Skip to main content
Plants logoLink to Plants
. 2022 Apr 6;11(7):996. doi: 10.3390/plants11070996

Less Virulent Leptosphaeria biglobosa Immunizes the Canola Plant to Resist Highly Virulent L. maculans, the Blackleg Pathogen

Kaluhannadige Rasanie Eranka Padmathilake 1, Wannakuwattewaduge Gerard Dilantha Fernando 1,*
Editors: Attila L Ádám1, Lorant Király1
PMCID: PMC9002471  PMID: 35406977

Abstract

Leptosphaeria biglobosa is a less virulent Leptosphaeria spp. that causes blackleg disease in canola. Previous studies from our lab have shown that inoculation with the less virulent L. biglobosa can boost the resistance of canola plants against the highly virulent L. maculans. The objective of this study was to confirm the effectiveness of L. biglobosa as a biocontrol agent against L. maculans utilizing morphology, fluorescence microscopy, gene quantification, and transcriptomic analysis. The in planta development of two Leptosphaeria species inoculated at different time points was assessed using fluorescent protein-tagged isolates which are GFP-tagged L. maculans and DsRed-tagged L. biglobosa. The growth inhibition of L. maculans by pre-and co-inoculated L. biglobosa was supported by no lesion development on cotyledons and no or weak fluorescence protein-tagged mycelia under the confocal microscope. The host defense-related genes, WRKY33, PR1, APX6, and CHI, were upregulated in L. biglobosa inoculated Westar cotyledons compared to L. maculans inoculated cotyledons. The quantification of each pathogen through qPCR assay and gene expressions analysis on host defense-related genes by RT-qPCR confirmed the potential of L. biglobosa “brassicae’ in the management of the blackleg disease pathogen, L. maculans ‘brassicae’, in canola.

Keywords: Brassica napus, Leptosphaeria maculans, Leptosphaeria biglobosa, biological control

1. Introduction

Blackleg is one of the most destructive diseases in canola (Brassica napus L.) growing areas and causes more than CAD $900 million annual loss per growing season worldwide [1]. Two Leptosphaeria species are associated with blackleg [2], and they are Leptosphaeria maculans. L. maculans isolates have been categorized into two sub clades ‘brassicae’ and ‘lepidii’, while L. biglobosa have been categorized into seven isolate groups, and they are ‘brassicae’, ‘canadensis’, ‘thlaspii’, ‘erysimii’, ‘australensis’, ‘occiaustralensis’, and ‘americensis’, respectively [2,3,4]. L. biglobosa ‘brassicae’ is the most common species and has been found in most canola growing regions [5]. These species co-exist in most B. napus growing areas [6].

L. maculans and L. biglobosa were described as virulent and less virulent strains, respectively [7]. Although L. maculans is more aggressive than L. biglobosa, their life cycles are similar [8]. The two species are genetically different and exhibit distinct disease symptoms on the canola plant [7]. L. maculans produces gray lesions with dark brown margins and black pycnidia. The pathogen moves towards the stem through the leaf petiole to the stem base and causes the main characteristic symptom of the disease, a blackened stem base canker, which was the reason for the name of the disease, ‘blackleg’. L. biglobosa caused leaf lesions to be smaller, darker, and confined to the upper stem [9]. L. maculans is a hemibiotrophic fungus, while L. biglobosa is a necrotrophic fungus with a comparatively shorter biotrophic stage in its life cycle. Furthermore, L. biglobosa is known to start its expression of hydrolases, a characteristic for the necrotrophic stage earlier than L. maculans [10].

Several studies demonstrated the resistance induction of the canola plant by L. biglobosa and suppression of L. maculans infection when L. biglobosa was pre- or co-inoculated with L. maculans. This suppression may be due to (1) the competition arising between the two species during infection and colonization within the host plant and (2) the induction of resistance in the host plant [11,12]. The enhanced plant defense in the host activated by biotic or abiotic factors is induced resistance [13]. Induction of disease resistance by pre- or co-inoculation with an avirulent or less virulent strain has been shown against many pathogenic strains and is known to be a broad-spectrum defense that protects the host from subsequent infections. For instance, the hampering of control strategies against the virulent Fusarium graminearum in the disease complex causes FHB by the presence of the less pathogenic F. poae [14] and tomato biocontrol activity of the F. oxysporum Fo47 endophyte against the pathogen F. oxysporum f. sp. Lycopersici causes tomato wilt disease [15]. The activated defense responses include (1) oxidative burst, which can cause cell death by restricting the pathogen at the inoculation site [16], and (2) changes in the cell wall composition by inhibiting pathogen penetration and secondary metabolite production, which can act as antimicrobial compounds [17].

Studying defense-related gene expressions is expected in the investigation of different plant–pathogen interactions. Phytohormones, such as salicylic acid (SA), ethylene (ET), and jasmonic acid (JA), coordinate defense responses by the activation of defense-related gene expressions. SA-mediated defense response plays a central role in local and systemic acquired resistance (SAR) against biotrophic pathogens. The ET/JA-mediated response contributes to the defense against necrotrophic pathogens. SA and JA target genes are PR1 and PDF1.2, respectively [18,19]. The respiratory burst oxidase homologues (RBOHs) are a major source of reactive oxygen species (ROS) during plant–microbe interactions [20]. On the other hand, ascorbate peroxidases (APXs) are another critical group of enzymes adjusting ROS levels in the cells [21]. Furthermore, transcription factors play important roles in defense responses. Transcription factor WRKY33 is essential for defense toward the necrotrophic pathogens [22], and plant-specific transcription factor WRKY70 is a common component in SA- and JA-mediated signal pathways [18].

