fulv[ous]+[Sal]atis for the orange-red wing color characteristic of these species formerly placed in Salatis.

Species included.

The type species and Bungalotis scyrus Bell, 1934.

Parent taxon.

Tribe Phocidini Tutt, 1906.

Adina Grishin, new genus

http://zoobank.org/B2165827-0302-48FD-8010-7B74D73D7FEC

Type species.

Nascus adrastor Mabille and Boullet, 1912, reinstated status.

Definition.

Nascus adrastor was placed as a synonym of Bungalotis midas (Cramer, 1775) (type locality Suriname) by Evans (1952: 139), who assumed it was “an aberration without the spot in space 3 upf.” Sequencing a leg of the N. adrastor holotype (NVG-18086A10, EL63165) in MNHP reveals that in addition to not being conspecific with B. midas (which is in a clade far removed from it), N. adrastor may be sister to all Evans’ “Bungalotis Sub-group” genera but Dyscophellus Godman and Salvin, 1893 with Euriphellus Austin, 2008 (Fig. 1), and therefore is not congeneric with any of them. Hence, first, we reinstate Nascus adrastor Mabille and Boullet, 1912 as a species-level taxon, because it is apparently not conspecific with any taxon with a more senior name. Second, we establish a new genus and place Adina adrastor in it as the type species. This new genus is distinguished from its relatives by the following combination of characters. Forewings lack hyaline spot in cell M3-CuA1 (Evans’ “space 3”) proximally to the irregular band formed by aligned and fully connected spots in discal cell and cells CuA1-CuA2 and CuA2-1A+2A (apparently not an aberration!). However, instead, there is a feeble white-centered dark-brown spot halfway between the white band and the outer margin. Furthermore, such small spots mark next four cells towards costa: a doublet of submarginal spots (in cells M1-M2 and M2-M3) and a doublet of subapical spots (in cells R4-R5 and R5-M1). It is possible that these spots may be better developed or hyaline in other specimens. Central spot in ventral hindwing cell CuA2-1A+2A is nearly equidistant from the discal cell spot and spot in cell CuA1-CuA2, slightly closer to the latter spot and not in-line with the former as in other genera. All these large ventral spots are gray-centered. Palpi brown, cheeks narrowly yellowish-white under eyes. Fringes prominently checkered on both wings. It should be noted that both antennae and all wings are glued onto the body of the A. adrastor holotype that we sequenced a leg of. Nevertheless, a combination of unique wing pattern with the unique genotype of the leg suggests that at least the wings may indeed belong to this body. Furthermore, in the absence of known males, the best diagnostic characters for this new genus are given by DNA, in particular in the COI barcode: T70A, A241T, T382C, T442C, A454T, and A562G, and in the nuclear genome: aly2012.62.1:T90C, aly1656.12.3:T762C, aly1656.12.3:A772G, aly349.23.9:C455T, and aly349.23.9:G475A.

Etymology.

The name is a feminine noun in the nominative singular, starting as the type species name to form a Hebrew name עדינה (pronounced ah-DEE-nah) meaning “gentle” or “subtle”. The genus being a gentle reminder that subtle phenotypic differences may hide the large genetic differentiation that can be revealed by genomic sequencing leading to surprising and insightful results.

Species included.

Only the type species.

Parent taxon.

Tribe Phocidini Tutt, 1906.

Euriphellus cebrenus (Cramer, 1777), new combination

The original illustration of Papilio cebrenus Cramer, 1777 (type locality Suriname) shows that the forewing discal cell yellow bar reaches costa, and the yellow spot in cell M3-CuA1 is close to the spot in cell CuA1-CuA2 (Cramer 1777). N.V.G. also inspected the original Lambertz drawing of P. cebrenus in the library of the National History Museum, London, UK used as a source of published Cramer’s engravings (Gilbert 2000). These drawings are usually more accurate than the published copies, but in this case the Lambertz drawing did not reveal additional information because the illustrations were quite similar. Evans (1952) applied the name cebrenus to a species known only from Southwest and South Brazil that has some similarities in wing patterns to Cramer’s P. cebrenus, but the yellow bar does not extend towards costa beyond discal cell, and the spot in M3-CuA1 is midway between the discal cell spot and apical spots. Therefore, both by wing pattern and by locality, P. cebrenus is a closer match to some females of the species known today as Euriphellus euribates (Stoll, 1782) (type locality Suriname) than to the species from South Brazil Evans called “cebrenus”. Furthermore, on the plate 170, Draudt (1922) illustrated a number of Hesperiidae species with P. cebrenus among them. Size comparison of the images suggests that the P. cebrenus specimen was larger than E. euribates and about the same size as Telegonus hesus Westwood, 1852 (currently a junior subjective synonym of E. euribates). Males of the species Evans called “cebrenus” are smaller in size (although size arguments should be taken with caution, due to possibly significant variation), and the Lambertz/Cramer illustrations do not resemble a female of that species, which has a continuous forewing discal band and not a broken one as in the true P. cebrenus. Therefore, we conclude with confidence that Evans misidentified P. cebrenus and we place it in the genus Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) to result in Euriphellus cebrenus (Cramer, 1777), new combination. We have not sequenced the specimens from the Guianas and do not know whether the narrow-banded females with the forewing band reaching costa (i.e., E. cebrenus) represent a variation of broader-banded females with the forewing band ending in discal cell (i.e., E. euribates), or they are two distinct taxa. Therefore we presently refrain from synonymizing Euriphellus euribates (Stoll, 1782) under Euriphellus cebrenus (Cramer, 1777) until further research sheds light on this possible synonymy.

Telegonus mutius Plötz, 1882 is a junior subjective synonym of Euriphellus phraxanor (Hewitson, 1876)

Considered since Evans (1952) a junior subjective synonym of Salatis cebrenus (Cramer, 1777) (type locality Suriname), Telegonus mutius Plötz, 1882 (type locality Colombia) does not agree, according to its description, with the original illustration (Cramer 1777) showing a female syntype of Papilio cebrenus. The description of T. mutius can be translated as “Margins of all wings smooth (i.e. not serrated), cell 1 of the forewing without hyaline points. … Forewing with a hyaline spot in the discal cell, one similar [spot] in cell 2, a slash in cell 3 and 2 small spots before the apex in cells 6 and 7. Hindwing [unmarked,] only with one brown, gray-core central moon and a row of such spots on the underside. Pale brown, palpi orange … Weymer [in litteris], 36 mm” (Plötz 1882c). Papilio cebrenus has a hyaline spot in the forewing cell 1, it also has additional hyaline spots between the discal spot and costa (i.e., discal cell spot continues to reach costa), and three small apical spots, not two. Moreover, as we suggest above, P. cebrenus is a species very close to (or the same as) Euriphellus euribates (Stoll, 1782). Therefore, T. mutius is not the same species as E. cebrenus. Instead, we found that some females (for example, in ZMHB) currently identifiable as Euriphellus phraxanor (Hewitson, 1876) (type locality “New Granada”—likely referring to Colombia—and Panama: Chiriqui) perfectly match the T. mutius description, including the large size of the specimen (forewing length 36 mm). Indeed, nearly identical to each other large hyaline spots in forewing discal cell and cell CuA1-CuA2, a hyaline “slash” in cell M3-CuA1 and two subapical spots (in cells R4-R5 and R5-M1) are the only prominent dorsal markings on these females. Their ventral hindwing is marked with a central spot and a discal crescent of similar spots. These spots are mostly pale and encircled with dark scales, but can be viewed as brown with pale centers. Although the type specimens of T. mutius have not been located, the description is sufficient to place this taxon in synonymy with Euriphellus phraxanor, awaiting a detailed revision of the E. phraxanor complex that requires examination and sequencing of the primary types of these taxa.

Salantoia gildo (Mabille, 1888), new combination, reinstated status

Treated as a junior subjective synonym of Salatis cebrenus (Cramer, 1777) (type locality Suriname) since Evans (1952), Telegonus gildo Mabille, 1888 (type locality Brazil: Amazonas, Coary) has significantly broader spots on forewing compared to S. cebrenus. Sequencing of the T. gildo syntype (NVG-15031H01) in the ZMHB reveals that it is in the same clade with Eudamus eriopis Hewitson, 1867, the type species of Salantoia Grishin, 2019, and is not monophyletic with Salatis Evans, 1952 (type species Papilio salatis Stoll, 1782) or Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) (Fig. 1). In male genitalia, T. gildo shares the following characters with S. eriopis: uncus longer and narrower than in Salatis, penis not narrowing distad, and harpe with distal short spike or spikes instead of being rounded as in Salatis. In wing patterns, T. gildo and S. eriopis have two or three conspicuous subapical white spots, while Salatis species mostly have one (sometimes vestigial) (Evans 1952). Therefore, T. gildo belongs to Salantoia and not to Salatis or Euriphellus, and we reinstate it as a species-level taxon Salantoia gildo (Mabille, 1888), new combination. To stabilize nomenclature, the sole syntype in the Museum für Naturkunde, Berlin, Germany (ZMHB) with the following eight rectangular labels ∥ Origin. ∥ Coary | Hhnl ∥ Tel. gildo ♂ Mab. ∥ Gildo | Mab. ∥ Gildo | Mab. ∥ GEN.PREP., | MIELKE | 1996 ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 940b47 ∥ DNA sample ID: | NVG-15031H01 | c/o Nick V. Grishin ∥ is hereby designated by Grishin as the lectotype of Telegonus gildo Mabille, 1888.

Furthermore, a specimen of the species that Evans misidentified as S. cebrenus (NVG-17104C01) is placed near the base of Evans’ “Bungalotis Sub-group” (excluding Dyscophellus Godman and Salvin, 1893 and Euriphellus Austin, 2008) clade and does not fall into any existing genera (Fig. 1). We see that it is away from Euriphellus (where the true Papilio cebrenus and Telegonus mutius Plötz, 1882 belong), away from Salantoia (where Telegonus gildo belongs), and away from Salatis (where Evans (1952) placed it). We see that Evans’ “S. cebrenus” has neither genus nor species name applicable to it, and it is named here below.

Ornilius rotundus Grishin, new genus and new species

http://zoobank.org/6CAFDF62-38BE-465D-934A-D844A589F12A

http://zoobank.org/926EC06C-982B-4811-9152-0270F924C028

Definition of the new species.

This is the species Evans misidentified as Papilio cebrenus Cramer, 1777 (type locality Suriname) and called “Salatis cebrenus”. Thus, the diagnostic characters for it are given in Evans (1952), where the species keys out to D.2.3. Specifically, both sexes have wings rounder than most relatives, fringes not checkered. Males with yellowish hyaline spots on forewing, cheeks broadly white. Forewing of female with hyaline discal band of three spots well-aligned with each other, small roundish spot in cell M3-CuA1 offset from the discal band and three well-developed (not one as in Salatis species) hyaline subapical spots. The COI barcode sequence of the holotype is: AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTCATACTCGGAGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTTTACTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACTGGATGAACAGTATATCCTCCTTTATCGTCTAATATTGCTCACCAAGGATCTTCTGTAGACTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTATCTTAGGAGCTATTAATTTCATTACAACAATTATTAACATACGAATTAAAAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTCTTTTATTATTACTTTCTTTACCTGTCTTAGCTGGCGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type locality.

Brazil: Santa Catarina, São Bento do Sul, elevation 850 m, GPS coordinates −26.283, −49.417.

Distribution.

The species is known only from the Southeast and South regions in Brazil.

Type material.

Holotype (Fig. 2a,b), male deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), with the following rectangular white labels: ∥ BRAZIL: Sta Catarina | Sao Bento do Sul | 26°17′S 49°25′W | 25.III.1990 | 850m, leg. Rank ∥ GENITALIA NO. | X-5024 | J.M.Burns 2001 ∥ USNMENT | [barcode image] | 00913850 ∥ DNA sample ID: | NVG-17104C01 | c/o Nick V. Grishin ∥. Paratypes: 3 ♂♂ and 5 ♀♀ from Brazil: Espírito Santo and Rio de Janeiro in the Natural History Museum, London, UK (BMNH), 1 ♂ and 1 ♀ in USNM and 3 ♀♀ in the ZMHB. Type identification labels will be mailed to curators of these collections to be placed on these specimens.

Figure 2.

Figure 2.

Holotypes of the Eudaminae species described in this work: a) Ornilius rotundus Grishin, gen. n., sp. n. dorsal; b) ibid. ventral; c) Dyscophellus australis Grishin, sp. n. dorsal; d) Salantoia metallica Grishin, sp. n. dorsal; e) ibid. ventral; f) ibid. left antennal club in ventro-anterior view, nudum facing up, 1 mm scale above; g) ibid. sterigma and ovipositor in ventral view, 1 mm scale below; h) Telegonus subflavus Grishin, sp. n. dorsal; i) ibid. ventral; j) Dyscophellus basialbus Grishin, sp. n. dorsal; k) ibid. ventral. Specimen images are to scale (shown under image a) and data are in the text. Photograph c (by N.V.G.) is © of the Trustees of the Natural History Museum London and is made available under Creative Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/).

Definition of the new genus.

This new genus is erected here to receive species previously included in Salatis Evans, 1952 (type species Papilio salatis Stoll, 1782), but not monophyletic with it and instead originating near the base of the group consisting of Bungalotis Watson, 1893 (type species Papilio midas Cramer, 1775), Sarmientoia Berg, 1897 (type species Dyscophus faustinus Burmeister, 1878), Salatis Evans, 1952, Nicephellus Austin, 2008 (type species Eudamus nicephorus Hewitson, 1876), Salantoia Grishin, 2019 (type species Eudamus eriopis Hewitson, 1867), Fulvatis Grishin, new genus (type species Telegonus fulvius Plötz, 1882), and Adina Grishin, new genus (type species Nascus adrastor Mabille and Boullet, 1912) (Fig. 1). While the wing pattern characters are reserved to define the new species, the new genus is defined by male genitalia that are more likely to be the shared character for the genus if additional congeners are discovered. This genus is distinguished from its relatives by the following characters in male genitalia: uncus undivided, concave and narrow in lateral view, tegumen with two flanges about half of uncus length, valva nearly as broad as long, nearly square in shape, long process of sacculus reaching harpe, harpe twice as broad as long, its distal margin with irregular broad dentations. In DNA, a combination of the following base pairs is diagnostic: aly2487.42.4:G49T, aly2012.14.3:G1592C, aly185.5.3:G934C, aly2012.62.1:T90T (not C), aly1656.12.3:T762T (not C), aly1656.12.3:A772A (not G), aly527.19.4:G150G (not A), aly294.11.1:A93A (not G), aly2202.33.1:T40T (not G), aly1231.7.2:T1033T (not A), aly1231.7.2:G1019G (not C), aly15220.1.1:T537T (not C), aly1603.69.1:T840T (not C), aly1139.65.13:C280C (not A), and aly1139.46.3:A70A (not C).

Type species.

Ornilius rotundus Grishin, new species.

Species included in the genus.

Only the type species.

Parent taxon for the genus.

Tribe Phocidini Tutt, 1906.

Etymology.

The genus name is a masculine noun in the nominative singular, given due to the elaborate and embellished shape of the genitalia: Orn[atus] + ilius (from ilia: guts, groin, genitals, etc.). The species name is a masculine adjective proposed for rounded wings on the type species, more so than in most Phocidini.

Salantoia metallica Grishin, new species

http://zoobank.org/8CC4BEC6-D009-4F8A-B2CC-9AC227EB20A7

Definition.

Genomic analysis reveals that one female specimen (NVG-2683) in the USNM collection belongs to Salantoia, together with S. gildo and the type species S. eriopis (Fig. 1), but is not identifiable to species either genetically (it did not match any of the species we have sequenced) or phenotypically, and therefore is new. Female of this species (Fig. 2d,e) is distinguished from other Salantoia by extensive greenish-yellow metallic sheen on its body and all wings above and below. The sheen is most extensive on hindwing and the basal half of forewing, basad of a discal hyaline band from mid-costa to tornus, composed of four aligned spots narrowly interrupted by three darker veins. In addition to the band, forewing with three subapical hyaline dots, the one in cell R5-M1 offset distad from the two others, and one dot in cell M3-CuA1 by vein CuA1. This banded pattern (but not the subapical dots) and metallic sheen reminds of Porphyrogenes Watson, 1893 (type species Telegonus omphale Butler, 1871), but the new Salantoia species differs in the structure of palpi with the 3rd segment very short, mostly hidden among the scales (not protruding much beyond) of the 2nd quadrantic (not cylindrical) segment; the structure of antennae: stronger thickened at the club and with very long nudum of 34 segments (Fig. 2f) vs. up to 25 in Porphyrogenes according to Evans (1952: 136), and by weakly defined but yet clearly visible pale discal spots on ventral hindwing complemented with similar spots in discal cell and at the basal third of cell Sc+R1-RS. Sterigma in female genitalia does not offer unusual features: with broad and short, wide-M-shaped well developed lamella antevaginalis and postvaginalis (Fig. 2g). Male is unknown and is not among specimens we have sequenced. The COI barcode sequence of the holotype is: AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAACAGAATTAGGTACCCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCTTTAACACTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTATCCTCCTTTATCAGCTAATATTGCACATCAAGGATCTTCAGTTGATTTAGCAATTTTCTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAACATACGAATTAAAAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCATTACCTGTATTAGCAGGTGCTATTACAATACTTTTAACAGACCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type locality.

Guyana: Acarai Mts., Sipu River, 900′–2500′, GPS 1.387, −58.947.

Type material.

Holotype, female deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), with the following rectangular white labels: ∥ GUYANA: Acarai Mts. | Sipu R. 900′–2500′ | 29.X.-12.XI.2000 | 1°23.2′N 58°56.8′W | Leg. S.Fratello et al ∥ DNA sample ID: | 11-BOA-13383B08 | c/o Nick V. Grishin ∥ DNA sample ID: | NVG-2683 | c/o Nick V. Grishin ∥ NVG140628–53 ∥ [barcode image] | USNM ENT 00179743 ∥. The holotype was sampled for DNA twice: a leg sample (11-BOA-13383B08) and abdomen extraction (NVG-2683) prior to genitalia preparation stored in a vial (NVG140628–53) by the specimen. The holotype identification label will be mailed to the curators of the collection. No other specimens are known.

Etymology.

The species is named for the metallic sheen of the wings not present in other Salantoia. The name is a feminine adjective.

Telegonus erythras Mabille, 1888 is a junior subjective synonym of Dyscophellus damias (Plötz, 1882)

Inspecting unpublished illustrations by Plötz, Godman (1907: 135) suggested that Netrocoryne damias Plötz, 1882 (type locality Brazil) is synonymous with Dyscophellus ramusis (Stoll, 1781). This treatment was followed by the subsequent authors, with Evans (1952) applying this name to the southernmost populations of this species as Dyscophellus ramusis damias. However, these specimens (and other D. ramusis populations) do not agree with the original description of N. damias (Plötz 1882c), given in a key, the last part of which can be translated as: “No hyaline spots. All wings are rust-colored on both sides, with small brown spots instead of the hyaline spots, which below are mostly gray in the middle. FW near the base in cell 1, with two brown points one above the other, HW with a broad brown costal margin[al area].” First, all D. ramusis populations are brown-colored, not rust-colored. Rust color is orange-brown, with clear reddish tones absent in D. ramusis. Second, southern D. ramusis populations have gray-, white- and hyaline-centered dark spots on wing above, not only below.

Furthermore, we found at least one syntype of N. damias in the ZMNB, where many Plötz types are curated. One of these specimens (NVG-15031F05) bears a 4-digit label ∥ 4858 ∥. Such labels were frequently referenced in Plötz papers (but not for N. damias). This specimen also bears a green label ∥ Damias | HSch ∥. Plötz referenced his N. damias as “Coecutiens var. Herr. Sch.” (Plötz 1882c), and “HSch” on the label stands for Herrich-Schäffer. Another green label with “Pará” suggests that the specimen is from Brazil. The specimen is reddish in color, has brown spots and these brown spots have pale centers on ventral hindwing. Therefore, it matches the description of N. damias, is from Brazil, and is a syntype. This specimen has a red “Typus” label pinned next to it and is referenced in the ZMHB card catalogue as both N. damias and Telegonus fulvius Plötz, 1882. Indeed, it also bears a white label ∥ fulvius Pl | type ∥ in more modern handwriting, but it does not match the description of T. fulvius Plötz, 1882, and therefore is not a syntype of this taxon. A second specimen (NVG-15031F12) is labeled as a type of “sebaldus, Cr.” (i.e., Papilio sebaldus Stoll, 1781), which it is not, because it does not match the original description of P. sebaldus and is not from Suriname. However, it bears an old label matching Herrich-Schäffer’s handwriting ∥ Amazon inf. | H[a]h[ne]l ∥, generally fits the description and locality of N. damias and is therefore a possible syntype of this taxon, although it is smaller than mentioned in the description of N. damias.

Genomic sequencing reveals that both N. damias specimens (NVG-15031F05 and NVG-15031F12) are likely conspecific with each other and with specimens identified as Dyscophellus erythras (Fig. 1). Telegonus erythras Mabille, 1888 (type locality “Amazone inférieur”) was described and illustrated from the Staudinger collection (Mabille 1888), which for the large part is in the ZMHB. However, it is possible that other syntypes exist and they may belong to other species. To stabilize nomenclature, N.V.G. hereby designates the specimen with a clear syntype status (NVG-15031F05) in the ZMHB as the lectotype of Netrocoryne damias Plötz, 1882. This specimen is chipped near the tornus of the left hindwing and bears the following labels ∥ 4858 ∥ Pará Sieber ∥ fulvius Pl | type ∥ Damias | HSch. ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 940b35 ∥ DNA sample ID: | NVG-15031F05 | c/o Nick V. Grishin ∥.

Next, we see that a possible paralectotype of N. damias (NVG-15031F12) from “Amazon inf” without discrepancies matches the description and the first illustrated syntype of T. erythras and is most likely this syntype, making this specimen part of the type series of both taxa: N. damias and T. erythras. We also located and sequenced the second illustrated syntype (NVG-15031G03), which Mabille assumed to be a female of this species in his description (Mabille 1888), but it is a male (even labeled as a male in Mabille handwriting) of a species known today as Fulvatis fulvius (Plötz, 1882) (formerly in Salatis) (Fig. 1), which lacks costal fold in males and for this reason can pass for a female by mistake. This second syntype bears a similar label ∥ Amaz. inf. | H[a]h[ne]l ∥ and it also is labeled ∥ Tel. erythras | ♂ Mab ∥ in Mabille’s handwriting in addition to the label ∥ Erythras | Mab. ∥ in Staudinger’s handwriting. The “Amazon inf.” labels on both connect the two syntypes together and offer additional evidence that these are the two syntypes from the Staudinger collection illustrated by Mabille (1988: Fig. 3). To select one species from the polytypic series of Telegonus erythras that agrees best with the current usage of these names, to resolve the confusion about them, and to stabilize their usage, N.V.G. designates the syntype in the ZMHB with its right hindwing chipped near tornus and bearing the following labels ∥ Origin ∥ Amazon inf. | Hhl ∥ Dyscophus | sebaldus, Cr. | ♂ | not ♂ of | Erythus, Cr! ∥ Sebaldus | Crm. ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 940b3e ∥ DNA sample ID: | NVG-15031F12 | c/o Nick V. Grishin ∥ as the lectotype of Telegonus erythras Mabille, 1888.

Genomic and phenotypic comparison of the two lectotypes: N. damias (type locality Brazil: Para) and T. erythras (type locality “Amazon inf.”) reveals that they are conspecific (Fig. 1). Therefore Telegonus erythras Mabille, 1888 is a junior subjective synonym of Dyscophellus damias (Plötz, 1882). As a result, the taxon that Evans (1952) following Godman (1907) misidentified as damias is left without a name, a situation that is corrected next.

Dyscophellus australis Grishin, new species

http://zoobank.org/0959D624-05B4-4EE3-8AB8-AB11D1D3B31D

Definition.

This new name is proposed for the taxon that Evans (1952) misidentified as Dyscophellus ramusis damias. Austin (2008) suggested that it is a species-level taxon due to genitalic differences, with which we agree. The description of it is given by Evans (1952: 150) and it keys to D.4.9.(c[sic! recte d]). In brief, smaller than D. ramusis (Stoll, 1781) (type locality Suriname), forewing length about 25 mm in males and 30 mm in females (not 30 and 35); wings ochreous-brown (not reddish-brown) with darker-brown spots, most of which with paler centers both above and below; hindwing with outer margin convex and angled at vein CuA2; harpe in male genitalia terminally broader and divided, inner edge not folded over. The specimen in the best condition from the Evans series is selected as the holotype, a male from Paraguay: Sapucay in the Natural History Museum, London, UK (BMNH), illustrated in Fig. 2c, and the rest of the series curated by Evans (8 ♂♂ and 2 ♀♀) are paratypes, from Paraguay and Brazil: Espírito Santo, Rio de Janeiro and Goiás. Type identification labels will be mailed to curators of the collection to be placed on these specimens.

Type locality.

Paraguay: Sapucay.

Distribution.

The species is known from Southeast Brazil and Paraguay.

Etymology.

The species is the southernmost representative of the Dyscophellus species that are close relatives of D. ramusis. The name is a masculine adjective.

Dyscophellus basialbus Grishin, new species

http://zoobank.org/20AC7B30-B572-4E35-B3B3-FDC0910626A7

Definition.

Sequencing of the Nascus diaphorus Mabille and Boullet, 1912 (type locality Suriname) holotype (NVG-18086A07, EL63162) in MNHP reveals that it is a taxon closely related to Dyscophellus ramon Evans, 1952 (type locality Panama: Bugaba), and not to the species Evans (1952) and consequently Austin (2008) identified as Dyscophellus diaphorus. The D. diaphorus holotype will key out to D. ramon in Evans (1952: 149), because it has a white stripe along the vein 8 (i.e. Sc+R1) on dorsal hindwing (instead of white basal area of Evans’ “D. diaphorus”) and tawny wing color (instead of more brown). Therefore, in the absence of available synonyms, Austin’s and Evans’ “D. diaphorus” becomes a species without a name, which is given to it here. Description of this species is already provided by Evans (1952: 149), where it keys out to D.4.8., and complemented by Austin (2008: 23), who also illustrated its male genitalia in detail (2008: Fig. 100). In brief, the new species is distinguished from its relatives by males with a broad pale area along hindwing costa above, up to about half wing length, preceded by dark basal spot and followed by dark-brown scaling between veins Sc+R1 and M1. This species is most closely related to Dyscophellus porsena (E. Bell, 1934) (type locality Peru: Iquitos) as revealed by sequencing of its holotype (NVG-15104B04) in AMNH. Austin (2008) discussed and illustrated D. porsena, which according to Austin differs from the new species by the pale area at the hindwing costa being confined to near vein Sc+R1 as a white ray (but it looks more extensive in D. porsena holotype, so it remains to be investigated whether this character is variable or Austin misidentified D. porsena as well) and male genitalia with bulkier uncus, shorter tegumen and narrower valva with somewhat downturned harpe instead of slightly upturned harpe in the new species. The COI DNA barcodes of the new species and D. porsena differ by 5.8% (38 bp), and the new species is identified by the following combination of DNA characters in the barcode: A40C, T59C, A79G, T112C, A238G, T382A, T463C, A494T, and T547C. The COI barcode sequence of the holotype is: AACTCTTTATTTTATTTTCGGAATTTGAGCAGGAATAGTCGGTACATCATTAAGATTACTAATTCGAACTGAATTAGGGATCTCAGGTTCTTTAATTGGTGATGATCAAATCTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATATTAGGGGCCCCTGATATAGCTTTCCCGCGAATAAATAACATAAGATTTTGATTATTACCCCCATCCTTAATTTTACTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGATGAACTGTTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAACATACGAATTAGAAACTTATCATTCGATCAATTACCCTTATTTGTTTGATCTGTTGGAATTACAGCTTTACTATTATTACTTTCCTTACCTGTATTAGCAGGAGCTATTACAATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material.

The specimen illustrated by Austin (2008: Fig. 34, 37), a male, is chosen as the holotype, also illustrated in Fig. 2j,k here. It is currently in the collection of McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA (MGCL) and bears the following labels: ∥ BRASIL: Rondonia | 65 km S Ariquemes | linea C-20, 7 km E | B-65, Fazenda | Rancho Grande | 9 June 1993 / leg. G. T. Austin | (at paper lures | 1700–1730) ∥ DNA sample ID: | NVG-15026C05 | c/o Nick V. Grishin ∥. Another male from the same locality, but collected on 11 August 1993, was also sequenced as NVG-15026C06 and is the only paratype. Due to possibly cryptic species in this complex, unsequenced specimens are not made paratypes. Type identification labels will be mailed to curators of the collection to be placed on these specimens.

Type locality.

Brazil: Rondônia; 62 km south of Ariquemes, Linha C-20, 7 km (by road) east of route B65, Fazenda Rancho Grande, elevation 180 m.

Distribution.

Currently only known with confidence from the type locality, but phenotypically similar populations according to Evans (1952) are recorded from Colombia (Muzo, Rio Negro), French Guiana, Amazonian Peru and Brazil (Pará). At least some of these, however, may be D. porsena or other species.

Etymology.

The species is named for the diagnostic character defined by Evans, white basal area by the costa on dorsal hindwing, instead of white ray along vein 8 (Sc+R1). The name is a masculine adjective.

Dyscophellus doriscus (Hewitson, 1867), reinstated status

Eudamus doriscus Hewitson, 1867 (type locality Brazil: Rio de Janeiro) has been treated as a subspecies of Dyscophellus porcius (C. Felder and R. Felder, 1862) (type locality “upper Rio Negro”) from Southeast Brazil since Evans (1952). Genomic analysis reveals notable separation between the two taxa with Fst/Gmin statistics on Z chromosome-encoded protein of 0.32/0.03 (Cong et al. 2019a). These numbers suggest genetic diversification and limited gene exchange between the two taxa. Phenotypically they differ by the number of hyaline spots in males (Evans 1952). Therefore, we propose species-level status for Dyscophellus doriscus (Hewitson, 1867), reinstated status. Our genomic analysis included two syntypes of Netrocoryne coecutiens Herrich-Schäffer, 1869 from Brazil: Rio de Janeiro in the ZMHB (NVG-15031G01 and G02), which are D. doriscus, and specimens from Venezuela, Peru and Bolivia for D. porcius. Despite the notable genetic diversification in nuclear genomes, COI barcodes of these species differ by only 0.9% (6 bp), albeit consistently without much variation within each species.

Telegonus diophorus Möschler, 1883 is a junior objective synonym of Bungalotis corentinus (Plötz, 1882), reinstated status

Telegonus corentinus Plötz, 1882 (type locality Suriname), whose drawing (No. 1333) according to Godman (1907: 151) was missing from the original set made by Plötz, has been since Mabille (Mabille 1903) treated as a junior subjective synonym of Papilio midas Cramer, 1775 (type locality Suriname). However, Bungalotis midas specimens do not agree with the original description of T. corentinus. T. corentinus was described in a key to Hesperiidae species (Plötz 1882c), and was the next species to B. midas, both unified by the following characters, as translated from German original: “Without hyaline spots. Forewing basad in cell 1 unspotted. Rust-yellow, hindwing above from vein 7 to the costa brown. Tornus somewhat pointed.” And also for T. corentinus: “Hindtibiae with very long hairs.” The lack of a brown spot doublet at the basal third of forewing cell CuA2-1A+2A excludes Dyscophellus Godman and Salvin, 1893. The lack of hyaline spots combined with rusty-yellow (not brown) color excludes all other related genera except Bungalotis E. Watson, 1893. Furthermore, according to Evans (1952: 137), “densely fringed” tibiae are characteristic of Bungalotis. Therefore, it is most probable that T. corentinus indeed belongs to Bungalotis.

Plötz’s key clearly spells out the differences between Bungalotis corentinus and B. midas. First, in B. corentinus: “Upper side almost without markings, the most noticeable is a brown spot in the middle cell of the hindwing.” In contrast, for B. midas we have: “Upper side of all wings with a brown spot in the middle and an unequal, curvy cross-band against the margin.” While we do find poorly marked specimens of B. midas, they are not common and they tend to have forewing spots more prominent that the discal cell spot on hindwing. Second, in B. corentinus: “Underside brownish, forewing only with a row of small brown spots against the margin, hindwing with a larger central spot and a circle of smaller ones, almost all white-centered.” In B. midas: “On the underside, … the markings of the forewing are as above, the hindwing has two transverse bands consisting of large square spots and a smaller one in cell 7 next to the base.” The description of B. midas is quite accurate. However, in B. midas males we inspected, the hindwing brown spots do not have white centers, as stated by Plötz for B. corentinus. Third, forewing length of B. corentinus is 28 mm, which is on the lower side for B. midas with the forewing length 30 mm as given by Evans (1952). Thus, if B. corentinus is indeed B. midas, as currently assumed (Mielke 2005), it would have been one of the smallest, poorest-marked specimens with white-centered small ventral hindwing spots. Out of dozens B. midas we have seen, none matched this description. Therefore, B. corentinus is not likely to be B. midas.

Next, we attempted to locate syntypes of B. corentinus. We searched carefully all Hesperiidae drawers in the ZMHB collection, including the supplemental drawers that may contain additional syntype specimens not currently labeled as types. We also searched Hesperiidae holdings in the ZSMC that contain a number of Plötz type specimens. In these collections, the specimen that comes closest to the original description of T. corentinus is the holotype of Telegonus diophorus Möschler, 1883 (NVG-15031G10) in the ZMHB, also from Suriname. It is not likely that this specimen was a syntype of T. corentinus, because the most prominent spot on dorsal hindwing is the one closest to the dark costal area, not the discal cell spot as mentioned in the description (see above). Out of all specimens we have seen, the specimen that matches the Plötz description best is the specimen (NVG-15026B10) identified as Bungalotis gagarini Mielke, 1967 (type locality Brazil: Goiás) by Austin (2008) and illustrated in his figures 24 and 25. However, this specimen is from Brazil: Rondonia, not Suriname. We sequenced both of these specimens, and they are apparently conspecific (Fig. 1). Furthermore, we sequenced another specimen from Rondonia (NVG-15026B11, also an excellent match to the original description of B. corentinus) with genitalia GTA #1617 illustrated by Austin (2008: Fig. 89) as B. gagarini, and an old specimen from the Schaus collection in the USNM from French Guiana (NVG-17104D08) identified as B. diophorus. All these specimens cluster tightly together in the tree (Fig. 1) and their COI barcodes show only a couple of base pair difference among them, suggesting that they are all conspecific, and are B. diophorus, because the B. diophorus holotype is among them. While we leave the question about possible synonymy of B gagarini and B. diophorus for future studies pending genomic sequencing of B. gagarini holotype, we use this opportunity to objectively define the taxonomic identity of B. corentinus by neotype designation. Here, N.V.G. designates the holotype of Telegonus diophorus Möschler, 1883 as the neotype of Telegonus corentinus Plötz, 1882, making the former a junior objective synonym of the latter. It is the only species known to us that is a perfect match to the original description of T. corentinus.

We believe that there is an exceptional need to designate this neotype, not only because the name B. corentinus has been misapplied and its current treatment is inconsistent with its original description thus creating a source for future instability of names, but also because of an opportunity to correct the following long-standing confusion between orthographically similar names. The two names currently in use are Bungalotis diophorus (Möschler, 1883) and Dyscophellus diaphorus (Mabille and Boullet, 1912). Their species epithets differ by only one letter: o vs. a. Their males are quite similar in appearance, most notably distinguished by a doublet of dark spots towards the base of forewing cell CuA2-1A+2A, absent in B. diophorus and present in D. diaphorus. A mnemonic to remember: o means no spots; o fused with l to form a, where l stands for the vertical doublet of spots, means spots. This spot doublet character was also mentioned in the key by Plötz (1882c). This similarity in names and appearance is a source of many confusions. We are taking this opportunity given by the misidentification B. corentinus that allows us to put the confusion behind and set the record straight about the true identity of B. corentinus, a name proposed earlier than B. diophorus.

Our neotype of B. corentinus satisfies all requirements set forth by ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Telegonus corentinus Plötz, 1882, which has been inconsistent with its original description; 75.3.2. The characters for the taxon have been given in its original description by Plötz (1882c: 78) (some are discussed above), and also by Evans (1952: 138) as those for B. diophorus (keys out to D.1.2.); 75.3.3. The neotype specimen is also the holotype of Telegonus diophorus Möschler, 1883, with the following labels: ∥ Surinam | Prb. | Wd. | 79 | ∥ Type. | Verh. z-b. Ges: Wien. | 1882. p.322. ∥ Diophorus | Möschl. ∥ Origin ∥ Coll. | Staudinger ∥ Coll. Möschl. ∥ Diophorus | Möschl. ∥ GEN.PREP., | MIELKE | 1996 ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 940b51 ∥ DNA sample ID: | NVG-15031G10 | c/o Nick V. Grishin ∥; 75.3.4. Our search for the syntypes is described above, it was not successful, and we consider that the specimens composing the type series of T. corentinus are lost; 75.3.5. As detailed above, the neotype is consistent with the original description, more, it apparently is the only currently known species that matches the original description; 75.3.6. The neotype is from Suriname according to its label, which is the type locality of B. corentinus; 75.3.7. The neotype is in the collection of the Museum für Naturkunde, Berlin, Germany (ZMHB).

Alternative taxonomy of the Bungalotis group

The following eight genera: Bungalotis Watson, 1893 (type species Papilio midas Cramer, 1775), Sarmientoia Berg, 1897 (type species Dyscophus faustinus Burmeister, 1878), Salatis Evans, 1952 (type species Papilio salatis Stoll, 1782), Nicephellus Austin, 2008 (type species Eudamus nicephorus Hewitson, 1876), Salantoia Grishin, 2019 (type species Eudamus eriopis Hewitson, 1867), Fulvatis Grishin, new genus (type species Telegonus fulvius Plötz, 1882), Adina Grishin, new genus (type species Nascus adrastor Mabille and Boullet, 1912), and Ornilius Grishin, new genus (type species Ornilius rotundus Grishin, new species) form a prominent clade in the genomic tree (Fig. 1). All these genera key to D.1b. in Evans (1952) and share similarity of caterpillars and pupae. They form part of the Evans’ “Bungalotis Sub-group” to exclude his Dyscophellus (which included Euriphellus). Previous errors in assignment of species to Salatis and Sarmientoia Berg, 1897 using phenotypes (Evans 1952) suggest that they are reasonably close relatives of each other. Due to rapid radiation near the origin of these eight genera, it is a challenge to confidently partition them into smaller number of genera and avoid monotypic Ornilius, new genus, and Adina, new genus. However, it may be meaningful to combine all these genera into one: Bungalotis sensu lato. This lumping approach will eliminate these monotypic genera and therefore has merit. Under this treatment, the eight genera, which are prominent evolutionary groups within this clade regardless of their rank, become subgenera of Bungalotis. However, genetic differentiation even between the two closest genera Salatis and Nicephellus is substantial (COI barcodes are 9.4% different) (Li et al. 2019). For this reason, we are not taking the step to promote Bungalotis sensu lato, but leave it as a possibility to consider.

Pseudonascus Austin, 2008 is a subgenus of Nascus Watson, 1893

Although without overwhelming statistical support, Papilio paulliniae Sepp, [1842], the type species of Pseudonascus Austin, 2008, appears monophyletic with Papilio phocus Cramer, 1777, the type species of Nascus Watson, 1893 with exclusion of other species, such as Nascus prax Evans, 1952, Telemiades solon Plötz, 1882, and Papilio broteas Cramer, 1780 (Fig. 1). For this reason, if this tree is correct, and if Pseudonascus is kept as a genus, these other species would belong to a new genus or genera. To avoid naming this genus (or genera), an alternative solution would be to consider Pseudonascus a subgenus, new status, within Nascus. This broader Nascus would include all the species placed in it by Evans (1952). As reported previously (Warren et al. 2008, 2009; Li et al. 2019), Nascus is closely allied to Phocides Hübner, [1819], and it is even conceivable to take the next step and consider it a subgenus of Phocides. This broader Phocides would be strongly monophyletic, while Nascus is more weakly supported (Fig. 1), suggesting evolutionary irregularities such as incomplete lineage sorting and introgression between ancestors of these lineages. We do not propose this radical taxonomic step here, but offer it for discussion. Due to morphological differences that prompted Austin (2008) to erect this genus and its genetic differentiation from Nascus, we agree that Pseudonascus is sufficiently distinct to keep it at least as a subgenus instead of a synonym. Therefore, the other two clades of approximately the same genetic differentiation from each other as Nascus from Pseudonascus are named as subgenera next.

Praxa Grishin, new subgenus

http://zoobank.org/945FA578-C50B-424E-8196-02DFEB22BB26

Type species.

Nascus prax Evans, 1952.

Definition.

The subgenus is in the clade that is sister to the clade formed by subgenera Nascus and Pseudonascus, but only with moderately strong statistical support (Fig. 1). Keys to D.5.6 in Evans (1952). Distinguished from other species in the genus Nascus by the following combination of characters: the closest to costa apical white spot on forewing in line with others (not offset basad); cheeks and palpi below yellowish, not white; tegumen with side processes, harpe without a tooth by ventral side, rounded. In DNA, a combination of the following base pairs is diagnostic: aly1259.4.2:C165T, aly1097.19.1:A220T, aly536.142.1:T339C, aly999.3.4:C78T, and aly86.4.1:C51T.

Etymology.

The name is a feminine noun in the nominative singular formed from the type species name.

Species included.

Only the type species.

Parent taxon.

Genus Nascus Watson, 1893.

Bron Grishin, new subgenus

http://zoobank.org/A950EBEA-7799-40AF-9841-8BF5105D1027

Type species.

Papilio broteas Cramer, 1780.

Definition.

The subgenus is sister to Praxa Grishin, new subgenus (Fig. 1). Keys to D.5.3b in Evans (1952). Distinguished from its relatives by the following combination of characters: the closest to costa apical white spot on forewing in line with others (not offset basad); cheeks and palpi white; tegumen with side processes, harpe with a tooth by ventral side. In DNA, a combination of the following base pairs is diagnostic: aly525.53.4:A108T, aly1222.15.5:A8532G, aly2532.10.1:A375G, aly113.26.2:A28C, and aly28779.7.3:A62T.

Etymology.

The name is a masculine noun in the nominative singular, a fusion of species names in this genus: Br[oteas] + [sol]on.

Species included.

The type species and Telemiades solon Plötz, 1882.

Parent taxon.

Genus Nascus Watson, 1893.

Phocides vida (A. Butler, 1872), reinstated status

Distinguished from Phocides urania (Westwood, 1852) (type locality Mexico) by the lack of hyaline forewing spots, Erycides vida Butler, 1872 (type locality Costa Rica) was treated as its subspecies by Evans (1952). However, the two taxa are well-differentiated genetically forming distinct clades (Fig. 1) and the COI barcode difference between them is 2.9% (19 bp). Therefore, we reinstate P. vida as a species-level taxon.

Telegonus galesus form subflavus R. Williams, 1927 is an infrasubspecific name

Genomic sequencing and comparison of the holotype of Telegonus galesus form subflavus Williams, 1927 (type locality Ecuador: Riobamba, NVG-15096B05) in the CMNH and a syntype of Telegonus galesus Mabille, 1888 (type locality Peru: Chanchamayo, NVG-15031B07) in the ZMHB reveals that they represent two distinct species (Fig. 1). The COI barcodes of these type specimens differ by 4.3% (28 bp), which in the presence of phenotypic differences is suggestive of species-level status of these taxa. Because the name subflavus was proposed for a “form”, it may not be necessarily available, and we studied it further. Williams (1927b) used the term “race” to indicate geographic variants (i.e., subspecies) in the same publication where he described “form subflavus”. Therefore his term “form” applies to an infrasubspecific entity rendering the name subflavus unavailable according to the Article 45.6.1. of the ICZN Code. The condition of the Article 45.6.4.1. to “rescue” the name does not apply, because the name subflavus has not been used as valid and is not a homonym.

The situation is more complex, however, because Williams uses the word “form” in several meanings in both of his papers (Williams 1927b; Williams 1927a). First, is its general meaning for any phenotypic difference, be it geographically induced or individual, for example, for “a remarkable aberration”, he writes “attention is now being called to these occasional forms by assigning them names” (Williams 1927b: 262), using “form” for an aberration. Then he writes “race socus … The prevailing form in the following localities” (Williams 1927b: 263), “racial form” (Williams 1927b: 279), or “a racial name for the Insular form” (Williams 1927a: 70) using “form” for wing patterns characteristic of a race. Second, is the specific meaning of “form” to denote distinct wing pattern across geographic localities, which can be deduced from phrases like “presents itself in two forms almost wherever it is found” (Williams 1927a: 72), “chiriquensis form grullus (Mabille) … I believe them to be only a varietal form” (Williams 1927b: 285), or “creteus form hopfferi (Plotz) … it does not seem to be a racial character” (Williams 1927b: 286). A particularly revealing phrase is “the South Eastern race, in which these larger markings seem to be the prevailing form” (Williams 1927b: 263), that indicates Williams’ thinking that species may be divided into geographic “races”, and there are wing pattern “forms” within (and possibly across) these races. It is apparent that Williams distinguishes between “racial form” (=subspecies) and “varietal form” (=non-geographic variation). This second meaning is assigned to the names preceded by the word “form” and in particular those followed by “new form” notation added by Williams to the new names he proposed, because he used “new species” (for species), “new race” (for subspecies). Hence, we conclude that all “new form” names proposed by Williams (1927a,b) are infrasubspecific, unless the conditions of the ICZN Article 45.6.4.1. apply. Our conclusion here is the same as that of Steinhauser (1987) who considered subflavus “an invalid form name”.

Telegonus subflavus Grishin, new species

http://zoobank.org/460487EA-BD24-468A-A335-4F0B49C5DC7A

As shown above, Telegonus galesus form subflavus Williams, 1927 (type locality Ecuador: Riobamba) is an infrasubspecific name with the “holotype” that is a species distinct from Telegonus galesus Mabille, 1888 (type locality Peru: Chanchamayo). This species does not have a valid name, and therefore is new. Here, we apply the same epithet subflavus (a masculine adjective) to this species, which according to ICZN Article 45.5.1. would establish it as new, provided that the description of this species, including its holotype designation and illustration are given in Williams (1927b: 281, pl. 24, fig. 4), all are adopted here. It is distinguished from T. galesus by more extensive yellow overscaling on wings below, especially in the discal area of ventral hindwing. The holotype (NVG-15096B05) (Fig. 2h,i), male, in the collection of the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH) is already conveniently labeled as “Telegonus subflavus”, the exact name that is applied to it now. It bears the following six labels: ∥ Riobamba | Ecuador ∥ Type | Telegonus | subflavus | R.C. Williams,Jr. | 7128 ∥ CMNH HOLOTYPE #762 | Telegonus | subflavus | Williams ∥ Insect collection | CARNEGIE MUSEUM OF | NATURAL HISTORY | Pittsburg, Pa. (CMNH) ∥ Allyn Museum photo | No. 820630–3/4 ∥ DNA sample ID: | NVG-15096B05 | c/o Nick V. Grishin ∥. The COI barcode sequence of the holotype is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTAATAATAGGAGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCATCAAGGAACATCCGTTGACTTAGCAATTTTTTCATTACATCTTGCTGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCATTACTATTATTACTTTCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATCTATTT

It differs from T. galesus by the following combination of characters (among a number of others): 19T, 38G, 85C, 100T, 112T, 133C, 187C, 197T, 205C, 206C, 220T, 223A, 138T, 334A, 374A, 379C, 397T. The type locality is Ecuador: Riobamba. The species is also know from Colombia and Peru with 3 paratypes, NVG-18056D07 ♂, NVG-18056D09 ♀, both from Colombia: Pacho, in ZfBS, and NVG-18028H03 ♂ from Peru: Cusco, in the USNM (Fig. 1). Type identification labels will be mailed to curators of these collections to be placed on the specimens of the type series. Apparently, the range of this new species overlaps with T. galesus and they may be sympatric in Peru.

Telegonus cassius (Evans, 1952), confirmed status

We confirm that Telegonus cassius (Evans, 1952) (type locality Costa Rica) is a species distinct from T. galesus, as listed in Warren et al. (2016), because the COI barcodes between the two taxa differ by 6.5% (43bp) in the presence of phenotypic differences described by Evans (Evans 1952). To stabilize nomenclature, N.V.G. hereby designates a syntype in the ZMHB collection bearing the following seven labels ∥ Origin. ∥ Chanchamayo | Thamm ∥ Teleg. Galesus | ♂ Mab. ∥ Galesus | Mab. ∥ Galesus | Mab. ∥ [barcode image] http://coll.mfn-berlin.de/u/ | e1f9cf ∥ DNA sample ID: | NVG-15031B07 | c/o Nick V. Grishin ∥ as the lectotype of Telegonus galesus Mabille, 1888.

Aethilla jaira Butler, 1870 and Telegonus jaira race jamaicensis Williams, 1927 are junior subjective synonyms of Telegonus cretellus (Herrich-Schäffer, 1869), reinstated status

Currently a junior subjective synonym of Telegonus cassander (Fabricius, 1793) (type locality not specified [Cuba?]), Eudamus cretellus Herrich-Schäffer, 1869 (type locality not more specific than Tropical America to USA) is not conspecific with it, and the E. cretellus syntype (NVG-15031C03) in the ZMHB is placed in the genomic tree within a clade containing specimens from Jamaica identified as Telegonus jaira (Butler, 1870) (type locality West Indies [Jamaica]) (Fig. 1). The syntype has heavier green overscaling consistent with a Jamaican origin identified by DNA sequencing and thus differs phenotypically from its sister species T. cassander from Cuba and Isla de Juventud. Because this species is only known from Jamaica, it is likely that the syntype of E. cretellus was collected in Jamaica. The holotype and allotype of Telegonus jaira race jamaicensis Williams, 1927 (type locality Jamaica) (NVG-15096C01 and NVG-15096B01) in the CMNH are also in the same clade. Telegonus cretellus (Herrich-Schäffer, 1869) is the oldest name for this clade and therefore takes priority, rendering Aethilla jaira Butler, 1870 and T. j. race jamaicensis Williams, 1927 its junior subjective synonyms. To stabilize nomenclature, N.V.G. designates the syntype in the ZMHB bearing the following labels ∥ Origin ∥ cretellus HS ∥ Coll. H. – Sch. ∥ Telegon. | Cretellus | HS. ∥ GEN.PREP., | MIELKE | 1996 ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 940b07 ∥ DNA sample ID: | NVG-15031C03 | c/o Nick V. Grishin ∥ as the lectotype of Eudamus cretellus Herrich-Schäffer, 1869.

Albiphasma Huang, Chiba, Wang and Fan, 2016 is a subgenus of Pintara Evans, 1932

Sequencing of the holotype of Abraximorpha heringi Mell, 1922 (NVG-18073G05) in the ZMHB collection and its phylogenetic comparison with other Tagiadinae Mabille, 1878 species reveals its close relationship with Pintara Evans, 1932 (type species Plesioneura pinwilli Butler, 1879) (Fig. 3); the COI barcode difference between A. heringi and Pintara pinwilli is 6.5% (43 bp), which is suggestive of their congeneric relationship. Recently, a new genus Albiphasma Huang, Chiba, Wang and Fan, 2016 was proposed for A. heringi and its close relative Abraximorpha pieridoides Liu and Gu, 1994 (Huang et al. 2016). We suggest that, due to genetic and morphological similarities, Albiphasma is a subgenus of Pintara. We think that it is more instructive to emphasize the close relationships of nearly monotypic Albiphasma with a more species-rich and diverse Pintara rather than the uniqueness of its mimetic wing patterns. Notably, the closeness between Albiphasma and Pintara was hypothesized already on the basis of morphology in the original publication that proposed Albiphasma (Huang et al. 2016).

Tagiades ceylonica Evans, 1932, new status

Named by Evans (1932) as a subspecies of Tagiades litigiosa Möschler, 1878 (type locality Bangladesh: Sylhet) from Sri Lanka, T. ceylonica is set apart from a cluster of T. litigiosa specimens in the genomic tree (Fig. 4). COI barcodes of T. ceylonica and T. litigiosa differ by 5.5% (36 bp). Additionally noting wing pattern, size and genitalic differences between these taxa described previously (Evans 1932, 1949), we conclude that T. ceylonica is a species-level taxon.

Figure 4.

Figure 4.

Genomic tree of Tagiades. See Fig. 1 legend for notations.

Tagiades tubulus Fruhstorfer, 1910, new status

Placed as a subspecies of Tagiades sambavana Elwes and Edwards, 1897 (type locality Sambawa) by Maruyama (1991), and before that treated as a subspecies of Tagiades litigiosa Möschler, 1878 (type locality Sylhet) by Evans (1949), Tagiades [striata?] tubulus Fruhstorfer, 1910 (type locality W Java) shows 2% (13 bp) COI barcode difference from T. sambavana and genitalic distinction in a longer style of valva noted by Evans (1949). For these reasons, we suggest species status for T. tubulus.

New and reinstated statuses in the Tagiades trebellius (Hopffer, 1874) complex

Treated by Evans (1949) as subspecies of Tagiades trebellius (Hopffer, 1874) (type locality Sulawesi), the following five taxa show genitalic differences in the structure of valva (described and illustrated in Evans (1949) suggesting that they are species: Tagiades martinus Plötz, 1884 (type locality Philippines), Tagiades sem Mabille, 1883 (type locality Sangir Is.), Tagiades neira Plötz, 1885 (type locality Aru Is.), Tagiades trebellius kina Evans, 1934 (type locality Borneo: Kinabalu) and Tagiades trebellius sheba Evans, 1934 (type locality Guadalcanar Is.). Furthermore, genetic differentiation between T. trebellius and the T. neira syntype is large (Fig. 4) and their COI barcodes differ by 8.2% (54 bp), which is a very large difference, not uncommon even between species from different genera. Other pairs of species may exhibit somewhat smaller barcode differences, for example, 6.2% between T. neira and a partial barcode of T. martinus from Japan (GenBank accession AB192504). Therefore we propose to divide the T. trebellius complex into six species and tentatively assign to them other subspecies treated as valid by Evans (1949) as follows: Tagiades trebellius moti Evans, 1934 (type locality Waigou) and Tagiades canonicus Fruhstorfer, 1910 (type locality New Guinea) of T. neira; Tagiades trebellius vella Evans, 1934 (type locality Vella Lavella Is.) and Tagiades trebellius lola Evans, 1949 (type locality Treasury Is.) of T. sheba; while Tagiades mitra Mabille, 1895 (type locality Sula Is.) remains a subspecies of T. trebellius. Some of these subspecies may turn out to be species when additional genomic data become available. Here, we gave precedence to the name sheba published in the same work with the name vella (Evans 1934).

Tagiades korela Mabille, 1891 and Tagiades presbyter Butler, 1882, reinstated statuses

Considered by Evans (1949) among subspecies of Tagiades nestus (C. Felder, 1860) (type locality Amboina), the taxa Tagiades korela Mabille, 1891 (type locality Waigeo) and Tagiades presbyter Butler, 1882 (type locality Duke of York Is.) differ phenotypically (Evans 1949) and genetically from T. nestus and we reinstate them as species (Fig. 4). For instance, the COI barcode difference between T. nestus gilolensis Mabille, 1878 (type locality Halma-hera Is.) and T. presbyter Butler, 1882 is 3% (20 bp) and that between T. n. gilolensis and T. korela (GenBank accession HQ570836) is 2.3% (15 bp). We tentatively place the following subspecies treated as valid by Evans (1949) under T. korela (while others remain with T. nestus): Tagiades nestus biakana Evans, 1934 (type locality Biak Is.), Tagiades nestus mefora Evans, 1934 (type locality Numfoor Is.), Tagiades suffusus Rothschild, 1915 (type locality Vulcan Is.), and Tagiades nestus brunta Evans, 1949 (type locality Muyua Is.). Assignment of some of the T. nestus group subspecies to species is preliminary and is likely to change (for example, they may be species-level taxa) as additional genomic data are analyzed.

Tagiades obscurus Mabille, 1876, Tagiades ravi (Moore, [1866]), Tagiades atticus (Fabricius, 1793), Tagiades titus Plötz, 1884, Tagiades janetta Butler, 1870, Tagiades inconspicua Rothschild, 1915, and Tagiades hovia Swinhoe, 1904, reinstated statuses

Placed by Evans (1949) as subspecies of Tagiades japetus (Stoll, [1781]) (type locality Ambon), the following seven taxa reveal genetic differentiation among them and the nominotypical japetus consistent with reproductive isolation: Tagiades obscurus Mabille, 1876 (type locality deduced as Sri Lanka), Pterygospidea ravi Moore, [1866] (type locality Bengal), Hesperia atticus Fabricius, 1793 (type locality suggested as Malay Peninsula), Tagiades titus Plötz, 1884 (type locality Philippines), Tagiades janetta Butler, 1870 (type locality Aru Islands), Tagiades hovia Swinhoe, 1904 (type locality Shortland Islands), and Tagiades inconspicua Rothschild, 1915 (type locality Manus Island) (Fig. 4). For instance, COI barcode difference between sisters T. obscurus and P. ravi is 5.3% (35 bp) and between sisters T. inconspicua and T. janetta is 4.5% (30 bp). Among these eight taxa, the smallest COI difference is observed between nominotypical T. japetus and T. titus: 2.1% (14 bp). Combined with phenotypic differences described by Evans (1949), such genetic differences support species rank for these taxa. Comparing other subspecies in the T. japetus complex with available DNA sequences with their close relatives shows little differentiation for many pairs, for example, P. ravi and Tagiades khasiana ravina Fruhstorfer, 1910 (type locality Andamas) COI barcodes differ by 0.3% (2 bp). Therefore, we suggest to divide the japetus complex into eight species and tentatively assign other subspecies considered valid by Evans (1949) to these species as follows: T. k. ravina of T. ravi; Tagiades japetus carnica Evans, 1934 (type locality Car Nicobar), Tagiades japetus nankowra Evans, 1934 (type locality Nancowry), Pterygospidea helferi C. Felder, 1862 (type locality Pulomilo) and Tagiades balana Fruhstorfer, 1910 (type locality N. Borneo) of T. atticus; Tagiades japetus mathias Evans, 1934 (type locality St. Mathias) of T. inconspicua; Tagiades japetus kazana Evans, 1934 (type locality Treasury Islands) of T. hovia; while others remain as subspecies of T. japetus. This treatment is conservative, because some of these species show non-trivial difference in barcodes within species, for example, T. atticus and T. balana differ by 1.7% (11 bp), and we have not obtained sequences of several taxa, for instance a uniquely patterned T. kazana. It is likely that some of our seven species (probably T. atticus, T. japetus and T. janetta) are complexes of additional species to be sorted out in future work.

Tagiades silvia Evans, 1934, new status and Tagiades elegans Mabille, 1877, reinstated status

Treated as subspecies of Tagiades gana (Moore, [1866]) (type locality “Bengal” [probably Java]) by Evans (1949), Tagiades gana silvia Evans, 1934 (type locality N. Kanara) and Tagiades elegans Mabille, 1877 (type locality Philippines) show genetic differentiation among them suggestive of species level for these taxa (Fig. 4). For instance, T. elegans and Tagiades gana meetana Moore, 1878 (type locality Meetan) show COI barcode difference of 5.9% (39 bp), or T. elegans and T. g. silvia reveal 3.6% (24 bp). Conversely, the barcodes differ by 0.5% (3 bp) between the nominotypical T. gana specimen from Sumatra (GenBank accession JF851897) and T. g. meetana. Therefore we propose to split the T. gana complex into three species (T. silvia, T. gana and T. elegans) and place Tagiades gana fuscata de Jong and Treadaway, 2007 (type locality Philippines: Mindoro) and, after much hesitation and very tentatively, pending further research, also Tagiades semperi Fruhstorfer, 1910 (type locality Camiguin Is.) as subspecies of T. elegans. We leave with T. gana other subspecies that Evans (1949) considered valid.

Daimio Murray, 1875 and Pterygospidea Wallengren, 1857 are subgenera of Tagiades Hübner, [1819]

Genome-based phylogenetic tree reveals that Tagiades Hübner, [1819] (type species Papilio japetus Stoll, [1781]) consists of three prominent clades (Fig. 3, 4) that could be given subgenus status. Each clade contains one type species of an available genus-group name that we assign to the clade. Subgenus Pterygospidea Wallengren, 1857, revised status (type species Papilio ophion Stoll, [1790], which is a junior subjective synonym of Papilio flesus Fabricius, 1781), consists of Afrotropical Tagiades species. Subgenus Tagiades is the japetus group of Evans (1949). Notably, the nestus group of Evans (1949) belongs to the subgenus Daimio Murray, 1875, revised status (type species Pyrgus tethys Ménétriés, 1857), together with Tagiades (Daimio) tethys as defined by Evans (1949). We think that denoting the distinct phylogenetic groups with the genus Tagiades as subgenera is instructive about the relationships between the many species of the genus, and we prefer not to synonymize Daimio as proposed recently (Huang et al. 2020). We also considered an alternative solution of breaking Tagiades into three genera, but decided against it. Tagiades sensu lato forms a more prominent phylogenetic group than its subgenera (Fig. 3). It includes species that are similar in appearance making them immediately recognizable as Tagiades, for which reason they were historically included in it. We are in agreement with Huang et al (2020) that inclusion of Daimio in Tagiades is preferable to splitting of Tagiades into several genera. It is interesting that the type species of Daimio is the most distinct in appearance out of all Tagiades, both in wing patterns and wing shapes, while being closer related to a subgroup of Tagiades species that are in turn more similar in appearance to more distant from Daimio species of Tagiades. Additionally, superficial similarity of Daimio tethys with some species of Gerosis Mabille, 1903 indicates convergent evolution.

Ctenoptilum de Nicéville, 1890 is a subgenus of Tapena Moore, [1881]

Phylogenetic analysis reveals that two small genera: Ctenoptilum de Nicéville, 1890 (type species Achlyodes vasava Moore, [1866], two currently recognized species) and Tapena Moore, [1881] (type and the only species Tapena thwaitesi Moore, [1881]) are sisters (Fig. 3). COI barcode difference between their type species is 8.7% (57 bp). Moreover, their genitalia are similar in a peculiar shape of valva (Evans 1949). We think it is less informative to keep monotypic or nearly monotypic genera unless they are prominently distinct than to join them in a single genus thus indicating their relatedness. Therefore we suggest to treat Ctenoptilum de Nicéville, 1890 as a subgenus of Tapena Moore, [1881].

Tapena bornea Evans, 1941 and Tapena minuscula Elwes and Edwards, 1897 are species-level taxa

Presently placed as subspecies of Tapena thwaitesi Moore, [1881] (type locality Sri Lanka), Tapena thwaitesi bornea Evans, 1941 (type locality Malaysia: Perak) and Tapena minuscula Elwes and Edwards, 1897 (type locality Myanmar: Bernardmyo) show genitalic differences of the magnitude known for species level taxa. Genomic tree reveals a prominent separation between T. thwaitesi from Sri Lanka (NVG-18019A08) and T. bornea from Borneo: Kinabalu (NVG-18073F07). Their COI barcodes differ by 2.4% (16 bp). Although we have not sequenced T. minuscula, due to its genitalic differences from others we propose to treat both Tapena bornea Evans, 1941 and Tapena minuscula Elwes and Edwards, 1897 as species.

Darpa dealbata (Distant, 1886), reinstated status

Tagiades dealbata Distant, 1886 (type locality Malay Peninsula) has been treated by Evans (1949) as a subspecies of Darpa pteria (Hewitson, 1868) (type locality Philippines). In addition to comparatively (among Darpa Moore, [1866] species) large genetic distances revealed by a genomic tree (Fig. 3), COI barcodes of these two taxa differ by 7% (46 bp), and genitalia differ per Evans’ sketches (1949) and more detailed illustrations (Huang et al. 2019), most strongly in the shape of ampulla process and the end of harpe. For these reasons, we reinstate Darpa dealbata (Distant, 1886) as a species distinct from D. pteria.

Triskelionia Larsen and Congdon, 2011 belongs to Tagiadini Mabille, 1878 and is confirmed as a valid genus

Proposed for Hyda tricerata Mabille, 1891 (type locality Sierra Leone) at that time placed in the Celaenorrhinini Swinhoe, 1912 genus Sarangesa Moore, [1881] (type species Sarangesa albicilia Moore, [1881], which is currently a subspecies of Nisoniades dasahara Moore, [1866]), Triskelionia Larsen and Congdon, 2011 was left in Celaenorrhinini (Larsen and Congdon 2011). We sequenced two syntypes of Triskelionia tricerata in the ZMHB collection (NVG-18055E03 and 4). They form a clade distinct from others and sister to Tapena Moore, [1881] (type species Tapena thwaitesi Moore, [1881]) plus Gerosis Mabille, 1903 (type species Coladenia hamiltoni de Nicéville, [1889], which is a junior subjective synonym of Satarupa phisara Moore, 1884) with strong support (Fig. 3). All these genera are within Tagiadini Mabille, 1878, and away from Celaenorrhinini as judged by the monophyly with the corresponding type genera of these tribes. Therefore, we transfer Triskelionia from Celaenorrhinini to Tagiadini, new placement, and confirm its validity as a genus.

Abaratha Moore, 1881 is a valid genus

Presently placed in the genus Caprona Wallengren, 1857 (type species Caprona pillaana Wallengren, 1857), Pterygospidea ransonnetii R. Felder, 1868, the type species of Abaratha Moore, 1881, is not monophyletic with C. pillaana. Instead, Abaratha is sister to Odontoptilum de Nicéville, 1890 (type species Achlyodes sura Moore, [1866], which is a junior subjective synonym of Pterygospidea angulata C. Felder, 1862). To restore the monophyly of Caprona, we suggest to treat Abaratha as a valid genus, revised status.

Odontoptilum de Nicéville, 1890 is a subgenus of Abaratha Moore, 1881

Both Odontoptilum de Nicéville, 1890 (type species Achlyodes sura Moore, [1866], which is a junior subjective synonym of Pterygospidea angulata C. Felder, 1862) and Abaratha Moore, 1881 (type species Pterygospidea ransonnetii R. Felder, 1868) are sister genera that consist of several species (Fig. 3). Although species within each genus are more closely related to each other than between genera, the two genera are close, for example, COI barcode difference between their type species is only 7.3% (48 bp). Moreover, their male genitalia are similar to each other, characterized by a highly asymmetric uncus and considerably elongated valvae. For these reasons, it would be more informative to emphasize the close relatedness of the two genera and consider all these species congeneric by placing Odontoptilum de Nicéville, 1890 in Abaratha Moore, 1881 as a subgenus.

Leucochitonea Wallengren, 1857 is a junior subjective synonym of Abantis Hopffer, 1855

Leucochitonea Wallengren, 1857 (type species Leucochitonea levubu Wallengren, 1857) and Abantis Hopffer, 1855 (type species Abantis tettensis Hopffer, 1855) cluster closely in the tree (Fig. 3), their COI barcodes are different by 6.2% (41 bp). Their genitalia are similar, wing shapes are similar, and the major distinction of Leucochitonea is in its white-colored wings, which is hardly a good argument for the genus distinction: for example, Capila pieridoides (Moore, 1878), the white-patterned species, is included within the same genus with the darker-patterned species. Therefore we suggest to treat Leucochitonea Wallengren, 1857 as a junior subjective synonym of Abantis Hopffer, 1855.

Sapaea Plötz, 1879 and Netrobalane Mabille, 1903 are junior subjective synonyms of Caprona Wallengren, 1857, which is a subgenus of Abantis Hopffer, 1855

The genomic tree reveals unexpected grouping of the four genera that were considered valid: Leucochitonea Wallengren, 1857 (type species Leucochitonea levubu Wallengren, 1857) and Abantis Hopffer, 1855 (type species Abantis tettensis Hopffer, 1855), Netrobalane Mabille, 1903 (type and the only species Caprona canopus Trimen, 1864) and Caprona Wallengren, 1857 (type species Caprona pillaana Wallengren, 1857) (Fig. 3). As discussed above, all species previously placed in Caprona but its type species are in the same clade with Odontoptilum de Nicéville, 1890. Then, only the type species of Abantis is in the same clade with Leucochitonea. All other Abantis species, including Leucochitonea bicolor Trimen, 1864, which is the type species of Sapaea Plötz, 1879, currently considered a junior subjective synonym of Abantis, are closely related to the type species of Caprona and monotypic Netrobalane. The tree topology is strongly supported with 100% bootstrap values (Fig. 3). The tree reveals two major clades that we suggest to treat as subgenera: (1) Leucochitonea with Abantis tettensis and (2) Sapaea with Caprona pillaana and Netrobalane Mabille, 1903. Considering the priority of these names we propose that Sapaea Plötz, 1879 and Netrobalane Mabille, 1903 are junior subjective synonyms of Caprona Wallengren, 1857, which is a subgenus of Abantis Hopffer, 1855. Further analysis of the tree reveals that Abaratha (with its subgenus Odontoptilum) and Abantis (with its subgenus Caprona) are relatively close to each other, form a prominent clade in the tree, and together could be considered congeneric within Abantis sensu lato. However, instead of joining all these reasonably close relatives in one large genus, we think that keeping two genera may be more instructive because they make geographical sense: African Abantis and Asian Abaratha.

Kobelana Larsen and Collins, 2013 belongs to Celaenorrhinini Swinhoe, 1912 and is confirmed as a valid genus

Originally tentatively placed in Tagiadini Mabille, 1878 (Larsen and Collins 2013), Kobelana Larsen and Collins, 2013 (type species Nisoniades kobela Trimen, 1864) is not monophyletic with the type genus of the tribe, and is placed close to the root of Celaenorrhinini (Fig. 3). Due to its distinction and prominent separation from other taxa, it is confirmed as a valid genus, and due to its phylogenetic position, it is transferred from Tagiadini to Celaenorrhinini, new placement.

Apallaga Strand, 1911 is confirmed as a valid genus

Apallaga Strand, 1911 (type species Apallaga separata Strand, 1911, currently a subspecies of Pterygospidea mokeezi Wallengren, 1857) is not monophyletic with Celaenorrhinus Hübner, 1819 (type species Papilio eligius Stoll, 1781) and genetically distant from other genera (Fig. 3). Therefore, it is confirmed as a valid genus (Libert 2014).

Gorgopas extensa (Mabille, 1891), new combination

Presently in Polyctor Evans, 1953 (type species Pirgus [sic] polyctor Prittwitz, 1868), Pterygospidea extensa Mabille, 1891 (type locality Peru: Huayabamba) is not monophyletic with it, and instead is sister to Gorgopas Godman and Salvin, 1894 (type species Achlyodes viridiceps Butler and Druce, 1872, which is currently treated as a junior subjective synonym of Pellicia chlorocephala Herrich-Schäffer, 1870) (Fig. 5), where it is transferred to form Gorgopas extensa (Mabille, 1891), new combination.

Figure 5.

Figure 5.

Genomic tree of Carcharodini and relatives. See Fig. 1 legend for notations.

Clytius shola (Evans, 1953), new combination

Staphylus shola Evans, 1953 (type locality unknown, sequenced specimen is from Venezuela) is not monophyletic with Staphylus Godman and Salvin, 1896 (type species Helias ascalaphus Staudinger, 1876), and instead is sister to Clytius clytius (Godman and Salvin, 1897) (Fig. 5). Male genitalia of the two species share similarly convex costa and bulging ampulla, but a triangular harpe is more extended caudad in S. shola. Thus, it is placed in the genus Clytius Grishin, 2019 (type species Pholisora clytius Godman and Salvin, 1897) as Clytius shola (Evans, 1953), new combination.

Perus narycus (Mabille, 1889), new combination

Presently in Ouleus Lindsey, 1925 (type species Achlyodes fridericus Geyer, 1832), Pythonides narycus Mabille, 1889 (type locality Peru: Chanchamayo) is not monophyletic with it, and is not even in the tribe Achlyodini Burmeister, 1878 where Ouleus belongs (Fig. 5). Instead, P. narycus belongs to the tribe Carcharodini Verity, 1940, where it is sister to Perus Grishin, 2019 (type species Pholisora cordillerae Lindsey, 1925), and where we place it to form Perus narycus (Mabille, 1889), new combination. Thus, we find that yet another species from Peru belongs to Perus.

Perus parvus (Steinhauser and Austin, 1993), new combination

Staphylus parvus Steinhauser and Austin, 1993 (type locality Costa Rica) is not monophyletic with Staphylus Godman and Salvin, 1896 (type species Helias ascalaphus Staudinger, 1876) and instead originates within Perus Grishin, 2019 (type species Pholisora cordillerae Lindsey, 1925) (Fig. 5), where we transfer it to form Perus parvus (Steinhauser and Austin, 1993), new combination.

Perus manx (Evans, 1953), new status

Presently in Perus Grishin, 2019 (type species Pholisora cordillerae Lindsey, 1925), Staphylus minor manx Evans, 1953 (type locality Colombia: Cauca), is not monophyletic with nominotypical Perus minor (Schaus, 1902) (type locality Peru), and instead is sister to Perus parvus (Steinhauser and Austin, 1993) (type locality Costa Rica) (Fig. 5), being distinct from it: COI barcodes differ by 2.1% (14 bp). Therefore, it is the species-level taxon Perus manx (Evans, 1953), new status.

Pholisora litus (Dyar, 1912), new combination

Presently in Bolla Mabille, 1903 (type species Bolla pullata Mabille, 1903 currently a junior subjective synonym of Bolla imbras (Godman and Salvin, 1896)), Staphylus litus Dyar, 1912 (type locality Mexico: Guerrero) is not monophyletic with it and instead is sister to Pholisora Scudder, 1872 (Hesperia catullus Fabricius, 1793) (Fig. 5), which is further supported by phenotypic similarities, such as forewing pattern of white spots, white pectus and white palpi beneath. To restore the monophyly, we transfer this species to the latter genus to form Pholisora litus (Dyar, 1912), new combination.

Turis Grishin, new subgenus

http://zoobank.org/A4674C67-2288-44AE-8C89-2A914EBCBCAF

Type species.

Pyrgus (Scelothrix) veturius Plötz, 1884.

Definition.

Chirgus Grishin, 2019 splits into two prominent clades suggesting to divide it into two subgenera (Fig. 6). One clade includes Hesperia (Syrichthus [sic]) limbata Erschoff, 1876 and thus is the nominotypical subgenus, and the other is a new subgenus that keys to G.1.9 in Evans (1953). Distinguished from the nominotypical subgenus by the following combination of characters: forewing above with white or hyaline spots in base of cell CuA1-CuA2 and in cell R2-R3 half way between the discal cell spot and subapical spots, below without pale streaks between the discal cell spot and postdiscal spots in cells M1-M2 and M2-M3; males without costal fold, with tibial tuft; uncus undivided; valva simple, three times longer than wide, without inner processes; harpe weakly separated from ampulla, rounded; aedeagus terminally expanded. In DNA, a combination of the following base pairs is diagnostic: aly3561.6.1:A201C, aly3653.7.2:A220C, aly6841.32.4:A1374G, aly116.29.5:A129G, and aly208.28.1:A135G.

Figure 6.

Figure 6.

Genomic trees of Pyrgini and relatives. See Fig. 1 legend for notations.

Etymology.

The name is a masculine noun in the nominative singular formed from the type species name: [ve] Turi[u]s.

Species included.

Only the type species.

Parent taxon.

Genus Chirgus Grishin, 2019.

Canesia pallida (Röber, 1925), reinstated status

Carrhenes pallida Röber, 1925 (type locality Brazil: Rio Grande do Sul) was downgraded by Evans (1953) to a subspecies of Carrhenes canescens (R. Felder, 1869) (type locality Mexico: Veracruz), now in Canesia Grishin, 2019. Sequencing of the C. pallida holotype (NVG-18094F04) in MTD in the context of several specimens of both taxa reveals that they form two distinct non-sister clades (Fig. 6) prompting us to reinstate C. pallida as a species-level taxon.

Carrhenes conia Evans, 1953, new status

Genomic sequencing and comparison of Carrhenes Godman and Salvin, 1895 (type species Leucochitonea fuscescens Mabille, 1891) reveals that Carrhenes fuscescens conia Evans, 1953 (type locality French Guiana) and Carrhenes fuscescens (Mabille, 1891) (type locality Honduras) are not monophyletic (Fig. 6), suggesting species status for Carrhenes conia Evans, 1953, new status. Furthermore, the two syntypes of Leucochitonea chaeremon Mabille, 1891 (type locality Brazil: Amazonas) in the ZMHB are not conspecific, one of them being C. conia. To resolve the ambiguity about its identity and to preserve current usage of the names, N.V.G. designates as the lectotype of Leucochitonea chaeremon the specimen representing the species that has been known as such since Evans (1953): a paler and more complete male syntype NVG-15033B09 (not the one with right wings missing) in the ZMHB collection that already carries a red rectangular label “Lectotypus”, in addition to the following six labels: ∥ Origin. ∥ S. Paulo | Amaz. sup. ∥ ist aber ♂ ∥ Chaeremon ♀ | Mab. | (Mab.) ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 90857b ∥ DNA sample ID: | NVG-15033B09 | c/o Nick V. Grishin ∥. From the original description and one of the labels, this specimen was considered a female by Mabille, but it is a male, as corrected on a different label, and it lacks its abdomen.

Carrhenes decens (A. Butler, 1874), new combination

Genomic sequencing reveals that Antigonus decens Butler, 1874 (type locality Peru) is not monophyletic with Antigonus erosus (Hübner, [1812]) (type locality not given), the type species of Antigonus Hübner, [1819] (Fig. 6), and instead is in the same clade with Carrhenes Godman and Salvin, 1895 (type species Leucochitonea fuscescens Mabille, 1891), suggesting Carrhenes decens (A. Butler, 1874), new combination.

Paches era Evans, 1953 is a junior subjective synonym of Santa palica (Mabille, 1888), reinstated status, new combination

Currently treated as a junior subjective synonym of Chiothion asychis (Stoll, 1780) (type locality Suriname), Ephyriades palica Mabille, 1888 (type locality Peru: Pebas) is not only a species distinct from C. asychis, but also it belong to a different tribe: Pyrgini Burmeister, 1878 instead of Erynnini Brues and Carpenter, 1932, because it is in the same clade with Santa Grishin, 2019 (type species Carrhenes santes Bell, 1940) (Fig. 6), implying Santa palica (Mabille, 1888), new combination. Sequencing of the S. palica holotype, female (NVG-15032B09), in the ZMHB reveals that it is conspecific with Paches era Evans, 1953 (type locality Peru: Rio Pacaya, known only from males), making the latter a junior subjective synonym of the former. The two taxa cluster closely in the genomic tree and COI barcodes of specimens we sequenced differ only by 0.15% (1 bp). Sexual dimorphism is quite striking in this species and made it a challenge to associate the sexes in the absence of DNA data. Furthermore, because the holotype of S. palica is lacking an abdomen, this association with P. era males by DNA suggests that it is a female.

Tiges Grishin, new subgenus

http://zoobank.org/9744C848-1996-435D-B28E-19D21537D656

Type species.

Antigonus liborius Plötz, 1884.

Definition.

Genomic sequencing of the Antigonus liborius Plötz, 1884 (type locality Brazil: Bahia) syntype in the ZMHB reveals that it is not monophyletic with Antigonus Hübner, [1819] (type species Urbanus erosus Hübner, [1812]), but instead is in the same clade with Paches exosa (Butler, 1877) (type locality Brazil: Amazonas) within Paches Godman and Salvin, 1895 (type species Pythonides loxus Westwood, 1852) forming a new subgenus of Paches (Fig. 6). Keys to E.43.5 or E.55.7a in Evans (1953). Distinguished from its relatives by the combination of the following characters: hindwings (at least in males) with concave outer margin in cell Sc+R1-RS and between veins M1 and M3 (sometimes only slightly); complete lack of blue coloration (blue or purple at least on hindwing in male in subgenus Paches); uncus divided, as broad as wide (narrower in Antigonus), weakly separated from tegumen (stronger in subgenus Paches); valva with a long curved process on ampulla protruding caudad beyond harpe; harpe narrow, less than half of valva width. In DNA, a combination of the following base pairs is diagnostic: aly1454.6.2:G68A, aly1838.7.1:A584G, aly1838.7.1:T609A, aly208.4.3:A578G, and aly685.1.9:G164A.

Etymology.

The name is a masculine noun in the nominative singular formed as a fusion of the two genus names: [An]Tig[onus] + [Pach]es, symbolizing a transfer of the type species from Antigonus to Paches.

Species included.

The type species, Achlyodes mutilatus Hopffer, 1874 and Achlyodes exosa Butler, 1877.

Parent taxon.

Genus Paches Godman and Salvin, 1895.

Timochreon Godman and Salvin, 1896 is a subgenus of Zopyrion Godman and Salvin, 1896

In genomic trees, Timochreon Godman and Salvin, 1896 (type species Helias satyrus C. Felder and R. Felder, 1867) clusters closely with Zopyrion Godman and Salvin, 1896 (type species Zopyrion sandace Godman and Salvin, 1896), and they together form a more prominent clade with divergence suggestive of a genus (Fig. 6), with each being subgenera. Barcodes of the type species of these taxa differ by about 8.8% (58 bp). The two names were proposed in the same publication (Godman and Salvin 1896), and as the first reviser we give priority to Zopyrion over Timochreon because the former consists of more species than the latter, and this choice will result in fewer name changes. Thus, we propose to consider Timochreon Godman and Salvin, 1896 a subgenus of Zopyrion Godman and Salvin, 1896.

Anisochoria extincta Hayward, 1933, new status and Anisochoria polysticta Mabille, 1876, reinstated status

Currently placed as subspecies of Anisochoria pedaliodina (Butler, 1870) (type locality not stated), Anisochoria pedaliodina form extincta Hayward, 1933 (type locality Argentina: Misiones) and Anisochoria polysticta Mabille, 1876 (type locality Colombia) form well-separated clades in the genomic tree (Fig. 6), and COI barcodes of A. p. f. extincta and A. pedaliodina differ by 5.8% (38 bp). Due to this genetic differentiation complemented by phenotypic distinction, even reflected in male genitalia (Evans 1953), we suggest to treat A. extincta and A. polysticta as species distinct from each other and from A. pedaliodina.

Anisochoria verda Evans, 1953, new status

Named by Evans (1953) as a subspecies of Anisochoria minorella Mabille, 1898 (type locality Bolivia) from Ecuador, A. m. verda forms a distinct clade in the genomic tree (Fig. 6), and their COI barcodes differ by 4.4% (29 bp), in addition to phenotypic differences detailed by Evans (1953), including those in genitalia. Therefore, we elevate it to a species Anisochoria verda Evans, 1953, new status.

Bralus nadia (Nicolay, 1980), new combination

Sequencing a paratype and a recently collected specimen of Anisochoria nadia Nicolay, 1980 (type locality Ecuador: Loja) reveals that the species clusters with Anisochoria albida Mabille, 1888, which is the type species of Bralus Grishin, 2019, represented by a syntype (NVG-15033E01) from the ZMHB and a more recent specimen, instead of with Anisochoria polysticta Mabille, 1876, the type species of Anisochoria Mabille, 1876 (Fig. 6). The pattern of apical forewing spots in A. nadia agrees with this placement. Therefore, we establish Bralus nadia (Nicolay, 1980), new combination.

Bralus alco (Evans, 1953), new status

Named by Evans (1953) as a subspecies of (then in Anisochoria Mabille, 1876) Bralus albida (Mabille, 1888) (type locality Peru: Chanchamayo) from Bolivia, B. a. alco exhibits 3.5% (23 bp) difference from it. Genetic differentiation combined with consistent differences in phenotypic differences in wing patterns suggests species level for Bralus alco (Evans, 1953), new status.

Tolius Grishin, new genus

http://zoobank.org/4D0B91EA-3367-42AB-B443-6BE63BB2F5C4

Type species.

Antigonus tolimus Plötz, 1884.

Definition.

Despite similarity in appearance and genitalia with Achlyodes sempiternus A. Butler and H. Druce, 1872 (the type species of Echelatus Godman and Salvin, 1894), the new genus is not monophyletic with it (Fig. 7). Keys to F.6.2 in Evans (1953). Distinguished from its relatives by the following combination of characters: wings below with at least some vestigial dark bands, forewing apex dark brown below, without a yellow spot; forewing costal fold well developed; no tibial tuft of long scales; uncus with developed arms and side horn-like processes; valva narrow, harpe longer than valva, not expanding basad over ampulla. In DNA, a combination of the following base pairs is diagnostic: aly6841.51.2:A736G, aly1656.26.1:A258G, aly1038.8.1:C1956T, aly862.7.1:A129G, and aly862.7.1:G107A.

Figure 7.

Figure 7.

Genomic tree of Erynnini. See Fig. 1 legend for notations.

Etymology.

The name is a masculine noun in the nominative singular, formed from the type species name: Toli[m]us.

Species included.

The type species and Echelatus luctuosus Godman and Salvin, [1894].

Parent taxon.

Subtribe Erynnina Brues and Carpenter, 1932.

Comments.

Frequently misidentified as Echelatus sempiternus or Anastrus sempiternus in collections, species of this new genus are indeed very similar to it. One of the most reliable wing pattern characters to distinguish the two genera is the color of forewing apex below. It is paler and yellower than the surrounding ground brown color (“yellow spot at apex” of Evans (1953: 182)) in Echelatus, but is not different from the background color in Tolius. Specimens curated as syntypes of Anastrus varius Mabille, 1883 (type locality Venezuela) in the ZMHB (NVG-15032H09) and the ZSMC (NVG-18057A09) are Tolius tolimus tolimus. However, these specimens are labeled as being from Panama: Chiriqui, and not Venezuela, and therefore are not syntypes. A syntype of varius in BMNH is indeed Echelatus.

Antigonus alburnea Plötz, 1884 is a junior subjective synonym of Tolius tolimus robigus (Plötz, 1884)

A syntype of Antigonus alburnea Plötz, 1884 (type locality Brazil: Para, specimen #5992, DNA sample NVG-15032H11) in the ZMHB is not Echelatus but Tolius, both by genomic analysis and by wing pattern (Fig. 7). Hence, we consider A. alburnea to be a junior subjective synonym of Tolius tolimus robigus (Plötz, 1884) and not of Echelatus sempiternus simplicior (Möschler, 1877). The names alburnea and robigus were published in the same work issued on the same date (Plötz 1884), and we give priority to the name robigus, because this name is used as valid, but alburnea has been placed in synonymy, although with a wrong taxon (Mielke 2005).

Echelatus depenicillus Strand, 1921 is a junior subjective synonym of Echelatus sempiternus simplicior (Möschler, 1877)

Judging from its wing patterns, the holotype of Echelatus depenicillus Strand, 1921 (type locality Colombia) in DEI is indeed Echelatus and not Tolius. Thus, we consider E. depenicillus to be a junior subjective synonym of Echelatus sempiternus simplicior (Möschler, 1877) (type locality Suriname) and not of Tolius tolimus robigus (Plötz, 1884) (type locality South America).

Alternative taxonomy of the Echelatus group

An alternative taxonomic arrangement would be to consider Tolius Grishin, new genus, Anaxas Grishin, 2019 Hoodus Grishin, 2019 and Potamanaxas Lindsey, 1925 as subgenera of Echelatus Godman and Salvin, 1894. These five taxa form a prominent monophyletic group in the tree and are within the range of genetic diversification known for genera (Fig. 7). However, due to phenotypic diversity of all these species, we do not adopt this solution here, pending further studies.

Antigonus aura Plötz, 1884 is a junior subjective synonym of Theagenes dichrous (Mabille, 1878)

Kept by Evans (1953) as a junior subjective synonym of Helias phalaenoides palpalis (Latreille, [1824]) (type locality Brazil), Antigonus aura Plötz, 1884 (Herrich-Schäffer in litt., type locality Brazil) is actually Theagenes dichrous (Mabille, 1878) (type locality Brazil) according to its syntype (NVG-15033E04) in the ZMHB, both phenotypically and genotypically (Fig. 7). We consider this specimen a syntype because it agrees with the original description, bears a red label “Typus”, is from Herrich-Schäffer collection according to its label “Coll. H.–Sch”, and carries two labels typical of Herrich-Schäffer specimens: a narrow faded label with probable Herrich-Schäffer handwriting “aura HS” and a nearly square label with a black frame “Palpalis Latr.” In addition, it has two recent labels: one with a barcode image and “http://coll.mfn-berlin.de/u/9085f5” and the other ∥ DNA sample ID: | NVG-15033E04 | c/o Nick V. Grishin ∥. To ensure stability in application of the name aura, this specimen is designated by N.V.G. as the lectotype of Antigonus aura Plötz, 1884. Thus, A. aura is a junior subjective synonym of Theagenes dichrous (Mabille, 1878).

Camptopleura cincta Mabille and Boullet, 1917, new status

Camptopleura iphicrates var. cincta Mabille and Boullet, 1917 (type locality Colombia, Bolivia) is currently treated as a junior subjective synonym of Camptopleura auxo (Möschler, 1879) (type locality Colombia). We sequenced a syntype of C. i. var. cincta from Bolivia (NVG-18078D02) in MNHP and found that it is not monophyletic with C. auxo syntype (NVG-15033B06) in the ZMHB (Fig. 7). Instead, it appears to be a distinct species closely related to Camptopleura theramenes Mabille, 1877 (type locality Colombia). The COI barcodes of the C. i. var. cincta syntype and C. theramenes specimen from Costa Rica differ by 6.2% (41 bp). Therefore, it is incorrect to keep C. i. var. cincta as a synonym of C. auxo, and we propose to consider C. i. var. cincta a species-level taxon pending further studies: Camptopleura cincta Mabille and Boullet, 1917, new status.