The focus of this study was to investigate the potential of L. biglobosa in inducing canola plant resistance against the virulent species L. maculans through a combination of (1) the assessment of outer lesion developments, (2) confocal microscopic observations of fluorescent protein-tagged isolate growth in planta, (3) the quantification of each isolate by quantitative PCR, and (4) defense-related host gene expressions RT-qPCR.

2. Results

2.1. Disease Development in Cotyledons

The disease lesion caused by LbDsRed was limited to the surrounding inoculation sites of each lobe of the cotyledon (Figure 1). The significantly largest and second-largest disease lesions were observed in cotyledons in which L. maculans was used as the sole inoculum and pre-inoculum, as shown in Figure 1. In those two treatments, black colored pycnidia were visible on the disease lesions. Lesion development on LbDsRed and LmGFP co-inoculated cotyledons and LbDsRed pre-inoculated cotyledons were not statistically different from the lesions seen in LmDsRed solely inoculated cotyledons (p < 0.05) (Figure 1).

Figure 1.

Figure 1

Blackleg disease lesion development in Westar cotyledons at 14 days post-inoculation under controlled conditions with Leptosphaeria maculans ‘brassicae’ and L. biglobosa ‘brassicae’ inoculations. Seven-day-old cotyledons were wound inoculated and observed the lesion development in time course. Cotyledons inoculated with only GFP-tagged L. maculans (LmGFP) and cotyledons pre-inoculated with LmGFP showed significantly higher lesion development at 14 dpi. Control: distilled water treatment; Treatment 1: LbDsRed inoculation; Treatment 2: LmGFP inoculation; Treatment 3: LbDsRed and LmGFP co-inoculation; Treatment 4: LbDsRed followed by LmGFP inoculation (in 24 h intervals); Treatment 5: LmGFP followed by LbDsRed inoculation (in 24 h intervals). (a) Scanned images of disease lesion development in cotyledons; (b) Lesion size shown as a percentage of the total leaf area of both host types calculated by ImageJ. Different letters refer to significant differences between treatments (p ≤ 0.05).

2.2. Presence of Leptosphaeria spp. in Inoculated Westar Cotyledons

PCR products of genomic DNA extracted from infected cotyledons inoculated with only LmGFP and only LbDsRed showed gel bands of 444 bp and 331 bp sizes for LbDsRed and LmGFP, respectively. Co-inoculated cotyledons with both isolates displayed both bands (Figure 2).

Figure 2.

Figure 2

Gel image of species-specific PCR products of Leptosphaeria maculans ‘brassicae’ and L. biglobosa ‘brassicae’ isolates in inoculated Westar cotyledons. PCR identification of L. biglobosa and L. maculans with species-specific primers, LmacF/LmacR and LbigF/LmacR in a multiplex PCR. L. biglobosa ‘brassicae’ and L. maculans ‘brassicae’ gave PCR bands of 444 bp and 331 bp, respectively. PCR products were resolved by electrophoresis through a 1% (w/v) agarose gel. Lane 1: L. maculans ‘brassicae’ inoculated cotyledon gDNA; Lane 2: L. biglobosa ‘brassicae’ inoculated cotyledon gDNA; Lane 3: both isolates co-inoculated cotyledon gDNA; M: 100 bp DNA ladder.

2.3. L. biglobosa Inhibits the L. maculans Growth in B. napus Cotyledons

Confocal observation at 14 dpi showed the LbDsRed mycelia, but, comparatively, in less density (Figure 3a). The DNA quantity of LbDsRed was reduced approximately 33 times from 1- to 7- dpi (Figure 3b). In cotyledons inoculated solely by LmGFP, confocal microscopic observations showed a densely grown mass of LmGFP (Figure 3c). The L. maculans DNA quantity increased starting from three dpi onwards. Moreover, the fungal DNA quantity was raised at an exponential rate from seven dpi onwards (Figure 3d). LmGFP DNA increased 10 times from 7- to 14- dpi. The co-inoculated cotyledons displayed both LbDsRed and LmGFP signals, as shown in Figure 3e. The quantification study demonstrated the reduction in LbDsRed in a similar pattern in cotyledons treated only with LbDsRed. However, the reduction in the DNA of LmGFP was also observed in those cotyledons (Figure 3f).

Figure 3.

Figure 3

Figure 3

DsRed-tagged L. biglobosa (LbDsRed) and GFP-tagged L. maculans (LmGFP) in planta development of Westar cotyledons under controlled environment at 14 days post-inoculation. (a) Confocal microscopic observations of fluorescence protein-tagged Leptosphaeria isolates (10× magnification). (b) Quantification of each isolate in planta at 3-, 7-, 11-, and 14- dpi. LbDsRed and LmGFP mycelia shown in fluorescent red and green colors, respectively. In graphs, red and green colors represent LbDsRed and LmGFP DNA, respectively. (a,b) LbDsRed inoculation; (c,d) LmGFP inoculation; (e,f) LbDsRed and LmGFP co-inoculation; (g,h) LbDsRed followed by LmGFP inoculation with one day interval; (i,j) LmGFP followed by LbDsRed inoculation with one-day interval; (k) Chlorophyll autofluorescence of cellular chloroplasts of cotyledons in control.

Cotyledons pre-inoculated with LbDsRed one day before the LmGFP inoculation showed only LbDsRed mycelia in confocal observations. The quantification study demonstrated clear growth inhibition of LmGFP from 3- to 14- dpi (Figure 3h). On the other hand, LmGFP inoculation followed with LbDsRed inoculation with a 1-day interval showed densely developed LmGFP in confocal images and increment in LmGFP DNA quantity starting from 7 dpi similar to the LmGFP solely treated cotyledons. LbDsRed was not observed in the confocal observations, and the DNA quantity of LbDsRed reduced with time (Figure 3j).

2.4. Expression of Defense Genes

Except for WRKY70 and PDF1.2, all other genes, PR1, WRKY33, RbohD, APX6, were upregulated in L. biglobosa inoculated cotyledons compared to the other two methods of inoculations. CHI, chitinase, which is important in the degradation of pathogen cell walls, was expressed significantly higher in L. biglobosa inoculated cotyledons (Figure 4). As shown by Figure 5, the ROS burst marker gene, RbohD, started to upregulate starting from 3 dpi onwards at an exponential rate.

Figure 4.

Figure 4

Relative transcript levels of several important genes involved in host defense signaling pathways were assessed by quantitative RT-PCR at 7 days post-inoculation. The expression of WRKY70 and PDF1.2 showed significantly higher expressions in Lm solely inoculated cotyledons. PR1, WRKY33, RbohD, APX6, and CHI showed significantly higher expression in cotyledons inoculated with only Lb. (a) Relative gene expression of WRKY70 and PR1; (b) Relative gene expression of WRKY33 and PDF1.2; (c) Relative gene expression of RbohD and APX6; (d) Relative gene expression of CHI; in Westar cotyledons inoculated with only DsRed-tagged L. biglobosa (Lb), with only GFP-tagged L. maculans (Lm) and co-inoculated with both isolates (Lm + Lb). Different letters refer to significant differences (p ≤ 0.05).

Figure 5.

Figure 5

Expression profile of RbohD in Westar cotyledons infected with LmGFP, LbDsRed as sole and combined inocula. RbohD expression was upregulated at an exponential rate from 3- to 7- dpi. The observations were taken at 0-, 6-, 12- hpi and 1-, 3-, 7- dpi.

3. Discussion

This study demonstrated the resistance inducing potential of a less virulent isolate, L. biglobosa ‘brassicae’ in the susceptible canola variety Westar against virulent L. maculans ‘brassicae’. The successful control of L. maculans was demonstrated by pre-and co-inoculation of L. biglobosa by studies of cotyledon lesion development, in planta mycelial development, pathogen quantification, and gene expressions related to host defense.

The avirulence nature of L. biglobosa ‘brassicae’ on the susceptible Westar was evidenced by (1) the restricted disease lesion at the inoculation site, (2) reduction of LbDsRed DNA quantity by 33 folds from 3- to 7- dpi, and (3) low density of L. biglobosa mycelia under the confocal microscope. The restricted disease lesion caused by L. biglobosa could be related to the oxidative burst that arises in the host plant during the pathogen infection [10]. Lowe et al., (2014) demonstrated that the oxidative burst occurrence is higher in the host infected with L. biglobosa than in the host infected by L. maculans. RbohD is the oxidative burst marker gene of canola and RbohD-dependent ROS is involved in the plant defense [23]. RbohD was upregulated starting from 3 dpi onwards in this study. As the principal ROS producer, RbohD leads the hypersensitive response (HR) and induce SAR against pathogen attacks [23,24]. The on-site oxidative burst and localized cell death are two of the typical behaviors during HR caused by gene-for-gene interaction [25]. Upregulation of RbohD in the host during L. biglobosa infection could be one of the main reasons that host became resistant, and the pathogen was inhibited and limited to the infection site. The SAR induced by RbohD could favor the controlling of subsequent L. maculans infections [24].

On the other hand, APX6 was significantly upregulated in Westar after being inoculated with L. biglobosa, compared to the plants inoculated with L. maculans. APX6 plays a leading role in eliminating intracellular ROS and protecting plants from oxidative burst and damage consequences. As discussed above, RbohD, the source of ROS, was also upregulated in L. biglobosa inoculated cotyledons and then led to cell death. Cell death could benefit the necrotrophic pathogen L. biglobosa [26]. Spoel et al. (2007) described that sacrificing infected cells by triggering cell death is a defense strategy against biotrophic pathogens. In contrast, the maintenance of plant cell viability can be used as a defense mechanism against necrotrophic pathogens [26]. Based on these observations, the higher expression of APX6 could be used to maintain the balance of cell death caused by upregulated RbohD in L. biglobosa infected cotyledons.

The hypothesis was further supported by the expression patterns of the selected defense-related genes. In the canola blackleg pathosystem, the host becomes resistant by the early recognition of L. maculans by gene-for-gene interaction and the interaction is known as incompatible. SA signaling pathway-related WRKY70 initiates the process and is upregulated to higher levels as early as 3 dpi when the interaction is incompatible. However, the Westar plant’s compatible interaction with L. maculans in this study exhibited the upregulation of WRKY70 from 7 dpi onwards due to the late recognition of the pathogen [19,27]. Interestingly, Westar did not show an apparent upregulation of WRKY70 in the interaction with L. biglobosa at 7 dpi compared to its level at 3 dpi (data have shown only for 7 dpi). Similar results were obtained by Lowe et al., (2014). On the other hand, WRKY33, a gene related to the JA signaling pathway, was highly upregulated in Westar infected by L. biglobosa than by L. maculans. Previous studies revealed that responses against biotrophic pathogens are generally regulated by SA [28], while reactions towards necrotrophs are mediated by JA and ethylene [29]. Therefore, the upregulation of only WRKY33 in response to L. biglobosa infections further confirms L. biglobosa as a necrotrophy, but L. maculans is a hemibiotroph, which initiates its lifespan as a biotroph. PDF1.2 is considered as an ethylene-response-factor marker gene and JA marker gene [18]. The increment of PDF1.2 in LmGFP inoculated seedlings at 7 dpi onwards can be explained by the switching of the pathogen’s trophic nature into necrotrophy [18].