Achlyodes impressus Mabille, 1889 is a junior subjective synonym of Camptopleura orsus (Mabille, 1889), reinstated status

Achlyodes orsus Mabille, 1889 (type locality Venezuela: Puerto Cabello) is treated as a junior subjective synonym of Nisoniades mimas (Cramer, 1775) (type locality Suriname) (Mielke 2005). We sequenced the holotype of Achlyodes orsus (NVG-15034D08) in the ZMHB and it is in the same clade with a syntype of Achlyodes impressus Mabille, 1889 (type locality Panama: Chiriqui) (NVG-15033A11) in the ZMHB (Fig. 7). These two primary type specimens are phenotypically similar and their COI barcodes are only 0.3% (2 bp) different. Therefore we conclude that they are conspecific. The type specimens of these taxa mostly agree with the original descriptions and/or illustrations (Mabille 1889a; Mabille 1889b), and according to their labels are the true type specimens of these taxa. One issue is that the original description of A. orsus does not fully agree with the original illustration (Mabille 1889a), therefore some errors have been made. The first two lines of the back-to-back descriptions of A. orsus and A. oiclus (currently Telemiades oiclus (Mabille, 1889)) are identical (they seem to describe A. oiclus), surely by mistake (Mabille 1889a). However, the original illustration is in agreement with the ZMHB specimen NVG-15034D08, and therefore, taking into account appropriate labels on this specimen (“Origin”, “achl. orsus | ♂ Mb.” (in Mabille handwriting), “Pto Cabello”, “Coll. Staudinger”), it is the holotype. According to Lamas (2021) and original publications (Mabille 1889a; Mabille 1889b), the name orsus was published on January 15, 1889 and the name impressus was published on March 15, 1889. Therefore, we propose that Achlyodes impressus Mabille, 1889 is a junior subjective synonym of Camptopleura orsus (Mabille, 1889), reinstated status.

Ephyriades jamaicensis (Möschler, 1879), reinstated status

Currently treated as a subspecies of Ephyriades brunnea (Herrich-Schäffer, 1865) (type locality Cuba), Achlyodes jamaicensis Möschler, 1879 (type locality Jamaica) is not monophyletic with it and forms a prominent clade of its own (Fig. 7). The difference in COI barcodes is 3.8% (25 bp) between syntypes of E. brunnea (NVG-15032B07) and A. jamaicensis (NVG-15032B06) in the ZMHB. Hence, we reinstate Ephyriades jamaicensis (Möschler, 1879) as a species.

Pulchroptera Hou, Fan and Chiba, 2021 is a subgenus of Heteropterus Duméril, 1806

Two monotypic genera Heteropterus Duméril, 1806 (type species Papilio aracinthus Fabricius, 1777, which is Papilio morpheus Pallas, 1771) and Pulchroptera Hou, Fan and Chiba, 2021 (type species Pamphila pulchra Leech, 1891) are sisters of each other (Fig. 8) and are closely related, for example, COI barcodes of their type species differ by 8.6% (57 bp). Therefore, to reduce the number of monotypic genera that are not prominently distinct, we propose that Pulchroptera Hou, Fan and Chiba, 2021 is a subgenus of Heteropterus Duméril, 1806, new status. Heteropterus pulchra (Leech, 1891), new combination, conveys close relationship of this species with Heteropterus morpheus (Pallas, 1771) and therefore is more informative than a monotypic genus.

Figure 8.

Figure 8.

Genomic tree of Heteropterinae Aurivillius, 1925, some Old World Hesperiinae and relatives. See Fig. 1 legend for notations.

Bibla Mabille, 1904 is a valid genus

Treated as a synonym of Taractrocera Butler, 1870 (type species Hesperia maevius Fabricius, 1793) by Evans (1949), Bibla Mabille, 1904 (type species Hesperia papyria Boisduval, 1832) is not monophyletic with it, and instead is sister to a clade consisting of Suniana Evans, 1934 (type species Pamphila lascivia Rosenstock, 1885), Potanthus Scudder, 1872 (type species Hesperia omaha Edwards, 1863), and Ocybadistes Heron, 1894 (type species Ocybadistes walkeri Heron, 1894) (Fig. 8). To restore the monophyly of Taractrocera we suggest that Bibla is a valid genus. An alternative solution could be to treat Ocybadistes, Bibla, and Suniana as subgenera of Potanthus.

Prosopalpus Holland, 1896, Lepella Evans, 1937, and Creteus de Nicéville, 1895 belongs to Aeromachini Tutt, 1906

Genomic tree reveals that Prosopalpus Holland, 1896 (type species Cobalus duplex Mabille, 1889, a junior subjective synonym of Apaustus debilis Plötz, 1879), Lepella Evans, 1937 (type and the only species Hesperia lepeletier Latreille, 1824) and Creteus de Nicéville, 1895 (type and the only species Hesperia cyrina Hewitson, 1876) fall in the prominent clade with Aeromachus de Nicéville, 1890 (type species Thanaos stigmata Moore, 1878) (Fig. 8) and therefore belong to the tribe Aeromachini Tutt, 1906, where we place them. Unusual phenotypes of these three genera hindered their proper attribution within Hesperiidae.

Parasovia Devyatkin, 1996 is a junior subjective synonym of Sebastonyma Watson, 1893

Monotypic genus Parasovia Devyatkin, 1996 (type and the only species Halpe perbella Hering, 1918) clusters closely with Sebastonyma Watson, 1893 (type species Hesperia dolopia Hewitson, 1868) (Fig. 8) and COI barcodes of their type species differ by 6.7% (44 bp), suggesting that they are congeneric. Therefore, we propose that Parasovia Devyatkin, 1996, new synonym is a junior subjective synonym of Sebastonyma Watson, 1893.

Rapid diversification of Asian Hesperiinae

More detailed analysis of rapid diversification of Asian Hesperiinae reveals strongly supported clades that render Erionotini Distant, 1886 sensu lato paraphyletic (Fig. 9). After adding genomic datasets for the type genera of all six available family-group names associated with Erionotini Distant, 1886 (Warren et al. 2008; Warren et al. 2009; Li et al. 2019) (Fig. 9), we find that out of four confidently supported clades that disrupt monophyly of Erionotini, three clades do not have names. These clades are proposed here as new tribes. The fourth clade is recognized as a valid tribe Notocryptini Swinhoe, 1913, new status, that consists of Notocrypta de Nicéville, 1889 (type species Plesioneura curvifascia C. Felder and R. Felder, 1862), Ancistroides Butler, 1874 (type species Ancistroides longicornis Butler, 1874) and Udaspes Moore, [1881] (type species Papilio folus Cramer, 1775) as these genera are defined in Evans (1949), but we rearrange them below. Monophyly of Erionotini is thus restored.

Figure 9.

Figure 9.

Genomic trees of representative Hesperiidae to illustrate their classification into subfamilies, and for the subfamily Hesperiinae into tribes. Names of species placed in the new tribes described in this work are highlighted in yellow, their clades are colored in red and highlighted in green. Sequenced specimens of the type species of the type genera of the new tribes are illustrated in dorsal (left or above) and ventral (right or below) views and indicated by blue arrows. Some images are left-right inverted and digitally edited to correct wing damage and scale loss by removing imperfections and combining segments of left and right wings. See Fig. 1 legend for other notations.

Psolosini Grishin, new tribe

http://zoobank.org/1160A323-4DAA-4B2D-9A69-F77B64F0F37D

Type genus.

Psolos Staudinger, 1889.

Definition.

Forms a strongly supported clade that falls in the assemblage of Asian genera with unresolved phylogeny. Not confidently associated with any tribe (Fig. 9), and therefore is a tribe of its own. Keys to I.2a in Evans (1949). Diagnosed by the following combination of characters: hindwing vein M2 decurved at origin, forewing vein M2 straight (not decurved at the origin), its origin in the middle between veins M3 and M1 and veins; veins R1 and SC nearly touching each other; wings broader and rounder than in relatives, for example, forewing costa is frequently strongly convex and outer margin rounded, especially near the base, no hyaline spots; second segment of palpi erect, quadrantic and stout, third segment short and conical; club of antenna not constricted before finely pointed apiculus. In DNA, a combination of the following base pairs is diagnostic: aly798.25.4:T315C, aly1370.9.2:C686T, aly798.25.4:A290T, aly5965.2.3:C1712G, and aly5965.2.3:T1711A.

Genera included.

Psolos Staudinger, 1889 and Koruthaialos Watson, 1893, which includes Stimula de Nicéville, 1898, new status, as a subgenus (see below).

Parent taxon.

Subfamily Hesperiinae Latreille, 1809.

Ismini Grishin, new tribe

http://zoobank.org/83F01EBB-D009-4199-9942-1FA6FE507088

Type genus.

Isma Distant, 1886.

Definition.

Forms a strongly supported clade that falls within the assemblage of Asian genera with unresolved phylogeny. Not confidently associated with any tribe (Fig. 9), and therefore is a tribal level taxon. Keys to I.1 or J.9 in Evans (1949). Phenotypically heterogeneous group that is diagnosed by the following combination of characters: club of antenna not constricted before apiculus, apiculus finely pointed, 2nd segment of palpi erect; and if hindwing vein M2 decurved at origin, then wings broad with forewing costal margin arched and about as long as anal margin, forewing vein M2 straight, at its origin in the middle between veins M1 and M3, and forewing veins SC and R1 separate (not nearly touching each other); or if hindwing vein M2 not decurved then forewing vein M2 decurved, apiculus not longer than twice width of club, nudum less than 20 segments, antennae at least as long as cell, 3rd segment of palpi short, pointed and protruding, hindwing anal margin longer than costal margin, and males with secondary sexual characters such as forewing stigma and brand and forewing with subapical hyaline spots. In DNA, a combination of the following base pairs is diagnostic: aly1052.8.2:A287G, aly133.35.12:C148G, aly7003.4.4:G1802A, aly4645.12.5:A1343T, and aly4305.15.10:A273G.

Genera included.

Isma Distant, 1886, Iambrix Watson, 1893, and Idmon de Nicéville, 1895.

Parent taxon.

Subfamily Hesperiinae Latreille, 1809.

Eetionini Grishin, new tribe

http://zoobank.org/9775636D-E693-445B-8438-61F3223570F4

Type genus.

Eetion de Nicéville, 1895.

Definition.

In the current nuclear genomic tree, is not confidently grouped with any tribe and therefore a tribal level taxon (Fig. 9). Keys to J.21 in Evans (1949). Phenotypically, diagnosed by the following combination of characters: antenna not longer than half of forewing costal margin, apiculus longer than two times width of club, nudum around 25 segments, forewing discal cell long, not shorter than forewing anal margin, forewing vein M2 decurved, hindwing discal cell shorter than half of wing. In DNA, a combination of the following base pairs is diagnostic: aly276558.19.1:A374C, aly366.4.1:T5240A, aly2633.4.3:T97A, aly971.9.15:A88G, and aly971.9.15:A89T.

Genera included.

Eetion de Nicéville, 1895.

Parent taxon.

Subfamily Hesperiinae Latreille, 1809

Acerbas sarala (de Nicéville, 1889), new combination

Parnara sarala de Nicéville, 1889 (type locality India: Khasi Hills) currently placed in Lotongus Distant, 1886 (type species Eudamus calathus Hewitson, 1876) is not monophyletic with it and is instead closest to the type species of Acerbas de Nicéville, 1895 (type species Hesperia anthea Hewitson, 1868) (Fig. 8). Therefore, we propose Acerbas sarala (de Nicéville, 1889), new combination.

Carystus tetragraphus Mabille, 1891 is a junior subjective synonym of Lotongus calathus (Hewitson, 1876)

Inspection of the phenotype and sequencing of the Carystus tetragraphus Mabille, 1891 (type locality “Amboine”) syntype in the ZMHB (NVG-18075G04) which agrees with the original description, bears appropriate labels and therefore we consider it to be a true syntype, reveals that it is not Borbo impar (Mabille, 1883), and is not even a Borbo Evans, 1949 (type species Hesperia borbonica Boisduval, 1833), but belongs to Lotongus Distant, 1886 (type species Eudamus calathus Hewitson, 1876) being placed in the tree within Lotongus type species (Fig. 8). Even in the absence of the syntype, only from the original description, C. tetragraphus does not agree with the phenotype of Borbo impar (Mabille, 1883). By the dark wing pattern and small spots, it fits well within Lotongus calathus (Hewitson, 1876), where we place this taxon. Judging from its dark phenotype, C. tetragraphus may be Lotongus calathus parthenope (Plötz, 1886) (type locality Nias), where we tentatively assign it. However, we are unaware of its records from the Ambon Island in Indonesia, and it is possible that the C. tetragraphus syntype was mislabeled.

Borbo impar bipunctata (Elwes and J. Edwards, 1897) is a valid name

Considered a junior subjective synonym of Borbo impar tetragraphus (Mabille, 1891), Parnara bipunctata Elwes and J. Edwards, 1897 (type locality Indonesia: Bacan Is.) becomes the senior name for this subspecies of Borbo impar (Mabille, 1883) (type locality around New Caledonia) after we have shown above that Carystus tetragraphus Mabille, 1891 is Lotongus calathus (Hewitson, 1876). Therefore the name Borbo impar bipunctata (Elwes and J. Edwards, 1897) becomes valid.

Koruthaialos frena Evans, 1949, new status

Described by Evans (1949) as a subspecies of Koruthaialos focula (Plötz, 1882) (type locality Java) from Malaysia: Mount Kinabalu, K. f. frena exhibits nuclear genomic differences in line with the species level (Fig. 8). COI barcodes are 6.5% (43 bp) different between K. f. frena and K. focula from their type localities. Its secondary sexual characters are different from K. focula and more similar to Koruthaialos rubecula (Plötz, 1882) (type locality Malaysia: Kalimantan) (Evans 1949). Therefore we propose to treat it as a species-level taxon: Koruthaialos frena Evans, 1949, new status. Koruthaialos focula kerala de Nicéville, [1896] (type locality Indonesia: Sumatra) does not reveal strong genetic differentiation from the nominotypical subspecies (Fig. 8) and its secondary sexual characters are similar to it. Therefore no change of status is proposed for K. f. kerala.

Stimula de Nicéville, 1898 is a subgenus of Koruthaialos Watson, 1893

Genomic phylogeny reveals that Watsonia swinhoei Elwes and Edwards, 1897 (type locality India: Khasi Hills), type and the only species in the genus Stimula de Nicéville, 1898, is a sister to both Koruthaialos focula and Koruthaialos frena, thus originating deep within Koruthaialos Watson, 1893 (type species Koruthaialos hector Watson, 1893, which is currently a subspecies of Koruthaialos rubecula (Plötz, 1882)) and rendering it paraphyletic (Fig. 8). Koruthaialos is a compact genus of five species and breaking it into several genera to restore its monophyly seems inferior to including Stimula into it as a subgenus. As a result, only one species, Koruthaialos rubecula (Plötz, 1882) as defined by Evans (1949), and characterized by thin and protruding 3rd segment of palpi and convergent arms of uncus, remains in the nominal subgenus, other Koruthaialos species are placed in subgenus Stimula, which is characterized by short and blunt 3rd segment of palpi and divergent uncus arms. Therefore, Arunena Swinhoe, 1919 (type species Arunena nigerrima Swinhoe, 1919, which is currently a junior subjective synonym of Astictopterus butleri de Nicéville, [1884]), becomes junior subjective synonym of Stimula.

Pemara Eliot, 1978 is a junior subjective synonym of Oerane Elwes and Edwards, 1897

Two currently monotypic genera Pemara Eliot, 1978 (type and the only species Parnara pugnans de Nicéville, 1891) and Oerane Elwes and Edwards, 1897 (type species Notocrypta neaera de Nicéville, 1891, currently a subspecies of Plesioneura microthyrus Mabille, 1883) are sisters, closer to each other than the two species of Suastus Moore, [1881] to each other (Fig. 8). COI barcodes of Pemara pugnans and Oerane microthyrus differ by 7.1% (47 bp). For these reasons, moving towards simpler classification, we unite the two monotypic genera into one and suggest that Pemara Eliot, 1978 is a junior subjective synonym of Oerane Elwes and Edwards, 1897.

Kerana Distant, 1886 and Tamela Swinhoe, 1913 are valid genera

Genomic tree reveals that Ancistroides Butler, 1874 (type species Ancistroides longicornis Butler, 1874) is polyphyletic (Fig. 8). While the type species of Ancistroides groups closely with Notocrypta de Nicéville, 1889 (type species Plesioneura curvifascia C. Felder and R. Felder, 1862), other species currently placed in Ancistroides form two distinct clades nearby. Each of these clades contains one type species of an available genus group name, currently treated as junior subjective synonyms of Ancistroides. To restore monophyly of Ancistroides, we resurrect these two names from synonymy and suggest to treat Kerana Distant, 1886 (type species Astictopterus armatus Druce, 1873) and Tamela Swinhoe, 1913 (type species Nisoniades diocles Moore, 1865, which is a subspecies of Hesperia nigrita Latreille, [1824]) as valid genera.

Udaspes Moore, [1881] and Notocrypta de Nicéville, 1889 are subgenera of Ancistroides Butler, 1874

Further inspection of the clade with Ancistroides longicornis Butler, 1874, the type species of Ancistroides Butler, 1874, reveals that it is compact, and in addition to a large genus Notocrypta de Nicéville, 1889 (type species Plesioneura curvifascia C. Felder and R. Felder, 1862) includes a nearly monotypic genus Udaspes Moore, [1881] (type species Papilio folus Cramer, 1775) (Fig. 8). Ancistroides and Udaspes stand out from Notocrypta merely in their unique wing patterns, but male genitalia of all these taxa are of a similar plan and suggest that this entire clade can be viewed as a single genus. Thus, taking into account priority of these names, we propose to treat Udaspes Moore, [1881] and Notocrypta de Nicéville, 1889 as subgenera of Ancistroides Butler, 1874. Next, we find that the subgenus Notocrypta as it is defined is nor monophyletic, and the subclade of Notocrypta that does not include the type species does not have a name. A new name for the clade is proposed here to restore the monophyly of Notocrypta.

Ocrypta Grishin, new subgenus

http://zoobank.org/A1411503-9F26-4E6F-A95B-71D967BD3BE7

Type species.

Notocrypta caerulea Evans, 1928.

Definition.

The subgenus is not monophyletic with Notocrypta de Nicéville, 1889 (type species Plesioneura curvifascia C. Felder and R. Felder, 1862) despite wing pattern similarities, but is instead a probable sister to Udaspes Moore, [1881] (type species Papilio folus Cramer, 1775) (Fig. 8). Keys to I.6.7a in Evans (1949). Distinguished from phenotypically similar Notocrypta with which it shares white discal forewing band and in some species white apical spots on otherwise dark-brown wings by the following combination of characters: forewing vein M3 originates closer to vein M2 than to vein CuA1; white dorsal forewing band usually fills out the base of cell M3-CuA1 and reaches costa (except in some darker specimens); in all species except N. renardi (Oberthür, 1878) antennae dark without pale ring at club and abdomen pale below. In DNA, a combination of the following base pairs is diagnostic: aly272.4.2:T91A, aly594.9.1:A660G, aly1445.3.1:A475G, aly1139.10.12:A524C, and aly1019.14.2:A193G.

Etymology.

The name is a feminine noun in the nominative singular, formed by removing “Not” from Notocrypta. Similar to how “Not” was added to Amblyscirtes Scudder, 1872 to form Notamblyscirtes Scott, 2006, but in reverse.

Species included.

The type species, Plesioneura renardi Oberthür, 1878, Plesioneura waigensis Plötz, 1882, Notocrypta aluensis Swinhoe, 1907, Plesioneura flavipes Janson, 1886, and Notocrypta maria Evans, 1949.

Parent taxon.

Genus Ancistroides Butler, 1874.

Ankola Evans, 1937 is a junior subjective synonym of Pardaleodes Butler, 1870

A monotypic genus Ankola Evans, 1937 (type species Osmodes (?) fan Holland, 1894) renders Pardaleodes Butler, 1870 (type species Papilio edipus Stoll, [1781]) paraphyletic (Fig. 10). Due to genetic and morphological (Evans 1937) closeness of these species that form a compact clade in the tree similar in genetic differentiation to Ceratrichia Butler, [1870] (type species Papilio nothus Fabricius, 1787), we restore monophyly by treating Ankola, as a new junior subjective synonym of Pardaleodes Butler, 1870.

Figure 10.

Figure 10.

Genomic tree of Ceratrichiini and Astictopterini. See Fig. 1 legend for notations.

Lennia Grishin, new genus

http://zoobank.org/07B33FAD-F918-4127-9EED-9FA4E5EBD74F

Type species.

Leona lena Evans, 1937.

Definition.

A genus not monophyletic with but related to Leona Evans, 1937 (type species Hesperia leonora Plötz, 1879), where these species were previously placed (Fig. 10). Keys to VIII.59.A in Evans (1937) and differs from its relatives, including Leona, by a combination of erect palpi with the last segment short and stout; forewing vein M3 not closer to vein M2 than to vein CuA1; antennae ochreous above and hindwing below without prominent marking but frequently with several white dots. In male genitalia, gnathos, if developed, shorter that half of uncus (in lateral view) uncus either narrow in dorsal view, at least three times longer that wide, barely divided, or broad, rounded and undivided. In DNA, a combination of the following base pairs is diagnostic: aly2627.2.2:T53A, aly2694.9.8:A8661G, aly1370.10.3:A65T, aly6841.66.1:A2191C, and aly490.12.1:A4147G.

Etymology.

The name is a feminine noun in the nominative singular formed from the type species name in a manner to avoid homonyms.

Species included.

The type species, Proteides binoevatus Mabille, 1891, Hesperia maracanda Hewitson, 1876, and Leona lota Evans, 1937.

Parent taxon.

Tribe Astictopterini Swinhoe, 1912.

Caenides sophia (Evans, 1937), new combination

Since its description kept in the genus Hypoleucis Mabille, 1891 (type species Hypoleucis tripunctata Mabille, 1891), H. sophia Evans, 1937 (type locality Cameroon) is not monophyletic with it and instead originates within Caenides Holland, 1896 (type species Hesperia dacela Hewitson, 1876) (Fig. 10). Hence, we transfer it to the latter genus to form Caenides sophia (Evans, 1937), new combination. In wing pattern (ventral hindwing brown with ivory colored bands and spots instead of mostly white) and size (smaller), and also due to the lack of brand and differences in palpi (Evans 1937), C. sophia was abnormal in Hypoleucis, thus this transfer is not surprising.

Hypoleucis dacena (Hewitson, 1876), new combination

Currently still in Caenides Holland, 1896 (type species Hesperia dacela Hewitson, 1876), although Larsen (2005) suggested that it does not belong there, Hesperia dacena Hewitson, 1876 (type locality Gabon) is sister to Hypoleucis Mabille, 1891 (type species Hypoleucis tripunctata Mabille, 1891) (Fig. 10), where we suggest to place it as Hypoleucis dacena (Hewitson, 1876), new combination. COI barcodes of H. dacena and H. tripunctata draga Evans, 1937 differ by only 6% (40 bp). We agree with Larsen (2005) that by its rounder wing shape and less extensive pale spotting and without hindwing hair tuft or brands on forewing (Evans 1937), H. dacena was abnormal in Caenides, as our genomic results confirm pointing to its more meaningful placement in Hypoleucis. Lose one gain one.

Dotta tura (Evans, 1951), new combination

Described by Evans (1951) in Astictopterus C. Felder and R. Felder, 1860 (type species Astictopterus jama C. Felder and R. Felder, 1860), A. tura is not monophyletic with it (Fig. 10), but is sister to the two species currently in Dotta Grishin, 2019 (type species Ceratrichia stellata Mabille, 1891). Therefore, we transfer Astictopterus tura to Dotta forming Dotta tura (Evans, 1951), new combination. Dotted ventral hindwing pattern characteristic of Dotta agrees with this placement.

Nervia wallengrenii (Trimen, 1883), new combination

Thymelicus wallengrenii Trimen, 1883 (type locality in South Africa) is not monophyletic with Kedestes Watson, 1893 (type species Hesperia lepenula Wallengren, 1857), where it is currently placed and instead groups closely with Nervia Grishin, 2019 (type species Hesperia nerva Fabricius, 1793) (Fig. 10). Therefore, we propose Nervia wallengrenii (Trimen, 1883), new combination.

Trida Grishin, new genus

http://zoobank.org/AEF4CB05-6711-4D6D-BD1C-804B18C99CE6

Type species.

Cyclopides barberae Trimen, 1873.

Definition.

Currently in Kedestes Watson, 1893 (type species Hesperia lepenula Wallengren, 1857), but not monophyletic with it and instead sister to a clade consisting of Nervia Grishin, 2019 (type species Hesperia nerva Fabricius, 1793) and Tsitana Evans, 1937 (type species Cyclopides tsita Trimen, 1870) (Fig. 10). Keys to 27.B.(a) (a1)(a2)(a3) in Evans (1937). Distinguished from its relatives by the following combination of characters: antennae ventrally pale, with blunt apiculus, forewings with white spots, ventral hindwing brown with silver or white markings, uncus sides straight to convex in dorsal view, tegumen strongly notched before uncus in lateral view, gnathos developed, separated from uncus, valva twice as long as wide, harpe slightly separated from not expanded ampulla, distally with a knob-like projection. In DNA, a combination of the following base pairs is diagnostic: aly1222.15.2:A8503C, aly1370.20.2:C124A, aly3087.2.1:T919A, aly347.12.1:A962A (not G), aly2487.24.2:C457C (not A), aly1838.7.1:G340G (not C), aly8661.2.1:A1479A (not C), aly84.37.1:T669T (not C), aly127.91.2:T147T (not C), aly563.9.2:A1117A (not C), aly1060.3.2:A168A (not T), and aly1379.9.4:A1006A (not C).

Etymology.

The name is a feminine noun in the nominative singular, given for the trident-like white pattern on ventral hindwing of the type species.

Species included.

The type species and Kedestes sarahae Henning and Henning, 1998.

Parent taxon.

Tribe Astictopterini Swinhoe, 1912.

Euphyes kiowah (Reakirt, 1866), reinstated status

Currently considered a south-central subspecies of Euphyes vestris (Boisduval, 1852) (type locality USA: California), Hesperia kiowah Reakirt, 1866 (type locality USA: Rocky Mountains) forms a distinct clade in the genomic tree, separated from other populations currently placed in E. vestris (Fig. 11). For example, COI barcodes of the nominotypical E. vestris and a specimen in central Colorado differ by 2.9% (19 bp). Therefore, we propose Euphyes kiowah (Reakirt, 1866), reinstated status.

Euphyes kiowah chamuli Freeman, 1969, new status

Since its description, Euphyes chamuli Freeman, 1969 (holotype sequenced) treated as a valid species from Mexico: Chiapas originates within Euphyes kiowah (Reakirt, 1866) (type locality USA: Rocky Mountains) (Fig. 11), suggesting possibly synonymy. However, due to phenotypic differences, we keep the name for the southern populations of E. kiowah as a subspecies, pending further studies: Euphyes kiowah chamuli Freeman, 1969, new status.

Arotis Mabille, 1904 is a junior subjective synonym of Mnaseas Godman, 1901

A clade of species currently placed in Mnaseas Godman, 1901 (type species Thymelicus bicolor Mabille, 1889) originates deeply within Arotis Mabille, 1904 (type species Arotis sirene Mabille, 1904), rendering it paraphyletic (Fig. 11). To restore the monophyly, instead of defining several new genera or subgenera, and due to genetic similarity among these species, we propose to treat Arotis Mabille, 1904 is a junior subjective synonym of Mnaseas Godman, 1901. These two genera combined form a reasonably prominent clade sister to a genetically prominent genus Euphyes Scudder, 1872 (type species Hesperia metacomet Harris, 1862, currently a subspecies of Hesperia ? vestris Boisduval, 1852) (Fig. 11), and we refrain from merging it into the latter genus, even as a subgenus.

Mnaseas inca Bell, 1930, reinstated status

Placed by Evans (1955) as a subspecies of Thymelicus bicolor Mabille, 1889 (type locality Honduras), which is the type species of Mnaseas Godman, 1901, and kept there since, Mnaseas inca Bell, 1930 (type locality Bolivia: Santa Cruz) is not monophyletic with it (Fig. 11), and the two taxa are only rather distantly related exhibiting COI barcode difference of 6.1% (40 bp). Therefore, it is a species-level taxon as originally proposed: Mnaseas inca Bell, 1930, reinstated status.

Testia mammaea (Hewitson, 1876), new combination

Hesperia mammaea Hewitson, 1876 placed in Decinea Evans, 1955 (type species Hesperia decinea Hewitson, 1876) by Evans (1955) is in a clade away from Decinea (Fig. 11) and is instead sister to Testia potesta (Bell, 1941), the type and the only species in its genus. The two species are similar in having long uncus arms, terminally expanded penis, a small pale spot near the end of the discal cell and a postdiscal row of such spots on hindwing below (sometimes vestigial) and a prominent ivory-colored area in the middle of cell CuA2-1A+2A on ventral forewing. Therefore, we propose Testia mammaea (Hewitson, 1876), new combination, making Testia Grishin, 2019 no longer monotypic.

Oxynthes trinka (Evans, 1955), new combination

Described in Orthos Evans, 1955 (type species Eutychide orthos Godman, 1900), Orthos trinka Evans, 1955 is closely related to Goniloba corusca Herrich-Schäffer, 1869), which is the type species of Oxynthes Godman, 1900, in Hesperiina Latreille, 1809, while Orthos is in Carystina Mabille, 1878 (Fig. 11). Therefore, we propose Oxynthes trinka (Evans, 1955), new combination.

Noxys Grishin, new genus

http://zoobank.org/6A7D1061-E6D2-4DC5-A6C6-9CE3DB6A56EF

Type species.

Oxynthes viricuculla Hayward, 1951.

Definition.

Currently placed in Oxynthes Godman, 1900 (type species Goniloba corusca Herrich-Schäffer, 1969) but not monophyletic with it. Sister to Metrocles Godman, 1900 (type species Metrocles leucogaster Godman, 1900) instead (Fig. 11). Keys to O.10.2 in Evans (1955). The pattern is surprisingly similar to Oxynthes corusca (Herrich-Schäffer, 1869) given their distant relationship. Differs from Oxynthes species by brand extending along discal cell from the origin of vein CuA2 to near the origin of vein CuA1, narrower discal band on ventral hindwing, not crossing the discal cell, which is with a small white spot, smaller tegumen and uncus, much broader aedeagus with large cornuti, and terminally rounded harpe. In DNA, a combination of the following base pairs is diagnostic: aly806.11.5:A397C, aly84.40.4:A239G, aly318.14.6:C739A, aly10226.3.14:G184A, and aly1149.1.1:G219A.

Etymology.

The name is a masculine noun in the nominative singular, for the genus the type species was placed previously: No[t] + [O]xy[nthe]s.

Species included.

Only the type species.

Parent taxon.

Subtribe Hesperiina Latreille, 1809.

Metrocles Godman, 1900 is a valid genus with Chalcone Evans, 1955, Hansa Evans, 1955, and Propertius Evans, 1955 as its junior subjective synonyms

Our genomic trees reveal that Metron Godman, 1900 (type species Pamphila chrysogastra Butler, 1870) is not monophyletic (Fig. 11). Presently in Metron, Metrocles leucogaster Godman, 1900, which is the type species of Metrocles Godman, 1900 clusters closely with Chalcone Evans, 1955 (type species Augiades chalcone Schaus, 1902, which is a subspecies of Pamphila briquenydan Weeks, 1901), Hansa Evans, 1955 (type species Hesperia hyboma Plötz, 1886), and Propertius Evans, 1955 (type species Hesperia propertius Fabricius, 1793) in a clade different from Metron. Therefore, we reinstate Metrocles as a valid genus. We also find that neither Hansa nor Chalcone are monophyletic (Fig. 11). Notably, the type species of Hansa is sister to Propertius. Due to genetic closeness of all these species and challenges to classify them correctly using phenotypic considerations, we propose that Chalcone Evans, 1955 Hansa Evans, 1955 and Propertius Evans, 1955 are junior subjective synonyms of Metrocles Godman, 1900.

Metrocles argentea (Weeks, 1901), Metrocles scitula (Hayward, 1951) and Metrocles schrottkyi (Giacomelli, 1911), new combinations

Formerly placed in Paratrytone Godman, 1900 (type species Paratrytone rhexenor Godman, 1900), Pamphila argentea Weeks, 1901 (type locality Bolivia: near Cusilluni) is not monophyletic with it and instead originates within the newly expanded Metrocles Godman, 1900 (type species Metrocles leucogaster Godman, 1900), near species formerly placed in Chalcone Evans, 1955 (type species Augiades chalcone Schaus, 1902, which is a subspecies of Pamphila briquenydan Weeks, 1901) (Fig. 11). In the same clade, we find Niconiades scitula Hayward, 1951 (type locality Brazil: Mato Grosso), placed by Evans (1955) in Mucia Godman, 1900 (type species Mucia thyia Godman, 1900, a junior subjective synonym of Hesperia zygia Plötz, 1886), which is in subtribe Moncina A. Warren, 2008, and not in Hesperiina Latreille, 1809 as Metrocles (Fig. 11). Phenotypically, these placements are reasonable due to similarities in ventral hindwing patterns: white irregular discal band separated into spots by veins is also present in Metrocles zisa (Plötz, 1882) (formerly in Chalcone). Finally, inspection of the photographs of the holotype of Thymelicus (?) schrottkyi Giacomelli, 1911 (type locality Argentina: La Rioja), currently in Metron Godman, 1900 (type species Pamphila chrysogastra Butler, 1870), revealed very close similarity with M. scitula in wing patterns and stigma. For all these reasons, we propose Metrocles argentea (Weeks, 1901), new combination, Metrocles scitula (Hayward, 1951), new combination, and Metrocles schrottkyi (Giacomelli, 1911), new combination.

Metron hypochlora (Draudt, 1923) is a species distinct from Metrocles schrottkyi (Giacomelli, 1911)

Inspection of the holotype photograph reveals that Evans (1955) misidentified Metrocles schrottkyi (Giacomelli, 1911), a species with a narrow white ventral hindwing band prominently separated into spots by veins and whitish forewing spots, and assigned this name to Metrocles hypochlora Draudt, 1923 (type locality Peru: Madre de Dios), a species with the entire hindwing white band and yellow spots in forewing. Robbins et al. (1996) treated M. hypochlora as a subspecies of M. schrottkyi. Genomic sequencing confirms that M. hypochlora belongs to Metron Godman, 1900 (type species Pamphila chrysogastra Butler, 1870) and not to Metrocles Godman, 1900 (type species Metrocles leucogaster Godman, 1900) (Fig. 11). Thus we reinstate Metron hypochlora as a species-level taxon and place Metron hypochlora tomba Evans, 1955, new combination, as its subspecies.

Metron voranus (Mabille, 1891) is a valid species with Augiades tania Schaus, 1902 as its junior subjective synonym

Sequencing of a ZMHB syntype of Pamphila voranus Mabille, 1891 (type locality Colombia), currently a junior subjective synonym of Metron zimra (Hewitson, 1877) (type locality Brazil), reveals that it is not even in the same clade with M. zimra and instead is conspecific with Augiades tania Schaus, 1902 (type locality Brazil: Petropolis), currently a valid species of Chalcone Evans, 1955 (type species Augiades chalcone Schaus, 1902, which is a subspecies of Pamphila briquenydan Weeks, 1901) (Fig. 11). Phenotypic assessment agrees with this conclusion: the white discal band on ventral hindwing is of similar shape in P. voranus and A. tania that differs from that in M. zimra. We confirm that the P. voranus syntype agrees with the original description in all aspects, and bears labels in Mabille handwriting. To stabilize the usage of these names, the specimen in the ZMHB collection with the following seven rectangular labels: purple, printed ∥ Origin ∥, two white, handwritten (the second one might be in Mabille handwriting) ∥ Columbia ∥, ∥ P. voranus | Mab. ∥, white printed ∥ Coll. | Staudinger ∥, white handwritten ∥ Voranus | Mab. ∥, and two white printed ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 44a09b ∥ DNA sample ID: | NVG-18043H03 | c/o Nick V. Grishin ∥ is hereby designated by N.V.G. as the lectotype of Pamphila voranus Mabille, 1891. Thus, we conclude that Augiades tania Schaus, 1902 as its junior subjective synonym of Metron voranus (Mabille, 1891), reinstated status.

Metron fasciata (Möschler, 1877) is a valid species with Pamphila verdanta Weeks, 1906 as its junior subjective synonym

Sequencing of the Pamphila fasciata Möschler, 1877 holotype from Suriname in the ZMHB reveals that this taxon is not monophyletic with Metron zimra (Hewitson, 1877) (type locality Brazil), with which it was synonymized (Evans 1955) (Fig. 11). Phenotypically, discal white band on ventral hindwing reaches costa in M. zimra, but stops at vein C-Sc+R1 in P. fasciata leaving a brown-olive background color space between the band and costa. Therefore, we reinstate it as a species Metron fasciata (Möschler, 1877), reinstated status, and place Pamphila verdanta Weeks, 1906 (type locality Venezuela: Suapure) as its junior subjective synonym, because the hindwing band does not reach costa in the P. verdanta syntype.

Niconiades derisor (Mabille, 1891), new combination

Genomic sequencing of a syntype of Pamphila derisor Mabille, 1891 (type locality Venezuela) from the ZMHB collection, currently in Decinea Evans, 1955 (type species Hesperia decinea Hewitson, 1876) in subtribe Hesperiina Latreille, 1809, reveals that it originates within Niconiades Hübner, [1821] (type species Niconiades xanthaphes Hübner, [1821]) in the subtribe Moncina A. Warren, 2008 (Fig. 11). Phenotypic assessment agrees with this placement. For instance, the syntype of P. derisor has brands characteristic of Niconiades and lacking in Decinea. Therefore, we propose Niconiades derisor (Mabille, 1891), new combination.

Niconiades viridis vista Evans, 1955 is a junior subjective synonym of Niconiades derisor (Mabille, 1891)

Using Evans (1955), the syntype of Pamphila derisor Mabille, 1891 (type locality Venezuela) that we sequenced, keys to Niconiades viridis vista Evans, 1955 (type locality Colombia), the northern subspecies of Thoon viridis Bell, 1930 (type locality Bolivia). In the genomic tree, Niconiades derisor is indeed sister to Niconiades viridis (Fig. 11), but they are not conspecific: their COI barcodes differ by 2.3% (15 bp) in the presence of definitive phenotypic differences listed by Evans (1955: 435). Therefore, we propose that Niconiades viridis vista Evans, 1955 is a junior subjective synonym of Niconiades derisor (Mabille, 1891).

Decinea huasteca (H. Freeman, 1969), Decinea denta Evans, 1955 and Decinea antus (Mabille, 1895) are species distinct from Decinea decinea (Hewitson, 1876), and Decinea denta pruda Evans, 1955, new combination

Evans (1955) described genitalic differences in the presence and shape of side process of aedeagus in subspecies of Decinea decinea (Hewitson, 1876) (type locality Brazil) that are more indicative of species-level differences. Our genomic tree reveals the most prominent separation of the nominotypical D. decinea from other taxa (Fig. 11), as reflected in the largest genitalic difference: long slender aedeagus process, instead of short process or no process. In COI barcodes, it translates to 5.5% (36 bp) between D. decinea and Tirynthia huasteca H. Freeman, 1969 (type locality Mexico: San Luis Potosi). Other taxa also reveal significant differences, for example, while Proteides antus Mabille, 1895 (type locality Brazil: Santa Catarina), which is sympatric with D. decinea in Southeast Brazil and lacks the aedeagus process as T. huasteca, differs from the latter by 3.2% (21 bp) and the former by 5.6% (37 bp). Decinea decinea denta Evans, 1955 (type locality Peru: La Merced) and Decinea denta pruda Evans, 1955 (type locality Paraguay: Sapucay) possess a short process and are more similar to each other. For these reasons, we propose that Decinea decinea (Hewitson, 1876) is a monotypic species without subspecies, Decinea huasteca (H. Freeman, 1969), revised status (already used as a species in several more recent publications since Miller (1992), but not in others (Mielke 2005)), Decinea denta Evans, 1955, new status, and Decinea antus (Mabille, 1895), reinstated status are species-level taxa, but Decinea denta pruda Evans, 1955, new combination, is a subspecies, pending further studies. The names denta and pruda were published in the same work issued on the same date (Evans 1955), and here we gave priority to the name denta because of larger known distribution of this taxon that is also more common in collections.

Decinea colombiana Grishin, new species

http://zoobank.org/D8193C3F-5827-46A6-9809-70EA8978ACFC

Definition.

Evans (1955) misidentified Pamphila derisor Mabille, 1891 (type locality Venezuela), as detailed above. Hence the taxon Evans identified as Decinea decinea derisor is left without a name. Evans (1955) provided its description in a form of identification key, which is adopted here: this new species keys to L.11.2.(a) in Evans (1955). Differs from its relatives by the lack of side process on aedeagus, two separate pale spots in forewing cell, in males, lower spot smaller and typically opaque, usually an opaque small spot in dorsal forewing cell CuA2-1A+2A, and ventrally ferruginous background with some ochreous overscaling, but not as extensive as in Decinea huasteca (H. Freeman, 1969) (type locality Mexico: San Luis Potosi), and less prominent dorsal ochreous overscaling than in the latter species. The holotype, male is from Colombia: Bogota, illustrated in Fig. 12a,b and deposited in the Natural History Museum, London, UK (BMNH), its genitalia are prepared on a mini-slide 936 pinned under the specimen. In addition to this genitalia slide, the holotype bears the following three rectangular printed labels: ∥ Bogota, | Colombia. | Druce Coll. ∥ Druce Coll. | ex | Kaden Coll. ∥ Godman-Salvin | Coll. 1913.—2. ∥. Scales are removed from the left forewing of the holotype. Other specimens from the “derisor” series in BNMH curated by Evans may include additional species to be studied and no paratypes are chosen. The holotype identification label will be mailed to curators of the collection to be placed on the holotype.

Figure 12.

Figure 12.

Specimens of Hesperiinae. a) Decinea colombiana Grishin, sp. n. holotype dorsal; b) ibid. ventral; c) Cynea rope Grishin, sp. n. holotype dorsal; d) ibid. ventral; e) Hesperia dido Plötz, 1882 neotype dorsal; f) ibid. ventral; g) Godman’s copy of an unpublished Plötz’s illustration of H. dido, left/right dorsal/ventral, no. 577; h) ibid. no. 577a; i) Lerema lucius Grishin, sp. n. holotype dorsal; j) ibid. ventral; k) Godman’s copy of an unpublished Plötz’s illustration of Hesperia lochius Plötz, 1882, left/right dorsal/ventral, no. 576; l) H. lochius illustration (left-right inverted for comparison) from the plate 187c[5] in Draudt (1921–1924), ventral; m) Cymaenes laureolus (Schaus, 1913) ventral, Panama: Cocoli, 4-Oct-1962, leg. G. B. Small, NVG-7250 [USNM]; n) ibid. Mexico: Veracruz, Coatepec, Jun-1917, NVG-15111G01 [AMNH]; o) Lerodea sonex Grishin, sp. n. holotype dorsal; p) ibid. ventral; q) Metiscus goth Grishin, sp. n. holotype dorsal; r) Godman’s copy of an unpublished Plötz’s illustration of Apaustus vicinus Plötz, 1884, left/right dorsal/ventral, no. 764; s) specimen of Corticea from the Staudinger and Bang-Haas collection bearing an old identification label “Padraona vicinus”, NVG-18096C08, dorsal; t) ibid. ventral. Specimen images are to scale and missing data are in the text. Photographs a–d (by Bernard Hermier) and g, h, k, r (by N.V.G.) are © of the Trustees of the Natural History Museum London and are made available under Creative Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/), and photographs o, p are © of Jim Brock, used with permission.

Etymology.

Currently, there are no valid Hesperiinae taxa named for the country of Colombia, which is one of the centers of Hesperiidae diversity. This omission is corrected here. The name is a feminine adjective.