PR1 expression was upregulated highly in L. biglobosa inoculated Westar cotyledons compared to L. maculans inoculated ones. The PR1 gene is often used as a marker for SAR. The upregulation of PR1 and the resulting SAR will induce a defense response against subsequent infection in host plants [30]. The defense-related genes of RbohD, APX6, PR1, WRKY33, PDF1.2, and CHI began to upregulate from 3 dpi onwards (results not shown except for RbohD), which is consistent with the observed reduction in the L. maculans quantity from 3 dpi onwards in planta.

Chitinase showed a significant upregulation at 7 dpi in plants inoculated by L. biglobosa compared to the other plants. Chitinase belongs to the glycosyl hydrolase family, catalyzing the hydrolysis of glycosidic bonds in chitin, a key component of the fungal cell wall [31]. Lowe et al. (2014) observed a significantly higher chitinase expression in L. biglobosa ‘canadensis’ inoculated plants compared to the ones inoculated by L. maculans. Therefore, the upregulation of chitinase must play a significant role in plant resistance against L. biglobosa in Westar.

As demonstrated by Zou et al. (2019), different L. biglobosa isolates showed different levels of virulence on Westar. Interestingly, the population of L. biglobosa ‘brassicae’ reduced from 1 dpi onwards in susceptible Westar cotyledons in this study. In contrast, L. maculans showed its general virulence when LmGFP was inoculated solely on Westar cotyledons. As the Westar makes a compatible interaction with the LmGFP, no early recognition of the pathogen by the host plant and no triggering of effector-triggered immunity [27]. Therefore, the pathogen colonized within the host tissues at its biotrophic stage without doing any apparent damage upon host cells and showed an incremental increase in the L. maculans quantity observed from 7 dpi onwards as demonstrated by previous studies [19,27,32]. The lesion development was prominent as the virulent pathogen kills more and more tissues needed for the survival of the later necrotrophic stage [33].

Interestingly, the virulence of L. maculans was hidden entirely when it was co-inoculated or post-inoculated one day after L. biglobosa. The restraining of the L. maculans in the cotyledons was evidenced by restricted lesion development images and PCR quantification studies. The inhibition of L. maculans did not occur when the cotyledons were inoculated with L. maculans prior to L. biglobosa inoculation. The above observation suggests that L. biglobosa inoculation induces the host defense system and prime for any subsequent infections by L. maculans.

Both L. maculans and L. biglobosa coexist in most regions in which Brassica crops are grown. For instance, Dilmaghani et al. [34], revealed the existence of L. maculans and L. biglobosa species within the same field in the American continent, extending from Chile to Canada. L. maculans is considered more damaging to the crop than L. biglobosa [35]. Though damage, symptoms, and other biological features of L. maculans and L. biglobosa have been studied thoroughly; different ecological niches and other epidemiological features such as the timing of infection remained unrevealed [36]. As West et al. [37], and Mazáková et al. [38], demonstrated two Leptosphaeria spp. exhibited different niches even in the same host plant. Liu et al. [39], demonstrated the possibility of controlling the incidence of stem canker caused by L. maculans with the antagonistic interactions or the induction of systemic resistance caused by L. biglobosa in the host plant. Furthermore, Jacques et al. [36], suggested that though there is no sign of exclusion between two Leptosphaeria spp., there could be defense response induction, resource competition, and topographic exclusion. Martyn [40] and Mahuku et al. [11], reported that closely related pathogens could better induce resistance to the target pathogen.

The reduction of in planta mycelial development and disease lesion development, pathogen quantification, as well as transcriptomic observations of plant defense gene expressions confirms L. biglobosa could be used as a biological control in the diversification of the integrated management system of L. maculans in order to reduce the selection pressure exerted on host resistant genes. Further studies are required to determine the time of application of L. biglobosa in the field to prime the plant against this devastating pathogen.

4. Materials and Methods

4.1. Pathogen Isolates

Green fluorescent protein (GFP)-tagged L. maculans ‘brassicae’ isolate (refers to LmGFP) and red fluorescent protein, DsRed, tagged L. biglobosa ‘brassicae’ (refers to LbDsRed), received from the Dr. Kim Hammond-Kosack group [41] were used in this study. The isolates were grown in V8 agar plates and maintained under a light bank for a 24-h period at 20 ± 2 °C. After 21 days, the mycelial cultures with pycnidia were harvested by flooding culture plates with sterilized distilled water and scraping the fungal cultures gently by a heat sterilized spatula. Then, two layers of Miracloth-filtered pycnidiospore suspension was adjusted to a final concentration of 2 × 107 pycnidiospores/mL using a hemocytometer.

4.2. Plant Growth and Inoculation

The susceptible B. napus cultivar, Westar, with no known R genes or quantitative resistance [42] was grown in Sunshine mix #4 (Sun Gro Horticulture, BD Canada Ltd., Vancouver, BC, Canada), under a 16-h photoperiod (18 °C dark and 21 °C light) in a growth chamber at the Department of Plant Science, University of Manitoba. The cotyledons of seven-day-old seedlings were needle-punctured as one per lobe and inoculated with 10 µL of pycnidia suspension of each isolate or sterile distilled water as the control, respectively. Five different inocula types were used in addition to the control (control): treatment 1: L. biglobosa inoculation, treatment 2: L. maculans inoculation, treatment 3: L. maculans and L. biglobosa co-inoculation, treatment 4: L. biglobosa inoculation followed by L. maculans inoculation with a one-day interval, and treatment 5: L. maculans inoculation followed by L. biglobosa inoculation with a one-day interval. In treatment 3, L. maculans and L. biglobosa spore suspensions were mixed in equal volumes to prepare the co-inoculum (Figure 6). For treatments 3 and 4, the first inoculation was followed by another pinching of the same site to perform the second inoculation as 24 h of callus formation of the pinched site acts as a barrier for the second inoculation [43].

Figure 6.

Figure 6

Schematic representation of the research design. Seven-day-old Westar cotyledons were wound inoculated with Control: distilled water treatment; Treatment 1: LbDsRed inoculation; Treatment 2: LmGFP inoculation; Treatment 3: LbDsRed and LmGFP co-inoculation; Treatment 4: LbDsRed followed by LmGFP inoculation (in 24-h intervals); Treatment 5: LmGFP followed by LbDsRed inoculation (in 24-h intervals). Inoculated cotyledons were collected at different time points to analyze the lesion development in planta mycelial development, pathogen quantification, and host-defense-related gene expressions.

4.3. Disease Lesion Development on Cotyledons

Cotyledon lesion developments in each treatment were observed at 7-, 10-, and 14- days post inoculation (dpi) and the lesion development was calculated as the percentage of the total cotyledon area by ImageJ software [44].

4.4. Confocal Observation of in Planta Mycelial Development

The collected cotyledons from each treatment at 7-, 10- and 14- dpi were observed by laser confocal LSM 700 microscope (LSM 700; Zeiss, Jena, Germany). At 7 dpi, cotyledon pieces 2 × 2 mm2 in size were cut two millimeters away from the pinched wounds made on the cotyledons. At 10- and 14- dpi, the cut pieces of cotyledons with lesions were taken two millimeters away from the margin of the diseased lesions with the growing fungus. The cut pieces were water-mounted on slides. The cut pieces were water-mounted on slides, and GFP-tagged L. maculans mycelia and DsRed-tagged L. biglobosa development were observed by Zeiss LSM 700 confocal microscope (Jena, Germany). LmGFP was imaged using the excitation of BP 470/40 nm and emission of BP 525/50, and LbDsRed was visualized with the excitation of BP 550/25 nm and emission of BP 605/70. The study was repeated two times.

4.5. PCR Identification of Leptosphaeria maculans ‘brassicae’ and L. biglobosa ‘brassicae’ Isolates in Inoculated Cotyledons

Cotyledons of LmGFP and LbDsRed separately and co-inoculated were collected at 7 dpi as two cotyledons per replicate for three replicates. Genomic DNA extraction from inoculated Westar cotyledons was performed using the CTAB method that Liban et al. [45], explained with modifications. Freeze-dried cotyledons were grounded into a fine powder and mixed with lysis buffer (Tris, EDTA, CTAB, and NaCl), incubated at 65 °C for 20 min, extracted with phenol: chloroform: isoamyl alcohol (25:24:1), precipitated with 5M NaCl and 95% ethanol, and washed by 70% ethanol twice. After the final centrifugation, the DNA pellet was dissolved in 100 μL sterile distilled water.

Species-specific primers LmacF/LmacR ((LmacF, 5′-CTT GCC CAC CAA TTG GAT CCC CTA-3′; LmacR, 5′-GCA AAA TGT GCT GCG CTC CAGG-3′ for L. maculans) and LbigF/LmacR (LbigF, 5′-ATC AGG GGA TTG GTG TCA GCA GTT GA-3′; LmacR, 5′-GCA AAA TGT GCT GCG CTC CAGG-3′ for L. biglobosa) were used for PCR identification of the isolates as described by Liu et al. (2006). PCRs were performed in 20 μL volumes, made up of 10 μL of 2x Taq Mix (FroggaBio, Toronto, ON, Canada), with 0.8 μL of each primer (10 mM) and 100 ng total of sample gDNA and sterile distilled water to increase the volume. PCR was performed on a T100 Thermal cycler (Bio-Rad, Hercules, CA, USA), and the amplification program set was an initial denaturation period of 95 °C for two minutes followed by 30 cycles of 95 °C for 15 s, 70 °C for 30 s, and 72 °C for one minute, followed by an additional primer-extension period of 72 °C for 10 min. PCR products were resolved by electrophoresis through a 1% (w/v) agarose gel (Figure 2).

4.6. Quantification of Pathogen Isolates Using Quantitative PCR

Fungal suspensions of both isolates of LmGFP and LbDsRed with mycelia, pycnidia, and pycnidiospores were collected from a single spore grown on a V8 agar plate of each isolate in sterile distilled water. Genomic DNA of fungal suspensions was extracted using the modified CTAB method, as Liban et al. [45], described, with minor modifications. The extraction procedure followed was the same as explained above, except for the initial steps. The fungal suspensions were centrifuged to remove the aqueous portion of the fungal biomass. The samples were mixed with a lysis buffer and lysed with between 5 and 8 ceramic beads at 10,000 rpm for one min. The rest of the procedure was the same as described above.