Pamphila puxillius Mabille, 1891 is a junior objective synonym of Limochores pupillus (Plötz, 1882)

The original descriptions of Pamphila puxillius Mabille, 1891 (type locality Mexico) and Hesperia pupillus Plötz, 1882 (type locality not given) mention Herrich-Schäffer after each name: “H. S. collect.” for P. puxillius and “HS. i. l.” for H. pupillus, and are very similar to each other, mentioning the same spotting, including one or two (but not three) forewing apical spots (Plötz 1882b; Mabille 1891). Moreover, the names themselves are similar. The description of P. puxillius is based on a single male from Mexico in Staudinger collection, now in the ZMHB. A thorough search of the ZMHB Hesperiidae holdings revealed the presence of a single male, with the following eight rectangular labels: red, printed ∥ Typus ∥; white, handwritten ∥ Mex ∥, where “M” is in ink, but “ex” is in pencil, probably added at a later date, possibly after of Plötz’s description of H. pupillus; white, printed ∥ Coll. H.–Sch. ∥; white, printed ∥ Coll. | Staudinger ∥; white, handwritten, old, typical of Herrich-Schäffer specimens ∥ pupillus | Hs. ∥; white, handwritten, typical of Staudinger specimens ∥ Pupillus | HS. (i. l.?) ∥; and two white printed ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 44a0af ∥ DNA sample ID: | NVG-18052A04 | c/o Nick V. Grishin ∥. This specimen matched the original description, is a Herrich-Schäffer specimen in the Staudinger collection, and is the holotype of P. puxillius, because no other specimens of this species were found neither among Herrich-Schäffer specimens, nor the entire Hesperiidae holdings in the ZMHB. Moreover, this specimen is also a syntype of H. pupillus Plötz, 1882, because it agrees with the original description, is from Herrich-Schäffer collection, carries a label “pupillus HS. (i. l.?)” with a similar attribution as in the original description: “pupillus HS. (i. l.)”, and is a close match to the Godman’s copy of unpublished drawing numbered 532 of H. pupillus (in BMNH, inspected and photographed by N.V.G.). Even the detail that a forewing above has two apical spots, but below only one is clearly visible, is depicted in this drawing. We were not able to locate other syntypes (maybe no others existed), and N.V.G. hereby designates this specimen NVG-18052A04 as the lectotype of Hesperia pupillus Plötz, 1882 to stabilize the usage of this name as it was intended by Plötz. This action makes Pamphila puxillius Mabille, 1891 a junior objective synonym of Limochores pupillus (Plötz, 1882).

Limochores catahorma (Dyar, 1916) is a valid species

Evans (1955) synonymized Amblyscirtes catahorma Dyar,1916 (type locality Mexico: Guerrero) with Hesperia pupillus Plötz, 1882 (type locality not given). However, the lectotype of Limochores pupillus designated above (NVG-18052A04) is in a clade distinct from the clade with the holotype of A. catahorma (Fig. 11). Their COI barcodes differ by 4% (26 bp). Moreover, L. pupillus is a senior objective synonym of Pamphila puxillius Mabille, 1891 (type locality Mexico), because the lectotype of the former is the holotype of the latter. Therefore, Limochores catahorma (Dyar, 1916) is a valid species, not a synonym of L. pupillus or P. puxillius. In other words, Evans misidentified L. pupillus considering it a species distinct from P. puxillius, and the name for the species that Evans called “Poanopsis pupillus” is A. catahorma. Notably, Draudt (1923a), applied the three names correctly, in agreement with our analysis, i.e., L. pupillus as a synonym of P. puxillius (although with a questionmark), with A. catahorma being a separate species. We recently argued for placing these species in the genus Limochores Scudder, 1872 (type species Hesperia manataaqua Scudder, 1864, which is a junior subjective synonym of Hesperia origenes Fabricius, 1793) (Zhang et al. 2019d; Zhang et al. 2021).

Pamphila binaria Mabille, 1891 is a junior subjective synonym of Conga chydaea (A. Butler, 1877)

A syntype in the ZMHB of Pamphila binaria Mabille, 1891 (type locality Venezuela, NVG-15036F12) currently treated as junior subjective synonym of Cynea cynea (Hewitson, 1876) (type locality Venezuela), is not monophyletic with it or with its subtribe Moncina A. Warren, 2008, and instead is placed with specimens of Conga chydaea (Butler, 1877) (type locality Brazil: Amazonas) in a subtribe Hesperiina Latreille, 1809 (Fig. 11). Phenotypic assessment confirms this placement. Therefore, we propose that Pamphila binaria Mabille, 1891 is a junior subjective synonym of Conga chydaea (A. Butler, 1877).

Paratrytone samenta (Dyar, 1914), new combination

Since its description kept in the genus Ochlodes Scudder, 1872 (type species Hesperia nemorum Boisduval, 1852, currently a subspecies of Hesperia agricola Boisduval, 1852), O. samenta Dyar, 1914 (type locality Mexico: Guerrero and Jalisco) is not monophyletic with it and instead is sister to Paratrytone Godman, 1900 (type species Paratrytone rhexenor Godman, 1900) (Fig. 11). Therefore, we place it in this genus to form Paratrytone samenta (Dyar, 1914), new combination.

Tixe Grishin, new subgenus

http://zoobank.org/6A1F5AB0-013D-460A-9E0C-2A740784317F

Type species.

Cobalus quadrata Herrich-Schäffer, 1869.

Definition.

Our genomic tree reveals that a number of species currently placed in Tisias Godman, 1901 (type species Proteides myna Mabille, 1889) are not monophyletic with it and instead form a clade sister to Xeniades Godman, 1900 (type species Papilio orchamus Cramer, 1777), which also includes Cravera de Jong, 1983 (type species Cravera rara de Jong, 1983) as a subgenus (Fig. 11). This non-Tisias clade is not prominent enough to be a genus of its own, but together with Xeniades sensu stricto and Cravera, they form a prominent clade that we define as the genus Xeniades, with the non-Tisias clade as its new subgenus. It keys to K.20.1 or K.20.2 in Evans (1955). Distinguished from its relatives by the following combination of characters: forewing discal cell spots staggered in males, upper spot is not connected to the lower spot (connected or nearly so in Tisias); forewing with brands; body robust, palpi quadrantic, third segment short and stout, antennae half of costa in length, apiculus long, half of the club, mid-tibiae with spines; gnathos arms broadly separated and visible in dorsal view protruding on the sides of uncus. In DNA, a combination of the following base pairs is diagnostic: aly1146.55.6:C75T, aly1139.48.3:G142A, aly1432.13.2:A93G, aly144.18.1:A185G, and aly536.195.3:A187C.

Etymology.

The name is a feminine noun in the nominative singular, a fusion of previous and presently suggested genus names for these species: Ti[sias] + xe[niades].

Species included.

The type species, Tisias rinda Evans, 1955 and Tisias putumayo Constantino and Salazar, 2013.

Parent taxon.

Genus Xeniades Godman, 1900.

Xeniades pteras Godman, 1900, reinstated status

Proposed as a species, Xeniades pteras Godman, 1900 (type locality Panama, Colombia and Venezuela) was treated as a subspecies of Xeniades chalestra (Hewitson, 1866) (type locality Brazil: Minas Gerais) by Evans (1955), who gave diagnostic phenotypic characters for X. pteras, such as more extensive iridescent green-blue scaling on body above and no hindwing cell spot. In the genomic tree, Xeniades chalestra corna Evans, 1955 (Fig. 11) clusters closely with Xeniades chalestra, but X. pteras does not, revealing profound genetic differentiation and possibly not monophyletic with chalestra. COI barcode difference between X. pteras and X. chalestra is 3.2% (21 bp, specimens NVG-18119B02 and NVG-15035B01). Therefore we reinstate it as the species level taxon: Xeniades pteras Godman, 1900, reinstated status.

Xeniades difficilis Draudt, 1923, reinstated status

Proposed as a species, Xeniades difficilis Draudt, 1923 (type locality Bolivia: Coroico) was considered a subspecies of Xeniades orchamus (Cramer, 1777) (type locality Suriname) by Evans (1955). Genomic sequencing and comparison of X. difficilis holotype (NVG-18093D12) with X. orchamus specimens reveals profound genetic differentiation (Fig. 11), for example, their COI barcodes differ by 4.9% (32 bp). Therefore, we reinstate Xeniades difficilis Draudt, 1923 as a species-level taxon.

Xeniades hermoda (Hewitson, 1870), reinstated status, new combination

Initially proposed as a species, Hesperia hermoda Hewitson, 1870 (type locality Ecuador) has been placed as a subspecies of Tisias quadrata (Herrich-Schäffer, 1869) (type locality not given) by Evans (1955). COI barcode difference between the syntype of quadrata NVG-15036C04 in the ZMHB and a hermoda specimen NVG-18112A05 from Colombia is 2.4% (16 bp). Our genomic tree places both taxa in Xeniades Godman, 1900 (type species Papilio orchamus Cramer, 1777) instead of Tisias Godman, 1901 (type species Proteides myna Mabille, 1889) (Fig. 11), Furthermore, nuclear genome differences between hermoda and quadrata at the level typical of closely related species and the presence of white apical spots, absent in quadrata, prompt us to propose Xeniades hermoda (Hewitson, 1870), reinstated status, new combination.

Cravera de Jong, 1983 is a subgenus of Xeniades Godman, 1900

Cravera de Jong, 1983 (type species Cravera rara de Jong, 1983) and Xeniades Godman, 1900 (type species Papilio orchamus Cramer, 1777) are closely related sisters in the genomic tree (Fig. 11). COI barcodes of Cravera laureatus (Draudt, 1923) holotype (NVG-18093D09) and Xeniades orchamus (Cramer, 1777) from Panama (NVG-18119B04) are only 5.9% (39 bp) different, small divergence not unusual even for cryptic species. Phenotypically, these taxa are also similar in their robust bodies, nearly triangular wing shapes, and patters of spots and stripes. Due to these similarities, we place Cravera de Jong, 1983 as a subgenus of Xeniades Godman, 1900.

Jongiana O. Mielke and Casagrande, 2002 is a junior subjective synonym of Cobaloides Hayward, 1939

The two currently monotypic genera Jongiana O. Mielke and Casagrande, 2002 (type and the only species Surina unica de Jong, 1983) and Cobaloides Hayward, 1939 (type and the only species Cobaloides argus Hayward, 1939) are sisters (Fig. 11). Genetic differentiation between them is not larger than in most Hesperiidae genera. Their COI barcodes differ by 6.8% (45 bp). Their genitalia are similar in the outline of uncus and gnathos and have similarly oval-shaped valva ending in a rounded harpe with a rounded small process near ampulla directed caudad. Apparently, Jongiana is unique in its wing patterns, probably a result of accelerated phenotypic changes, but otherwise is closely related to Cobaloides. For these reasons, we suggest that Cobaloides would include Jongiana, new synonym.

Cobaloides Hayward, 1939 is a subgenus of Oligoria Scudder, 1872

Next, we find that Cobaloides (now including Jongiana) clusters closely with Oligoria Scudder, 1872 (type species Hesperia maculata Edwards, 1865) (Fig. 11), and genetic differentiation between them is more in line of subgenera than genera. For instance, COI barcode difference between their type species is 5.5% (36 bp), even less than the difference between Cobaloides and Jongiana. Male genitalia are similar in shape (see previous section) and show more variability within Oligoria species than between Oligoria and Cobaloides. Thus, we place Cobaloides in Oligoria as a subgenus, new status.

Oligoria (Cobaloides) locutia (Hewitson, 1876), new combination

Currently in Quinta Evans, 1955 (type species Cobalus cannae Herrich-Schäffer, 1869) from subtribe Moncina A Warren, 2008, Hesperia locutia Hewitson, 1876 (type locality Brazil) is not monophyletic with it and instead is sister to Oligoria (Cobaloides) argus (Hayward, 1939) (type locality Paraguay) from subtribe Hesperiina Latreille, 1809 (Fig. 11). Therefore we propose Oligoria (Cobaloides) locutia (Hewitson, 1876), new combination.

Gracilata Grishin, new genus

http://zoobank.org/47FC2A31-8815-4D52-BC21-DE35A408F432

Type species.

Enosis quadrinotata Mabille, 1889.

Definition.

Previously placed in Styriodes Schaus, 1913 (type species Styriodes lyco Schaus, 1913) but is not monophyletic with it, instead being sister to Psoralis Mabille, 1904 (type species Psoralis sabaeus Mabille, 1904, which is a junior subjective synonym of Pamphila idee Weeks, 1901) (Fig. 13). Keys to K.2.1 in Evans (1955). Distinguished from its relatives by the following combination of characters: antennae long, in males longer than 2/3 of the costal margin of forewing; brands short and stout: triangular at the base of cell CuA1-CuA2 and a dash below vein CuA2; forewing longer and narrower than in relatives with produced apex, hindwing disproportionally smaller than forewing compared to relatives, more angular and in males convex in cell CuA2-1A+2A; tegumen with a dorsal appendage, uncus undivided; aedeagus simple, without processes; harpe short, upturned, with a finger-like process directed dorsal by ampulla, ampulla expanded into a lobe. In DNA, a combination of the following base pairs is diagnostic: aly736.5.2:A444G, aly318.42.2:A1054C, aly3071.1.1:A328G, aly1350.9.1:G193C, and aly481.12.1:T87C.

Etymology.

The name is a feminine noun in the nominative singular, for the slender built of these skippers, very long antennae and legs, and narrower wings than in their relatives: Gracil[e] + [quadrinot]ata.

Species included.

Only the type species.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Pamba Evans, 1955 is a junior subjective synonym of Psoralis Mabille, 1904

Our genomic tree reveals that the type species of Psoralis Mabille, 1904 (type species Psoralis sabaeus Mabille, 1904, which is a junior subjective synonym of Pamphila idee Weeks, 1901) and Pamba Evans, 1955 (type species Pamba pamba Evans, 1955) are sisters, rendering Psoralis paraphyletic if it includes Psoralis stacara (Schaus, 1902) (type locality Brazil: Rio de Janeiro), a phenotypically obvious congener (Fig. 13). Moreover, their genitalia and even patterns on ventral hindwing are similar. Therefore, we propose that Pamba Evans, 1955 is a junior subjective synonym of Psoralis Mabille, 1904.

Psoralis sabina (Plötz, 1882), Psoralis laska (Evans, 1955), Psoralis arva (Evans, 1955), Psoralis umbrata (Erschoff, 1876), Psoralis calcarea (Schaus, 1902), and Psoralis visendus (E. Bell, 1942), new combinations

In our genomic tree, the following species form a clade sister to Psoralis Mabille, 1904 (type species Psoralis sabaeus Mabille, 1904, which is a junior subjective synonym of Pamphila idee Weeks, 1901) (Fig. 13): Hesperia sabina Plötz, 1882 (type locality Brazil: Rio de Janeiro) the type species of Saniba Mielke and Casagrande, 2003, Vidius laska Evans, 1955 (type locality Brazil: Mato Grosso) currently in Vidius Evans, 1955 (type species Narga vidius Mabille, 1891), Vettius arva Evans, 1955 (type locality Brazil: Rio de Janeiro) currently in Vettius Godman, 1901 (type species Papilio phyllus Cramer, 1777), Hesperia (Pamphila) umbrata Erschoff, 1876 (type locality not given, likely South Brazil) currently in Vettius, Padraona calcarea Schaus, 1902 (type locality Brazil: Rio de Janeiro) currently in Molo Godman, 1900 (type species Hesperia heraea Hewitson, 1868, treated as junior subjective synonym of Hesperia mango Guenée, 1865) and Anthoptus visendus E. Bell, 1942 (type locality Ecuador) currently in Molo. All these species together with Psoralis form a confident and compact clade (=share prominent genetic similarities), and not willing to place a number of them in monotypic new genera, we propose to consider them all congeneric, despite phenotypic differences in wing shapes and patterns: Psoralis sabina (Plötz, 1882), new combination, Psoralis laska (Evans, 1955), new combination, Psoralis arva (Evans, 1955), new combination, Psoralis umbrata (Erschoff, 1876), new combination, Psoralis calcarea (Schaus, 1902), new combination, and Psoralis visendus (E. Bell, 1942), new combination.

Saniba O. Mielke and Casagrande, 2003 is a subgenus of Psoralis Mabille, 1904

Despite close genetic relationship with Psoralis Mabille, 1904 (type species Psoralis sabaeus Mabille, 1904, which is a junior subjective synonym of Pamphila idee Weeks, 1901), Saniba O. Mielke and Casagrande, 2003 (type species Hesperia sabina Plötz, 1882) exhibits a number of phenotypic differences and COI barcode difference between their type species is 9.1% (60 bp). Therefore, we propose to treat Saniba O. Mielke and Casagrande, 2003 as a subgenus of Psoralis Mabille, 1904, new status. In addition to the type species, we place the following species in Saniba: Vidius laska Evans, 1955 (type locality Brazil: Mato Grosso), Vettius arva Evans, 1955 (type locality Brazil: Rio de Janeiro), Hesperia (Pamphila) umbrata Erschoff, 1876 (type locality not given, likely South Brazil), Padraona calcarea Schaus, 1902 (type locality Brazil: Rio de Janeiro), and Anthoptus visendus E. Bell, 1942 (type locality Ecuador) (Fig. 13).

Hermio Grishin, new genus

http://zoobank.org/A8DADA97-8F87-4109-B0D0-CB1AA243C7DD

Type species.

Falga ? hermione Schaus, 1913.

Definition.

Previously placed in Lento Evans, 1955 (type species Pamphila lento Mabille, 1878), but not monophyletic with it, clustering with Psoralis Mabille, 1904 (type species Psoralis sabaeus Mabille, 1904, which is a junior subjective synonym of Pamphila idee Weeks, 1901) instead (Fig. 13), but distantly: COI barcodes of their type species differ by 10.9% (72 bp). Keys to I.3.1 in Evans (1955). Distinguished from its relatives by the following combination of characters: antennae longer than half of forewing costal margin; third segment of palpi long, needle-like; hindwing discal cell shorter than half of wing, forewing apex and hindwing tornus rounded; uncus broad, arms knob-like, valvae narrow, asymmetrical, left harpe extended, apically narrowing, right harpe rounded, upturned, forming a cleft between it and ampulla. In DNA, a combination of the following base pairs is diagnostic: aly127.55.6:G65T, aly127.55.6:T69A, aly127.55.6:A113T, aly144.18.1:A190G, and aly4683.4.2:A2881C.

Etymology.

The name is a feminine noun in the nominative singular, for the slender build of these skippers, very long antennae and legs, and narrower wings than in their relatives.

Species included.

The type species and Lento hermione vina Evans, 1955.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Hermio vina (Evans, 1955), new status, new combination

Named by Evans (1955) as a subspecies of Lento hermione (Schaus, 1913) (type locality Costa Rica), L. h. vina (type locality Peru) differs from Hermio hermione by the lack of stigma and the shape of left harpe, not terminally upturned and without basal projection. Due to these differences being consistent with species-level distinction, we propose Hermio vina Evans, 1955, new status, new combination.

Alternative taxonomy of Psoralis Mabille, 1904 relatives

Due to confident clustering in the genomic tree (Fig. 13), in addition to subgenus Saniba O. Mielke and Casagrande, 2003, it may be reasonable to treat Hermio Grishin, new genus and Gracilata Grishin, new genus as subgenera of Psoralis Mabille, 1904. While they indeed share some similarity in having long antennae and either undivided or weakly divided uncus, their phenotypic diversity may be too large for a single genus. Therefore we currently do not adopt this view.

Alychna gota (Evans, 1955), new combination

Psoralis gota Evans, 1955 (type locality Venezuela) is not monophyletic with Psoralis Mabille, 1904 (type species Psoralis sabaeus Mabille, 1904, which is a junior subjective synonym of Pamphila idee Weeks, 1901), but instead originates within Alychna Grishin, 2019 (type species Pamphila exclamationis Mabille, 1898) (Fig. 13) and therefore we propose Alychna gota (Evans, 1955), new combination.

Adlerodea asema (Mabille, 1891) and Adlerodea subpunctata (Hayward, 1940), new combinations

Currently placed in Eutychide Godman, 1900 (type species Hesperia physcella Hewitson, 1866), Pamphila asema Mabille, 1891 (type locality Honduras) and Eutychide subpunctata Hayward, 1940 (type locality Argentina) sequenced from their primary type specimens, are not monophyletic with it and instead cluster closely with Adlerodea Hayward, 1940 (type species Adlerodea modesta Hayward, 1940) (Fig. 13). Genitalia are similar between these species, as well as the brands on forewing. Therefore, we propose Adlerodea asema (Mabille, 1891), new combination, and Adlerodea subpunctata (Hayward, 1940), new combination.

Psoralis concolor Nicolay, 1980 is a junior subjective synonym of Ralis immaculatus (Hayward, 1940), new combination

Inspection of photographs of the holotype of Oeonus immaculatus Hayward, 1940 (type locality Ecuador: Morona Santiago, Sucúa) currently in Mucia Godman, 1900 (type species Mucia thyia Godman, 1900, a junior subjective synonym of Hesperia zygia Plötz, 1886), and the original illustration of its genitalia (Hayward 1940) reveal strong similarities with Psoralis concolor Nicolay, 1980 (type locality Ecuador: Napo, Cotundo) named 40 years later and currently in Ralis Grishin, 2019 (type species Lerema coyana Schaus, 1902). The similarities include general dark-brown coloration, wing shape, very prominent stigma, shape of harpe, uncus and aedeagus. Moreover, a specimen identified after genitalic dissection by Nicolay himself as Mucia immaculatus (NVG-19069D04) is conspecific with Ralis concolor according to genomic analysis (Fig. 13). Both taxa are from the eastern slopes of Andes in Ecuador. Therefore, we propose that Psoralis concolor Nicolay, 1980 is a junior subjective synonym of Ralis immaculatus (Hayward, 1940), new combination.

Rhinthon braesia (Hewitson, 1867) and Rhinthon bajula (Schaus, 1902), new combinations

Evans (1955) treated Thracides molion Godman, 1901, Thracides bajula Schaus, 1902, and Hesperia braesia Hewitson, 1867 in Neoxeniades Hayward, 1938 (type species Neoxeniades musarion Hayward, 1938). Burns et al. (2010) transferred molion to Rhinthon Godman, 1900 (type species Proteides chiriquensis Mabille, 1889, a junior subjective synonym of Hesperia osca Plötz, 1882), but left the other two of its close relatives (Fig. 13) in Neoxeniades. Here, we correct this problem and suggest Rhinthon braesia and Rhinthon bajula as new combinations.

Nycea Grishin, new subgenus

http://zoobank.org/7CF78EC7-BD8B-48DB-9AED-7A0720A5429A

Type species.

Pamphila hycsos Mabille, 1891.

Definition.

Forms a prominent clade in the tree sister to Quinta Evans, 1955 (type species Cobalus cannae Herrich-Schäffer, 1869) (Fig. 13) and therefore is a subgenus. Keys to L.7.3b or 5b in Evans (1955). Identified within Cynea Evans, 1955 (type species Hesperia cynea Hewitson, 1876) by a tuft of long scales in forewing cell CuA2-1A+2A above, gnathos shorter than uncus, and various modifications (styles, processes, several teeth) at the distal end of aedeagus, harpe not deeply bilobed as in Quinta Evans, 1955 (type species Cobalus cannae Herrich-Schäffer, 1869). In DNA, a combination of the following base pairs is diagnostic: aly171.6.1:C2996G, aly256.31.3:A7G, aly1370.7.2:C2177A, aly890.59.1:A2627C, and aly2258.11.1:A217C.

Etymology.

The name is a feminine noun in the nominative singular, formed from the genus name Cynea by swapping letters c and n.

Species included.

The type species, Hesperia corisana Plötz, 1882, Cynea rope Grishin, new species (see below), Cynea popla Evans, 1955, Rhinthon iquita Bell, 1941, Cynea robba Evans, 1955, Thracides melius Geyer, 1832, and Pamphila irma Möschler, 1879.

Parent taxon.

Genus Cynea Evans, 1955.

Quinta Evans, 1955 is a subgenus of Cynea Evans, 1955

Our genomic tree shows that Cynea Evans, 1955 (type species Hesperia cynea Hewitson, 1876) is paraphyletic with respect to Quinta Evans, 1955 (type species Cobalus cannae Herrich-Schäffer, 1869) (Fig. 13), and Quinta is closely related to a clade consisting of Cynea species. To restore the monophyly, we propose to treat Quinta as a subgenus of Cynea, new status.

Hesperia dido Plötz, 1882 is a junior subjective synonym of Cynea (Quinta) cannae (Herrich-Schäffer, 1869)

Original descriptions of Hesperia lochius Plötz, 1882 (type locality Venezuela: La Guaira) and Hesperia dido Plötz, 1882 (type locality Venezuela) were placed next to each other in the key (Plötz 1882b) and preceded by a re-description of Cobalus cannae Herrich-Schäffer, 1869 (type locality not specified in the original description and given as [Venezuela:] “Laguayra” by Plötz, the same as for H. lochius). The lectotype (NVG-15035D04) and paralectotypes of Cynea (Quinta) cannae are in the ZMHB, they are from Herrich-Schäffer collection and agree with the his original description. Therefore, the identity of this species is without a doubt. However, C. cannae might have been misidentified by Plötz, because he mentioned “a weak stigma” in male, but true C. cannae lacks stigma, and only has a small brand over the vein 1A+2A, covered by a tuft of long scales (Evans 1955).

The two other names (H. lochius and H. dido) have been considered synonymous since Evans (1955). Type specimens of these species have not been documented. To learn about these taxa, we only have their original descriptions augmented with the copies of unpublished Plötz’s drawings made by Godman’s request (Godman 1907) (Fig. 12g,h), now in the Library of the Natural History Museum London. The following combination of characters differentiates H. dido from similar species, including H. lochius, as translated from Plötz (1882b), with the relevant parts gathered throughout his key: “Dorsal side of wings black-brown. Forewing with mostly white, often very faint glass spots, which are sometimes missing except for the three dots in front of the apex. Forewing without a hyaline spot in the discal cell. Fringes not checkered. Forewing cells 4 (M2-M3) and 5 (M1-M2) without spots. Forewing cell 1 (CuA2-1A+2A) with a whitish spot, cells 2 (CuA1-CuA2) and 3 (M3-CuA1) with transverse spots. Hindwing red-brown on ventral side, overscaled with violet-gray in the middle and in the submarginal area, with two rusty-yellow spots in the costal area and one such [rusty-yellow] postdiscal band.”

Godman’s copies of two Plötz’s illustrations of this species (Nos. 577 and 577a, inspected and photographed by N. V. G.), agree perfectly with this description, except that the fringes appear checkered on the ventral side. Both images are recognizable as minor variations of C. cannae, and can hardly be confused with any other species, thus differing from H. lochius illustration (No. 576) and description (for example, brown, not violet-overscaled, submarginal area on ventral hindwing). The fringes are mostly not checkered in C. cannae, however, in many specimens, there are patches of dark scales at the outer margin in the middle of cells on ventral side of wings, creating an impression of checkering. Moreover, in some specimens, fringes are darker at veins near the wing margin, thus agreeing with the illustrations. Despite this detail, agreement between the original description, copies of unpublished illustrations, and C. cannae specimens is nearly perfect.

A search for syntypes of H. dido in the Museum für Naturkunde, Berlin, Germany (ZMHB) and the Zoologische Staatssammlung München, Germany (ZSMC), where primary types of many taxa authored by Plötz are deposited failed to find them. Inspection of photographs of the drawers with Plötz types in the collection of the Universität Greifswald (EMAU) revealed no H. dido syntypes either. Therefore, we believe that the syntypes were lost, and we proceeded with the neotype designation. There is an exceptional need to stabilize nomenclature by a neotype of H. dido, because the identity of this taxon has been misunderstood, and it has been placed in synonymy with Lerema accius (J. E. Smith, 1797) (type locality USA: Georgia) or with L. a. lochius, both not in agreement with information available about H. dido. To ensure that this name is applied consistently with the original description and illustrations, a neotype is necessary. Therefore, N. V. G. designates a female of C. cannae from Venezuela illustrated in Fig. 12e,f as the neotype of Hesperia dido Plötz, 1882. The wing pattern of the neotype agrees with the description and the illustrations of H. dido, and the only discrepancy is the larger size of the neotype: forewing length is about 19 mm, not 16 mm as in the H. dido description. However, size is variable, for example, forewing of the specimen from Venezuela: Puerto Cabello in the ZMHB collection used as the basis for the unavailable name Pamphila byzas Godman, 1900 (Mabille in litt.), proposed in synonymy with C. cannae, is only 15.5 mm. Therefore, forewing length of H. dido falls within the range known for C. cannae.

This neotype of H. dido satisfies all requirements set forth by ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of this taxon, which has been confused and inconsistent with its original description; 75.3.2. The characters for the taxon have been given in its original description by Plötz (1882a: 53) and are re-stated above; 75.3.3. The neotype specimen bears the following labels: ∥ El Valle | Venez | 1443 | CHBal-lou | Sofia “ ∥ on Canna ind- | ica Oct.21.’40 | Pupa.Oct.25 | Adult.Nov.10 ∥ DNA sample ID: | NVG-15102B06 | c/o Nick V. Grishin ∥, and can be recognized by a tear at the base of right hindwing; 75.3.4. Our unsuccessful search for the syntypes is described above, leading us to conclude that the specimens composing the type series of H. dido are lost; 75.3.5. As detailed above, the neotype is consistent with the original description and additional information (for example, copies of Plötz drawings) known about this taxon; 75.3.6. The neotype is from Venezuela: Caracas, El Valle, and the type locality given for H. dido in the original description is “Venezuela”; 75.3.7. The neotype is in the collection of the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM). The neotype implies that Hesperia dido Plötz, 1882 is a junior subjective synonym of Cynea (Quinta) cannae (Herrich-Schäffer, 1869).

Cymaenes loxa Evans, 1955, new status

Proposed as a stronger-patterned subspecies of Cymaenes laureolus (Schaus, 1913) (type locality Costa Rica) by Evans (1955), C. l. loxa (type locality Brazil: Para) is genetically distinct to the extent that suggests its species status. For example, Fst/Gmin statistics for comparing specimens from Mexico and Guatemala to loxa from South America are 0.40/0.02. Therefore, we propose Cymaenes loxa Evans, 1955, new combination.

Cymaenes lochius Plötz, 1882, new combination

Placed by Evans (1955) as a subspecies of Lerema accius (J. E. Smith, 1797) (type locality USA: Georgia), Hesperia lochius Plötz, 1882 (type locality Venezuela: La Guaira), was more recently treated as a species level taxon, for example, by Llorente et al. (1990). The original description of H. lochius, with the relevant parts gathered throughout the identification key, follows translated from Plötz (1882b): “Dorsal side of wings black-brown. Forewing with mostly white, often very faint glass spots, which are sometimes missing except for the three dots in front of the apex. Forewing without a hyaline spot in the discal cell. Fringes not checkered. Forewing cells 4 (M2-M3) and 5 (M1-M2) without spots, also cell 1 (CuA2-1A+2A) [without a spot]. Hindwing with a slightly wavy outer margin, violet-gray below, light brown on the anal margin to vein 2 (CuA2), broad brown on the costal margin, in cell 7 (Sc+R1-RS) with two violet-gray spots, after the middle two brown transverse bands from cell 6 (RS-M1) to 2 (CuA1-CuA2). Forewing with three hyaline dots at the apex and beneath a very small white dot in cell 3 (M3-CuA1). ♂.”

Similarly to Hesperia dido Plötz, 1882 (type locality Venezuela) (see above), we found Godman’s copy of the unpublished Plötz’s H. lochius drawing in the Library of the Natural History Museum London (Fig. 12k). This illustration, possibly used by Draudt (1921–1924) (plate 187c[4,5], without a violet tint of the original copy, and Fig. 12l here), agrees with the original description, and with all likelihood shows a male, as stated in the description, and as we also deduce from its narrower and more pointed wings. There is no obvious stigma on the forewing, typical for the species Evans identified as Lerema accius lochius. Moreover, no stigma is mentioned in the original description of H. lochius. Judging from Godman’s copies, Plötz illustrated stigmas where they were well-defined (for example, in other Lerema Scudder, 1872 taxa), and mentioned them in his key. For instance, a stigma is mentioned for the species placed before H. lochius in the Plötz’s key, called “Cannae HS”. The description of Plötz’s “Cannae” agrees better with the taxon Evans identified as L. a. lochius, than with Cynea (Quinta) cannae (Herrich-Schäffer, 1869), and could have been Plötz’s misidentification. In any case, it seems likely that males of H. lochius lack stigma, while males of the taxon Evans identified as L. a. lochius possess a well-developed stigma.

Thus, our analysis reveals that the taxon Evans identified as L. a. lochius, is not the species that Plötz described. More, out of all currently known Neotropical species of Hesperiidae, Cymaenes laureolus (Schaus, 1913) agrees best with what we learned about H. lochius (Fig. 12m,n). It lacks a stigma in males, has a wavy hindwing margin, most specimens are quite dark, only spotted at forewing apex, additionally with a single dash in cell 3 (M3-CuA1) on ventral forewing. Ventral hindwing pattern of C. laureolus (could be poorly expressed in some specimens) while different from that of the taxon Evans identified as L. a. lochius, is a match to H. lochius Plötz. Namely, a prominent, nearly square spot in the middle of cell 7 (Sc+R1-RS) is aligned with the dark discal band; this spot is distad of paler basal area (not a small spot aligned with basal violet-gray area, spot basad of the dark discal band as in Evans’ L. a. lochius), separated from costa by a dark-brown area; another similar to it spot in the same cell closer to the wing base (frequently fading within darker background); a continuous and nearly straight violet-gray band between veins 7 (RS) and 2 (CuA2) (not a curved band with the spot in cell 6 (RS-M1) offset basad, and aligned with the brown discal band in Evans’ L. a. lochius); hindwing is somewhat paler in the submarginal area and pale-brown from the inner margin to at least vein 1A+2A-3A and partly in the previous cell CuA2-1A+2A.

In summary, the most noticeable difference between the two species in hindwing pattern is that in H. lochius Plötz, the pale spot aligned with the discal brown band is in cell 7 (Sc+R1-RS), and this spot is rather large and square, with violet tint (as in species of Cymaenes Scudder, 1872), but in Evans’ L. a. lochius, which was treated as a species-level taxon by Llorente et at. (1990), the pale spot aligned with the discal brown band is in cell 6 (RS-M1) and this spot is smaller, rounder and yellower, more similar to that in L. accius.

While we are not able to accomplish this task in the present work, search for the type specimens of H. lochius will be conducted and, if unsuccessful, a neotype from Venezuela that agrees with the original description and matches closely the copy of Plötz’s illustration (for example, at least lacks stigma in male) will be selected. This species from Venezuela is seemingly quite close to mostly Central American C. laureolus (Fig. 12m,n) and may even be conspecific with it. However, in case we are erroneous in our present assessment based only of the original description and the unpublished illustration, not willing to prematurely synonymize C. laureolus with it, we tentatively keep H. lochius as a valid species to form Cymaenes lochius Plötz, 1882, new combination, currently recorded only from Venezuela.

Lerema lucius Grishin, new species

http://zoobank.org/E895C840-A81D-4D0E-A212-3F17D8C6FC62

Definition.

Evans (1955) misidentified Hesperia lochius Plötz, 1882 (type locality Venezuela: La Guaira), as detailed above. Hence, because it has no synonyms, the taxon Evans identified as Lerema accius lochius is left without a name, and is proposed as a new species, due to genetic differentiation and genitalic differences from Lerema accius (J. E. Smith, 1797) (type locality USA: Georgia). Evans provided its description in a form of identification key, which is adopted here: this new species keys to J.39.2b in Evans (1955). In brief, it is superficially similar to L. accius in having ventral hindwing variegated with paler and darker areas of olive-ochreous tones juxtaposed with reddish brown patches and violet-fray overscaling particularly by the outer margin, forewing without a hyaline spot in cell R2-R3, and typically with white dashes along costa near apex; but differs from L. accius in being on average larger, less variable in pattern, and diagnosed by the end of harpe being flatter and broader than in L. accius. The holotype is a female from Panama: Colón Province, Playa Piña, illustrated in Fig. 12i,j. It bears the following labels ∥ PANAMA: CANAL ZONE | Pina | 9° 17′N 80° 03′W | I. 1973 | Leg. G.B.Small ∥ DNA sample ID: | NVG-7737 | c/o Nick V. Grishin ∥ genitalia | NVG170205–22 | Nick V. Grishin | USNMENT | [barcode image] | 01321577 ∥ and deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM). Its COI barcode sequence is: AACTTTATATTTTATCTTCGGAATTTGAGCTGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGTGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCCCCATCATTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTTTACCCTCCATTATCCTCAAATATTGCCCATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCTCTTCATCTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTCGTTTGATCTGTAGGAATTACTGCACTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACTTCTTTTTTT GATCCTGCAGGAGGAGGAGATCCTATTCTATATCAACATTTATTT

Despite wing pattern similarities, it is 7.3% (48 bp) different from L. accius, the difference comparable to that for species placed in different subgenera. Paratypes are: ♂ from Mexico: Sinaloa, San Ignacio, leg. Doug Mullins, 27-Jul-1981, NVG-17111G08 [LACM] and ♀ from Colombia: Valle, Hormiguero, 1000m, 3° 17′N 76° 29′W, 19-Jan-1992, leg. J. Bolling Sullivan, NVG-7736 [USNM]. Type identification labels will be mailed to curators of the collections to be placed on these specimens. Only specimens we sequenced were included in the type series, but the species appears to be widely distributed from Mexico to Venezuela.

Etymology.

The name for this species that is phenotypically closest to Lerema accius is taken from a Roman poet Lucius Accius. The name is a noun in apposition.

Proteides osembo Möschler, 1883 is a junior subjective synonym of Cynea (Cynea) diluta (Herrich-Schäffer, 1869)

Placed into synonymy with Cynea (Quinta) cannae (Herrich-Schäffer, 1869) (type locality not specified) by Godman in the Biologia Centrali-Americana book (Godman and Salvin 1900a), Proteides osembo Möschler, 1883 (type locality Suriname) stayed there since. Sequencing of the P. osembo holotype (NVG-15035D08, in the ZMHB) reveals that it clusters closely with Cynea (Cynea) diluta (Herrich-Schäffer, 1869) (type locality not specified), in a sense the latter taxon is currently understood (Fig. 13). This specimen is indeed the holotype, because it agrees with the original description and bears labels characteristic of Möschler specimen. However, it remains a mystery why Godman was “unable to detect any difference between” this holotype and the type series of Cobalus cannae, the latter being identified correctly (Godman and Salvin 1900a). Phenotypic inspection of the holotype confirms our genetic assessment, and we propose that Proteides osembo Möschler, 1883 is a junior subjective synonym of Cynea (Cynea) diluta (Herrich-Schäffer, 1869).

Eutus Grishin, new genus

http://zoobank.org/295E2282-74CC-47A1-8345-DFB108747EA4

Type species.

Cobalus rastaca Schaus, 1902.

Definition.

A diverse clade without obvious affinities, a weakly supported sister of the clade consisting of Moeris Godman, 1900 (type species Talides striga Geyer, 1832) with Viridina Grishin, 2019 (type species Lerema (?) viridis Bell, 1942) (Fig. 13) and therefore a genus of its own. Keys to J.50.8, or J.48.8, or L.11.9 in Evans (1955). Distinguished from its relatives by the following combination of characters: harpe narrower than valva, typically upturned as a broad hook, ampulla expanded and bulging out, uncus broad and short, arms far apart, nearly at a distance equal to their length, tegumen short, about the same as uncus in length, saccus shorter than half of vinculum, aedeagus about the same length as valva; triangular brand at the base of forewing cell CuA1-CuA2 in some species; frequently with a hyaline narrow spot between forewing veins CuA2 and CuA1 near the base of this cell just distad from triangular brand; forewing discal cell may be with a doublet of dash-like spots; hindwing below typically with pale spot in discal cell and postdiscal semi-circle of spots in several cells near the middle of the wing, these spots may be framed with black. Due to phenotypic diversity, best diagnosed by DNA characters and a combination of the following base pairs is diagnostic: aly2582.9.2:C40A, aly957.1.1:T3340C, aly7480.1.19:T466A, aly7480.1.19:C467G, and aly7480.1.19:G468C.

Etymology.

The name is a masculine noun in the nominative singular, formed from the first syllable of Eutychide, the genus where the type species was formerly placed.

Species included.

The type species, Thoon yesta Evans, 1955, and Cobalus mubevensis Bell, 1932.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Cobalopsis brema E. Bell, 1959 is a junior subjective synonym of Eutus rastaca (Schaus, 1902)

Known from a single male holotype, Cobalopsis brema E. Bell, 1959 and from a number of females, Eutus rastaca (Schaus, 1902) are sisters in the genomic tree (Fig. 13), and the COI barcodes of their primary type specimens are 100% identical. All these specimens are from southeastern Brazil and likely represent same species. Therefore, the name for this species is rastaca, and Cobalopsis brema E. Bell, 1959, becomes its new junior subjective synonym.

Gufa Grishin, new genus

http://zoobank.org/8F28C55F-3AA2-43ED-B0FB-572B2AD960DE

Type species.

Phlebodes gulala Schaus, 1902.

Definition.

Mucia gulala (Schaus, 1902) (type locality Brazil: Rio de Janeiro) and Tigasis fusca (Hayward, 1940) (type species Brazil: Santa Catarina) are not monophyletic with the genera they are currently assigned to and are sisters instead (Fig. 13), and their clade is a moderately supported (and therefore distant) sister of Chitta Grishin, 2019 (type species Phlebodes chittara Schaus, 1902). Keys to L.9.3 (as Mucia visa Evans, 1955, currently a junior subjective synonym of M. gulala) or J.44.6 in Evans (1955). Distinguished from its relatives by the following combination of characters: wings produced, in particular hindwing tornal area; forewing with inconspicuous tripartite stigma; palpi flattened, slender, 3rd segment short; antennae long, about 2/3 of costal margin length; mid-tibial with spines; uncus with flanges on the sides; saccus short, shorter than uncus, aedeagus with modifications at the distal end, shorter than valva, valva elongated, harpe half of valva in length, not separated from ampulla, distally flattened and notched. In DNA, a combination of the following base pairs is diagnostic: aly1603.75.10:T114C, aly123.8.2:G150T, aly640.20.4:C120T, aly517.7.11:C28T, and aly2692.8.2:C57A.

Etymology.

The name is a feminine noun in the nominative singular, formed from the names of species placed in the genus: Gu[lala]+f[usc]a.

Species included.

The type species and Lerema fusca Hayward, 1940.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Godmia Grishin, new genus

http://zoobank.org/5920ACE7-4172-4CC9-8197-B5335E8C8869

Type species.

Euroto chlorocephala Godman, 1900

Definition.

Placed by Evans (1955) in Onophas Godman, 1900 (type species Cobalus columbaria Herrich-Schäffer, 1870), the type species of this genus is not monophyletic with Onophas and instead is a phylogenetic lineage in the same clade with Halotus Godman 1900 (type species Hesperilla saxula Mabille, 1891, which is a junior subjective synonym of Hesperia angellus Plötz, 1886) (Fig. 13), but distant from it both genetically and morphologically. Therefore, this new genus is proposed. Keys to J.51.3 in Evans (1955). Distinguished from its relatives by the following combination of characters: antennae unusually long, longer than 2/3 of forewing costal margin; palpi flattened, 3rd segment short; mid-tibiae spined; head and thorax covered with metallic-green scales above, also sparsely overscaling basal half of wings; wings largely unmarked dark-brown; hindwing below with a central pale spot and a postdiscal row of indistinct pale spots; fringes not checkered; dorsal forewing with distinctive brand of two segments: one near the base of cell CuA1-CuA2, tear-shaped, narrowing distally; the other right below it adjacent to vein CuA2 in cell CuA2-1A+2A, roundish. In DNA, a combination of the following base pairs is diagnostic: aly2130.9.4:C87T, aly34048.2.6:G61A, aly525.35.8:T63C, aly318.14.4:T270C, and aly127.36.2:T312C.

Etymology.

The name is a feminine noun in the nominative singular, formed from the author’s name of the type species. A number of Hesperiinae have back wings and shiny green-scaled head and thorax above, and one, the type species of this genus, was named by Godman, whose insight into classification of Hesperiidae with the focus on male genitalia and description of new genera is still unmatched.

Species included.

Only the type species.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Rhomba Grishin, new genus

http://zoobank.org/62751D2B-43A2-4575-A8C4-ED4A28B86EE1

Type species.

Eutychide gertschi Bell, 1937.

Definition.

Placed in Justinia Evans, 1955 (type species Hesperia justinianus Latreille, [1824]), this genus is not monophyletic with it, and is instead in a different subtribe (not Falgina Grishin, 2019, but Moncina A. Warren, 2008), being in the same clade with Niconiades Hübner, [1821], Thoon Godman, 1900, Joanna Evans, 1955 and Pares Grishin, 2019 among others and not showing closer relationship with any of these genera (Fig. 13). Keys to J.50.6 in Evans (1955) and is distinguished from its relatives by the following combination of characters: antennae longer than half of the costal margin, palpi gracile, last segment conical and short, mid-tibiae without spines, very short and broad uncus with lateral projection on each side, together with tegumen square-shaped in dorsal view, saccus short, the same length as uncus, unusually shaped valva: broad with a bulging costa, trapezoid in shape, harpe upturned with stout teeth at the angles, penis the same length as vinculum in lateral view and slightly narrower than tegumen in lateral view. In DNA, a combination of the following base pairs is diagnostic: aly207.4.2:A41C, aly1019.26.7:A53T, aly925.20.2:G1259A, aly15220.5.8:A772C, and aly276890.2.1:T39C.

Etymology.

The name is a feminine noun in the nominative singular, given for the rhomboidal shape of valvae.

Species included.

Only the type species.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Psoralis panamensis Anderson and Nakamura, 2019 is a junior subjective synonym of Rhomba gertschi (Bell, 1937)

Phenotypic inspection reveals that the holotype of Rhomba gertschi (Bell, 1937) is a dark specimen of a species later described as Psoralis panamensis Anderson and Nakamura, 2019. Most notably, both taxa share tri-partite brand of similar shape, male genitalia with bulky uncus and tegumen armed with lateral projections, and uniquely shaped valva: costa expanded, harpe terminally serrated and with a prominent sharp tooth at its base inside.