Cotyledons of each treatment were collected at 0-, 1-, 3-, 7-, 11- dpi as two cotyledons per replicate for three replicates. Genomic DNA extraction was extracted from inoculated Westar cotyledons as described above. The amounts of DNA of L. maculans and L. biglobosa present in each pure fungal pathogen sample and pathogen inoculated cotyledon samples were quantified using SYBR Green qPCR, with species-specific primer pairs LmacF/LmacR and LbigF/LmacR used for L. maculans and L. biglobosa, respectively, as described by Liu et al. (2006). Quantitative PCR reaction mixtures were prepared to a total volume of 20 μL made up of 10 μL of Bio-Rad CFX ConnectTM Real-Time System with SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA), 0.8 μL (10 mM) of forward primer, and 0.8 μL (10 mM) of reverse primer, 100 ng total of sample gDNA, and sterile distilled water to increase the volume as per manufacturer’s instructions.

PCRs were performed with the amplification programs set as follows: 50 °C for two minutes, 95 °C for three minutes, 40 cycles at 95 °C for five seconds, 60 °C for 10 s, and 72 °C for 30 s. Melting curve analysis was performed by increasing 0.5 °C at 3 s/step from 55 to 95 °C. In each qPCR run, a standard dilution series consisting of 10,000, 1000, 100, 10, and 1 pg of DNA of L. maculans “brassicae” or L. biglobosa “brassicae” pure culture was used to produce a standard curve. The amount of L. maculans DNA or L. biglobosa DNA for each inoculated cotyledon sample was estimated using the standard curve. Results were expressed as the amount (pg) of L. maculans or L. biglobosa DNA in 100 ng total DNA from diseased plant tissue. The study was repeated two times [46].

4.7. Defense-Related Gene Expression

Inoculated cotyledons collected at 0-, 6-, 12- h post-inoculation (hpi) and 1-, 3-, 7- dpi were promptly frozen in liquid nitrogen. Frozen cotyledons were homogenized in liquid nitrogen with a sterilized porcelain mortar and pestle. Plant total RNA was extracted with PureLink® Plant RNA Reagent (Invitrogen, Carlsbad, CA, USA) and treated with a TURBO DNA-freeTM Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. Reverse transcription of the first-strand cDNA was achieved using the first cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA) with one μg total RNA. For the 10 μL of total qPCR volume, 2.1 μL of 100-fold diluted cDNA, five μL of Bio-Rad CFX ConnectTM Real-Time System with SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA), and 0.4 μL of each primer (10 mM; defense-related genes and used primers shown in Table 1) were used for PCR reaction. Real-time quantitative PCR was performed on a CFX96 Real-Time Instrument (Bio-Rad, USA) with the amplification program of 95 °C for two minutes, 40 cycles of 95 °C for five seconds, 60 °C for 10 s, and 72 °C for 30 s. Melting curve analysis was performed by increasing 0.5 °C at 3 s/step from 55 to 95 °C. (The primers list should be mentioned (Table 1)). The relative gene expression level was calculated using the 2−ΔΔCT method [47]. The study was repeated two times.

Table 1.

List of selected defense-related genes in canola used in gene expression analyses and the primer pairs used for each gene.

Gene Full Name Defense Signaling Pathway Forward Primer (5′3′) Reverse Primer (5′3′)
WRKY70 WRKY transcription factor 70 Salicyclic acid signaling pathway ACATACATAGGAAACCACACG ACTTGGACTATCTTCAGAATGC
PR1 Pathogenesis-related protein 1 Salicyclic acid pathway GGCTAACTATAACCACGATTC GTTCCACCATTGTTACACC
WRKY33 WRKY transcription factor 33 Jasmonic acid signaling pathway TGTCGGACAGCTTGGGAAAG AGAGGACGGTTACAACTGGAGAAA
PDF1.2 Plant defensin 1.2 Ethylene and Jasmonic acid pathway AAATGCTTCCTGCGACAACG AGTCCACGTCTCCGATCTCT
RbohD Respiratory burst oxidase homolog protein D Reactive Oxygen Species Production TATCCTCAAGGACATCATCAG TATCCTCAAGGACATCATCAG
APX6 Ascorbate peroxidase Reactive Oxygen Species Scavenging AGTTCGTAGCTGCTAAATATT GGAGTTGTTATTACCAAGAAA
CHI Chitinase Pathogen chitin degradation TGCTACATAGAAGAAATAAACGG TTCCATGATAGTTGAATCGG
Actin Actin Reference gene used in the assay CTGGAATTGCTGACCGTATGAG GTTGGAAAGTGCTGAGGGATG

4.8. Statistical Analysis

Unless specified, the analyses of samples used three biological replicates. Statistical analyses were performed using SAS 9.0 software. The data were log-transformed to maintain the homogeneity and normality of residuals. Analysis of variance (ANOVA) was conducted using the MIXED model to determine the significance of the treatments. The Fisher’s least significant difference (LSD) at the 0.05 probability level was applied to the percentage of lesion development, defense gene expression, and DNA quantity of each isolate.

5. Conclusions

Fluorescent protein-tagged Leptosphaeria isolates demonstrated a successful in planta control of virulent L. maculans in cotyledons pre- or co-inoculated with L. biglobosa. Moreover, lesion development on cotyledons, host defense-related gene expressions, and pathogen quantification studies in time course studies confirmed the above results. The outcome of the study concludes that L. biglobosa ‘brassicae’ can inhibit the destructive pathogen L. maculans in susceptible canola varieties. The reliability of this biological control agent under field conditions and the applicability of L. biglobosa into the integrated management approaches have to be studied further.

Acknowledgments

We would like to thank Yongju Huang, University of Hertfordshire, for providing the GFP-tagged L. maculans and DsRed-tagged L. biglobosa strains. A special thank you goes to Darshika Wickramasinghe for the support given on statistical analysis. We would also like to thank Cathy Bay and Rob Visser for their assistance in the experiments conducted under the controlled environment. The technical assistance given by Ravinder Sidhu is appreciated. We acknowledge the internal review by Abbot Oghenekaro, Liang Zhao and Aria Dolatabadian.

Author Contributions

W.G.D.F. and K.R.E.P. designed the experiments; K.R.E.P. performed the experiments and analyzed the data; K.R.E.P. wrote the manuscript; W.G.D.F. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Manitoba Graduate Fellowship and funds of DF.

Institutional Review Board Statement

Not Applicable.

Informed Consent Statement

Not Applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Zhang X., Fernando W.G.D. Insights into fighting against blackleg disease of Brassica napus in Canada. Crop Pasture Sci. 2018;69:40–47. doi: 10.1071/CP16401. [DOI] [Google Scholar]
  • 2.Mendes-Pereira E., Balesdent M.H., Hortense B., Rouxel T. Molecular phylogeny of the Leptosphaeria maculans–L. biglobosa species complex. Mycol. Res. 2003;107:1287–1304. doi: 10.1017/S0953756203008554. [DOI] [PubMed] [Google Scholar]
  • 3.Vincenot L., Balesdent M.H., Li H., Barbetti M.J., Sivasithamparam K., Gout L., Rouxel T. Occurrence of a new subclade of Leptosphaeria biglobosa in Western Australia. Phytopathology. 2008;98:321–329. doi: 10.1094/PHYTO-98-3-0321. [DOI] [PubMed] [Google Scholar]
  • 4.Zou Z., Zhang X., Parks P., du Toit L.J., Van de Wouw A.P., Fernando W.G.D. A New Subclade of Leptosphaeria biglobosa Identified from Brassica rapa. Int. J. Mol. Sci. 2019;20:1668. doi: 10.3390/ijms20071668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Liu Z., Latunde-Dada A.O., Hall A.M., Fitt B.D.L. Phoma stem canker disease on oilseed rape (Brassica napus) in China is caused by Leptosphaeria biglobosa ‘brassicae’. Eur. J. Plant Pathol. 2014;140:841–857. doi: 10.1007/s10658-014-0513-7. [DOI] [Google Scholar]
  • 6.West J.S., Biddulph J.E., Fitt B.D.L., Gladders P. Epidemiology of Leptosphaeria maculans in relation to forecasting stem canker severity on winter oilseed rape in the UK. Ann. Appl. Biol. 1999;135:535–546. doi: 10.1111/j.1744-7348.1999.tb00885.x. [DOI] [Google Scholar]
  • 7.West J.S., Kharbanda P.D., Barbetti M.J., Fitt B.D.L. Epidemiology and management of Leptosphaeria maculans (Phoma stem canker) on oilseed rape in Australia, Canada and Europe. Plant Pathol. 2001;50:10–27. doi: 10.1046/j.1365-3059.2001.00546.x. [DOI] [Google Scholar]
  • 8.Paul V.H., Rawlinson C.J. Diseases and Pests of Rape. Verlag Th. Mann; Gelsenkirchen-Buer, Germany: 1992. [Google Scholar]
  • 9.Fitt B.D.L., Brun H., Barbetti M.J., Rimmer S.R. World-wide importance of phoma stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape (Brassica napus) Eur. J. Plant Pathol. 2006;114:3–15. doi: 10.1007/s10658-005-2233-5. [DOI] [Google Scholar]
  • 10.Lowe R.G.T., Cassin A., Grandaubert J., Clark B.L., Van de Wouw A.P., Rouxel T., Howlett B.J. Genomes and Transcriptomes of Partners in Plant-Fungal- Interactions between Canola (Brassica napus) and Two Leptosphaeria Species. PLoS ONE. 2014;9:e103098. doi: 10.1371/journal.pone.0103098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mahuku G.S., Hall R., Goodwin P.H. Co-infection and induction of systemic acquired resistance by weakly and highly virulent isolates of Leptosphaeria maculans in oilseed rape. Physiol. Mol. Plant Pathol. 1996;49:61–72. doi: 10.1006/pmpp.1996.0039. [DOI] [Google Scholar]
  • 12.Chen Y., Fernando W.G.D. Induced resistance to blackleg (Leptosphaeria maculans) disease of canola (Brassica napus) caused by a weakly virulent isolate of Leptosphaeria biglobosa. Plant Dis. 2006;90:1059–1064. doi: 10.1094/PD-90-1059. [DOI] [PubMed] [Google Scholar]
  • 13.Choudhary D.K., Prakash A., Johri B.N. Induced systemic resistance (ISR) in plants: Mechanism of action. Indian J. Microbiol. 2007;47:289–297. doi: 10.1007/s12088-007-0054-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tan J., De Zutter N., De Saeger S., De Boevre M., Tran T.M., Van der Lee T., Waalwijk C., Willems A., Vandamme P., Ameye M., et al. Presence of the weakly pathogenic Fusarium poae in the Fusarium Head Blight disease complex hampers biocontrol and chemical control of the virulent Fusarium graminearum pathogen. Front. Plant Sci. 2021;12:216. doi: 10.3389/fpls.2021.641890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.De Lamo F.J., Spijkers S.B., Takken F.L.W. Protection to Tomato Wilt Disease Conferred by the Nonpathogen Fusarium oxysporum Fo47 is More Effective Than that Conferred by Avirulent Strains. Phytopathology. 2021;111:253–257. doi: 10.1094/PHYTO-04-20-0133-R. [DOI] [PubMed] [Google Scholar]