Alerema Hayward, 1942 is a valid genus

Inspection of the genomic tree reveals that Phlebodes simplex Bell, 1930 (type locality Brazil: Santa Catarina, Blumenau), a senior subjective synonym of Alerema aeteria Hayward, 1942 (type locality Argentina: Misiones), which is the type species of Alerema Hayward, 1942 is not monophyletic with Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900) where it is currently placed, but instead falls in the rapid radiation of the clade with Niconiades Hübner, [1821] (type species Niconiades xanthaphes Hübner, [1821])), Gufa Grishin, new genus (type species Phlebodes gulala Schaus, 1902) and Rhomba Grishin, new genus (type species Eutychide gertschi Bell, 1937) among others (Fig. 13). Therefore, we reinstate Alerema Hayward, 1942 as a valid genus.

Niconiades peri (Evans, 1955), new status, new combination

Evans (1955) named peri (type locality Brazil: Para) as a subspecies of Neoxeniades bajula (Schaus, 1902) (type locality Brazil: Rio de Janeiro, Nova Friburgo), apparently without examining N. bajula males. Above, we transferred N. bajula to Rhinthon Godman, 1900 (type species Proteides chiriquensis Mabille, 1889, a junior subjective synonym of Hesperia osca Plötz, 1882). Inspection of R. bajula syntype in the USNM reveals the lack of secondary sexual organs on wings (contrary to Evans’ key), but N. b. peri holotype (examined in BMNH) possesses a characteristic 3-partite brand as described by Evans, in addition to a number of wing patters differences. Therefore, N. b. peri is a species distinct from R. bajula. Furthermore, male genitalia of N. b. peri differ significantly from those of Rhinthon or Neoxeniades Hayward, 1938 (type species Neoxeniades musarion Hayward, 1938). The three-pronged distal end of valva and elaborate aedeagus structure, together with the brands, place peri in Niconiades Hübner, [1821] (type species Niconiades xanthaphes Hübner, [1821]) to form Niconiades peri (Evans, 1955), new status, new combination. By placing N. b. peri in Niconiades, we add another genus to the classic blue-white-black fulgerator mimicry complex named after Telegonus fulgerator (Walch, 1775). This accurate mimicry is the reason for errors in taxonomic classification.

Pares viridiceps (Mabille, 1889), reinstated status, new combination

Considered a junior subjective synonym of Thoon modius (Mabille, 1889) by Evans (1955), the holotype of Proteides viridiceps Mabille, 1889 (type locality Panama) is not monophyletic with it and is instead sister to Pares maritza (Nicolay, 1980) (type locality Ecuador) (Fig. 13). It differs from P. maritza by 2.3% (15 bp) in COI barcode. Therefore, we reinstate P. viridiceps as a species-level taxon and transfer it to Pares Grishin, 2019 (type species Phlebodes pares Bell, 1959), forming Pares viridiceps (Mabille, 1889), reinstated status, new combination.

Paracarystus ranka (Evans, 1955), new combination

Named by Evans (1955) in Thoon Godman, 1900 (type species Proteides modius Mabille, 1889), ranka is not monophyletic with it and instead groups closely with all three known species of Paracarystus Godman, 1900 (type species Cobalus hypargyra Herrich-Schäffer, 1869) (Fig. 13), where it is placed to form Paracarystus ranka (Evans, 1955), new combination.

Tricrista aethus (Hayward, 1951), Tricrista canta (Evans, 1955), Tricrista slopa (Evans, 1955), Tricrista circellata (Plötz, 1882), and Tricrista taxes (Godman, 1900), new combinations

Genomic sequencing reveals that the following species currently placed in Thoon Godman, 1900 (type species Proteides modius Mabille, 1889): Cobalus aethus Hayward, 1951 (type locality Bolivia), Thoon canta Evans, 1955 (type locality Colombia), Hesperia circellata Plötz, 1882 (type locality Brazil) and Thoon taxes Godman, 1900 (type locality Panama) are not monophyletic with it and instead are in the same prominent clade with Penicula crista Evans, 1955, the type species of Tricrista Grishin, 2019 (Fig. 13) implying Tricrista aethus (Hayward, 1951), new combination, Tricrista canta (Evans, 1955), new combination, Tricrista circellata (Plötz, 1882), new combination, and Tricrista taxes (Godman, 1900), new combination. Due to phenotypic similarity to these species, particularly to T. canta, we additionally propose Tricrista slopa (Evans, 1955), new combination.

Gallio madius (E. Bell, 1941) and Gallio seriatus (Mabille, 1891), new combinations

Currently in Vehilius Godman, 1900 (type species Cobalus illudens Mabille, 1891, currently a subspecies of Pamphila stictomenes Butler, 1877), Vehilius madius Bell, 1941 (type locality Brazil: Santa Catarina) and Phlebodes seriatus Mabille, 1891 (type locality Venezuela: Valera) are not monophyletic with it and are in same clade with Gallio Evans, 1955 (type species Stomyles gallio Mabille, 1904, which is a junior subjective synonym of Vehilius carasta Schaus, 1902) (Fig. 13), where they are transferred to form Gallio madius (E. Bell, 1941), new combination and Gallio seriatus (Mabille, 1891), new combination.

Gallio danius (Bell, 1941), reinstated status, new combination

Vehilius danius Bell, 1941 (type locality Brazil: Santa Catarina) is not monophyletic with Vehilius seriatus (Mabille, 1891) (type locality Venezuela: Valera) (Fig. 13) and therefore is not its subspecies, but instead is a species-level taxon in Gallio Evans, 1955 (type species Stomyles gallio Mabille, 1904, which is a junior subjective synonym of Vehilius carasta Schaus, 1902), not grouping closely with any other species: Gallio danius (Bell, 1941), reinstated status, new combination.

Gallio garima (Schaus, 1902), new combination

Currently in Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900), Oeonus garima Schaus, 1902 (type locality Trinidad) is not monophyletic with it and instead is sister to Gallio Evans, 1955 (type species Stomyles gallio Mabille, 1904, which is a junior subjective synonym of Vehilius carasta Schaus, 1902) (Fig. 13), where it is placed to form Gallio garima (Schaus, 1902), new combination, not grouping closely with any other genus.

Gallio massarus (E. Bell, 1940), reinstated status, new combination

Perimeles massarus Bell, 1940 (type locality Brazil: Santa Catarina), while being its sister, is only distantly related to Gallio garima (Schaus, 1902), new combination (type locality Trinidad) (Fig. 13), for example, their COI barcodes differ by 4.4% (29 bp), and therefore is not its subspecies but a species-level taxon Gallio massarus (E. Bell, 1940), reinstated status, new combination.

Tigasis corope (Herrich-Schäffer, 1869), new combination

Sequencing of the two syntypes (male a female) of Cobalus corope Herrich-Schäffer, 1869 (type locality not stated) in the ZMHB (NVG-15035A02 ♂ and NVG-15035A03 ♀) reveals that they do not belong to Cynea Evans, 1955 (type species Hesperia cynea Hewitson, 1876), as currently assumed, but are closely related to Tigasis arita Schaus, 1902 (type locality Trinidad), and therefore belong to the genus Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900) (Fig. 13). Specimens of T. arita from South America we sequenced possess identical COI barcodes from across the range from Venezuela, Trinidad, Ecuador and Brazil. However, the barcodes of the two C. corope syntypes, while being identical to each other, differ from T. arita by 0.8% (5 bp). Although this difference is not large, taking into account invariability of T. arita barcodes and not willing to synonymize T. arita under C. corope, we propose to treat C. corope as a species-level taxon pending further studies: Tigasis corope (Herrich-Schäffer, 1869), new combination. Moreover, while we do not have other specimens of T. corope from a known locality to figure out where the T. corope syntypes came from, they are not likely to be from Venezuela, Trinidad, Ecuador and Brazil and neighboring areas. It is likely (also see below) they were collected in Panama or western Colombia.

Tigasis wellingi (Freeman, 1969), reinstated status

Our genomic tree reveals a prominent separation between North American and South American populations currently assigned to Tigasis arita (Schaus, 1902) (type locality Trinidad) (Fig. 13). Specimens from Mexico: Oaxaca, Guatemala and Costa Rica formed a distinct clade that contained the holotype of Thoon wellingi Freeman, 1969 (type locality Mexico: Oaxaca). We consider this clade to be a distinct species: Tigasis wellingi (Freeman, 1969), reinstated status. The COI barcodes of the T. arita syntype and the T. wellingi holotype differ by 0.9% (6 bp), consistently with the difference between T. arita and Tigasis corope (Herrich-Schäffer, 1869) (type locality not stated), the latter formed the third clade that is not likely to be from the localities of the other two clades, suggesting that T. corope may have come from Panama or western Colombia (see above).

Cynea rope Grishin, new species

http://zoobank.org/65FDA5DB-B126-41C3-9DCA-E25F1613050A

Definition.

Evans (1955) misidentified Cobalus corope Herrich-Schäffer, 1869 (type locality not stated), as detailed above. Hence, because it has no synonyms, the taxon Evans identified as Cynea corope is left without a name. Evans provided its description in a form of identification key, which is adopted here: this new species keys to L.7.15 in Evans (1955). Differs from its relatives by a combination of the following characters: wings dark-brown, forewing with a tuft of scales in cell CuA2-1A+2A above the brand and a tuft in cell 1A+2A; small hyaline forewing spots: two parallel elongated spots in forewing discal cell, a tiny one in cell CuA2-1A+2A, narrow in cell CuA1-CuA2, round and smaller in cell M3-CuA1, and dot in cells R5-M1; hindwing largely unmarked in the holotype; head and thorax with greenish scales; gnathos shorter than uncus, uncus slightly longer than wide, with arms about the same length as gnathos arms, valva twice as long as wide, harpe moderately extended caudad, with a broad dorsal tooth by ampulla, irregularly serrated along the dorsal margin near the tooth, aedeagus with elaborations at the distal end. The holotype is a male from Nicaragua: Chontales, collected by T. Belt, from Godman-Salvin collection, illustrated in Fig. 12c,d and deposited in the Natural History Museum, London, UK (BMNH), its genitalia are glued to a card labeled R.8 and pinned under the specimen. The holotype identification label will be mailed to curators of the collection to be placed on the holotype.

Etymology.

The name is the last two syllables of corope to keep the former name association with this species. The name is a noun in apposition.

Tigasis perloides (Plötz, 1882), new combination

Currently in Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865), Hesperia perloides Plötz, 1882 (type locality Brazil) is not monophyletic with it and instead is sister to Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900) (Fig. 13). COI barcode difference between H. perloides and T. zalates is 7.6% (50 bp), and we propose that they are congeneric, implying Tigasis perloides (Plötz, 1882), new combination.

Styriodes Schaus, 1913, with Brownus Grishin, 2019 as its junior subjective synonym, and Remella Hemming, 1939 are subgenera of Mnasicles Godman, 1901

Genomic tree reveals that four closely related genera form a clade sister to Amblyscirtes Scudder, 1872 (type species Hesperia vialis W. H. Edwards, 1862) (Fig. 13). Genetic diversity of this clade is comparable to that of Amblyscirtes although the wing pattern differences (from solid dark-brown to cream-striped a spotted) resulted in their classification into several small genera. We propose to treat all these species currently in four genera as congeneric, within Mnasicles Godman, 1901 (type species Mnasicles geta Godman, 1901). Two genus-group names include particularly close relatives and we propose that Brownus Grishin, 2019 (type and the only species Paratrytone browni Bell, 1959) is a junior subjective synonym of Styriodes Schaus, 1913 (type species Styriodes lyco Schaus, 1913). We treat the two more distant ones: Styriodes and Remella Hemming, 1939 (type species Hesperia remus Fabricius, 1798), as subgenera of Mnasicles, new status for both.

Nausia Grishin, new subgenus

http://zoobank.org/2DF8540E-15F3-41E2-8F17-C537DB2F20E4

Type species.

Oenus [sic] nausiphanes Schaus, 1913.

Definition.

Currently in Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900) but not monophyletic with it, and instead is sister to the clade consisting of subgenera Mnasicles Godman, 1901 (type species Mnasicles geta Godman, 1901) and Remella Hemming, 1939 (type species Hesperia remus Fabricius, 1798) with subgenus Styriodes Schaus, 1913 (type species Styriodes lyco Schaus, 1913) originating right before, therefore is a subgenus of its own (Fig. 13). Keys to J.45.11 in Evans (1955). Similar to subgenus Remella in ventral hindwing pattern with a broad diffuse central cream band, but differs in that both sides of the band blend gradually with the basal or marginal brown areas (basal area sharply outlined in Remella); antennae checkered; stigma more prominent than in relatives, wider, less curved than in Remella, and lined with areas of gray scales outwards; forewing costal margin straight, not concave as in subgenus Styriodes Schaus, 1913 (type species Styriodes lyco Schaus, 1913) hindwing tornus in males more extended than in other subgenera; valva broad, only a third longer than its height, costa slightly convex, harpe rounded terminally, unturned, appressed to rounded ampulla, separated from it by a small notch, aedeagus terminally with a keel on both sides. In DNA, a combination of the following base pairs is diagnostic: aly216.57.2:G803A, aly499.78.3:A371T, aly1249.8.1:C1504A, aly1249.8.1:A1513C, and aly1603.54.2:G937T.

Etymology.

The name is a feminine noun in the nominative singular, formed from the type species name.

Species included.

Only the type species.

Parent taxon.

Genus Mnasicles Godman, 1901.

Cobalus asella Herrich-Schäffer, 1869 is a junior subjective synonym of Amblyscirtes alternata (Grote and Robinson, 1867)

Placed by Evans (1955) as a junior subjective synonym of Amblyscirtes vialis (W. H. Edwards, 1862) (type locality USA: Illinois, Mercer Co.), Cobalus asella Herrich-Schäffer, 1869 (type locality not specified) has not changed its status since. A single syntype of C. asella that we found and sampled (NVG-18042H03) in the ZMHB collection, groups with Amblyscirtes (Amblyscirtes) alternata (Grote and Robinson, 1867) (type locality USA: Georgia) in the genomic trees (Fig. 13) and phenotypically is consistent with A. alternata, not A. vialis, due to very short apiculus (extended in A. vialis) and more rounded wings. The specimen NVG-18042H03 is a syntype of C. asella because it bears the labels typical of Herrich-Schäffer, 1869 types: old darkening elongated handwritten label with the word “asella” on it and printed “Coll. H.–Sch” label, and agrees with the original description. Due to genetic and phenotypic similarities, we propose that Cobalus asella Herrich-Schäffer, 1869 is a junior subjective synonym of Amblyscirtes alternata (Grote and Robinson, 1867).

Amblyscirtes florus (Godman, 1900), revised combination

Stomyles florus Godman, 1900 (type locality Mexico: Nayarit), currently in Repens Evans, 1955 (type species Repens repens Evans, 1955), is not monophyletic with its type species and instead is sister to Amblyscirtes Scudder, 1872 (type species Hesperia vialis W. H. Edwards, 1862) (Fig. 13), of which Stomyles Scudder, 1872 (type species Pyrgus textor Hübner, [1831], currently a junior subjective synonym of Hesperia aesculapius Fabricius, 1793) is a subgenus. Attributed to Amblyscirtes by Hoffmann (1941) and reaffirmed in this genus by Evans (1955) due to phenotypic similarities (Evans 1955), it was then placed in Repens by Warren et al. (1998). Here, we return it to its nearly original genus as Amblyscirtes florus (Godman, 1900), revised combination.

Flor Grishin, new subgenus

http://zoobank.org/B66A50DF-DDB9-45CE-94F1-7EA51B682101

Type species.

Stomyles florus Godman, 1900.

Definition.

Transferred from Repens Evans, 1955 (type species Repens repens Evans, 1955) back to Amblyscirtes Scudder, 1872 (type species Hesperia vialis W. H. Edwards, 1862) above, A. florus (Godman, 1900) cannot be confidently assigned to any of the four current Amblyscirtes subgenera (Fig. 13), and therefore belongs to a new subgenus. This new subgenus keys to N.2.20 in Evans (1955). Similar to other Amblyscirtes in overall appearance, but distinguished from its congeners by long and thin prominent brands similar to Repens, no stigma; shorter saccus, not longer than valva (about twice as long in other Amblyscirtes); and aedeagus about twice as long as saccus. In DNA, a combination of the following base pairs is diagnostic: aly1139.81.2:G1397A, aly140.13.7:A228T, aly2284.27.2:T177A, aly1139.81.2:C1396A, and aly1294.2.1:T3438A.

Etymology.

The name is a masculine noun in the nominative singular, formed from the type species name.

Species included.

Only the type species.

Parent taxon.

Genus Amblyscirtes Scudder, 1872.

Repens Evans, 1955 is a subgenus of Eprius Godman, 1901

After we transferred Stomyles florus Godman, 1900 (type locality Mexico: Nayarit) from Repens Evans, 1955 (type species Repens repens Evans, 1955) to Amblyscirtes Scudder, 1872 (type species Hesperia vialis W. H. Edwards, 1862), Repens became monotypic. Our genomic tree reveals that Repens is sister to another monotypic genus Eprius Godman, 1901 (type species Epeus veleda Godman, 1901) (Fig. 15). The two genera are close to each other genetically, for example, their COI barcodes differ by 9% (59 bp), and resemble each other phenotypically in general appearance, brands and genitalia sharing the elaborate structure of aedeagus distal end. Therefore we propose that these species are congeneric and place Repens Evans, 1955 as a subgenus of Eprius Godman, 1901, new status.

Figure 15.

Figure 15.

Genomic tree of Moncina, part 3. See Fig. 1 legend for notations.

Vidius fraus (Godman, 1900), new combination

Currently in Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865), Megistias fraus Godman, 1900 (type locality Mexico: Tabasco, Guatemala and Honduras) is not monophyletic with its type species and instead originates within Vidius Evans, 1955 (type species Narga vidius Mabille, 1891) (Fig. 14), where it is transferred to form Vidius fraus (Godman, 1900), new combination.

Figure 14.

Figure 14.

Genomic tree of Moncina, part 2. See Fig. 1 legend for notations.

Rectava Grishin, new genus

http://zoobank.org/D858109A-4CF8-4504-810D-ED99A71CBBB6

Type species.

Megistias ignarus Bell, 1932.

Definition.

A clade without obvious close relatives near Cobalopsis Godman, 1900 (type species Pamphila edda Mabille, 1891, a junior subjective synonym of Hesperia autumna Plötz, 1882) and Lurida Grishin, 2019 (type species Cobalus lurida Herrich-Schäffer, 1869) (Fig. 14), therefore a genus. Not closely related to Papias Godman, 1900 (type species Pamphila integra Mabille, 1891). Keys to J.36.2, or J.37.5, or J.24.8 in Evans (1955). Distinguished from its relatives by the following combination of characters: brick-shaped, more or less rectangular valva, harpe with a small tooth at dorsal margin, uncus narrowing towards the distal end, with narrow arms (longer than wide) close together, gnathos about the same length as uncus, its arms are close to uncus arms in lateral view, saccus long and thin, longer than valva, aedeagus about 1.5 times longer than saccus; no brands or stigma. In DNA, a combination of the following base pairs is diagnostic: aly2178.27.2:A308G, aly207479.1.2:T48C, and aly1294.9.12:T79A.

Etymology.

The name is a feminine noun in the nominative singular, for the shape of valva: Recta[ngular]+va[lva].

Species included.

The type species, Megistias vorgia Schaus, 1902, Vidius nostra Evans, 1955, and Papias sobrinus Schaus, 1902 (see below).

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Rectava sobrinus (Schaus, 1902), reinstated status, new combination

Papias sobrinus Schaus, 1902 (type locality Brazil: Rio de Janeiro) is currently a junior subjective synonym of Papias phainis Godman, 1900 (type locality Mexico: Veracruz; Guatemala and Costa Rica). Sequencing of two P. sobrinus syntypes revealed that they are not even in the same genus with P. phainis (Fig. 14). In genitalia, uncus arms are long and wide apart in P. phainis, but are small and close together in P. sobrinus. Our genomic tree demonstrates that P. sobrinus belongs to a new genus named above. Therefore, we propose Rectava sobrinus (Schaus, 1902), reinstated status, new combination.

Nastra subsordida (Mabille, 1891), reinstated status, new combination

Pamphila subsordida Mabille, 1891 (type locality Honduras) has been considered a junior subjective synonym of Eutychide asema (Mabille, 1891) (type locality Honduras) by Evans (1955). Above, we placed E. asema in Adlerodea Hayward, 1940 (type species Adlerodea modesta Hayward, 1940). Sequencing of the P. subsordida holotype in the ZMHB collection (NVG-15035E09) reveals that it is a species-level taxon sister to Nastra leucone (Godman, 1900) (type locality Guatemala) (Fig. 14). Elongated, yellow-brown wings, even paler and unspotted below agree with this placement and refute Evans’ synonymy with A. asema, which is darker reddish-brown and typically with several black dots in postdiscal area on hindwing below. Hence, we reinstate Nastra subsordida (Mabille, 1891) as a species. Because the N. subsordida holotype lacked abdomen at least since the times of Godman and Salvin (1900a), genomic analysis is particularly important to reveal its true identity.

Papias trimacula Nicolay, 1973 is a junior subjective synonym of Nastra subsordida (Mabille, 1891)

Genomic sequencing of the Papias trimacula Nicolay, 1973 (type locality Panama: Canal Zone) holotype in the AMNH collection reveals its close relationship with the holotype of Nastra subsordida (Mabille, 1891) (type locality Honduras) (Fig. 14) and implies that P. trimacula belongs to Nastra Evans, 1955 (type species Hesperia lherminier Latreille, [1824]). Holotypes of P. trimacula and N. subsordida are similar phenotypically, and only differ in the lack of yellow spots in the latter. Inspection of several specimens identified as Papias trimacula reveals that the development of yellow spots is variable and they may be lacking. COI barcodes of the two holotypes differ by only 0.3% (2 bp). Therefore, we propose that Papias trimacula Nicolay, 1973 is a junior subjective synonym of Nastra subsordida (Mabille, 1891).

Nastra celeus (Mabille, 1891) and Nastra nappa (Evans, 1955), new combinations

Cyclopides celeus Mabille, 1891 (type locality Brazil: Para) currently in Vehilius Godman, 1900 (type species Cobalus illudens Mabille, 1891, currently a subspecies of Pamphila stictomenes Butler, 1877) and Vidius nappa Evans, 1955 (type locality Brazil: Parana) kept in Vidius Evans, 1955 (type species Narga vidius Mabille, 1891) are placed within Nastra Evans, 1955 (type species Hesperia lherminier Latreille, [1824]) in genomic trees and are not monophyletic with the type species of either Vehilius or Vidius (Fig. 14). Therefore new genus-species combinations for them are: Nastra celeus (Mabille, 1891) and Nastra nappa (Evans, 1955).

Vehilius warreni (Weeks, 1901), new combination

Currently in Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865), Pamphila warreni Weeks, 1901 (type locality Bolivia) is not monophyletic with it, and instead originates within Vehilius Godman, 1900 (type species Cobalus illudens Mabille, 1891, a subspecies of Pamphila stictomenes Butler, 1877) (Fig. 14), where it is transferred to form Vehilius warreni (Weeks, 1901), new combination.

Vehilius limae (Lindsey, 1925), new combination

Megistias limae Lindsey, 1925 (type locality Peru: Lima) placed in Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865) by Evans (1955) is sister to the clade with the type species of Vehilius Godman, 1900 (Cobalus illudens Mabille, 1891, currently a subspecies of Pamphila stictomenes Butler, 1877) and is not monophyletic with C. tripunctus (Fig. 14). Therefore, we establish a new combination Vehilius limae (Lindsey, 1925).

Cymaenes lumina (Herrich-Schäffer, 1869), new combination

Genome-based phylogenetic analysis of the Cobalus lumina Herrich-Schäffer, 1869 (type locality not specified) syntype in the ZMHB collection (NVG-18043C06) places it within the Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865) clade and away from Lerema Scudder, 1872 (type species Papilio accius J. E. Smith, 1797), where C. lumina has been placed previously (Fig. 14). We confirm this specimen, lacking the head, abdomen, right forewing and part of the right hindwing as a syntype, because it is from the Herrich-Schäffer collection according to its label, agrees with the original description of C. lumina, curated as the type and bears a label “lumina” in handwriting similar to that on the labels of many Herrich-Schäffer type specimens. The description is given as a key to species, and for C. lumina it states on page 203: “US der Hfl mit scharf licht zackig begrenztem dunklerem MBand” (Herrich-Schäffer 1869), which can be translated literally as “Underside of the hindwing with sharp light jagged outlined darker middle band” (i.e., ventral hindwing with a darker middle band sharply outlined by jagged pale areas), which matches the syntype very well, but does not agree with many specimens currently identified as this species. Furthermore, lumina #65 is placed in the key next to asella #66 (a junior subjective synonym of Amblyscirtes alternata (Grote and Robinson, 1867)), a species with rounded wing shape similar to the lumina syntype (wings are more elongated in Lerema). A syntype of Cobalus asella Herrich-Schäffer, 1869 is also in the ZMHB collection and bears labels similar to those of the C. lumina syntype. Therefore, we are convinced that the sequenced specimen (NVG-18043C06) is indeed a syntype of C. lumina, that N.V.G. hereby designates as the lectotype to stabilize the usage of this name, and hence we propose the new combination Cymaenes lumina (Herrich-Schäffer, 1869). The lectotype is in the ZMHB collection, it lacks the right forewing, head and abdomen and bears the following seven labels ∥ Origin. ∥ lumina ∥ Coll. H.—Sch. ∥ Coll. | Staudinger ∥ Lumina | H-Sch. | Micylla Burm. ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 44a05a ∥ DNA sample ID: | NVG-18043C06 | c/o Nick V. Grishin ∥.

Lerema pattenii Scudder, 1872, reinstated status, with Pamphila bipunctata Mabille, 1889 and Sarega staurus Mabille, 1904 as its junior subjective synonyms

Inspection of photographs of Lerema pattenii Scudder, 1872 (type locality Guatemala) holotype (MCZ collection) currently considered a junior subjective synonym of Lerema accius (J. E. Smith, 1797) reveals striated hindwing below and the presence of a white subapical spot in cell R2-R3 by the forewing apex. The latter character, according to Evans (1955: 163), is diagnostic of Lerema lumina and is not found in L. accius. We have not seen a striated hindwing pattern in L. accius specimens either. Therefore, L. pattenii is not L. accius, but it keys to L. lumina in Evans (1955). As we have shown above, Cobalus lumina Herrich-Schäffer, 1869 belong to Cymaenes. The C. lumina lectotype lacks white dashes along costa near forewing apex below and subapical white spot in forewing space 9 (i.e., cell R2-R3) and thus does not key out to “L. lumina” in Evans (1955). Hence, the senior synonym of Evans’ “L. lumina” would be the name for it. Pamphila bipunctata Mabille, 1889 (type locality Panama) and Sarega staurus Mabille, 1904 (type locality Colombia) are currently listed as synonyms of Evans’ “L. lumina” (Mielke 2005). However, L. pattenii was published in 1872, prior to both of them, and therefore we reinstate it as a species.

Sequencing of the P. bipunctata syntype in the ZMHB (NVG-15035G01) confirms that it belongs to Lerema Scudder, 1872 (type species Papilio accius J. E. Smith, 1797) and not to Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865), because it is sister to the type species of Lerema, and Cymaenes species are in a different clade (Fig. 14). This analysis confirms that Pamphila bipunctata cannot be a synonym of Cymaenes lumina, because they belong to different and distantly related genera. Instead, we find that in wing patterns, both P. bipunctata and S. staurus agree closely with L. pattenii and we propose to treat the former two taxa as junior subjective synonyms of the latter.

Hesperia aethra Plötz, 1886 is a junior subjective synonym of Lerema lineosa (Herrich-Schäffer, 1865)

Hesperia aethra Plötz, 1886 (type locality Suriname) was treated as a synonym of Morys compta (Butler, 1877) (type locality Brazil: Para) by Evans (1955). Genomic analysis places the H. aethra syntype in the ZMHB with Lerema lineosa (Herrich-Schäffer, 1865) (type locality Brazil) (Fig. 14). Their COI barcodes are only 0.15% (1 bp) different, and the specimens are phenotypically similar, being rather pale below with more diffuse vague spots on hindwing compared to darker M. compta with spots frequently more defined. Therefore, we propose that Hesperia aethra Plötz, 1886 is a junior subjective synonym of Lerema lineosa (Herrich-Schäffer, 1865).

Cobalopsis valerius (Möschler, 1879), new combination and Morys ancus (Möschler, 1879), reinstated status, new combination

Genomic sequencing of the holotype of Apaustus valerius Möschler, 1879 (type locality Colombia, NVG-15035E03, in the ZMHB) places it among species of Cobalopsis Godman, 1900 (type species Pamphila edda Mabille, 1891, which is junior subjective synonym of Hesperia autumna Plötz, 1882) (Fig. 14), and therefore we therefore propose Cobalopsis valerius (Möschler, 1879), new combination. This leaves a taxon known as “Morys valerius valerius” in Evans (1955) without a name. However, a syntype of Pamphila ancus Möschler, 1879 (type locality Colombia, NVG-15036E08) in the ZMHB, currently treated as a junior subjective synonym of Cymaenes tripunctus theogenis (Capronnier, 1874), was clustered with specimens identified as “M. v. valerius” sensu Evans, providing an available name for this species (Fig. 14). Furthermore, P. ancus agrees with Evans’ characters given for “ M. v. valerius” better than the A. valerius holotype: for example, paler general appearance, ventral forewing with a violet sheen near apex, a well-defined opaque spot in forewing cell CuA2-1A+2A (Ib in Evans’ notation), and forewing apical spots are closer to being along a single line. Therefore, we reinstate Morys ancus (Möschler, 1879), new combination, as a species. This is the species Evans identified as “Morys valerius valerius”. Below, we confirm that M. ancus is not conspecific with Morys valda Evans, 1955 described originally as Morys valerius valda, and propose to treat Morys as a subgenus of Lerema Scudder, 1872.

Morys valda Evans, 1955 confirmed status, is the type species of Morys Godman, 1900

Proposed for a single species Apaustus valerius Möschler, 1879 (type locality Colombia), genus Morys Godman, 1900 was diagnosed among other characters by genitalia agreeing with those of Morys valda Evans, 1955, figured “from Mexican examples” (Godman and Salvin 1900a). Godman’s descriptions of Morys and A. valerius do not apply to Cobalopsis, the genus to which A. valerius belongs (see above). Therefore, it is apparent that Godman incorrectly associated the holotype of A. valerius, which is a female of Cobalopsis (see above), with specimens of a taxon later named Morys valerius valda by Evans and elevated to species by Llorente et al. (1990). Due to genetic differences, for example, COI difference 2.7% (18 bp) we confirm the species status of M. valda. Thus, Godman’s application of the name A. valerius to these specimens is a misidentification. To secure the applicability of Godman’s description and ensure stability in continuing usage of the genus name, under Article 70.3.2. of the ICZN Code we fix the type species of Morys as Morys valda Evans, 1955, misidentified as Apaustus valerius Möschler, 1879 in the original description of the genus Morys (type species by monotypy) by Godman in Godman and Salvin (1900a). Below, we propose to treat Morys as a subgenus of Lerema Scudder, 1872.

Pamphila compta Butler, 1877 is the type species of Euroto Godman, 1900

Evans (1955) noted that Godman incorrectly synonymized Pamphila geisa Möschler, 1879 (type locality Colombia) with Pamphila compta Butler, 1877 (type locality Brazil: Para). (Godman and Salvin 1900a); the latter selected as the type species of Euroto Godman, 1900. Judging from Godman’s text, he considered all Euroto Godman, 1900 with well-defined hyaline spots on forewings to be P. compta. This concept included both better-patterned specimens of P. compta, and also P. geisa. Among other species Godman placed in Euroto, E. micythus Godman, 1900 (type locality Mexico: Guerrero and Tabasco and Costa Rica), is a close relative of the true P. compta (Fig. 14), and shares similar genitalia, but lacks hyaline spots. Godman’s description of the genus applies to all these species. Since Evans (1955), Euroto has been treated as a junior subjective synonym of Morys Godman, 1900 (type species Morys valda Evans, 1955), and P. compta is known as its type species. To preserve this treatment, and acknowledging that Godman considered P. compta and P. geisa to be conspecific (i.e., he partly misidentified P. compta and even illustrated P. geisa as P. compta), under Article 70.3.1. of the ICZN Code we fix the type species of Euroto as Pamphila compta Butler, 1877, i.e., the nominal species previously cited as the type species, which is the default choice, and not Pamphila geisa Möschler, 1879 that was additionally included in Godman’s concept of P. compta.

Megistias miaba Schaus, 1902 is a junior subjective synonym of Cobalopsis valerius (Möschler, 1879)

In the genomic tree, Megistias miaba Schaus, 1902 (type locality not specified) specimens, including its syntype (NVG-18116A03 in the USNM), which is currently treated as a valid species in the genus Cobalopsis Godman, 1900 (type species Pamphila edda Mabille, 1891, which is junior subjective synonym of Hesperia autumna Plötz, 1882) cluster closely with the holotype of Cobalopsis valerius (Möschler, 1879) (type locality Colombia, NVG-15035E03, in the ZMHB) (Fig. 14) and the COI barcodes of these primary type specimens are 99.8% identical (1 bp difference). Therefore, we propose that Megistias miaba Schaus, 1902 is a junior subjective synonym of Cobalopsis valerius (Möschler, 1879).

Cobalopsis dictys (Godman, 1900), new combination

Currently in Papias Godman, 1900 (type species Pamphila integra Mabille, 1891), P. dictys Godman, 1900 (type locality Mexico: Veracruz, Guatemala, Costa Rica, Panama) is not monophyletic with it and instead originates within Cobalopsis Godman, 1900 (type species Pamphila edda Mabille, 1891, which is a junior subjective synonym of Hesperia autumna Plötz, 1882) (Fig. 14), implying Cobalopsis dictys (Godman, 1900), new combination.

Cobalopsis zetus (Bell, 1942), reinstated status

Considered a junior subjective synonym of Cobalopsis nero (Herrich-Schäffer, 1869) (type locality not given) by Mielke and Casagrande (2002), Cobalus zetus Bell, 1942 (type locality Mexico: Guerrero) is not monophyletic with it (Fig. 14). We sequenced the holotype of C. zetus (NVG-18027A08) in AMNH and syntypes of the following taxa in the ZMHB: Hesperia autumna Plötz, 1882 (type locality [Panama: Veragua], NVG-15035A06) and Pamphila edda Mabille, 1891 (type locality Panama: Chiriqui, NVG-15035D09), the latter taxon treated by Evans (1955) as a junior subjective synonym of the former (which we confirm), C. nero (NVG-15034H09) and Carystus dyscritus Mabille, 1891 (type locality Colombia, NVG-15035D11) in the ZMHB, the latter taxon treated by Evans (1955) as a junior subjective synonym of the former (which we confirm). Their phylogenetic analysis reveals that C. zetus is sister to C. autumna, and C. nero is sister to them both (Fig. 14). Genomic analysis agrees with phenotypes of these specimens: C. zetus holotype keys out to C. autumna in Evans (1955: 159) due to brown ventral hindwing, vs. grayer hindwing in C. nero. Therefore, not willing to take the next step and prematurely synonymize C. zetus with C. autumna, we reinstate it as a species, a hypothesis to be tested in future work.

Morys Godman, 1900 is a subgenus of Lerema Scudder, 1872

Morys Godman, 1900 (type species Morys valda Evans, 1955) clusters closely with Lerema Scudder, 1872 (type species Papilio accius J. E. Smith, 1797) in genomic trees and is paraphyletic (Fig. 14). Genetic closeness of the two genus-group taxa is reflected in COI barcodes of their type species differing by only 6.8% (45 bp). Being combined, Morys with Lerema form a more prominent genus than either of them separately. For these reasons, we propose to treat Morys Godman, 1900 as a subgenus of Lerema Scudder, 1872.

Lerema etelka (Schaus, 1902) reinstated status, new combination, with Phanis sylvia Kaye, 1914 as its junior subjective synonym

Euroto etelka Schaus, 1902 (type locality Trinidad) is listed as a junior subjective synonym of Pamphila geisa Möschler, 1879 (type locality Colombia) (Mielke 2005). Sequencing syntypes of P. geisa (NVG-15035F08) in the ZMHB and E. etelka (NVG-18113E06) in the USNM suggests that they are distinct species due to substantial genetic differentiation between them (Fig. 14): for example, their COI barcodes differ by 5.3% (34 bp). Furthermore, genomic level phylogeny that includes syntypes of Euroto lyde Godman, 1900 (type locality Mexico: Veracruz and Tabasco, Guatemala, and Costa Rica, NVG-21013E01 and E02 in the CMNH) among other specimens reveals that E. etelka is not monophyletic with Lerema geisa, new combination, but is sister to the clade formed by L. geisa and Lerema lyde, new combination (Fig. 14). Therefore, we reinstate Lerema etelka (Schaus, 1902), reinstated status, new combination, as a species and place Phanis sylvia Kaye, 1914 (type locality Trinidad), currently a junior subjective synonym of L. geisa, as its junior subjective synonym. Finally, we confirm the species status of L. lyde (Godman, 1900) (type locality Mexico, Guatemala and Costa Rica) (Fig. 14) as suggested by Lewis (1973) and reinforced by Llorente et al. (1990), instead of placing this taxon as a subspecies of L. geisa adopted by some authors (Evans 1955; Mielke 2005). The COI barcode difference between the two taxa 2.9% (19 bp).

Sequencing of a female specimen in the USNM collection (NVG-19021F01) bearing labels ∥ Phanis | cumbre | Sch ∥ Type | No. 6026 | U.S.N.M. ∥, the first one in Schaus’ handwriting, reveals that it is L. etelka. We do not consider this specimen a paralectotype of Phanis cumbre (type locality Brazil: Rio de Janeiro, Petropolis, lectotype designated by Dolibaina et al. (2014)) despite it being identified as this species by Schaus, because only “male” is mentioned and “Petropolis, Brazil” is given as the only locality for P. cumbre in the original description (Schaus 1902), but this specimen is a female from “Tijuca, Brazil” according to its label.

Geia Grishin, new subgenus

http://zoobank.org/5A5B8B19-3484-4D04-BD77-742B9B52167F

Type species.

Pamphila geisa Möschler, 1879.

Definition.

Previously placed in Morys Godman, 1900 (type species Morys valda Evans, 1955), but not monophyletic with it, being sister to both Morys and Lerema Scudder, 1872 (type species Papilio accius J. E. Smith, 1797) (Fig. 14), and therefore is a subgenus distinct from them (above, we placed Morys as a subgenus of Lerema). Keys to J.40.3 in Evans (195). Distinguished from its relatives by the following combination of characters: forewing in males with a long single brand under vein CuA2 and a brand above vein CuA2 between the origins of veins CuA1 and CuA2; arms of both gnathos and uncus widely separated at their origins, thin, longer than a wide and short (about half of its width in length) tegumen; harpe long and narrow (at least thrice its height in length), hook-like. In DNA, a combination of the following base pairs is diagnostic: aly1454.7.7:T433A, aly1454.7.7:C434G, aly862.12.2:A1488G, aly997.9.7:G200C, and aly997.9.7:A199T.

Etymology.

The name is a feminine noun in the nominative singular formed from the type species name Gei[s]a.

Species included.

The type species, Euroto lyde Godman, 1900 and Euroto etelka Schaus, 1902.

Parent taxon.

Lerema Scudder, 1872.

Lerema (Morys) venias (Bell, 1942), new combination

Papias venias Bell, 1942 (type locality Venezuela) was placed in Cobalopsis Godman, 1900 (type species Pamphila edda Mabille, 1891, which is junior subjective synonym of Hesperia autumna Plötz, 1882) by Evans (1955) who inspected no specimens of this taxon. Genomic sequencing of P. venias holotype (NVG-18026H11) in AMNH reveals that it is sister to Lerema (Morys) compta (Butler, 1877) specimen from Guyana (Fig. 14): COI barcode difference between them is 1.7% (11 bp). Therefore, we confidently place P. venias in the genus Lerema Scudder, 1872 (type species Papilio accius J. E. Smith, 1797) in the subgenus Morys Godman, 1900 (type species Morys valda Evans, 1955). Then, not willing to err on synonymizing P. venias with L. compta, due to some degree of genetic differentiations, we tentatively treat it as a distinct species Lerema (Morys) venias (Bell, 1942), new combination.

Contrastia Grishin, new genus

http://zoobank.org/97587565-2593-473F-83D0-0C41CA0EEB7E

Type species.

Hesperia distigma Plötz, 1882.

Definition.

Previously placed in Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865), but is not monophyletic with its type species and instead forms a clade with Papias Godman, 1900 (type species Pamphila integra Mabille, 1891) and Vehilius Godman, 1900 (type species Cobalus illudens Mabille, 1891, currently a subspecies of Pamphila stictomenes Butler, 1877) (Fig. 14). Keys to J.27.12 in Evans (1955). Morphologically is similar to Cymaenes, particularly in the shape of valvae with harpe convex along distal margin, and long saccus, not shorter than valva; but distinguished by much narrower, not deeply divided uncus and lilac-colored broad areas on wings below. In DNA, a combination of the following base pairs is diagnostic: aly1547.3.3:A160C, aly2513.1.1:C97T, aly361.1.1:G42A, aly361.1.1:A47G, and aly2954.5.2:A838C.

Etymology.

The name is a feminine noun in the nominative singular, given for the contrasting pattern (dark top, pearly-lilac bottom) of the type species in its resting pose.

Species included.

Only the type species.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Neotype designation for Hesperia distigma Plötz, 1882

While designated as the type species of Contrastia new genus, Hesperia distigma Plötz, 1882 (type locality not specified), is not currently defined by known type specimens, and the possibility of misidentification by the subsequent authors after its original description is conceivable. Diagnostic characters of H. distigma assembled and translated from the original description given as a key are: upper side black; forewing reddish-gray beneath before the apex, without dots at the apex, in cell 1 (CuA2-1A+2A) with a white dot, in cells 2 (CuA1-CuA2) and 3 (M3-CuA1) with white hyaline spots, discal cell unspotted; hindwing beneath completely or partly reddish, “watered” brown, in the costal half darker, in the discal cell and in cells 1c (CuA2-1A+2A), 2 (CuA1-CuA2) and 3 (M3-CuA1) with white spots; forewing length 14 mm (Plötz 1882b). Inspection of the Godman’s copy of the unpublished Plötz’s drawing of H. distigma (no. 488) in the Library of the Natural History Museum London, UK additionally reveals a yellower area along the anal margin on ventral hindwing of a specimen that agrees with the original description. As for the type locality, Plötz’s statement is translated as “Fatherland ?”, which means it is unknown.

Armed with this original information about H. distigma, we carried out a search for its type specimens in collections known to house Plötz’s types. A particular emphasis was on the Museum für Naturkunde, Berlin, Germany (ZMHB), because the original description stated “Distigma HS. i. l.”, meaning that the name originated from Herrich-Schäffer, likely proposed on the basis of a specimen in his collection, which for the large part is in the ZMHB. Careful search of all Hesperiidae drawers revealed only one specimen that generally agreed with the Plötz’s description and drawing of H. distigma. Judging from its labels, this specimen is from the Herrich-Schäffer collection, and is apparently a female syntype of Cobalus stigmula Mabille, 1891 (sequenced as NVG-18052D05), currently a junior subjective synonym of H. distigma. As H. distigma, this specimen is from unknown locality, and it is even conceivable that it is a syntype of H. distigma. However, in addition to ventral hindwing white spots in discal cell and cells 1c (CuA2-1A+2A), 2 (CuA1-CuA2), and 3 (M3-CuA1) (as mentioned in the original description and illustrated in the drawing) it also has a rather well developed white spot in cell 6 (RS-M1), not mentioned in the description and not pictured in the drawing. Judging from his descriptions and illustrations, Plötz paid careful attention to the number of spots in specimens, and therefore, this is probably not the specimen illustrated as H. distigma. It seems impossible to confirm it as a syntype of H. distigma, while we confirm it as a syntype of C. stigmula.

Search for possible H. distigma syntypes in Zoologische Staatssammlung München, Germany (ZSMC) and Universität Greifswald (EMAU), the two other collections housing Plötz’s primary specimens, failed to find them. Therefore we assumed that the type material of H. distigma was lost or unrecognizable, and we proceeded with a neotype designation. There is an exceptional need to designate neotype of H. distigma, because it is the type species of a newly proposed genus, and the absence of the primary type specimen creates a potential for future instability of nomenclature. To define the genus Contrastia, new genus objectively, it is necessary to have a primary type specimen of its type species. To achieve this goal, N.V.G. designates a female syntype of Cobalus stigmula Mabille, 1891, NVG-18052D05, as the neotype of Hesperia distigma Plötz, 1882 (see label data of this specimen below). This specimen is from unknown locality and has a forewing length 13.5 mm. This specimen is used in our genomic tree (Fig. 14) to delineate the genus Contrastia, new genus.

Our neotype of H. distigma satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Hesperia distigma Plötz, 1882, which remains unsettled; 75.3.2. The characters for the taxon have been given in its original description by Plötz (1882b: 28) and are listed above; 75.3.3. The neotype specimen, which N.V.G. also designates as the lectotype of Cobalus stigmula Mabille, 1891 to stabilize nomenclature, bears the following labels (on two labels, the name appears to be misspelled as “stigmala”): ∥ Typus ∥ Stigmula m ∥ Coll. H.—Sch ∥ Stigmala | HS. ∥ Pamph. | Stigmala HS. | in litt. ∥ Coll. | Staudinger ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 44a0c8 ∥ DNA sample ID: | NVG-18052D05 | c/o Nick V. Grishin ∥, additionally recognized by a long tear along vein 1A+2A in the right hindwing; 75.3.4. Our search for the syntypes is described above, it was not successful, and we consider that the specimens composing the type series of H. distigma are either lost or unrecognizable; 75.3.5. As detailed above, the neotype is consistent with the original description of this taxon (with a single discrepancy: extra white spot in ventral hindwing cell 6 (RS-M1), but its expression is variable, and the spot is missing in at least one specimen of this species in BMNH collection) and a copy of an unpublished illustration by the author of the name; 75.3.6. The neotype is from unknown locality, and the original description also does not specify the type locality, which is likely to be in SE Brazil, and will later be detailed by genomic comparison of sequenced specimens across the distribution of this species (Cong et al. 2021); 75.3.7. The neotype is in the collection of the Museum für Naturkunde, Berlin, Germany (ZMHB). As a result of the lectotype and neotype designations presented here, Cobalus stigmula Mabille, 1891 becomes a junior objective synonym of Hesperia distigma Plötz, 1882.

Carystus odilia Burmeister, 1878, Pamphila trebius Mabille, 1891 and Megistias corescene Schaus, 1902 are junior subjective synonyms of Cymaenes lumina (Herrich-Schäffer, 1869)

Sequencing of syntypes of Pamphila trebius Mabille, 1891 (type locality Colombia: Bogota, NVG-15034E04), Cobalus lumina Herrich-Schäffer, 1869 (type locality not specified, NVG-18043C06), both in the ZMHB, and Megistias corescene Schaus, 1902 (type locality Brazil: Parana, NVG-18113D03) in the USNM reveals that they are closely grouped with specimens identified as Cymaenes odilia odilia (Burmeister, 1878) (type locality Argentina) from South Brazil and Paraguay (Fig. 14). These specimens do not cluster in the tree by their names but are intermixed with low statistical support for any of their grouping within their overall clade that is strongly supported. COI barcodes of the abovementioned syntypes of the three taxa are identical and the specimens are phenotypically similar. Therefore, we suggest that these four taxa are conspecific, and by the priority of names place Carystus odilia Burmeister, 1878, Pamphila trebius Mabille, 1891 and Megistias corescene Schaus, 1902 as junior subjective synonym of Cymaenes lumina (Herrich-Schäffer, 1869). The remaining puzzle is the locality of the P. trebius syntype, stated as “Bogota” [Colombia] on it label. By DNA, the syntype groups with specimens from southern South America (Fig. 14), and its wing pattern, i.e., prominent and wide brown discal hindwing patch below and the lack of submarginal darkening are characteristic of them rather than of specimens that belong to this species group that we have seen from Colombia.

Cymaenes isus (Godman, 1900), reinstated status

Treated by Evans (1955) as a junior subjective synonym of Cymaenes trebius (Mabille, 1891) (type locality Colombia: Bogota), Megistias isus Godman, 1900 (type locality Mexico, Guatemala, Nicaragua, Costa Rica, Venezuela and Guyana) may become the senior name for this species after we have shown above that Pamphila trebius Mabille, 1891 is a junior subjective synonym of Cymaenes lumina (Herrich-Schäffer, 1869). Cymaenes trebius was misidentified by Evans (1955), because its syntype specimen in the ZMHB (NVG-15034E04) actually (and correctly) keys out to “Sub-sp. odilia” by its characters. i.e. on its hindwing below “grey suffusion along the termen reaches to the discal [pale] band” (Evans 1955: 133), and specimens from North America that key to Evans’ “Sub-sp. trebius” are in a different from the P. trebius syntype clade of Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865) in the genomic tree (Fig. 14). Indeed, Evans identified all the North American syntypes of M. isus in the BMNH collection as “Sub-sp. trebius” and no other name except M. isus can be applied to this species. Therefore, we reinstate Cymaenes isus (Godman, 1900) as a species-level taxon. Phylogenetic analysis reveals that C. isus is sister to the type species of the genus, C. tripunctus (type locality Cuba) (Fig. 14). The type series of C. isus includes specimens from South America that represent a taxon different from North America specimens. To promote stability of nomenclature and follow Evans (1955) who listed the type locality of C. isus as “Mexico”, in addition to the original author of the taxon Godman (Godman and Salvin 1900b) who illustrated specimens from Mexico, thus giving them more weight in the description, N.V.G. hereby designates one of these illustrated specimens, the male in BMNH collection that is already curated as “the type” with the following labels ∥ Type / H 2222 ∥ Type | H. T. ∥ Venta de Zopilote, | Guerrero, 2800 ft. | Oct. H. H. Smith ∥ ♂ ∥ Sp. figured. ∥ B. C. A. Lep. Rhop. | Megistias | isus, | Godm. ∥ Godman-Salvin | Coll. 1914.–5 ∥ as the lectotype of Megistias isus Godman, 1900. The type locality of C. isus thus becomes Mexico: Guerrero, 22 km N of Chilpancingo, nr. southern end of the Canon de Zopilote at 2800 ft elevation, approximate GPS 17.77, −99.53, as detailed by Selander and Vaurie (1962), who researched the localities used by Godman and Salvin.

Cymaenes edata (Plötz, 1882), reinstated status

Hesperia edata Plötz, 1882 (type locality Venezuela: La Guaira) was treated by Evans (1955) as a subspecies of Cymaenes odilia (Burmeister, 1878) (type locality Argentina), but it is not monophyletic with it. As we have shown above, C. odilia is a junior subjective synonym of Cymaenes lumina (Herrich-Schäffer, 1869) (Fig. 14). Instead, in the genomic tree, C. o. edata is sister to Cymaenes isus (Godman, 1900) (type locality Mexico: Guerrero). Therefore, we reinstate Cymaenes edata (Plötz, 1882) as a species. With this action, and pending further studies, we follow Llorente et al. (1990) in considering North American C. isus (formerly C. trebius) a species distinct from South American C. edata (formerly within C. odilia).

Hesperia phocylides Plötz, 1882 is a junior subjective synonym of Cymaenes edata (Plötz, 1882)

Following the hypothesis of Godman (1907), who suggested that was “probably a small ♀ of Lerema accius” (J. E. Smith, 1797) (type locality USA: Georgia), Hesperia phocylides Plötz, 1882 (type locality Venezuela: La Guaira) is currently treated as a junior subjective synonym of L. accius (Mielke 2005). However, inspection of copies of Plötz’s unpublished drawings (no. 578 for H. phocylides) in the library of the Natural History Museum, London, revealed that the wing pattern of H. phocylides does not agree with that of L. accius. Namely, hindwing below has a broad middle pale band through the discal cell, also expressed in cell Sc+R1-RS as a wide rectangular spot, which is narrow in L. accius, but the brown discal band is narrow in contrast to broader band in L. accius. However, the illustration of H. phocylides is an excellent match to Cymaenes edata (Plötz, 1882) (type locality Venezuela: La Guaira) specimens from Venezuela. Both phocylides and edata have the same type locality and due to phenotypic similarities we suggest, acting as first reviser (ICZN Code Art. 24), that Hesperia phocylides Plötz, 1882 is a junior subjective synonym of C. edata. Both taxa were proposed in the same work issued on the same date (Plötz 1882b), and we give priority to the name edata, because this name is currently used as valid, but phocylides has been placed in synonymy (although with a wrong taxon) by the suggestion of Godman (1907) since Draudt (1923b).

Cymaenes miqua (Dyar, 1913), reinstated status and Cymaenes aequatoria (Hayward, 1940), new status

Lerema miqua Dyar, 1913 (type locality Peru: San Miguel) and Lerodea aequatoria Hayward, 1940 (type locality Ecuador) placed as subspecies of Cymaenes odilia (Burmeister, 1878) (type locality Argentina) (Mielke 2005) are not monophyletic with it, but instead are sisters to each other forming a separate clade near the base of Cymaenes Scudder, 1872 (type species Cobalus tripunctus Herrich-Schäffer, 1865) (Fig. 14). We sequenced the holotype of L. miqua (NVG-17102E10) in the USNM and the holotype of L. aequatoria (NVG-15104C10) in AMNH. The 4.1% (27 bp) difference in their COI barcodes coupled with phenotypic differences detailed by Evans (1955) suggest that they are species-level taxa: Cymaenes miqua (Dyar, 1913), reinstated status and Cymaenes aequatoria (Hayward, 1940), new status. In agreement with Mielke (2005), we leave Cymaenes odilia pacer Evans, 1955 (type locality Peru: Limbani) as a junior subjective synonym of C. miqua due to phenotypic similarities and relative geographic proximity.

Vehilius labdacus (Godman, 1900), reinstated status

North American specimens identified as Vehilius inca (Scudder, 1872) (type locality Peru) formed a prominent cluster distinct from South American specimens (Fig. 14) and thus are a distinct species. Available name for this species is Megistias labdacus Godman, 1900 (type locality Mexico: Guerrero, Morelos, Veracruz; Guatemala; Nicaragua and Costa Rica), which we reinstate from synonymy with V. inca as Vehilius labdacus (Godman, 1900), reinstated status, a combination already proposed by Lewis (1973).

Pamphila xenos Mabille, 1898 is a junior subjective synonym of Vehilius inca (Scudder, 1872)

Currently placed in Lerodea Scudder, 1872 (type species Hesperia eufala Edwards, 1869), Pamphila xenos Mabille, 1898 (type locality Bolivia: Tanampaya) is not monophyletic with it, but instead the two syntypes in the ZMHB we sequenced group within Vehilius inca (Scudder, 1872) (type locality Peru) and are conspecific with it (Fig. 14). Therefore, Pamphila xenos Mabille, 1898 is a junior subjective synonym of Vehilius inca (Scudder, 1872).

Lerodea sonex Grishin, new species

http://zoobank.org/86F96C45-03DE-4776-A24A-2CDEB659E1AD

Definition.

Evans (1955) misidentified Pamphila xenos Mabille, 1898 (type locality Bolivia: Tanampaya), which as we show above is Vehilius inca (Scudder, 1872) (type locality Peru), and the species Evans called “Lerodea xenos” is now left without a name, which is given here. The description of this species is given by Evans (1955: 394) and it keys to N.3.2. Diagnosed by a bifid, crab claw-like harpe with equal length parallel to each other processes. Identified by variegated pattern on hindwing; forewing cell spots (if present) not in line with spot in cell CuA1-CuA2; fringes not checkered, mostly whitish, except on apical half of forewing; forewing below with pale violet triangular area along the margin, wider in the middle; hindwing below variegated pale violet, with small discal pale spots in some specimens and mostly brown wing segment by anal margin. The holotype is a female from Peru: Cuzco, Cosnipata Valley, Waykecha, elevation 2835 m, GPS −13.177500, −71.603889, collected on 19 August 2009 by Brian Harris, illustrated in Fig. 12o,p and deposited in the Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru (MUSM). The four males from the Evans’ series in the Natural History Museum, London, UK (BMNH) are paratypes, from Peru: Carabaya, Limbani and Agualani.Additional paratypes, 9♂♂ and 13♀♀ from Peru: Huánuco, Junín, Huancavelica, Apurímac, and Cuzco are in MUSM. Type identification labels will be mailed to curators of these collections to be placed on these specimens.

Etymology.

The name of the species is a reversed word xenos, and it is a noun in apposition.

Mnasilus Godman, 1900 is a junior subjective synonym of Papias Godman, 1900

A monotypic genus Mnasilus Godman, 1900 was proposed for Mnasilus penicillatus Godman, 1900 (type locality Mexico, Guatemala, Panama and Brazil), which is currently a junior subjective synonym of Pamphila allubita Butler, 1877 (type locality Brazil: Para). In the genomic trees (Fig. 14), Mnasilus is sister to the clade consisting of several species of Papias Godman, 1900 (type species Pamphila integra Mabille, 1891), such as Papias phainis Godman, 1900 (type locality Mexico: Veracruz) and Papias projectus Bell, 1942 (type locality Ecuador) among others. In turn, they together are sister to the clade with the type species of Papias (Fig. 14). To restore the monophyly of Papias, we can either propose a new genus for the sister clade of Mnasilus, or include Mnasilus in Papias. We opt for the latter solution due to genetic similarities between these taxa. For instance, COI barcodes of Pamphila integra lectotype (NVG-15035E12) and Mnasilus allubita specimen from the type locality (NVG-19122C09) differ by 7.1% (47 bp), a divergence common for many congeners. Therefore, we propose to treat Mnasilus Godman, 1900 as a junior subjective synonym of Papias Godman, 1900.

Papias amyrna (Mabille, 1891), reinstated status and new combination

Genomic sequencing of the syntype of Pamphila amyrna Mabille, 1891 (type locality Venezuela: Porto Cabello, DNA sample NVG-15036F04) in the ZMHB collection reveals that it is separated from Papias [formerly Mnasilus] allubita (Butler, 1877), a species that P. amyrna was considered a junior subjective synonym of, at a level consistent with P. amyrna being a species-level taxon (Fig. 14). While COI barcodes of the P. amyrna syntype and P. allubita specimen from the type locality (NVG-19122C09) differ by 0.9% (6 bp), not sufficient on its own to support the species-level status of this taxon, P. amyrna lacks the tuft of long scales in the middle of dorsal forewing by its inner margin, which per Evans (1955) is characteristic of P. allubita. The two taxa are likely to be sympatric at least in Venezuela (Evans, 1955). The syntype of Cobalus umbrosus Mabille, 1883 (type locality not specified) in the BMNH collection (inspected), possesses the forewing scale tuft and therefore is not amyrna but P. allubita, in agreement with Evans (1955). Therefore, pending clarification of the identity of the two taxa with the primary type specimens still to be found: Cobalus evanidus Mabille, 1883 (type locality South America) and Hesperia zalma Plötz, 1886 (type locality Panama), which, following Evans (1955), currently are junior subjective synonyms of P. allubita, we reinstate Papias amyrna (Mabille, 1891) as a species.

Mnasilus guianae Lindsey, 1925 is a junior subjective synonym of Papias amyrna (Mabille, 1891)

Originally named in the genus Mnasilus Godman, 1900 (type species Mnasilus penicillatus Godman, 1900, a junior subjective synonym of Pamphila allubita Butler, 1877), Mnasilus guianae Lindsey, 1925 (type locality Guyana: Georgetown) was placed in the genus Nastra Evans, 1955 (type species Hesperia lherminier Latreille, [1824]) by Evans (1955), who suggested that it may even be a subspecies of Nastra neamathla (Skinner and Williams, 1923) (type locality USA: Florida) due to similarities in genitalia. However, we find that genitalia of guianae are much more similar to those of P. allubita, that N. neamathla, e. g. valva is deeply bilobed terminally, not indented as in N. neamathla. Moreover, a specimen from Guyana in AMNH collection identified as M. guianae following genitalic inspection (NVG-19043B01), was placed within the Papias [formerly Mnasilus] allubita clade, far removed from Nastra, and next to the lectotype of Pamphila amyrna Mabille, 1891 (type locality Venezuela) (Fig. 14). Both guianae and Pamphila amyrna come from neighboring countries, are phenotypically similar to each other and to P. allubita, including their genitalia, but lack the diagnostic for P. allubita tuft of long scales by forewing inner margin above (Evans 1955). The COI barcodes of Pamphila amyrna lectotype and the guianae specimen NVG-19043B01 differ by only 0.3% (2 bp). For these reasons, we place Mnasilus guianae Lindsey, 1925 in the genus Papias (Mnasilus being its junior subjective synonym) and suggest that it is conspecific with Papias amyrna (Mabille, 1891).

Papias latonia (Schaus, 1913), revised combination

Returned to its original genus by Evans (1955) and kept it in thus far, Cobalopsis latonia Schaus, 1913 (type locality Costa Rica, syntype NVG 18113G07 in the USNM) is in the same clade with the lectotype of Pamphila integra Mabille, 1891 (NVG-15035E12), the type species of Papias Godman, 1900, but is distant from Pamphila edda Mabille, 1891 (syntype NVG-15035D09 sequenced), the type species of Cobalopsis Godman, 1900 (Fig. 14). Therefore we transfer C. latonia to the genus Papias. Notably, C. latonia had been placed in Papias by Bell (1946), a treatment that has not caught on, although it appears to be correct. Finally, to stabilize nomenclature, N.V.G. designates a sole syntype in the USNM bearing the following six labels ∥ Nov ∥ JuanVinas | CR ∥ Collection | WmSchaus ∥ Cobalopsis | latonia | type Sch. ∥ Type | No. 11814 | U.S.N.M. ∥ ♂ genitalia | slide #1710 | W.D.F. 7-X-41 ∥ as the lectotype of Cobalopsis latonia Schaus, 1913. This syntype has expanse of 33 mm, exhibits more extensive spotting, as mentioned and illustrated in the original description (Schaus 1913), and is from “Juan Vinas” according to its label, a locality given first in the description. The second syntype, now paralectotype, in BMNH, from “Cachi” per its label, is larger (expanse of 35 mm) and darker. For example, the second apical forewing spot mentioned in the original description and obvious in the original illustration is not noticeable on dorsal surface of the paralectotype, and a row of five pale spots on ventral hindwing is poorly defined. Furthermore, paralectotype identification label in Schaus’ handwriting lacks the word “type” present on the label of lectotype. For these reasons, we conclude that it was the USNM syntype (now lectotype) that was illustrated, described, and considered “type” by Schaus, and not the BMNH syntype (now paralectotype), despite the statement “In British Museum” as the last line in the original description, published in the Proceedings of the zoological Society of London (Schaus 1913). Schaus mentions collecting these specimens during “a recent visit to Costa Rica”, and it is possible that due to the venue of publication, the original intent was to deposit the “type”, now the lectotype, in BMNH that never realized.

Papias integra (Mabille, 1891), reinstated status

Genomic trees reveal a prominent partitioning of specimens identified as Papias subcostulata (Herrich-Schäffer, 1870) (type locality Brazil) into two groups (Fig. 14). Phenotypically, these groups correspond to the two subspecies defined by Evans (1955): the nominotypical subspecies and Papias subcostulata integra Mabille, 1891 (type locality Honduras). Although Mielke and Casagrande (2002), who designated the lectotypes of integra and Hesperia infuscata Plötz, 1882 (type locality “Brazil” in the original description, but Suriname on the label of the lectotype), did not advocate the two Evans’ subspecies, our genomic comparison suggests that they are distinct species with H. infuscata being a junior subjective synonym of the nominal P. subcostulata, and P. s. integra being the senior name for the second species. The two species are characterized by Fst/Gmin values of 0.45/0.008 in the Z chromosome. According to a recent study (Cong et al. 2019a), these values indicate strong genetic differentiation and suggest very low gene exchange between these species, thus supporting their distinction from each other. Evans (1955) mentioned that the two “subspecies” overlap in distribution. We sequenced specimens of both from Ecuador (although not from exactly the same localities). For these reasons (genetic and phenotypic distinction, possible sympatry), we reinstate Papias integra (Mabille, 1891) as a species-level taxon. Due to extensive pale overscaling along the veins below, we place Pamphila allianca Weeks, 1901 (type locality Bolivia) as a junior subjective synonym of P. subcostulata. Interestingly, all the specimens we sequenced have the same COI barcode sequence and thus offer yet another example of distinct species that, like North American Celastrina Tutt, 1906, do not differ in their barcodes.

Finally, as Mielke and Casagrande (2002) mentioned, type specimens of P. subcostulata are probably lost. They were illustrated by Plötz among his unpublished drawings (no. 286 for P. subcostulata). These drawings were inspected by Godman (1907), who organized copying many of them, with these copies bound in the library of the Natural History Museum, London. Although the drawing no. 286 was not copied, Godman (1907: 138) made a comment that P. subcostulata may belong to Papias and a specimen from Iquitos in Godman and Salvin collection may be this species. We located this specimen in BMNH, and it has prominent pale overscaling along the veins, in particular on the hindwing, agreeing with Evans’ concept of P. subcostulata. Furthermore, illustrations in Draudt (1921–1924) frequently resemble Plötz unpublished drawings seen as Godman copies, and more so than they resemble actual type specimens Plötz drawings were made of. Therefore it seems likely that many Draudt illustrations were made not from specimens, but from Plötz drawings. For this reason, Draudt illustrations may be viewed as (frequently inferior) copies of Plötz and probably depict the types of these taxa. The illustration of P. subcostulata (plate 187f in Draudt 1921–1924) shows ventral side with prominent pale veins and agrees well with the BMNH specimen from Iquitos selected to match Plötz drawing of P. subcostulata. Thus, although the type specimens of P. subcostulata could not be found, several lines of evidence presented here point to the same conclusion that it is the species with paler veins. Therefore, we agree with the Evans’ (1955) identification of P. subcostulata.

Pamphila nubila Mabille, 1891 is a junior subjective synonym of Papias integra (Mabille, 1891)

Treated by Evans as a junior subjective synonym of Cynea corisana (Plötz, 1882) (type locality Suriname), Pamphila nubila Mabille, 1891 (type locality Venezuela: Porto Cabello) is placed within Papias integra specimens in the genomic tree (Fig. 14) judging from the syntype in the ZMHB collection we have sequenced. This specimen (NVG-18043C11) is a syntype, because it agrees exactly with the original description, comes from the type locality mentioned in the description according to its labels (“Pto Cabello”), has a label with “Pa. nubila ♀ Mb.” in handwriting similar to that of Mabille, comes from the Staudinger collection, and is curated as the type of this taxon. To stabilize nomenclature, N.V.G. hereby designates this ZMHB specimen lacking left hindwing and bearing the following labels ∥ Origin. ∥ Pto Cabello | Hahnel ∥ Pa. nubila | ♀ Mb. ∥ Pamph. | Nubila | Mab. ∥ Coll. | Staudinger ∥ Nubila | Mab. ∥ GEN.PREP., | MIELKE | 1996 ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 44a060 ∥ DNA sample ID: | NVG-18043C11 | c/o Nick V. Grishin ∥ as the lectotype of Pamphila nubila Mabille, 1891. Wing patterns of the lectotype, are in agreement with the genomic assessment. For instance, its paler-brown ground color (also mentioned in the original description) and pale overscaling around the veins on ventral surface of wings are like those of P. integra specimens, including the lectotype (NVG-15035E12), but differ drastically from the darker brown without paler veins pattern of C. corisana. Currently, we do not have evidence to support P. nubila as a valid taxon distinct from P. integra. For instance, in addition to the fact that the COI barcodes of the two lectotypes are 100% identical, P. nubila does not form a prominent clade in genomic trees. Therefore we propose that Pamphila nubila Mabille, 1891 is a junior subjective synonym of Papias integra (Mabille, 1891). With this action, being the first reviser (ICZN Code Art. 24), we also give precedence to the name integra over nubila, both names published in the same work at the same date (Mabille 1891).

Metiscus atheas Godman, 1900 is a valid species

Currently considered a junior subjective synonym of Hesperia achelous Plötz, 1882 (type locality Panama: Chiriqui), Metiscus atheas Godman, 1900 (type locality Mexico: Tabasco, Guatemala: Coban, Costa Rica: Caché, Panama: Chiriqui, Brazil: Amazonas, Trinidad) does not conform to what is known about H. achelous. Metiscus atheas is characterized by dark-brown typically unspotted wings and a diagnostic shape of stigma, which is bipartite and rather broad—compare to Lychnuchus (Enosis) immaculata (Hewitson, 1868)—as illustrated in the original description (Godman and Salvin 1900b).

We reviewed information available about H. achelous. No type specimens of H. achelous are known to exist, and the original description given in a form of identification key is too brief to confidently identify this species (Plötz 1882a): “forewing darker in the middle area below” is the only species-specific information provided, in addition to forewing length of 16 mm and the drawing number 260. These unpublished Plötz drawings, now presumed lost, were inspected by Godman (1907) who organized copying those he could not readily match to species known to him. The drawings 258–265 relevent to this discussion were not among the compilation of these copies now in the library of the Natural History Museum, London (inspected by N.V.G), and Godman (1907: 137) noted that Hesperia paria Plötz, 1882 (type locality Panama: Chiriqui, Plötz drawing 259), currently in Eutychide Godman, 1900, was synonymous with H. achelous.

While it may seem odd that the two taxa placed next to each other (drawing numbers 259: H. paria and 260: H. achelous) by Plötz, and thus directly compared with each other, are synonymous, it is not without a precedent. For instance, Hesperia perloides Plötz, 1882 (type locality Brazil, drawing number 282) and Hesperia perla Plötz, 1882 (type locality Brazil: Rio de Janeiro, drawing number 283) are currently treated as synonyms (Mielke 2005).

The names H. achelous and H. paria were proposed in the same work issued on the same date (Plötz 1882a), and the precedence between the two names was determined by the “First Reviser” (ICZN Code Art. 24.2). By placing the name Eutychide achelous in the right column without comments, and Hesperia paria in the left column, Godman (1907: 137) seemingly gave priority to the name H. achelous over H. paria. This is because in all instances where the name given in the left column has priority, Godman’s text in the right column explicitly stated that priority (Godman 1907). If this priority designation is questioned, Draudt (1923b) also used E. achelous as a valid name and listed “= paria” as its synonym, probably following Godman. Therefore, if considered synonymous, H. paria would be a junior subjective synonym of H. achelous.

Furthermore, Godman (1907: 137) commented that the specimen illustrated by Plötz in the drawing number 259 as H. paria was “from La Guayra, not Chiriqui” as stated in the original description (Plötz 1882a). A number of possibilities arise here, one being that a mistake was made in listing the locality of H. paria as “Chiriqui” in the Plötz description. In agreement with that, Draudt (1923b) listed both Panama and Venezuela as the localities for his entry “E. achelous Plötz (= paria Plötz)”.

In addition to the analysis of Plötz drawing, the identity of H. achelous was based on the specimens identified as such from the Staudinger collection (Godman and Salvin 1900a), now in the ZMHB. Type specimens for a large number of Plötz names are in the Staudinger collection and it is possible that these H. achelous specimens were the Plötz types, although not labeled as such. Inspecting these specimens, Godman concluded that H. achelous is the species known today as Eutychide paria following Evans (1955). In the ZMHB Hesperiidae drawer 183, there was a male specimen (July 2012, inspected and photographed by N.V.G.) that would be identified as Evans’ H. paria with a green label “achelous / Plötz” above it.

Evans (1955) disagreed with the application of H. achelous for H. paria by Staudinger (Godman and Salvin 1900a), Godman (1907), and Draudt (1923b). Evans used Eutychide paria as the name for this species and synonymized M. atheas under his Enosis achelous. The reasons behind this disagreement and placement of M. atheas in synonymy with H. achelous were not given (Evans, 1955: 216), remain unsubstantiated, and are unclear to us. Based on the analysis presented above, we do not follow Evans, remove Metiscus atheas Godman, 1900 from synonymy, and consider it to be a valid species, which is the type species of Metiscus Godman, 1900 by monotypy. To promote the stability of nomenclature and to narrow down the type locality currently spanning both Americas, N.V.G. hereby designates the male specimen in the collection of the Natural History Museum, London, UK whose genitalia and wing venation were illustrated in the Godman and Salvin book (1900b), as the lectotype of Metiscus atheas Godman, 1900. The lectotype is from Mexico: Tabasco, Teapa, collected by H. H. Smith. Its left wings are cleared from scales to reveal venation and stigma, and genitalia are prepared on a mini-slide pinned together with its labels. According to Selander and Vaurie (1962), the type locality Teapa is 48 km south of Villahermosa (very near the border with Chiapas), approximate GPS coordinates 17.55, −92.95.

The identities of H. achelous and H. paria remain to be determined after a more careful search for its possible type specimens we have initiated in several collections is conducted. There are three issues with finalizing the application of the names H paria and H. achelous. First, the forewing length of H. achelous given by Plötz (1882a) in the original description is 16 mm (vs. 18 mm for H paria), which is smaller than typical for the species Evans (1955) called H. paria (20 mm) and Godman called H. achelous. Second, our argumentation presented above is based on three publications (Godman and Salvin 1900a; Godman 1907; Draudt 1923b) that may not be fully independent and could largely stem from the specimens that Staudinger identified as H. achelous. The argument breaks down if Staudinger misidentified these specimens and other sources simply followed this misidentification, and Plötz’s drawings 259 and 260 were not detailed enough or misleading to offer clues about the true identity of these species as interpreted by Godman. Third, the La Guaira specimens from the collection in Greifswald, given as Plötz’s place of residence in the original publication (Plötz 1882a) should be investigated to address the discrepancy between the locality of H. paria on the drawing (La Guaira) (Godman 1907: 137) and in the description (Chiriqui). The collection of Ernst Moritz Arndt Universität in Greifswald, Germany has been reported to contain a number of Plötz’s type specimens from La Guaira, some of which have been designated as lectotypes (Mielke and Casagrande 2002).

Presently, in the interest of nomenclature stability we treat Hesperia achelous as a nomen dubium, because current evidence points to synonymy between H. achelous and H. paria, which results in H. achelous being a valid name, instead of H. paria. Implied usage of H. achelous for the species currently known as E. paria may need revision after the identity of H. achelous is determined, a change that better be avoided. Therefore, we leave the application of the name E. paria as currently used, following Evans (1955).

Metiscus Godman, 1900 is a valid genus

Metiscus Godman, 1900 (type species Metiscus atheas Godman, 1900) is not monophyletic with Enosis Mabille, 1889 (type species Enosis dognini Mabille, 1889), where its species are currently placed, and does not have apparent close relatives (Fig. 15). Therefore, Metiscus is a valid genus. In addition to the type species, the genus consists of Enosis matheri H. Freeman, 1969 (type locality Mexico: Veracruz, Catemaco) and Pamphila angularis Möschler, 1877 (type locality Suriname).

Enosis matheri H. Freeman, 1969 is a junior subjective synonym of Metiscus atheas Godman, 1900

Genomic sequencing of the holotype of Enosis matheri H. Freeman, 1969 (type locality Mexico: Veracruz, Catemaco) and two topotypical paralectotypes of Metiscus atheas Godman, 1900 (type locality Mexico: Tabasco, Teapa) among other specimens, including one from Colombia, reveals their close clustering together without any separation (Fig. 15). COI barcodes of the E. matheri holotype (NVG-18026C08) and one of the M. atheas topotypical paralectotypes (NVG-21013E09) are identical, and differ by only one base pair from the other paralectotype (NVG-21013E08). Combined with morphological similarities and proximity of their type localities, our data suggest that Enosis matheri H. Freeman, 1969 is a junior subjective synonym of Metiscus atheas Godman, 1900.

Mnasalcas amatala Schaus, 1902 is a junior objective synonym of Hesperia infuscata Plötz, 1882, confirmed as a junior subjective synonym of Mnaseas derasa derasa (Herrich-Schäffer, 1870), new combination

The name Hesperia infuscata Plötz, 1882 (type locality Brazil) was proposed in the same work with Hesperia achelous Plötz, 1882 and Hesperia paria Plötz, 1882 (see discussion above) and placed in the identification key between these two species (Plötz 1882a). The only species-specific information given for H. infuscata was: “Distal half of the wings below gray-brown. ♂ with stigma”, in addition to the forewing length of 17 mm and the unpublished drawing number 265 (original likely lost), which was not included among Godman’s copies of Plötz’s drawings (now in the Natural History Museum, London, inspected by N.V.G.), because Godman assumed that he found a specimen closely matching it in the Godman and Salvin collection (Godman 1907).

First, Godman concluded that the Plötz’s drawing of H. infuscata did not match his previous identification of this species as published in Godman and Salvin (1900b). This Godman’s misidentification was based on the male specimen in the Staudinger collection (now in ZMHB) identified by Möschler as H. infuscata (Godman and Salvin 1900b). In all likelihood, it was the specimen that in addition to the “B.C.A.Lep.Rhop.” label routinely placed by Godman on specimens used in the book, gained the “Origin” label (Godman did not mention this specimen was a type) and was later designated as the lectotype of H. infuscata (Mielke and Casagrande 2002). This specimen (NVG-15035E11), from Suriname, not from Brazil as per H. infuscata description, does not agree with either of the species-specific statements of the original description. First, distal half of its wings below is nearly the same color as the basal half (not gray brown). Second, it is a male that lacks a stigma. According to Godman (1907), this specimen did not match the original Plötz drawing of H. infuscata.

Although the drawing no. 265 was not among the Godman’s copies, it is likely that many of the Plötz’s original drawings served as prototypes for illustrations in Draudt (1923b). This is because some of the Draudt illustrations appear more similar to Godman’s copies of Plötz drawing than to actual specimens of these species. Draudt considered H. infuscata to be possibly synonymous with Metiscus atheas Godman, 1900. The illustration of M. atheas ventral aspect (plate 187, row f, image no. 8), while not agreeing with the specimens from M. atheas type series, agrees well with the original description of H. infuscata: “Distal half of the wings below gray-brown.” It is possible that this illustration might have been a copy of the (now lost) Plötz’s drawing and can give an idea about how this species looks like. It is clear that Möschler’s specimen NVG-15035E11 or a species it represents, cannot possibly be approximated by this drawing. For all these reasons, this Möschler’s specimen is not a syntype of H. infuscata, despite the “Origin” label on its pin. Therefore, it cannot be a lectotype and should not be a used to define the name H. infuscata.

Second, Godman (1907: 137) noted that the Plötz’s drawing 265 depicted a stigma “formed of two narrow elongate streaks” that looked somewhat similar to that of M. atheas. The only South American specimens (H. infuscata is from Brazil) identified by Evans as Enosis achelous (he considered M. atheas to be its synonym) were from Ecuador. They possess atheas-styled stigma and their ventral aspect shows darker basal half of wings, mostly confined to discal cell on forewing, and paler-brown marginal areas. However the pattern is not as sharply two-toned as the Draudt illustration, which Evans described as “very exaggerated” for his “E. achelous”, but this pattern could be just right for some other species. Furthermore, the forewing is 17 mm in H. infuscata and is larger than 18 mm in the BMNH specimens from Ecuador. For these reasons, H. infuscata was a species different from M. atheas or E. achelous. Next, we searched for possible syntypes of H. infuscata in the Museum für Naturkunde, Berlin, Germany (ZMHB) and the Zoologische Staatssammlung München, Germany (ZSMC), where primary types of many taxa authored by Plötz are deposited: N.V.G. inspected all Hesperiidae drawers in the first two collections and failed to find any syntypes. We studied photographs of the drawers with Plötz types in the collection of the Universität Greifswald (EMAU) and found no H. infuscata syntypes. Therefore, we believe that the syntypes are no longer extant, and we proceed with a neotype designation. There is an exceptional need to designate neotype of H. infuscata, because a specimen that is not a syntype was designated as its lectotype previously (Mielke and Casagrande 2002), introducing confusion about application of this name and requiring the identity of this taxon to be objectively established in agreement with its original description to facilitate future research on Hesperiidae.

Translating from the original description of H. infuscata given as a key (Plötz 1882a), the following characters differentiate this taxon: antenna is nearly always longer than half of forewing, wings are without hyaline spots, dorsal and ventral sides of wings are almost equally dark, without markings, distal half of ventral wings is gray-brown, ♂ with stigma, forewing length 17 mm; augmented with Godman’s comments (Godman 1907) that H. infuscata, as drawn by Plötz, “has a brand formed of two narrow elongate streaks” and “comes very near Metiscus atheas Godm.” Among Brazilian Hesperiidae, we found a specimen that is an excellent match to the original description of H. infuscata, Draudt’s illustration of “Metiscus atheas” (Draudt 1921–1924), and Godman’s comments. This specimen is a syntype of Mnasalcas amatala Schaus, 1902, the only one from the known specimens of the syntypic series that has the word “type” on the identification label handwritten by Schaus. N.V.G. designates this specimen as the neotype of Hesperia infuscata Plötz, 1882 (see label data of this specimen below). This male from Brazil with dark-brown unspotted wings has forewing length 17 mm, antenna 0.53 of the forewing length, well-defined brand of two elongate streaks, distal half of both wings ventral side paler than basal half, and the darker forewing area nearly rectangular, shaped as in the Draudt’s illustration.

Our neotype of H. infuscata satisfies all requirements set forth by ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Hesperia infuscata Plötz, 1882, which has been inconsistent with its original description; 75.3.2. The characters for the taxon have been given in its original description by Plötz (1882a: 319), detailed by Godman (1907: 137) and are discussed above; 75.3.3. The neotype specimen, which N.V.G. also designates as the lectotype of Mnasalcas amatala Schaus, 1902 to stabilize nomenclature, bears the following labels: ∥ Nova Friburgo, | Brazil. ∥ Collection | W. Schaus ∥ Mnasalcas | amatala | type Sch. ∥ Type | No. 6031 | U.S.N.M. ∥, additionally recognized by the head tilted to the left, left antenna stretched out anteriad, and the tip of right hindwing tornus bent dorsad; 75.3.4. Our search for the syntypes is described above, it was not successful, and we consider that the specimens composing the type series of H. infuscata are lost; 75.3.5. As detailed above, the neotype is consistent with the original description and all additional information known about this taxon; 75.3.6. The neotype is from Brazil: Rio de Janeiro, Nova Friburgo, and the type locality given for H. infuscata in the original description is “Brasilien”; 75.3.7. The neotype is in the collection of the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM).

Genomic analysis of the H. infuscata/M. amatala neotype/lectotype (NVG-18111C07) places it together with a syntype of Pamphila gagatina Mabille, 1891 in the ZMHB (NVG-15034H04) and among other specimens from Brazil that we identified as Mnaseas derasa derasa (Herrich-Schäffer, 1870), new combination (type locality Brazil) (Fig. 11), thus confirming that the three former taxa are junior subjective synonyms of the latter.

Finally, Evans attributed the name H. infuscata to a species closely related to Metiscus angularis (Möschler, 1877) (type locality Suriname). However, this species is smaller: forewing length less than 16 mm in males (vs. 17 mm in H. infuscata) and has petite stigma, not similar to that of M. atheas. Therefore, Evans misidentified H. infuscata, and the taxon he identified as Enosis angularis infuscata does not have a name. It is therefore new, described as a species below.

Metiscus goth Grishin, new species

http://zoobank.org/AFAB9CB8-51EC-4296-863B-6CC917EBC94E

Definition.

Evans (1955) misidentified Hesperia infuscata Plötz, 1882 (type locality Brazil), as detailed above. Hence the taxon Evans identified as Enosis angularis infuscata is left without a name. Genitalic differences discussed and illustrated by Evans (1955) substantiate it as a species-level taxon, sister to but distinct from Metiscus angularis (Möschler, 1877) (type locality Suriname). Evans (1955) provided its description in a form of identification key, which is adopted here: this new species keys to K.4.10.(a) in Evans (1955) and its male genitalia are illustrated on Plate 68 as “infuscata”. Differs from its relatives by a combination of the following characters: wings dark-brown, rounded, dorsal side unmarked in males (no hyaline dot near the base of forewing cell M3-CuA1), females with one or several small hyaline spots; wings below paler towards the outer margin, hindwing with a diffuse discal band darker than the background; stigma small, brown-gray, stands out from the wing background color, bipartite, of a characteristic shape with the upper segment comet-like, at the very base of CuA1-CuA2 cell stretching along discal cell, lower segment oval-shaped, just below the upper segment base and below CuA2 vein; distal margin of harpe angled, without a notch, aedeagus not bifid. The holotype is a male from Costa Rica illustrated in Fig. 12q and deposited in the American Museum of Natural History, New York, USA (AMNH). Only the specimens of this species from Costa Rica are paratypes: 1♂ and 1♀ in the in the Natural History Museum, London, UK (BMNH), 3♂♂ and 3♀♀ in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM). Type identification labels will be mailed to curators of these collections to be placed on these specimens. Other specimens mentioned by Evans (1955) as his “Sub-sp. infuscata” are excluded from the type series.

Etymology.

The name of this dark species decorated with a gracile stigma refers to gothic fashion. The name is a noun in appostion.

Pamphila astur Mabille, 1891 is a junior subjective synonym of Metiscus angularis (Möschler, 1877)

A syntype of Pamphila astur Mabille, 1891 (type locality Brazil: Amazonas) in the ZMHB collection (NVG-15036F08), currently a junior subjective synonym of Cymaenes tripunctus theogenis (Capronnier, 1874) (type locality Brazil: Rio de Janeiro) is not monophyletic with it and instead originates within Metiscus angularis (Möschler, 1877) (type locality Suriname) sister to its syntype (NVG-15036E09) (Fig. 15). Wing patterns and brand shape of the syntype agree with genetic assessment. Therefore we place Pamphila astur Mabille, 1891 is a junior subjective synonym of Metiscus angularis (Möschler, 1877).

Enosis Mabille, 1889 is a subgenus of Lychnuchus Hübner, [1831]

Enosis Mabille, 1889 (type species Enosis dognini Mabille, 1889) is sister to currently monotypic Lychnuchus Hübner, [1831] (type species Lychnuchus olenus Hübner, [1831], which is a junior subjective synonym of Hesperia celsus Fabricius, 1793) (Fig. 15). COI barcode difference between the type species of these genera is 7.1% (47 bp). Morphologically, they both are characterized by bifid aedeagus tip covered in small teeth and stout uncus with knob-like arms. Due to these similarities and to avoid a monotypic genus Lychnuchus, which is not prominently distinct, but possesses possibly mimetic and unusual for Enosis wing patterns, we propose to treat Enosis Mabille, 1889 as a subgenus of Lychnuchus Hübner, [1831].

Lychnuchus (Enosis) demon (Evans, 1955), new status, new combination

Named as a subspecies of Hesperia immaculata Hewitson, 1868 from Peru, Enosis immaculata demon Evans, 1955 shows differences comparable to those of species and is genetically removed from E. immaculata (Fig. 15). Furthermore, as detailed above, Enosis Mabille, 1889 (type species Enosis dognini Mabille, 1889) is a subgenus of Lychnuchus Hübner, [1831] (type species Lychnuchus olenus Hübner, [1831], which is a junior subjective synonym of Hesperia celsus Fabricius, 1793). Therefore we propose Lychnuchus (Enosis) demon (Evans, 1955), new status, new combination.

Mit Grishin, new genus

http://zoobank.org/64AC561D-9CB2-477C-8492-ADC91A6146F8

Type species.

Mnasitheus badius Bell, 1930.

Definition.

A genus in the clade with Lychnuchus Hübner, [1831] (type species Lychnuchus olenus Hübner, [1831], which is a junior subjective synonym of Hesperia celsus Fabricius, 1793), Dion Godman, 1901 (type species Carystus gemmatus Butler, 1872) and Eutychide Godman, 1900 (type species Hesperia physcella Hewitson, 1866) among others (Fig. 15). Keys to J.32.6, or K.2.5, or K.4.11 in Evans (1955). Morphologically diverse genus of dark Moncina species, unified by a peculiar mitten-shaped valva with a style of varying length and thickness from the ampulla projecting dorsal (a thumb) and harpe projecting caudad, slightly upturned (hand). Other characters include uncus either short and broad, with small or without arms, or long and undivided, beak-like; saccus half of valva in length; either with brands (no brand over vein CuA2, long brands under vein CuA2 and over vein 1A+2A) or long prominent stigma reaching vein 1A+2A; 3rd segment of palpi short. In DNA, a combination of the following base pairs is diagnostic: aly3277.16.1:G904A, aly666.36.3:G181A, aly666.36.3:G182A, aly7193.1.1:T163C, and aly2041.19.7:G130T.

Etymology.

The name is a masculine noun in the nominative singular, given for the mitten-like shape of valva.

Species included.

The type species, Lerodea gemignanii Hayward, 1940 and Enosis schausi Mielke and Casagrande, 2002.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Rotundia Grishin, new subgenus

http://zoobank.org/63543CF4-05BF-4A97-A686-B9A38096E174

Type species.

Enosis schausi Mielke and Casagrande, 2002.

Definition.

Forms a more distant clade within Mit Grishin, new genus, and therefore is a subgenus (Fig. 15). Keys to K.4.11 in Evans (1955). Distinguished from its relatives by the following combination of characters: wings rounder, stigma prominent and long, reaching vein 1A+2A, uncus undivided, thin, beak-like, longer than tegumen, gnathos half of uncus in length, ampulla widely expanded dorsad (=thumb of a mitten) above smaller harpe. In DNA, a combination of the following base pairs is diagnostic: aly666.25.1:C2309A, aly3824.12.5:A3932G, aly3824.12.5:G2968A, aly577.34.1:G1716A, and aly1656.5.1:G106A.

Etymology.

The name is a feminine noun in the nominative singular, given for the broad and relatively round wings of the type species.

Species included.

Only the type species.

Parent taxon.

Genus Mit Grishin, new genus.

Comment.

From morphology, it seems apparent that Mit (Rotundia) schausi is more distant from either Mit (Mit) badius (Bell, 1930) (the type species of Mit) or Mit (Mit) gemignanii (Hayward, 1940), which are closer to each other, consistently with our genomic tree (Fig. 15). However, in COI barcodes, M. schausi is really close to M. badius: only 5.9% (39 bp) difference, less than that between M. badius and Mit (Mit) gemignanii (Hayward, 1940): 6.7% (44 bp), indicating that genomic data, not COI barcodes, are most valuable for proper classification that is consistent with phenotypic considerations.

Dion iccius (Evans, 1955) and Dion uza (Hewitson, 1877), new combinations

Currently placed in Enosis Mabille, 1889 (type species Enosis dognini Mabille, 1889), Enosis iccius Evans, 1955 (type locality Guyana) and Hesperia uza Hewitson, 1877 (type locality unknown) are not monophyletic with its type species and instead originate within Dion Godman, 1901 (type species Carystus gemmatus Butler, 1872) (Fig. 15). Therefore, they are transferred there to form Dion iccius (Evans, 1955), new combination, and Dion uza (Hewitson, 1877), new combination.

Dion agassus (Mabille, 1891), reinstated status, new combination

Mielke and Casagrande (2002) synonymized Pamphila agassus Mabille, 1891 (type locality Brazil: Amazonas, Massauary) with Hesperia uza Hewitson, 1877 (type locality not stated), both in Enosis Mabille, 1889 (type species Enosis dognini Mabille, 1889) following Evans (1955). Genomic sequencing of the lectotypes of these taxa revealed prominent genetic differentiation suggesting their distinctness at the species level. For example, their COI barcodes differ by 2.3%. Phenotypically, H. uza is larger than P. agassus: typical forewing lengths 19–20 mm vs. 17 mm; and the lavender area on its ventral hindwing is broader, occupying more than half of the wing. Moreover, ventral hindwing is patterned differently in the two species: P. agassus has a discal band of pale-blue metallic spots framed by brown background and lilac (more pinkish) distal area, while in H. uza these spots merged with the lavender (more bluish) background, not visibly contrasting it in color (but remain as patches of bluer than background metallic scales), and instead there is a row of indistinct brown streaks (remnants of the distal brown framing of P. agassus pale-blue spots) on the lavender background. While it is possible that wing patterns are variable, genetic distinctness identifies the two species. Above, we placed H. uza in Dion Godman, 1901 (type species Carystus gemmatus Butler, 1872), and P. agassus is its close relative that belongs to the same genus. Therefore, we propose Dion agassus (Mabille, 1891), reinstated status, new combination.

Hesperia pruinosa Plötz, 1882 is a junior objective synonym of Dion uza (Hewitson, 1877)

The original description of Hesperia pruinosa Plötz, 1882 (type locality South America) states that its ventral hindwing is dusted with violet-gray for more than 1/2 towards the anal angle, lists the forewing length at 20 mm, and gives the illustration number 293 (Plötz 1882a). While this illustration (likely lost) was not included in the Godman’s copy of Plötz drawings now in the Natural History Museum, London, UK (inspected by N.V.G.), Godman (1907: 138) noted the two specimens in the Godman and Salvin collection from [Brazil, Mato Grosso] Chapada belong to this species. Inspection of these two specimens in Natural History Museum, London, UK, also mentioned by Evans (1955) revealed that instead of ventral hindwing being “über 1/2 gegen den Hinterwinkel veilgrau bestäubt” per Plötz description, it has a discal band of pale-blue spots encircled with brown. Moreover, these specimens are smaller than the H. pruinosa type(s): forewing length under 18 mm instead of 20 mm, so they are not a perfect match to the description of H. pruinosa.

However, the Draudt illustration of H. pruinosa ventral aspect on plate 189 row e image 5 agrees with the original description better that the Chapada specimens (Draudt 1923b). Due to general resemblance between Draudt illustrations and Plötz illustrations copied by Godman’s decision, it is likely that a number of Draudt illustrations were either drawn from Plötz’s original illustrations or specimens used by Plötz. Therefore, the Draudt H. pruinosa illustration is a likely representation of the type specimen. Out of specimens we examined, this illustration comes closest to the lectotype of Hesperia uza Hewitson, 1877 (type locality not stated). In particular, both the specimen and illustration have a broad lavender area on ventral hindwing covering cells M1-M2 and M2-M3 and partly discal cell, discal blue spots are poorly defined (widened, merged with the background, noticeable upon more careful inspection as areas of blue/greener shiny scales), “replaced” by a row of brown spots, not as distinct on the specimen as on the illustration.

As far as we can tell, the name H. uza was not mentioned by either Plötz or Draudt, but its original description is nearly the same as H. pruinosa’s: “the outer margin of the anterior wing and more than the outer half of the posterior wing are lilac-white” (Hewitson 1877). It is likely that Plötz was not aware of H. uza. Because Plötz worked with many specimens from the Staudinger collection, now in the ZMHB, that contains many of his type specimens, he may have used this particular specimen to describe H. pruinosa. Therefore, it is possible that the H. uza lectotype is also a syntype of H. pruinosa. However, it seems to be nearly impossible to demonstrate it convincingly.

We conducted a careful search for H. pruinosa syntypes in all (more than 250) Hesperiidae drawers in the ZMHB, all Hesperiidae boxes in ZSMC and the Hesperiidae collection in EMAU (collections known to hold Plötz type material) and did not find any specimens that agree with the original description of H. pruinosa. Therefore, its types are either lost or unrecognizable, and we proceed with a neotype designation. There is an exceptional need to designate the neotype because this name has been arbitrarily assigned, causing inconsistency and thus confusion (Evans 1955; Mielke and Casagrande 2002), and the lack of the name-bearing type of H. pruinosa prevents definitive taxonomic studies of this group, stimulated by genomic sequencing that revealed the presence of two species. It is essential to define the name objectively and in a manner that is consistent with the intent of the original author, if it does not undermine stability of nomenclature.

The specimen, previously designed as the lectotype of Hesperia uza Hewitson, 1877 by Mielke and Casagrande (2002), who gave label data for it, is hereby designated by N.V.G. as the neotype of Hesperia pruinosa Plötz, 1882, making the two names objective synonyms. This specimen, pictured on the Butterflies of America website (Warren et al. 2016), bears two additional labels added since, both white, printed: ∥ [barcode image] http://coll.mfn-berlin.de/u/ | 44a0ce∥ and ∥ DNA sample ID: | NVG-18052D10 | c/o Nick V. Grishin ∥, and can be recognized by a unique wing tear from the outer margin along 1A+2A vein on the right hindwing. The neotype is in the Museum für Naturkunde, Berlin, Germany (ZMHB). The neotype is designated to clarify the taxonomic status of H. pruinosa, which is differentiated from other taxa by the characters stated in the original description (Plötz 1882a), and in Draudt (1923b), as discussed above. This neotype agrees with what is known about H. pruinosa. The collecting locality of the neotype is currently unknown and will be determined by genomic comparison with specimens from known localities. However, its phenotype is consistent with the neotype being from South America (the type locality of H. pruinosa), for example, from Colombia. Colombian specimens of this species in the BMNH collection are particularly large and are characterized by broadly-lavender ventral hindwings without a discal band of brown-framed blue spots.

In this work, we placed taxa discussed in this section in Dion Godman, 1901 (type species Carystus gemmatus Butler, 1872). And as a result of our studies, the taxon Evans (1955) called Enosis pruinosa pruinosa became Dion uza, and Enosis pruinosa agassus became Dion agassus.

Vistigma Hayward, 1939 is a valid genus and Penicula Evans, 1955 is its subgenus

Currently a junior subjective synonym of Phlebodes Hübner, [1819] (type species Papilio pertinax Stoll, [1781]), Vistigma Hayward, 1939 (type species Vistigma xanthobasis Hayward, 1939) is not monophyletic with it and instead is sister to Penicula Evans, 1955 (type species Pamphila bryanti Weeks, 1906) (Fig. 15), a genus that currently consists of two closely related species. COI barcode difference between the type species of Vistigma and Penicula is 8.2% (54 bp), thus we propose to consider them congeneric with Penicula Evans, 1955 being a subgenus of Vistigma Hayward, 1939, which is a valid genus, revised status. In addition to the type species, two species that are currently in Phlebodes belong to Vistigma: Phlebodes virgo Evans, 1955 (type locality Brazil: Amazonas) and Pamphila vira Butler, 1870 (type locality Brazil: Para).

Vistigma (Vistigma) opus (Steinhauser, 2008), new combination

Thoon opus Steinhauser, 2008 originates within Vistigma Hayward, 1939 (type species Vistigma xanthobasis Hayward, 1939) and is sister to species placed in the subgenus Vistigma (Fig. 15), but is in a clade different from the subgenus Penicula Evans, 1955, hence Vistigma (Vistigma) opus (Steinhauser, 2008), new combination.

Saturnus fartuga (Schaus, 1902), new combination

Presently in Parphorus Godman, 1900 (type species Phlebodes storax Mabille, 1891), Phlebodes fartuga Schaus, 1902 (type species Brazil: Rio de Janeiro) in not monophyletic with it and instead originates within Saturnus Evans, 1955 (type species Papilio saturnus Fabricius, 1787) (Fig. 15), where it is transferred to form Saturnus fartuga (Schaus, 1902), new combination.

Picova Grishin, new genus

http://zoobank.org/F411F412-42AE-4254-9423-8E0D3B787645

Type species.

Vorates steinbachi Bell, 1930.

Definition.

Currently in Saturnus Evans, 1955 (type species Papilio saturnus Fabricius, 1787), Vorates steinbachi Bell, 1930 (type locality Bolivia) and currently in Morys Godman, 1900 (type species Apaustus valerius Möschler, 1879), Euroto incompta Hayward, 1942 (type locality) are not monophyletic with the type species of the genera they are attributed to and instead are sister taxa in the genomic tree (Fig. 15). Their clade is a weakly supported sister to Vistigma Hayward, 1939 (type species Vistigma xanthobasis Hayward, 1939) with Haza Grishin, 2019 (type species Hesperia hazarma Hewitson, 1877) and therefore is a genus. Keys to L.1.2 or J.20.2(a) (in part) in Evans (1955). This new genus is distinguished from its relatives by a beak-like directed dorsad projection on otherwise rounded, broad harpe, harpe not prominently separated from ampulla, saccus slightly shorter than vinculum, uncus narrowing in the middle with two knob-like divergent arms, penis shorter than valva; boomerang-shaped narrow brand at the base of cell CuA1-CuA2. In DNA, a combination of the following base pairs is diagnostic: aly203.14.1:A408G, aly1146.42.8:A5096G, aly2250.14.1:A937C, aly151.17.2:C601A, and aly151.17.2:A3570C.

Etymology.

The name is a feminine noun in the nominative singular, for the beak-shaped projection on valva: Pico+va[lva].

Species included.

The type species and Euroto incompta Hayward, 1942 (see below).

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Picova incompta (Hayward, 1942), reinstated status, new combination

The holotype of Euroto incompta Hayward, 1942 (type locality Ecuador), currently a junior subjective synonym of Lerema (Morys) micythus (Godman, 1900) (type locality Mexico: Guerrero and Tabasco; and Costa Rica) is not monophyletic with it and is in a different clade, where it is closely related to Picova steinbachi (E. Bell, 1930) (type locality Bolivia) (Fig. 15). Therefore, we propose Picova incompta (Hayward, 1942), reinstated status, new combination.

Phlebodes fuldai (E. Bell, 1930), revised combination

Evans (1955) correctly placed Euroto fuldai Bell, 1930 (type locality Colombia) in Phlebodes Hübner, [1819] (type species Papilio pertinax Stoll, 1781) as Phlebodes fuldia [sic], stating that none of its specimens were in BM[NH], and then named Vettius yalta Evans, 1955 (type locality Brazil: Espírito Santo) with similar genitalia that he illustrated. Lamas (1994) placed P. fuldai in Vettius Godman, 1901 (type species Papilio phyllus Cramer, 1777), then Mielke (2004) placed V. yalta in synonymy with V. fuldai. However, the holotype of fuldai is not monophyletic with the type species of Vettius, and instead is in the same clade with the type species of Phlebodes (Fig. 15). Hence, we propose Phlebodes fuldai (E. Bell, 1930), revised combination.

Mnasitheus padus (Evans, 1955), new combination

Named by Evans (1955) in Moeris Godman, 1900 (type species Talides striga Geyer, [1832]), padus Evans, 1955 is not monophyletic with it, and is instead sister to Mnasitheus chrysophrys (Mabille, 1891), a valid name for Mnasitheus cephis Godman, 1900, which is the type species of Mnasitheus (Fig. 15). The two species are genetically close, for example, COI barcodes differ by 7.8% (51 bp), and are similar in genitalia. Moreover, in their revision of Moeris Godman, 1900 (type species Talides striga Geyer, [1832]), Carneiro et al. (2015) mentioned a cleft between ampulla and harpe that is absent in all Moeris species except M. padus, but present in Eutychide submetallescens Hayward, 1940 that they place in Mnasitheus. Genomic tree shows that M. submetallescens is more distant from the type species of Mnasitheus than M. padus. Therefore, we confidently place M. padus in Mnasitheus, new combination.

Sucova Evans, 1955 is a junior subjective synonym of Mnasitheus Godman, 1900

A monotypic genus Sucova Evans, 1955 (type and the only species Hesperia sucova Schaus, 1902) is sister to Mnasitheus submetallescens Hayward, 1940 making Mnasitheus polyphyletic. To restore monophyly, we can either transfer submetallescens to Sucova, or place Sucova in Mnasitheus. We prefer the latter solution, because Carneiro et al. (2015) correctly deduced phylogenetic affinity of then-Moeris submetallescens on the basis of morphological characters. Therefore, the placement of submetallescens in Mnasitheus is supported by the genus concept used in morphology-based studies and could be taken as a reference. Noting genetic similarity of these taxa (Fig. 15), we conclude that Sucova Evans, 1955 is a junior subjective synonym of Mnasitheus Godman, 1900.

Naevolus brunnescens (Hayward, 1939), new combination

Placed in Psoralis Mabille, 1904 (type species Psoralis sabaeus Mabille, 1904, which is a junior subjective synonym of Pamphila idee Weeks, 1901) by Evans (1955), Oeonus brunnescens Hayward, 1939 is not monophyletic with it (Fig. 15), and is instead sister to Naevolus orius (Mabille, 1883), the senior subjective synonym of Cydrus naevolus Godman, 1900, type and the only known species of Naevolus Hemming, 1939, where it is therefore placed. We note that both species possess similarly elongated wings, not frequently found in other Moncina.

Naevolus naevus Evans, 1955, new status

Named by Evans (1955) as a subspecies of Naevolus orius (Mabille, 1883) from western Ecuador, naevus differs from orius not only in wing patterns, but also in male genitalia (Evans 1955), in addition to genetic differences (Fig. 15) and COI barcode difference of 4% (26 bp), supporting its new status as a distinct species.

Lattus Grishin, new genus

http://zoobank.org/0C22E44F-6EF6-40F6-8233-70D069072441

Type species.

Eutocus arabupuana Bell, 1932.

Definition.

A genus sister to the clade consisting of five genera: Eutocus Godman, 1901 (type species Eutocus phthia Godman, 1901, a junior subjective synonym of Apaustus facilis Plötz, 1884), Tarmia Lindsey, 1925 (type species Tarmia monastica Lindsey, 1925), Lucida Evans, 1955 (type species Carystus lucia Capronnier, 1874), Panca Evans, 1955 (type species Lerodea subpunctuli Hayward, 1934), and Ginungagapus Carneiro, O. Mielke and Casagrande, 2015 (type species Eutocus schmithi Bell, 1930) (Fig. 15). Therefore, it is a genus. Keys to J.3.7 in Evans (1955). Distinguished from its relatives by the following combination of characters: wings broad, rounded, below with variegated patterns of darker lines and spots, reminding of a lattice pattern; small triangular brand at the base of CuA1-CuA2 cell; gnathos arms very long and thin, longer than uncus, uncus terminally rounded, undivided; penis with a style half of its length; valva twice as long as broad, harpe upturned, extends dorsally for a third of its length beyond ampulla. In DNA, a combination of the following base pairs is diagnostic: aly345.4.7:C2251A, aly1838.61.1:G543C, aly86.14.2:A4732G, aly138.16.3:G112C, and aly86.14.2:A4681C.

Etymology.

The name is a masculine noun in the nominative singular, given for the lattice-like ventral hindwing pattern of the type species.

Species included.

Only the type species.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Lucida scopas (Mabille, 1891), Lucida oebasus (Godman, 1900), Lucida leopardus (Weeks, 1901), and Lucida melitaea (Draudt, 1923) reinstated statuses

Narga scopas Mabille, 1891 (type locality Venezuela: Merida, syntype NVG-15033D05 sequenced), Megistias oebasus Godman, 1900 (type locality Costa Rica), and Pamphila leopardus Weeks, 1901 (type locality Bolivia) are currently subspecies of Lucida lucia (Capronnier, 1874) (type locality Brazil: Rio de Janeiro) and Artines melitaea Draudt, 1923 (type locality Colombia: Río Aguacatal, lectotype NVG-18093B11 sequenced) is a junior subjective synonym of Lucida lucia scopas. However, these taxa show prominent genetic differentiation, in particular, L. lucia is the most different from the all, showing COI barcode difference of 5.6% (37 bp) from Lucida scopas (Mabille, 1891), reinstated status. Curiously, the COI barcode difference between L. scopas and Lucida melitaea (Draudt, 1923), reinstated status, is also quite large, at 2.9% (19 bp), and that between L. scopas and Lucida leopardus (Weeks, 1901), reinstated status, is 3.2% (21 bp). Coupled with phenotypic differences, in particular in the absence/presence/size of the brand, considerable genetic differentiation argues for species status of these taxa, including Lucida oebasus (Godman, 1900), reinstated status, that lacks the brand.

Alternative taxonomy of Eutocus Godman, 1901 relatives

Lattus Grishin, new genus (type species Eutocus arabupuana Bell, 1932) was proposed as a genus, because it is sister to all other members of this group classified into of five genera: Eutocus Godman, 1901 (type species Eutocus phthia Godman, 1901, a junior subjective synonym of Apaustus facilis Plötz, 1884), Tarmia Lindsey, 1925 (type species Tarmia monastica Lindsey, 1925), Lucida Evans, 1955 (type species Carystus lucia Capronnier, 1874), Panca Evans, 1955 (type species Lerodea subpunctuli Hayward, 1934), and Ginungagapus Carneiro, O. Mielke and Casagrande, 2015 (type species Eutocus schmithi Bell, 1930) (Fig. 15). A number of species have been misclassified between these genera, for example, Lattus arabupuana Bell, 1932) was placed in Eutocus before. Due to close relationship between the six genera, it may be advantageous to consider all their species as congeneric within a larger but phylogenetically compact Eutocus sister to Artines Godman, 1901 (type species Thracides aepitus Geyer, 1832), and treat other five genus-group names as its subgenera. We are not adopting this view here, but offering it for consideration.

Lamponia ploetzii (Capronnier, 1874), new combination

Not monophyletic with Vettius Godman, 1901 (type species Papilio phyllus Cramer, 1777), where it was placed previously, Goniloba ploetzii Capronnier, 1874 instead groups within the species of Lamponia Evans, 1955 (type species Hesperia lamponia Hewitson, 1876) (Fig. 15), where it is transferred to form Lamponia ploetzii (Capronnier, 1874), new combination.

Gubrus Grishin, new genus

http://zoobank.org/B5CF60DB-22DD-4829-9DBD-8A673CF58BF0

Type species.

Vehilius lugubris Lindsey, 1925.

Definition.

Currently included in Vehilius Godman, 1900 (type species Cobalus illudens Mabille, 1891, a subspecies of Pamphila stictomenes Butler, 1877), but not monophyletic with it, and instead is a distant sister to Callimormus Scudder, 1872 (type species Callimormus juventus Scudder, 1872) (Fig. 15). A new genus is established here due to genetic and morphological differentiation of its currently sole member. Keys to J.28.5 in Evans (1955). The new genus is distinguished from its relatives, in particular from Callimormus, by the following combination of characters: no brands in male, uncus broader, not prominently narrowing distad (narrowing in Callimormus), divided, with knob-like arms, valva similar to Callimormus in shape, but rounder and harpe less separated from nearly straight to slightly convex ampulla, overlapping with it. In DNA, a combination of the following base pairs is diagnostic: aly1624.2.1:T259C, aly1624.2.1:T231C, aly164.4.1:A79T, aly3277.16.1:C892A, and aly1041.6.1:C56T.

Etymology.

The name is a masculine noun in the nominative singular, formed from the type species name: [lu] Gubr(u)s.

Species included.

Only the type species.

Parent taxon.

Subtribe Moncina A. Warren, 2008.

Mnestheus silvaticus Hayward, 1940, reinstated combination

Currently in Ludens Evans, 1955 (type species Cobalus ludens Mabille, 1891) probably due to wing pattern similarities, Mnestheus silvaticus Hayward, 1940 (type locality Argentina) is not monophyletic with it and instead is sister to Mnestheus Godman, 1901 (type species Phlebodes ittona Butler, 1870) (Fig. 15). To restore monophyly, we put it back in its original genus to form Mnestheus silvaticus Hayward, 1940, reinstated combination. Morphological characters, in particular undivided uncus and valva shape without a deep cleft between ampulla and harpe, support this placement.

Rigga spangla (Evans, 1955), new combination

Named by Evans (1955) in Mnasitheus Godman, 1900 (type species Mnasitheus cephis Godman, 1900, a junior subjective synonym of Cobalus chrysophrys Mabille, 1891), M. spangla is not monophyletic with it and is placed within Rigga Grishin, 2019 (type species Vorates auristriga Draudt, 1923) in our genomic tree (Fig. 15), implying a new combination Rigga spangla (Evans, 1955) that we adopt. Placement of R. spangla, new combination, in Sodalia Evans, 1955 (type species Pamphila sodalis Butler, 1877) suggested recently (Gaviria-Ortiz et al. 2020), is not supported by genomic analysis and is indeed at odds with the shape of stigma, uncus and valva, which are more similar to Rigga paramus (E. Bell, 1947) and Rigga sapala (Godman, 1900) than to Sodalia species.

Anthoptus macalpinei H. Freeman, 1969 is a junior subjective synonym of Anthoptus inculta (Dyar, 1918)

Sequencing of primary type specimens of Anthoptus macalpinei Freeman, 1969 (type locality Mexico: Veracruz) and Padraona inculta Dyar, 1918 (type locality Mexico, probably Veracruz) reveals the lack of genetic differentiation at the species level between them (Fig. 16). Their COI barcodes are 100% identical. They are similar phenotypically and were probably collected at nearby localities. Therefore, we consider them conspecific and propose that Anthoptus macalpinei is a new synonym of A. inculta.

Figure 16.

Figure 16.

Genomic tree of Anthoptina, Falgina and relatives. See Fig. 1 legend for notations.

Corticea schwarzi (E. Bell, 1941) and Corticea sylva (Hayward, 1942) are species distinct from Corticea mendica (Mabille, 1898)

Treated by Evans (1955) as subspecies of Corticea mendica (Mabille, 1898) (type locality Bolivia), Lerodea schwarzi Bell, 1941 (type locality Colombia: Cali) and Lerodea sylva Hayward, 1942 (type locality Ecuador and Colombia: Muzo) show genetic differentiation among them at the level consistent with them being species-level taxa (Fig. 16). For example, COI barcodes of L. schwarzi and L. sylva differ by 2.6% (17 bp) and of C. mendica and L. sylva by 5.3% (35 bp). Their wing pattern differences and localities are consistent with these results. Therefore, we reinstate Corticea schwarzi (E. Bell, 1941) and Corticea sylva (Hayward, 1942) as species.

Corticea vicinus (Plötz, 1884), new combination

Apaustus vicinus Plötz, 1884 (Herrich-Schäffer in litt.) (type locality not specified) has been placed in his new genus Lento by Evans (1955) (type species Pamphila lento Mabille, 1878), who probably examined Godman’s copy of an unpublished illustration of this species by Plötz (Fig. 12r) in the Natural History Museum, London, but have not seen any specimens. Although there is general resemblance between the illustration and some of Lento species, the agreement is not ideal. Lento species tend to have forewing discal band invading discal cell, or the discal cell spot separate from the band, or hindwing mostly orange above, not with an broad and long orange band as in A. vicinus. We found two old specimens, one in the ZMHB and the other in the MTD (Fig. 12s,t) labeled “vicinus” that agreed with the Plötz illustration much better than any of the Lento species. Presently, we consider these specimens to be A. vicinus, but are conducting additional studies about its identity. The specimen in the ZMHB is from the Staudinger collection and may even be a possible syntype of A. vicinus. Both specimens are not Lento but Corticea Evans, 1955 (type species Hesperia corticea Plötz, 1882), identified by their phenotype as closely resembling Corticea schwarzi (E. Bell, 1941) (type locality Colombia) and differing from it mostly in the shape of orange band on hindwing above also reflected in the pattern differences below. We sequenced the specimen in MTD, from Colombia: Magdalena (NVG-18096C08), along with another specimen of this species in the CMNH (NVG-21012E11), and our genomic tree placed it as sister to Corticea sylva (Hayward, 1942) (type locality Ecuador) in the same clade with C. schwarzi (Fig. 16), differing from C. sylva by 2.6% (17 bp) in COI barcode. Therefore, we transfer Apaustus vicinus from Lento to Corticea forming Corticea vicinus (Plötz, 1884), new combination. Curiously, the C. vicinus specimen largely shares mitochondrial genome with C. schwarzi, for example, COI barcode difference between them in only 0.6% (4 bp), possibly due to introgression or hybrid origin of this species that is closer to C. sylva in nuclear genome, but in wing patterns is more similar to C. schwarzi.

Pyrrhocalles Mabille, 1904 and Asbolis Mabille, 1904 are junior subjective synonyms of Choranthus Scudder, 1872

Genomic tree reveals that Choranthus Scudder, 1872 (type species Hesperia radians Lucas, 1857) is paraphyletic with respect to Pyrrhocalles Mabille, 1904 (type species Pamphila antiqua Herrich-Schäffer, 1863) and Asbolis Mabille, 1904 (type and the only species Goniloba sandarac Herrich-Schäffer, 1865, a junior subjective synonym of Eudamus capucinus Lucas, 1857), which are sisters (Fig. 16). Genetic differentiation between the species in these three genera is similar to that in their close relatives Corticea Evans, 1955 and Anthoptus E. Bell, 1942 (type species Hesperia epictetus Fabricius, 1793). With only Asbolis capucinus being abnormally distinct in its wing shapes and patterns, other species are more similar, for example, Choranthus lilliae E. Bell, 1931 resembles a smaller version of Pyrrhocalles jamaicensis (Schaus, 1902). Therefore, it appears that the best way to restore monophyly is to consider all these species congeneric and propose Pyrrhocalles and Asbolis as new synonyms of Choranthus.

New combinations: Choranthus orientis (Skinner, 1920), revised status, and Choranthus orientis eleutherae (Bates, 1934)

Pyrrhocalles antiqua form orientis Skinner, 1920 (type locality Cuba: Guantanamo) differs phenotypically (Evans 1955) and genetically from the nominal Pamphila antiqua Herrich-Schäffer, 1863 (type locality “Cuba”, recte Haiti) (Fig. 16). COI barcode difference between P. antiqua and the [holo]type of P. a. f. orientis is 2.3% (15 bp, specimens NVG-8060 and NVG-15095F10). Therefore, we consider Choranthus orientis (Skinner, 1920), revised status to be a species-level taxon. Phemiades antiqua eleutherae M. Bates, 1934 (type locality Bahamas: S. Eleuthera) is sister to C. orientis and not to C. antiqua, therefore we place this subspecies under orientis to form a new combination Choranthus orientis eleutherae (Bates, 1934).

Methionopsis typhon Godman, 1901 is a junior subjective synonym of Methionopsis ina (Plötz, 1882)

Inspecting Plötz unpublished drawing, Godman concluded that Hesperia ina Plötz, 1882 from Panama: Chiriqui is a synonym of his Methionopsis modestus Godman, 1901 (type locality Mexico (Gue, Ver, and Tab), Guatemala, Honduras, Panama, and Brazil) (Godman 1907). However, sequencing of M. ina specimens with the “Typus” label in the ZMHB (sampled as NVG-18052A01) reveals that it is not M. modestus, but instead it clusters within Methionopsis typhon Godman, 1901 (type locality Guatemala) (Fig. 16). The shape of the brands supports genomic assessment. The ina “Typus” specimen agrees with the original description of ina and carries the labels consistent with it being a syntype: it is labeled from “Chiriqui”, collected in 1874 (prior to ina description) and one of the labels refers to the number 261, which is the illustration number (“t. 261”) Plötz assigned to ina. This specimen is a true syntype, and to ensure stability of nomenclature, N.V.G. hereby designates it as the lectotype of Hesperia ina Plötz, 1882. The specimen can be recognized by its head turned to the left and partly uncurled proboscis. It is illustrated in Warren et al. (2016) and bares DNA sample label NVG-18052A01. We do not have evidence to consider M. typhon a species distinct from M. ina and therefore suggest that the latter is the senior name for M. typhon, new synonym.

Methionopsis modestus Godman, 1901 is a valid name

Incorrectly considered a synonym of Hesperia ina Plötz, 1882 (type locality Panama: Chiriqui), which is conspecific with Methionopsis typhon Godman, 1901 (type locality Guatemala) instead, Methionopsis modestus Godman, 1901 (type locality Mexico (Gue, Ver, and Tab), Guatemala, Honduras, Panama, and Brazil) becomes a valid name for the species referred previously to as Methionopsis ina. This species is characterized by a long brand above vein CuA2 on the forewing (Evans 1955).

Miltomiges Mabille, 1903 is a junior subjective synonym of Methionopsis Godman, 1901

Monotypic genus Miltomiges Mabille, 1903 (type and the only species Cobalus cinnamomea Herrich-Schäffer, 1869) is sister to Methionopsis modestus Godman, 1901, the type species of Methionopsis Godman, 1901, rendering this genus paraphyletic (Fig. 16). Although unique in ventral wing pattern, M. cinnamomea is similar to Methionopsis species in genitalia, in particular in the shape of uncus, gnathos and valva (Evans, 1955), in addition to genetic closeness. Therefore, to restore the monophyly of Methionopsis, we place cinnamomea in this genus, making Miltomiges a junior subjective synonym of Methionopsis.

Thargella volasus (Godman, 1901), new combination, is a valid species and Methionopsis dolor Evans, 1955 is its junior subjective synonym

Sequencing of the holotype of Eutocus volasus Godman, 1901 (type locality Panama: Chiriqui, NVG-15036A12) in the ZMHB reveals that it is not closely related to Eutocus facilis (Plötz, 1884) (type locality Suriname) and therefore is not its junior subjective synonym as currently assumed. Instead, E. volasus clusters closely with specimens we identified as Methionopsis dolor Evans, 1955 (type locality Colombia: Cauca) from Costa Rica and Panama (Fig. 16). Moreover, named by Evans (1955) in Methionopsis Godman, 1901 (type species Methionopsis modestus Godman, 1901), dolor is not monophyletic with it and instead originates near Thargella Godman, 1900 (type species Hesperia caura Plötz, 1882) (Fig. 16). Therefore, not willing to propose monotypic genera in the presence of confident relationship, we propose Thargella volasus (Godman, 1901), new combination. Then, pending further studies of its holotype, we tentatively place Methionopsis dolor Evans, 1955 as a junior subjective synonym of T. volasus. Furthermore, we note that T. volasus is rather distant from T. caura genetically, despite some similarity in genitalia, and a new subgenus is proposed for it and its to-be-discovered close relatives.

Volus Grishin, new subgenus

http://zoobank.org/68E90C79-0033-4994-97BC-3441C8D33B1B

Type species.

Eutocus volasus Godman, 1901.

Definition.

In the same clade with Propapias Mielke, 1992 (type species Rhinthon proximus Bell, 1934, a subjective junior synonym of Cymaenes sipariana Kaye, 1925) and Synapte Mabille, 1904 (type species Carystus salenus Mabille, 1883), but closer related to Thargella Godman, 1900 (type species Hesperia caura Plötz, 1882), and defined as its subgenus (Fig. 16). Keys to J.8.2 in Evans (1955). Distinguished from its relatives by the following combination of characters: antennae longer than 2/3 of forewing costa, palpi slender, with long and thin 3rd segment; forewing costa more convex than in most dark-brown Hesperiidae, but less convex than in the nominotypical subgenus Thargella, forewing without brand above vein CuA2; uncus terminally narrowing, bifid, valva length about thrice of its height, harpe narrow, claw-like, pointed dorsad and separated from ampulla. In DNA, a combination of the following base pairs is diagnostic: aly1341.12.28:A8953C, aly1603.19.3:A81G, aly1591.7.3:T313A, aly1591.7.3:C314G, and aly1672.3.1:T709A.

Etymology.

The name is a feminine noun in the nominative singular, derived from the type species name: Vol[as]us.

Species included.

Only the type species.

Parent taxon.

Genus Thargella Godman, 1900.

Pseudopapias Grishin, new subgenus

http://zoobank.org/CA8F6588-7E24-496A-BE4F-2A6A51FAB9FE

Type species.

Papias tristissimus Schaus, 1902.

Definition.

Previously placed in Papias Godman, 1900 (type species Pamphila integra Mabille, 1891), in subtribe Moncina A. Warren, 2008, but not monophyletic with it and instead belongs to subtribe Falgina Grishin, 2019 (Fig. 16), being closer related Propapias Mielke, 1992 (type species Rhinthon proximus Bell, 1934, a subjective junior synonym of Cymaenes sipariana Kaye, 1925) and, in particular, to Thargella Godman, 1900 (type species Hesperia caura Plötz, 1882) and. Keys to J.36.9 in Evans (1955), where it is placed as a subgenus. Distinguished from its relatives by the following combination of characters: males with prominent oval brand above forewing vein 1A+2A, antennae longer than half of costa, genitalia remind of Propapias: uncus arms long and thin, longer than tegumen, saccus short, shorter than penis width, but differ by nearly rectangular valva with a broad tooth-like projection near the middle by costa and narrow tooth-like upturned harpe narrowly separated from ampulla. In DNA, a combination of the following base pairs is diagnostic: aly536.210.3:A34C, aly173.33.1:A894T, aly2793.1.1:T1014C, aly1155.15.1:A383A (not G), aly598.2.1:C466C (not A), aly315.12.2:G1169G (not C), aly1341.12.28:A8953A (not C), aly1591.7.3:T313T (not A), and aly1591.7.3:C314C (not G).

Etymology.

The name is a masculine noun in the nominative singular, derived from the genus name where the type species has been placed previously but does not belong despite some superficial similarities.

Species included.

Only the type species.

Parent taxon.

Genus Thargella Godman, 1900.

Mnasinous Godman, 1900 is a subgenus of Methionopsis Godman, 1901

A monotypic genus Mnasinous Godman, 1900 (type and the only species Mnasinous patage Godman, 1900) is sister to Methionopsis Godman, 1901 (type species Methionopsis modestus Godman, 1901) and it show neither genetic (Fig. 16) nor phenotypic distinction to justify a monotypic genus. Indeed, the characteristic structure of the junction between harpe and ampulla is similar in M. patage and M. cinnamomea. Therefore we suggest that Mnasinous is a subgenus, new status. All other species currently included in Methionopsis belong to the nominotypical subgenus.

Mnasalcas Godman, 1900 is a valid genus

Currently a junior subjective synonym of Mnasitheus Godman, 1900 (type species Mnasitheus cephis Godman, 1900, a junior subjective synonym of Cobalus chrysophrys Mabille, 1891), Mnasalcas Godman, 1900 (type species Pamphila uniformis Butler and H. Druce, 1872, which is a junior subjective synonym of Cobalus simplicissima Herrich-Schäffer, 1870) in not monophyletic with it. Instead of Moncina A. Warren, 2008, Mnasalcas belongs to the subtribe Falgina Grishin, 2019, where it is in the same clade with Falga Mabille, 1898 (type species Carystus jeconia Butler, 1870) and Barrolla Grishin, 2019 (type species Paratrytone barroni Evans, 1955), and therefore is a valid genus (Fig. 16). In addition to the type species, Mnasitheus continua Evans, 1955 (type locality Bolivia) and Euroto ritans Schaus, 1902 (type locality Brazil: Rio de Janeiro), currently in Mnasitheus are transferred to Mnasalcas.

Mnasalcas thymoetes (Hayward, 1942) and Mnasalcas boyaca (Nicolay, 1973), new combinations

Mnasicles thymoetes Hayward, 1942 (type locality Ecuador) in not monophyletic with Mnasicles geta Godman, 1901, which is the type species of Mnasicles Godman, 1901, and Pamba boyaca Nicolay, 1973 (type locality Colombia: Boyaca) is not monophyletic with Pamba pamba Evans, 1955, which is the type species of Pamba Evans, 1955 (Fig. 16). Instead the two species are sisters of each other in the same clade with Mnasalcas Godman, 1900 (type species Pamphila uniformis Butler and H. Druce, 1872, which is a junior subjective synonym of Cobalus simplicissima Herrich-Schäffer, 1870) implying Mnasalcas thymoetes (Hayward, 1942), new combination, and Mnasalcas boyaca (Nicolay, 1973), new combination.

Koria Grishin, new genus

http://zoobank.org/72B44650-DA81-4698-980D-91FDD457216F

Type species.

Hesperia kora Hewitson, 1877.

Definition.

Genetically separated from Justinia Evans, 1955 (type species Hesperia justinianus Latreille, 1824), where it was previously placed, and possibly not even monophyletic with it due to weak statistical support, pending more detailed studies (Fig. 16), therefore proposed as a genus. Keys to J.49.2 in Evans (1955). Distinguished from Justinia by white above antennal club, flanges on tegumen, shorter uncus arms and expanded ampulla. In DNA, a combination of the following base pairs is diagnostic: aly363.37.2:C727A, aly813.4.4:T4508G, aly1222.14.14:A7170C, aly694.20.3:G480A, and aly694.20.3:T479C.

Etymology.

The name is a feminine noun in the nominative singular formed from the type species name.

Species included.

Only the type species.

Parent taxon.

Subtribe Falgina Grishin, 2019.

Septia Grishin, new subgenus

http://zoobank.org/B0752926-ED73-40E8-B044-F64974FFDED4

Type species.

Justinia septa Evans, 1955.

Definition.

While confidently monophyletic with Justinia Evans, 1955 (type species Hesperia justinianus Latreille, 1824) separated from the Justinia core group of species by a prominent genetic gap (Fig. 16) and therefore a distinct taxon. Keys to J.49.7a in Evans (1955). Distinguished from other Justinia species by small pale spot in discal cell on ventral hindwing, two such spots in forewing discal cell, and harpe not extending dorsally beyond ampulla. In DNA, a combination of the following base pairs is diagnostic: aly1222.15.2:A9212C, aly1651.2.5:C5104A, aly2178.30.1:A34G, aly1450.10.1:C985A, and aly208.17.4:A1281G.

Etymology.

The name is a feminine noun in the nominative singular formed from the type species name.

Species included.

The type species and Eutychide maculata Bell, 1930.

Parent taxon.

Genus Justinia Evans, 1955.

Corta Grishin, new genus

http://zoobank.org/E9A954DA-B466-473F-A726-442FD4014A11

Type species.

Eutychide lycortas Godman, 1900

Definition.

With species previously placed in Orthos Evans, 1955 (type species Eutychide orthos Godman, 1900), this genus is not monophyletic with it (Fig. 17). Keys to L.15.2 in Evans (1955). Distinguished from its relatives by the following combination of characters: antennae longer than half of costal margin; palpi flattened with the last segment short and stout, conical in shape; mid-tibiae with spines; males with short brand over vein 2 and long and wide brand over vein 1 (~1/3 of anal wing margin length); tegumen with a long distal apophysis reaching the end of uncus; uncus narrowing distad, rounded at the tip; gnathos close to uncus in lateral view, arms divergent, protruding on uncus sides in lateral view; penis widens distally, as wide as tegumen in lateral view; valva with expanded ampulla, harpe separated from it by a gap, upturned, serrated at its distal margin. In DNA, a combination of the following base pairs is diagnostic: aly235.16.1:A601T, aly235.16.1:A602C, aly208.50.8:G914C, aly1405.22.5:G41A, and aly86.14.2:T4498G.

Etymology.

The name is a feminine noun in the nominative singular formed from the type species name: [ly] Corta[s]. Also, it is phylogenetically near the genus Orthos and sounds similar to it.

Species included.

Only the type species.

Parent taxon.

Subtribe Carystina Mabille, 1878.

Comments.

Unusually patterned, Corta lycortas reminds of a small Talides sergestus (Cramer, 1775), a more distant relative from the same subtribe, and maybe to some extent others from two different subtribes: Lerema accius (J. E. Smith, 1797) (Moncina A. Warren, 2008) and female Lon zabulon (Boisduval and Le Conte, [1837]) or Lon taxiles (W. H. Edwards, 1881) (Hesperiina Latreille, 1809). However, there is no reason to expect that this pattern would be present in yet undiscovered members of the genus Corta, new genus, therefore the wing pattern characters were not included in the diagnosis of this genus.

Hesperia cinica Plötz, 1882 is a junior subjective synonym of Dubiella dubius (Stoll, 1781)

Suggested to belong to Tirynthia Godman, 1900 (type species Goniloba conflua Herrich-Schäffer, 1869) by Godman (1907) and kept there since as a valid species, Hesperia cinica Plötz, 1882 (type locality Brazil: Para) remains a mystery with no specimens known. Inspection of a Godman’s copy of the H. cinica Plötz’s illustration in BMNH, an inferior copy of which (too green instead of cedar-brown, dorsal hindwing spot without a long smudge present in the original copy) was apparently published by Draudt (1921–1924), reveals that it uniquely matches females of Dubiella dubius (Stoll, 1781) (type locality Suriname). More specifically, forewing is with single elongated discal cell spot along cubitus, white spots nearly in a row in cells CuA2-1A+2A, CuA1-CuA2, M3-CuA1, and M2-M3, a missing spot in cell M1-M2, three adjoining apical spots in a straight line, and yellow mark mid-costa below; hindwing is with a diffuse central pale mark dorsally, not expressed into a complete band as in some D. dubius specimens, ventrally mahogany-red-colored with discal white band from costa to anal margin, broken in cell 1A+2A-3A. Therefore, we place Hesperia cinica Plötz, 1882 as a junior subjective synonym of Dubiella dubius (Stoll, 1781).

Cobalus disjuncta Herrich-Schäffer, 1869 is a junior subjective synonym of Dubiella dubius (Stoll, 1781)

Cobalus disjuncta Herrich-Schäffer, 1869 (type locality not specified) placed in synonymy with Vettius lafrenaye (Latreille, [1824]) (type locality Brazil) by Evans (1955) and kept there since, is not that species according to its original description (Herrich-Schäffer 1869). Notably, the description states that “underside of the hindwing rusty-red colored with continuous sharp white horizontal band through the middle” in C. disjuncta, completely different from that of V. lafrenaye, whose hindwing is with a broad white triangular area as described for Vettius lafrenaye pica (Herrich-Schäffer, 1869) (type locality not specified), named in the same publication that proposed the name C. disjuncta. Moreover, Herrich-Schäffer listed Zenis minos (Latreille, [1824]) (type locality Brazil) as a synonym of his C. disjuncta, therefore the two species are expected to be similar. Herrich-Schäffer either misidentifed Z. minos or considered the differences between C. disjuncta and Z. minos to be intraspecific variation, because Z. minos lacks forewing pale spots in cells 1 (1A+2A and CuA2-1A+2A) and 5 (M1-M2), but has a well-developed spot in cell 8 (R3-R4). According to the original description, C. disjuncta is characterized by “FW cells 1–7 with spots” (Herrich-Schäffer 1869), not matching the characters of Z. minos. However, females of Dubiella dubius (Stoll, 1781) (type locality Suriname) are superficially similar to Z. minos in having mahogany-colored hindwing with a continuous white discal band, and they also have a spot in cell 1b (CuA2-1A+2A). Moreover, some D. dubius females have a dot in cell 5 (M1-M2, erroneously given as “space 4” by Evans (1955)), but may lack a spot in cell 8 (R3-R4, place of a 3rd apical spot; D. dubius females are identified by having “always 2 or 3 apical spots” per Evans (1955)). Thus, such females fully agree with the original description of C. disjuncta being spotted in forewing cells 1–7 and also differing from Dubiella fiscella (Hewitson, 1877) (type locality Brazil: Para; no spots in cells 5 and 7 (M1-M2 and R4-R5) per Evans (1955)). Therefore, we tentatively place Cobalus disjuncta Herrich-Schäffer, 1869 as a junior subjective synonym of Dubiella dubius (Stoll, 1781). We consider this placement tentative due to possible variation in the number of white spots, and acknowledge that it is conceivable for some females of D. fiscella (Hewitson, 1877) (type locality Brazil: Para) to have at least very small white dots in forewing cells 5 and 7 (M1-M2 and R4-R5) in addition to a larger round spot in cell 6 (R5-M1), thus agreeing with the original description of C. disjuncta. A search for C. disjuncta syntypes and, if necessary, neotype designation will settle this issue.

Sacrator Evans, 1955 is a junior subjective synonym of Thracides Hübner, [1819]

The two known species of Sacrator Evans, 1955 (type species Hesperia sacrator Godman and Salvin, 1879) originate within Thracides Hübner, [1819] (type species Papilio phidon Cramer, 1779) and thus render it paraphyletic (Fig. 17). Due to genetic and morphological (Evans 1955) similarities of all these species forming a compact clade with genetic differentiation comparable to that of related genera, we restore the monophyly by treating Sacrator as a new junior subjective synonym of Thracides Hübner, [1819].

Vertica brasta (Evans, 1955), new combination

Named by Evans (1955) in Lychnuchus Hübner, [1831] (type species Lychnuchus olenus Hübner, [1831], which is a junior subjective synonym of Hesperia celsus Fabricius, 1793), brasta (type locality Peru: Chanchamayo) is not in the same subtribe with it (in Carystina Mabille, 1878, while Lychnuchus celsus is in Moncina A. Warren, 2008) and confidently clusters with specimens identified as being in the genus Vertica Evans, 1955 (type species Hesperia verticalis Plötz, 1882) (Fig. 17). Due to this confident relationship arguing against a monotypic new genus for brasta, we propose Vertica brasta (Evans, 1955), new combination.

Brasta Grishin, new subgenus

http://zoobank.org/CD758877-73A0-4CF6-A0B9-4DD661B0E90B

Type species.

Lychnuchus brasta Evans, 1955.

Definition.

As argued above, we placed Lychnuchus brasta Evans, 1955 in Vertica Evans, 1955 (type species Hesperia verticalis Plötz, 1882) (Fig. 17). However, it is rather distant from other congeners, for example its COI barcode differs from the type species of the genus by 10.8% (71 bp). Combined with phenotypic distinction, these differences argue for placing L. brasta in a subgenus separate from other Vertica. This new subgenus keys to K.12.3 in Evans (1955). Distinguished from its relatives by the following combination of characters: antennae long, longer than half of costa; palpi bulky, quadrantic with short and stout third segment; male with long and narrow brands above and below both veins 1A+2A and CuA2; uncus wider and aedeagus broader than in Vertica, harpe of valva without hooks or processes. In DNA, a combination of the following base pairs is diagnostic: aly10226.56.1:G163A, aly1186.4.1:A1079G, aly1313.27.7:C1522A, aly851.5.4:A154A (not G), aly1838.46.1:A323A (not G), and aly1838.8.2:T446T (not A).

Etymology.

The name is a feminine noun in the nominative singular, tautonymous with the type species name.

Species included.

Only the type species.

Parent taxon.

Genus Vertica Evans, 1955.

Calvetta Grishin, new genus

http://zoobank.org/8EA0229D-7B8C-4D34-AC64-4A7FEAE2D5F4

Type species.

Hesperia calvina Hewitson, 1866

Definition.

With species previously placed in Cobalus Hübner, [1819] (type species Papilio virbius Cramer, 1777), this genus is not monophyletic with it (Fig. 17). Keys to K.22.2 in Evans (1955). Distinguished from its relatives by the following combination of characters: mid-tibiae without spines, palpi orange-yellow on the sides. uncus broad-ended, expanded on the sides (instead of nearly rectangular in Cobalus), narrower in lateral view, harpe wider separated from ampulla without teeth or processes. In DNA, a combination of the following base pairs is diagnostic: aly527.15.2:T105G, aly281.17.1:A271C, aly451.25.1:T1415A, aly6002.2.1:A223G, and aly6002.2.1:T310A.

Etymology.

The name is a feminine noun in the nominative singular formed from the type species name with elaborations to avoid homonyms.

Species included.

Only the type species.

Parent taxon.

Subtribe Carystina Mabille, 1878.

Comments.

Hesperia discors Plötz, 1882 is known only from its description and unpublished illustration. Evans (1955) misunderstood the concept of Hesperia discors Plötz, 1882 and placed it next to C. calvina in Cobalus, where neither of these species belongs. Calvetta new genus would be a better place for H. discors than Cobalus. Until its type specimens are found or H. discors is re-discovered, we are not able to place it with confidence, but venture a tentative assignment of H. discors to Carystina Evans, 1955 next to C. lysiteles (Mabille, 1891) due to similarities in wing patterns.

Moeros Evans, 1955, Argon Evans, 1955, and Synale Mabille, 1904 are subgenera of Carystus Hübner, [1819]

Moeros Evans, 1955 (type and the only species Proteides moeros Möschler, 1877), Argon Evans, 1955 (type species Carystus argus Möschler, 1879, which is a junior subjective synonym of the only valid species name in the genus Hesperia lota Hewitson, 1877), and Synale Mabille, 1904 (type species Papilio hylaspes Stoll, 1781) form a prominent clade together with Carystus Hübner, [1819] (type species Papilio jolus Stoll, [1782]) (Fig. 17). Moreover, some of the species currently placed in Carystus should belong to Synale. For these reasons, we propose to treat Moeros, Argon, and Synale as subgenera of Carystus, and transfer the following species from the subgenus Carystus to the subgenus Synale: Carystus phorcus (Cramer, 1777), Carystus diores (Plötz, 1882), Carystus junior Evans, 1955, and Carystus ploetzi O. Mielke and Casagrande, 2002.

Zetka irena (Evans, 1955), new combination

A Costa Rican species recorded in Janzen and Hallwachs database (2021) as “Neoxeniades Burns03”, which judging from the wing patterns is either Neoxeniades irena Evans, 1955 (type locality Ecuador, holotype female in BMNH inspected) or its close undescribed relative, is sister to Zetka zeteki (E. Bell, 1931) (Fig. 17), the type species of Zetka Grishin, 2019, and not as closely related to Neoxeniades Hayward, 1938 (type species Neoxeniades musarion Hayward, 1938), suggesting Zetka irena (Evans, 1955), new combination.

Bina Grishin, new subgenus

http://zoobank.org/B51324A7-3BB1-4987-9EB8-208369F1CD1A

Type species.

Cobalus gabina Godman, 1900.

Definition.

Previously included in Orthos Evans, 1955 (type species Eutychide orthos Godman, 1900) this taxon is in a different clade and is sister to Neoxeniades Hayward, 1938 (type species Neoxeniades musarion Hayward, 1938) (Fig. 17). Due to its close relationship with Neoxeniades and monotypic composition, it is proposed as a subgenus. Keys to L.15.4 in Evans (1955). Distinguished from its relatives by the following combination of characters: antennae longer than costal margin, forewing with short brands on both sides of vein CuA2 and over vein 1A+2A; hindwing with convex outer margin, only moderately produced at tornus, but forewing in males narrower apically than in Neoxeniades; uncus distally notched, gnathos shorter than uncus, valva twice as long as wide, terminally rounded, harpe separated from flattened ampulla by a small notch, serrated at the dorsal margin. In DNA, a combination of the following base pairs is diagnostic: aly956.3.2:G153A, aly103.11.2:A2076G, aly1841.5.6:C285G, aly1341.12.28:A1324G, and aly1146.51.1:A1222T.

Etymology.

The name is a feminine noun in the nominative singular, last two syllables of the type species name.

Species included.

Only the type species.

Parent taxon.

Genus Neoxeniades Hayward, 1938.

Neoxeniades parna (Evans, 1955), new combination

Niconiades parna (Evans, 1955 (type locality Brazil: Para) is not monophyletic with Niconiades Hübner, [1821] (type species Niconiades xanthaphes Hübner, [1821]), in Moncina A. Warren, 2008, but instead is within Neoxeniades Hayward, 1938 (type species Neoxeniades musarion Hayward, 1938), in Carystina Mabille, 1878 (Fig. 17). The shape of valva and extended slightly bilobed uncus agree with this placement. Therefore we propose Neoxeniades parna (Evans, 1955), new combination.

Saliana vixen Evans, 1955 is a junior subjective synonym of Neoxeniades parna (Evans, 1955)

Inspection of the holotype Saliana vixen Evans, 1955 (type locality French Guiana) in BMNH reveals that it is similar to females of a Costa Rican species recorded in Janzen and Hallwachs database (2021) as “Neoxeniades Burns04”, which is closely related to Neoxeniades parna (Evans, 1955) (type locality Brazil: Para) (Fig. 17), suggesting that it is not Calpodes Hübner, [1819] (type species Papilio ethlius Stoll, 1782), which now includes Saliana Evans, 1955 (type species Papilio salius Cramer, 1775) (Zhang et al. 2019d), but a female of N. parna. Notably, the S. vixen holotype has no hyaline spot in forewing cell M2-M3 characteristic of Calpodes and has extensive bright emerald-green overscaling on the body above absent in Calpodes species. The names parna and vixen were published in the same work issued on the same date (Evans 1955), and here we give priority to the name parna. Therefore, we suggest that Saliana vixen (Evans, 1955) is a junior subjective synonym of Neoxeniades parna (Evans, 1955).

Oz Grishin, new genus

http://zoobank.org/48DA2281-9ED8-4962-A6BA-BB2A8E060F20

Type species.

Astictopterus ozias Hewitson, 1878.

Definition.

Superficially very similar to Lychnuchoides saptine (Godman and Salvin, 1879), the type species of Lychnuchoides Godman, 1901 and was placed in it. However, not monophyletic with L. saptine (Fig. 17) and instead forms a clade of its own closer to the base of the tree. Keys to K.29.3 in Evans (1955). Distinguished from its relatives by the following combination of characters: apiculus of antennae obtuse (not angled); nudum of about 13 segments; mid-tibiae without spines; males with a narrow stigma on forewing, no brands; gnathos developed, not as broad as in many relatives, arms converging, separated from uncus in lateral view; harpe expanded in the middle, longer than valva. See comments below about wing pattern characters. In DNA, a combination of the following base pairs is diagnostic: aly291.6.1:G208T, aly971.19.1:T1347C, aly207.8.6:A119G, aly207.8.6:A118C, and aly423.15.3:A165T.

Etymology.

The name is a masculine noun in the nominative singular, the first syllable of the type species name.

Species included.

The type species and Lychnuchoides sebastiani Salazar and Constantino, 2013.

Parent taxon.

Tribe Pericharini Grishin, 2019.

Comments.

The lack of monophyly between O. ozias and L. saptine took us by surprise due to close similarity in their wing patterns, for example, a nearly perfect agreement in the outline of forewing yellow patch and the resemblance in pale stripes separating darker patches on ventral hindwing. In the field, the best character to distinguish between the two genera is the pattern on the forewing apex below. In Oz, new genus, the wing is mostly brown past the yellow discal band, and the pale overscaling starts near the apex, at more than half the distance from the yellow band and apex. In Lychnuchoides, the wing is with a smaller brown patch (less than half of the distance from the yellow band to apex along costa) past the yellow discal band, and the rest of the apical area is occupied by pale overscaling, typically with several elongated brown spots inside it.

Lychnuchoides Godman, 1901 is a junior subjective synonym of Perichares Scudder, 1872

The type species of Lychnuchoides Godman, 1901, Hesperia saptine Godman and Salvin, 1879, is placed within Perichares Scudder, 1872 (type species Papilio coridon Fabricius, 1775, a homonym, considered to refer to Papilio philetes Gmelin, [1790]) and is sister to the clade formed by Perichares chima Evans, 1955 and Perichares seneca (Latreille, [1824]), rendering Perichares paraphyletic (Fig. 17). To restore monophyly, due to close clustering of all these species in the tree, we consider Lychnuchoides to be a subjective junior synonym of Perichares.

Orphina Grishin, new subtribe

http://zoobank.org/3DFB5B82-69E0-4B21-BF46-AEE78715AB34

Type genus.

Orphe Godman, 1901.

Definition.

Genomic phylogeny strongly supports sister relationship of Orphe Godman, 1901 (type species Hesperia gerasa Hewitson, 1867) and Pseudorphe A. Warren and Dolibaina, 2015 (type and the only species Telles pyrex Evans, 1955) and places them as distant sister to all other Pericharini Grishin, 2019 (Fig. 17). Due to this prominent genetic differentiation, the clade consisting of Orphe and Pseudorphe is defined here as a new subtribe. It keys to K.27 or K.19.2 in Evans (1955), and is diagnosed by a combination of the following characters: antennae long, nearly 2/3 of costa length; palpi quadrantic, 2nd segment not flattened; mid-tibiae smooth; forewings produced, hindwing rounded; in males, stigma sharply defined, continuous, either straight and lanceolate, or slightly curved inwards; in females, white spots present in every forewing cell between veins R3 and 1A+2A, including discal cell, forming an F (not Ш) on left wing; male genitalia with valva nearly rectangular, costa slightly convex, ampulla knob-like, harpe only slightly extending posteriad beyond ampulla and narrowly separated from it, terminally upturned, either rounded or ending in a tooth, aedeagus either stout and bulky or slender with coecum nearly as long as the rest of aedeagus, aedeagus with broad and long vesica opening. In DNA, a combination of the following base pairs is diagnostic: aly5007.4.1:T321C, aly2618.5.1:G4345A, aly2096.17.2:C490A, aly1074.4.1:G376A, and aly2613.3.2:A1493C.

Genera included.

The type genus and Pseudorphe A. Warren and Dolibaina, 2015.

Parent taxon.

Tribe Pericharini Grishin, 2019.

Comments.

Genetic differentiation of the new subtribe from the nominotypical subtribe Pericharina is quite substantial, and the branch that unties them is not particularly prominent in the genomic tree (Fig. 17). Therefore, it is conceivable to treat them both as distinct tribes. This view is not adopted here, because Orphina, new subtribe, includes a small number of species (only three) and they resemble Pericharina in general appearance.

Carystoidina Grishin, new subtribe

http://zoobank.org/A99BE530-AD8F-4711-8AF4-D58F4C08FCF4

Type genus.

Carystoides Godman, 1901.

Definition.

Genomic phylogeny reveals that Carystoides Godman, 1901 is not monophyletic with Calpodina Clark, 1948 (type genus Calpodes Hübner, [1819]), where it was placed by Warren et al. (2009) (as Calpodini) (Fig. 17). Furthermore, Carystoides is not monophyletic with Carystina Mabille, 1878 (type genus Carystus Hübner, [1819]) either. Instead, the subtribe here defined is a strongly supported sister to the rest of Megathymini (Fig. 17), but is morphologically distinct from it. The subtribe keys to K.28 in Evans (1955) and is diagnosed by a combination of the following characters: antennae longer than half of the forewing costal margin, club gradually bent into apiculus at about its half, with a white patch in males; palpi broad and quadrantic with short and stout last segment; atypical forewing venation in males: vein CuA1 originates in the middle between veins CuA2 and M3, but in females vein CuA1 originates near vein M3, causing sexual dimorphism in mutual arrangement of forewing white spots. In DNA, a combination of the following base pairs is diagnostic: aly113.11.4:G356A, aly86.8.16:G563C, aly1146.46.2:G569A, aly1146.46.2:A571C, and aly1200.3.1:G3549A.

Genera included.

Only the type genus.

Parent taxon.

Tribe Megathymini J. Comstock and A. Comstock, 1895.

Comments.

The placement of Carystoides into Megathymini was rather unexpected, and at last we apparently found the closest living relative of Giant-Skippers. Even morphological similarities link these groups, for example, Carystoides balza Evans, 1955 valva is similar to some Agathymus Freeman, 1959 species: harpe distally upturned and with a directed caudad process by ampulla. All other Megathymini except Carystoides are kept in a single subtribe Megathymina.

Balma Grishin, new subgenus

http://zoobank.org/DA438D8C-677C-40A0-B5A4-3713BC42D473

Type species.

Carystoides balza Evans, 1955.

Definition.

Carystoides Godman, 1901 (type species Hesperia basoches Latreille, [1824]) divides into two prominent clades (Fig. 17) one of which is this subgenus. Keys to K.28.5 or K.28.11 in Evans (1955). Distinguished from other species in the genus Carystoides by the hind tibiae lacking upper spurs, contrasting dark veins in the white apex of dorsal forewing in males, and harpe with a bulky process pointed caudad by ampulla. In DNA, a combination of the following base pairs is diagnostic: aly207.9.6:C320T, aly4192.1.2:G731A, aly536.164.4:G55A, aly1139.42.5:T64C, and aly2781.1.15:C208T.

Etymology.

The name is a feminine noun in the nominative singular formed as a fusion of the species names: Bal[za] + [maro]ma.

Species included.

The type species and Caristus [sic] maroma Möschler, 1877.

Parent taxon.

Genus Carystoides Godman, 1901.

Supplementary Material

supplementary file

Acknowledgments

We acknowledge Leina Song, Ping Chen and Ming Tang for excellent technical assistance. We are grateful to David Grimaldi and Courtney Richenbacher (American Museum of Natural History, New York, NY, USA), Blanca Huertas, David Lees and Geoff Martin (Natural History Museum, London, UK), Jonathan Pelham (Burke Museum of Natural History and Culture, Seattle, WA, USA), Jim Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late John Rawlins (Carnegie Museum of Natural History, Pittsburgh, PA, USA), Paul A. Opler, Chuck Harp and Boris Kondratieff (Colorado State University Collection, Fort Collins, CO, USA), Crystal Maier and Rebekah Baquiran (Field Museum of Natural History, Chicago, FL, USA), Weiping Xie (Los Angeles County Museum of Natural History, Los Angeles, CA, USA), John R. MacDonald and Richard L. Brown (Mississippi Entomological Museum, Starkville, MS, USA), Andrew D. Warren and Andrei Sourakov (MGCL: McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA), Rodolphe Rougerie (Muséum National d’Histoire Naturelle, Paris, France), Matthias Nuss (MTD: Museum für Tierkunde, Dresden, Germany), Gerardo Lamas (MUSM: Museo de Historia Natural, UNMSM, Lima, Peru), Larry F. Gall (PMNH: Peabody Museum of Natural History, Yale University, New Haven, CT, USA), Wolfgang A. Nässig (SMF: Natural History Museum, Frankfurt, Germany), Edward G. Riley, Karen Wright, and John Oswald (Texas A&M University Insect Collection, College Station, TX, USA), Alex Wild (TMMC: Biodiversity Center, University of Texas at Austin, Austin, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of Entomology, University of California, Davis, CA, USA), Robert K. Robbins, John M. Burns, and Brian Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA), Wolfram Mey and Viola Richter (ZMHB: Museum für Naturkunde, Berlin, Germany), and Axel Hausmann and Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung München, Germany), for granting access to specimens in the collections under their care and for stimulating discussions; to the Texas Parks and Wildlife Department (Natural Resources Program Director David H. Riskind) for the research permit 08-02Rev; to the U. S. National Park Service for the following research permits: Big Bend (Raymond Skiles) BIBE-2004-SCI-0011, Yellowstone (Erik Oberg and Annie Carlson) YELL-2017-SCI-7076; to the National Environment & Planning Agency of Jamaica for the permission to collect specimens; to Paul A. Opler and Rongjiang Wang for collecting and preserving specimens in RNAlater; to Ernst Brockmann, Bill Dempwolf, Bernard Hermier, John Shuey, the late Edward C. Knudson (specimens now at the McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA), John MacDonald, Kiyoshi Maruyama, Kojiro Shiraiwa, and Mark Walker for leg samples of their specimens, to Jim Brock and Bernard Hermier for photographs, to Ernst Brockmann for help with sampling specimens for DNA in a number of German collections, to Gerardo Lamas, Bernard Hermier and Jonathan Pelham for fruitful discussions and to Bernard Hermier for critical reading of the manuscript at its early stages and copious helpful suggestions and corrections. We are indebted to Bernard Hermier, Stephen R. Spomer and J. Bruce Walsh for providing critical reviews of the manuscript. Please note that the images ©The Trustees of the Natural History Museum, London are made available to you under Creative Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/), which means in particular that when using the images you must give appropriate credit and provide a link to the license. We acknowledge the Texas Advanced Computing Center (TACC) at The University of Texas at Austin for providing HPC resources. The study was supported in part by the grants (to N.V.G.) from the National Institutes of Health GM127390 and the Welch Foundation I-1505.

Footnotes

Contributor Information

Jing Zhang, Departments of Biophysics and Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX, 75390-8816 USA.

Qian Cong, Eugene McDermott Center for Human Growth and Development and Department of Biophysics, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX, 75390-8816 USA.

Jinhui Shen, Departments of Biophysics and Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX, 75390-8816 USA.

Nick V. Grishin, Howard Hughes Medical Institute and Departments of Biophysics and Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX, 75390-9050 USA

Literature Cited

  1. Austin GT. 2008. Hesperiidae of Rondônia, Brazil: Taxonomic comments on ‘night’ skippers, with descriptions of new genera and species (Lepidoptera: Eudaminae). Insecta Mundi 29: 1–36. [Google Scholar]
  2. Austin GT, Mielke OHH. 1998. Hesperiidae of Rondônia, Brazil: Aguna Williams (Pyrginae), with a partial revision and descriptions of new species from Panama, Ecuador, and Brazil. Revista brasileira de Zoologia 14(4): 889–965. [Google Scholar]
  3. Bell EL. 1946. A catalogue of the Hesperioidea of Venezuela. Boletín de Entomología venezolana 5(3/4): 65–203. [Google Scholar]
  4. Burns JM, Janzen DH, Hallwachs W, Hajibabaei M, Hebert PDN. 2010. Genitalia, DNA barcodes, larval facies, and food-plants place the mimetic species Neoxeniades molion in Rhinthon (Hesperiidae: Hesperiinae). Journal of the Lepidopterists’ Society 64(2): 69–78. [Google Scholar]
  5. Carneiro E, Mielke OHH, Casagrande MM. 2015. Two new species and taxonomic notes on species of Moeris Godman, 1900 (Hesperiidae, Hesperiinae, Moncini). The Journal of Research on the Lepidoptera 48: 29–37. [Google Scholar]
  6. Cong Q, Borek D, Otwinowski Z, Grishin NV. 2015a. Skipper genome sheds light on unique phenotypic traits and phylogeny. BMC Genomics 16: 639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cong Q, Borek D, Otwinowski Z, Grishin NV. 2015b. Tiger swallowtail genome reveals mechanisms for speciation and caterpillar chemical defense. Cell Reports 10(6): 910–919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cong Q, Li W, Borek D, Otwinowski Z, Grishin NV. 2018. The bear giant-skipper genome suggests genetic adaptations to living inside yucca roots. Molecular Genetics and Genomics 294(1): 211–226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cong Q, Shen J, Borek D, Robbins RK, Opler PA, Otwinowski Z, Grishin NV. 2017a. When COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings of the Royal Society B: Biological Sciences 284(1848): 20161735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cong Q, Shen J, Borek D, Robbins RK, Otwinowski Z, Grishin NV. 2016a. Complete genomes of hairstreak butterflies, their speciation, and nucleo-mitochondrial incongruence. Scientific Reports 6: 24863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cong Q, Shen J, Li W, Borek D, Otwinowski Z, Grishin NV. 2017b. The first complete genomes of metalmarks and the classification of butterfly families. Genomics 109: 485–493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cong Q, Shen J, Warren AD, Borek D, Otwinowski Z, Grishin NV. 2016b. Speciation in cloudless sulphurs gleaned from complete genomes. Genome Biology and Evolution 8(3): 915–931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cong Q, Shen J, Zhang J, Li W, Kinch LN, Calhoun JV, Warren AD, Grishin NV. 2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution 38(5): 2166–2176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cong Q, Zhang J, Grishin NV. 2019a. Genomic determinants of speciation. bioRxiv 837666. Available at 10.1101/837666 (Last accessed January 2022.) [DOI] [Google Scholar]
  15. Cong Q, Zhang J, Shen J, Grishin NV. 2019b. Fifty new genera of Hesperiidae (Lepidoptera). Insecta Mundi 0731: 1–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Cramer P 1777. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa en America. Papillons exotiques des trois parties du monde l’Asie, l’Afrique et l’Amérique. 2(9/16). S.J. Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp; Amsterdam. 151 p., pl. 97–192. [Google Scholar]
  17. Dolibaina DR, Mielke OH, Casagrande MM. 2014. Taxonomic revision of Cumbre Evans, 1955 (Hesperiidae: Hesperiinae: Moncini), with the description of two new species. Zootaxa 3841(1): 47–66. [DOI] [PubMed] [Google Scholar]
  18. Draudt MWK. 1921–1924. B. Grypocera, breitköpfige Tagfalter. p. 830–1011. In: Seitz A (ed.). Die Gross-Schmetterlinge der Erde. Bd. 5. Alfred Kernen; Stuttgart. 1141 p. [Google Scholar]
  19. Draudt MWK. 1922. B. Grypocera, breitköpfige Tagfalter. p. 873–880. In: Seitz A (ed.). Die Gross-Schmetterlinge der Erde. Bd. 5. Alfred Kernen; Stuttgart. 1141 p. [Google Scholar]
  20. Draudt MWK. 1923a. B. Grypocera, breitköpfige Tagfalter. p. 913–952. In: Seitz A (ed.). Die Gross-Schmetterlinge der Erde. Bd. 5. Alfred Kernen; Stuttgart. 1141 p. [Google Scholar]
  21. Draudt MWK. 1923b. B. Grypocera, breitköpfige Tagfalter. p. 953–992. In: Seitz A (ed.). Die Gross-Schmetterlinge der Erde. Bd. 5. Alfred Kernen; Stuttgart. 1141 p. [Google Scholar]
  22. Espeland M, Breinholt J, Willmott KR, Warren AD, Vila R, Toussaint EFA, Maunsell SC, Aduse-Poku K, Talavera G, Eastwood R, Jarzyna MA, Guralnick R, Lohman DJ, Pierce NE, Kawahara AY. 2018. A comprehensive and dated phylogenomic analysis of butterflies. Current Biology 28(5): 770–778. [DOI] [PubMed] [Google Scholar]
  23. Evans WH. 1932. The identification of Indian butterflies. Bombay Natural History Society; Mumbai. 454 [Google Scholar]
  24. Evans WH. 1934. Indo-Australian Hesperiidae: descriptions of new genera, species and subspecies. Entomologist 67: 61–65. [Google Scholar]
  25. Evans WH. 1937. A catalogue of the African Hesperiidae indicating the classification and nomenclature adopted in the British Museum. British Museum (Natural History); London. xii + 212 p., 30 pl. [Google Scholar]
  26. Evans WH. 1949. A catalogue of the Hesperiidae from Europe, Asia, and Australia in the British Museum (Natural History). British Museum (Natural History); London. xix + 502 p., 53 pl. [Google Scholar]
  27. Evans WH. 1951. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in the British Museum (Natural History). Part I. Introduction and Group A Pyrrhopyginae. British Museum (Natural History); London. x + 92 p., pl. 1–9. [Google Scholar]
  28. Evans WH. 1952. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in the British Museum (Natural History). Part II. Pyrginae. Section I. British Museum (Natural History). London. v + 178 p., pl. 10–25. [Google Scholar]
  29. Evans WH. 1953. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in the British Museum (Natural History). Part III. Pyrginae. Section 2. British Museum (Natural History); London. v + 246 p., pl. 26–53. [Google Scholar]
  30. Evans WH. 1955. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in the British Museum (Natural History). Part IV. Hesperiinae and Megathyminae. British Museum (Natural History); London. v + 499 p., pl. 54–88. [Google Scholar]
  31. Gaviria-Ortiz FG, Dolibaina DR, Carneiro E, Mielke OHH, Warren AD, Casagrande MM. 2020. A review of the Neotropical skipper genus Sodalia Evans, 1955 (Lepidoptera: Hesperiidae: Hesperiinae) with the description of a new species. Zootaxa 4877(1): 102–124. [DOI] [PubMed] [Google Scholar]
  32. Gilbert P 2000. Butterfly collectors and painters: four centuries of colour plates from the library collections of The Natural History Museum, London. Beaumont; Singapore. 166 p., 60 pl. [Google Scholar]
  33. Godman FD. 1907. Notes on the American species of Hesperiidae described by Plötz. Annals and Magazine of natural History (7) 20(16): 132–155. [Google Scholar]
  34. Godman FD, Salvin O. 1896. Biologia Centrali-Americana. Insecta. Lepidoptera-Rhopalocera. Dulau & Co., Bernard Quaritch; London. 2(131): 425–440, pl. 89. [Google Scholar]
  35. Godman FD, Salvin O. 1900a. Biologia Centrali-Americana. Insecta. Lepidoptera-Rhopalocera. Dulau & Co., Bernard Quaritch; London. 2(159): 533–556, pl. 97–98. [Google Scholar]
  36. Godman FD, Salvin O. 1900b. Biologia Centrali-Americana. Insecta. Lepidoptera-Rhopalocera. Dulau & Co., Bernard Quaritch; London. 2(160): 557–588, pl. 99–100. [Google Scholar]
  37. Hayward KJ. 1940. New species of Neotropical Hesperiidae from Ecuador (Lep.). Revista de Entomologia (Rio de Janeiro) 11(3): 861–877. [Google Scholar]
  38. Henao ER, Carneiro E, Mielke OH, Casagrade MM. 2015. Taxonomic notes on Wahydra Steinhauser (Hesperiidae, Hesperiinae, Anthoptini) with description of four new species. Zootaxa 4040(1): 59–73. [DOI] [PubMed] [Google Scholar]
  39. Herrich-Schäffer GAW. 1869. Prodromus systematis lepidopterorum. Versuch einer systematischen Anordnung der Schmetterlinge. Correspondenz-Blatt des zoologisch-mineralogischen Vereines in Regensburg 23(12): 184–204. [Google Scholar]
  40. Hewitson WC. 1877. Descriptions of twenty-five new species of Hesperidae. Annals and Magazine of natural History (4) 19(109): 76–85. [Google Scholar]
  41. Hoffmann C 1941. Catálogo sistemático y zoogeográfico de los lepidópteros mexicanos. Segunda parte. Hesperioidea. Anales del Instituto de Biología. Universidad nacional de México 12(1): 237–294. [Google Scholar]
  42. Huang ZF, Chiba H, Deng XH, Huang SY, Wang M, Fan XL. 2020. Molecular and morphological evidence reveals that Daimio Murray, 1875 is a junior synonym of Tagiades Hubner, 1819 (Lepidoptera: Hesperiidae: Tagiadini). Zootaxa 4731(4): 595–600. [DOI] [PubMed] [Google Scholar]
  43. Huang ZF, Chiba H, Fan XL. 2019. The third species of Darpa Moore, 1865 in China and some notes on the genus (Hesperiidae: Pyrginae: Tagiadini). Entomological News 128(3): 284–292. [Google Scholar]
  44. Huang ZF, Chiba H, Wang M, Fan XL. 2016. Establishment of a new genus for Abraximorpha heringi and A. pieridoides (Lepidoptera: Hesperiidae: Pyrginae: Tagiadini. Zootaxa 4173(2): 147–154. [DOI] [PubMed] [Google Scholar]
  45. Janzen DH, Hallwachs W. 2021. Caterpillars, pupae, butterflies & moths of the ACG. Available at http://janzen.sas.upenn.edu/caterpillars/database.lasso (Last accessed December 22, 2021.)
  46. Kawahara AY, Breinholt JW. 2014. Phylogenomics provides strong evidence for relationships of butterflies and moths. Proceedings of the Royal Society B: Biological Sciences 281(1788): 20140970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Kawahara AY, Plotkin D, Espeland M, Meusemann K, Toussaint EFA, Donath A, Gimnich F, Frandsen PB, Zwick A, Dos Reis M, Barber JR, Peters RS, Liu S, Zhou X, Mayer C, Podsiadlowski L, Storer C, Yack JE, Misof B, Breinholt JW. 2019. Phylogenomics reveals the evolutionary timing and pattern of butterflies and moths. Proceedings of the National Academy of Sciences of the United States of America 116(45): 22657–22663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Lamas G 1994. Butterflies of the Pampas del Heath, p. 73–74, 178–184. In: Foster RB, Carr JL, Forsyth AB (eds.). The Tambopata-Candamo reserved zone of Southeastern Perú: A biological assessment. RAP Working Papers 6 [ii] + 184 p. [Google Scholar]
  49. Lamas G 2021. An Annotated Bibliography of the Neotropical Butterflies and Skippers (Lepidoptera: Papilionoidea and Hesperioidea). Revised Electronic Edition. Available at: http://www.butterfliesofamerica.com/docs/Neotropical-Bibliography-2021.pdf (Last accessed December 22, 2021.) [Google Scholar]
  50. Larsen TB. 2005. The butterflies of West Africa. Apollo Books; Stenstrup. 595 p. [Google Scholar]
  51. Larsen TB, Collins SC. 2013. Kobelana: a new genus for two South African skippers currently placed in Calleagris Aurivillius (as C. kobela Aurivillius, 1925 and C. krooni Vári, 1974) (Lepidoptera: Hesperiidae: Pyrginae: Tagiadini). Metamorphosis 23: 8–15. [Google Scholar]
  52. Larsen TB, Congdon TCY. 2011. Triskelionia, a new African genus of the Celaenorrhinini (Lepidoptera: Hesperiidae) and the promotion of T. compacta to species-status. Zootaxa 3931(1): 53–58. [Google Scholar]
  53. Lewis HL. 1973. Butterflies of the World. Follett; Chicago. xvi + 312 p., 208 pl. [Google Scholar]
  54. Li W, Cong Q, Shen J, Zhang J, Hallwachs W, Janzen DH, Grishin NV. 2019. Genomes of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National Academy of Sciences of the United States of America 116(13): 6232–6237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Libert M 2014. Sur la taxonomie du genre Celaenorrhinus Hübner en Afrique: Lepidoptera, Hesperiidae. Michel Libert; Rouen. 272 p., 26 pl., 54 fig., 53 maps [Google Scholar]
  56. Llorente JE, Luis MA, Vargas A. 1990. Catálogo sistemático de los Hesperioidea de México. Publicaciones especiales del Museo de Zoología. Facultad de Ciencias. Universidad nacional autónoma de México; 1: 1–70. [Google Scholar]
  57. Mabille P 1888. Description de lépidoptères (hespérides) nouveaux. Le Naturaliste (2)2(31): 146–148. [Google Scholar]
  58. Mabille P 1889a. Diagnoses de lépidoptères nouveaux. Le Naturaliste (2)3(45): 25. [Google Scholar]
  59. Mabille P 1889b. Diagnoses de lépidoptères nouveaux. Le Naturaliste (2)3(49): 67–68. [Google Scholar]
  60. Mabille P 1891. Description d’hespérides nouvelles. Annales de la Société entomologique de Belgique 35: clxviii–clxxxvii. [Google Scholar]
  61. Mabille P 1903. Lepidoptera Rhopalocera. Fam. Hesperidae. Genera Insectorum 17a: 1–78. [Google Scholar]
  62. Maruyama K 1991. Butterflies of Borneo, Vol. 2, No. 2 Hesperiidae. Tobishma Corp.; Tokyo. 84 p. [Google Scholar]
  63. Medeiros ADD, Dolibaina DR, Carneiro E, Mielke OHH, Casagrande MM. 2019. Taxonomic revision of Artines Godman, 1901 (Hesperiidae: Hesperiinae: Moncini) with the description of nine new species. Zootaxa 4614(1): 1–49. [DOI] [PubMed] [Google Scholar]
  64. Mielke OHH. 2004. Hesperiidae. p. 25–86. In: Lamas G (ed.). Checklist: Part 4A. Hesperioidea - Papilionoidea. Association for Tropical Lepidoptera. Volume 5A. Scientific Publishers; Gainesville. xxxvi +439 p. [Google Scholar]
  65. Mielke OHH. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Sociedade Brasileira de Zoologia; Curitiba, Paraná, Brazil. xiii + 1536 p. [Google Scholar]
  66. Mielke OHH, Casagrande MM. 2002. Notas taxonômicas em Hesperiidae neotropicais, com descrições de novos taxa (Lepidoptera). Revista brasileira de Zoologia 19(Suplemento 1): 27–76. [Google Scholar]
  67. Miller JY. 1992. The common names of North American butterflies. Smithsonian Institution Press; Washington, D.C. ix + 177 p. [Google Scholar]
  68. Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32(1): 268–274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Plötz C 1882a. Die Hesperiinen-Gattung Hesperia Aut. und ihre Arten. Stettiner entomologische Zeitung 43(7/9): 314–344. [Google Scholar]
  70. Plötz C 1882b. Die Hesperiinen-Gattung Hesperia Aut. und ihre Arten. Stettiner entomologische Zeitung 44(1/3): 26–64. [Google Scholar]
  71. Plötz C 1882c. Einige Hesperiinen-Gattungen und deren Arten. Berliner entomologische Zeitschrift 26(1): 71–82. [Google Scholar]
  72. Plötz C 1884. Die Hesperiinen-Gruppe der Achlyoden. Jahrbücher des nassauischen Vereins für Naturkunde 37: 1–55. [Google Scholar]
  73. Robbins RK, Lamas G, Mielke OHH, Harvey DJ, Casagrande MM. 1996. Taxonomic composition and ecological structure of the species-rich butterfly community at Pakitza, Parque Nacional del Manu, Perú. p. 217–252. In: Wilson DE, Sandoval A (eds.). Manu. The biodiversity of southeastern Peru. Smithsonian Institution; Washington, DC. 679 p. [Google Scholar]
  74. Sahoo RK, Warren AD, Collins SC, Kodandaramaiah U. 2017. Hostplant change and paleoclimatic events explain diversification shifts in skipper butterflies (Family: Hesperiidae). BMC Evolutionary Biology 17(1): 174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Sahoo RK, Warren AD, Wahlberg N, Brower AV, Lukhtanov VA, Kodandaramaiah U. 2016. Ten genes and two topologies: an exploration of higher relationships in skipper butterflies (Hesperiidae). PeerJ 4: e2653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Schaus W 1902. Descriptions of new American butterflies. Proceedings of the United States national Museum 24(1262): 383–460. [Google Scholar]
  77. Schaus W 1913. New species of Rhopalocera from Costa Rica. Proceedings of the zoological Society of London 1913(3): 339–367. [Google Scholar]
  78. Selander RB, Vaurie P. 1962. A gazetteer to accompany the “Insecta” volumes of the “Biologia Centrali-Americana”. American Museum Novitates 2099: 1–70. [Google Scholar]
  79. Shen J, Cong Q, Borek D, Otwinowski Z, Grishin NV. 2017. Complete genome of Achalarus lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4): 366–374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Shen J, Cong Q, Grishin NV. 2015. The complete mitochondrial genome of Papilio glaucus and its phylogenetic implications. Meta Gene 5: 68–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Shen J, Cong Q, Grishin NV. 2016a. The complete mitogenome of Achalarus lyciades (Lepidoptera: Hesperiidae). Mitochondrial DNA Part B: Resources 1(1): 581–583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Shen J, Cong Q, Kinch LN, Borek D, Otwinowski Z, Grishin NV. 2016b. Complete genome of Pieris rapae, a resilient alien, a cabbage pest, and a source of anti-cancer proteins. F1000Research 5: 2631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Siewert RR, Mielke OHH, Casagrande MM. 2020. Taxonomic revision of the Neotropical genus Telemiades Hubner, [1819 (Lepidoptera: Hesperiidae: Eudaminae), with descriptions of fourteen new species. Zootaxa 4721(1): 1–111. [DOI] [PubMed] [Google Scholar]
  84. Steinhauser SR. 1987. Notes on the identity of the species-group names in the genera Urbanus and Astraptes (sensu Evans). Bulletin of the Allyn Museum 111: 1–16. [Google Scholar]
  85. Sukumaran J, Holder MT. 2010. DendroPy: a Python library for phylogenetic computing. Bioinformatics 26(12): 1569–1571. [DOI] [PubMed] [Google Scholar]
  86. Toussaint EFA, Breinholt JW, Earl C, Warren AD, Brower AVZ, Yago M, Dexter KM, Espeland M, Pierce NE, Lohman DJ, Kawahara AY. 2018. Anchored phylogenomics illuminates the skipper butterfly tree of life. BMC Evolutionary Biology 18(1): 101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Toussaint EFA, Chiba H, Yago M, Dexter KM, Warren AD, Storer C, Lohman DJ, Kawahara AY. 2021a. Afrotropics on the wing: phylogenomics and historical biogeography of awl and policeman skippers. Systematic Entomology 46(1): 172–185. [Google Scholar]
  88. Toussaint EFA, Ellis EA, Gott RJ, Warren AD, Dexter KM, Storer C, Lohman DJ, Kawahara AY. 2021b. Historical biogeography of Heteropterinae skippers via Beringian and post-Tethyan corridors. Zoologica Scripta 50(1): 100–111. [Google Scholar]
  89. Wahlberg N, Braby MF, Brower AV, de Jong R, Lee MM, Nylin S, Pierce NE, Sperling FA, Vila R, Warren AD, Zakharov E. 2005. Synergistic effects of combining morphological and molecular data in resolving the phylogeny of butterflies and skippers. Proceedings of the Royal Society B: Biological Sciences 272(1572): 1577–1586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Warren AD, Davis KJ, Stangeland EM, Pelham JP, Willmott KR, Grishin NV. 2016. Illustrated Lists of American Butterflies. [21-XI-2017]. Available at: http://www.butterfliesofamerica.com/ (Last accessed December 22, 2021.)
  91. Warren AD, Ogawa JR, Brower AVZ. 2008. Phylogenetic relationships of subfamilies and circumscription of tribes in the family Hesperiidae (Lepidoptera: Hesperioidea). Cladistics 24(5): 642–676. [Google Scholar]
  92. Warren AD, Ogawa JR, Brower AVZ. 2009. Revised classification of the family Hesperiidae (Lepidoptera: Hesperioidea) based on combined molecular and morphological data. Systematic Entomology 34(3): 467–523. [Google Scholar]
  93. Warren AD, Vargas I, Luis MA, Llorente JE. 1998. Butterflies of the state of Colima, Mexico. Journal of the Lepidopterists’ Society 52(1): 40–72. [Google Scholar]
  94. Watson EY. 1893. A proposed classification of the Hesperiidae, with a revision of the genera. Proceedings of the Zoological Society of London 1893(1): 3–132. [Google Scholar]
  95. Williams RC. 1927a. Studies in the Neotropical Hesperioidea. Paper I. Transactions of he American Entomological Society 52: 61–88. [Google Scholar]
  96. Williams RC. 1927b. Studies in the Neotropical Hesperioidea. Paper II. Transactions of he American Entomological Society 53: 261–292. [Google Scholar]
  97. Zhang J, Cong Q, Rex EA, Hallwachs W, Janzen DH, Grishin NV, Gammon DB. 2019a. Gypsy moth genome provides insights into flight capability and virus-host interactions. Proceedings of the National Academy of Sciences of the United States of America 116(5): 1669–1678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  98. Zhang J, Cong Q, Shen J, Brockmann E, Grishin NV. 2019b. Genomes reveal drastic and recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae). Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  99. Zhang J, Cong Q, Shen J, Brockmann E, Grishin NV. 2019c. Three new subfamilies of skipper butterflies (Lepidoptera, Hesperiidae). Zookeys 861: 91–105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  100. Zhang J, Cong Q, Shen J, Fan XL, Wang M, Grishin NV. 2017a. The complete mitogenome of Euschemon rafflesia (Lepidoptera: Hesperiidae). Mitochondrial DNA Part B: Resources 2(1): 136–138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  101. Zhang J, Cong Q, Shen J, Opler PA, Grishin NV. 2019d. Changes to North American butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(2): 1–11. [PMC free article] [PubMed] [Google Scholar]
  102. Zhang J, Cong Q, Shen J, Opler PA, Grishin NV. 2019e. Genomics of a complete butterfly continent. bioRxiv 829887. Available at 10.1101/829887 (Last accessed January 2022.) [DOI] [Google Scholar]
  103. Zhang J, Cong Q, Shen J, Opler PA, Grishin NV. 2020. Genomic evidence suggests further changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7): 1–40. [PMC free article] [PubMed] [Google Scholar]
  104. Zhang J, Cong Q, Shen J, Opler PA, Grishin NV. 2021. Genomics-guided refinement of butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  105. Zhang J, Cong Q, Shen J, Wang R, Grishin NV. 2017b. The complete mitochondrial genome of a skipper Burara striata (Lepidoptera: Hesperiidae). Mitochondrial DNA Part B: Resources 2(1): 145–147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  106. Zhang J, Shen J, Cong Q, Grishin NV. 2019f. Genomic analysis of the tribe Emesidini (Lepidoptera: Riodinidae). Zootaxa 4668(4): 475–488. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplementary file

RESOURCES