  • 16.Heath M.C. Apoptosis programmed cell death and the hypersensitive cell death. Eur. J. Plant Pathol. 1998;104:117–124. doi: 10.1023/A:1008645520976. [DOI] [Google Scholar]
  • 17.Hammerschmidt R. Induced disease resistance: How do induced plants stop pathogens? Physiol. Mol. Plant Pathol. 1999;55:77–84. doi: 10.1006/pmpp.1999.0215. [DOI] [Google Scholar]
  • 18.Li N., Han X., Feng D., Yuan D., Huang L.J. Signaling Crosstalk between Salicylic Acid and Ethylene/Jasmonate in Plant Defense: Do We Understand What They Are Whispering? Int. J. Mol. Sci. 2019;20:671. doi: 10.3390/ijms20030671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yang C., Fernando W.G.D. Hormonal responses to susceptible, intermediate, and resistant interactions in the Brassica napus–Leptosphaeria maculans pathosystem. Int. J. Mol. Sci. 2021;22:4714. doi: 10.3390/ijms22094714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Otulak-Kozieł K., Kozieł E., Valverde R.A. The Respiratory Burst Oxidase Homolog D (RbohD) Cell and Tissue Distribution in Potato-Potato Virus Y (PVYNTN) Hypersensitive and Susceptible Reactions. Int. J. Mol. Sci. 2019;20:2741. doi: 10.3390/ijms20112741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sharma R.K., Patel S., Pargaien K.C. Synthesis, characterization and properties of Mn-doped ZnO nanocrystals. Adv. Nat. Sci. Nanosci. Nanotechnol. 2012;3:035005. doi: 10.1088/2043-6262/3/3/035005. [DOI] [Google Scholar]
  • 22.Birkenbihl R.P., Diezel C., Somssich I.E. Arabidopsis WRKY33 is a key transcriptional regulator of hormonal and metabolic responses toward Botrytis cinerea infection. Plant Physiol. 2012;159:266–285. doi: 10.1104/pp.111.192641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Suzuki N., Miller G., Morales J., Shulaev V., Torres M.A., Mittler R. Respiratory burst oxidases: The engines of ROS signaling. Curr. Opin. Plant Biol. 2011;14:691–699. doi: 10.1016/j.pbi.2011.07.014. [DOI] [PubMed] [Google Scholar]
  • 24.Keller H., Blein J.P., Bonnet P., Ricci P. Physiological and Molecular Characteristics of Elicitin-Induced Systemic Acquired Resistance in Tobacco. Plant Physiol. 1996;110:365–376. doi: 10.1104/pp.110.2.365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bestwick C.S., Brown I.R., Bennett M.H.R., Mansfield J.W. Localization of hydrogen peroxide accumulation during the hypersensitive reaction of lettuce cells to Pseudomonas syringae pv phaseolicola. Plant Cell. 1997;9:209–221. doi: 10.1105/tpc.9.2.209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Spoel S.H., Johnson J.S., Dong X. Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proc. Natl. Acad. Sci. USA. 2007;104:18842–18847. doi: 10.1073/pnas.0708139104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Becker M.G., Zhang X., Walker P.L., Wan J.C., Millar J.L., Khan D., Granger M.J., Cavers J.D., Chan A.C., Fernando D.W., et al. Transcriptome analysis of the Brassica napus–Leptosphaeria maculans pathosystem identifies receptor, signaling and structural genes underlying plant resistance. Plant J. 2017;90:573–586. doi: 10.1111/tpj.13514. [DOI] [PubMed] [Google Scholar]
  • 28.Vlot A.C., Dempsey D.A., Klessig D.F. Salicylic Acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 2009;47:177–206. doi: 10.1146/annurev.phyto.050908.135202. [DOI] [PubMed] [Google Scholar]
  • 29.Farmer E.E., Alméras E., Krishnamurthy V. Jasmonates and related oxylipins in plant responses to pathogenesis and herbivory. Curr. Opin. Plant Biol. 2003;6:372–378. doi: 10.1016/S1369-5266(03)00045-1. [DOI] [PubMed] [Google Scholar]
  • 30.Henry E., Yadeta K.A., Coaker G. Recognition of bacterial plant pathogens: Local, systemic and transgenerational immunity. New Phytol. 2013;199:908–915. doi: 10.1111/nph.12214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kumar M., Brar A., Yadav M., Chawade A., Vivekanand V., Pareek N. Chitinases—Potential Candidates for Enhanced Plant Resistance towards Fungal Pathogens. Agriculture. 2018;8:88. doi: 10.3390/agriculture8070088. [DOI] [Google Scholar]
  • 32.Li C., Barker S.J., Gilchrist D.G., Lincoln J.E., Cowling W.A. Leptosphaeria maculans elicits apoptosis coincident with leaf lesion formation and hyphal advance in Brassica napus. Mol. Plant. Microbe Interact. 2008;21:1143–1153. doi: 10.1094/MPMI-21-9-1143. [DOI] [PubMed] [Google Scholar]
  • 33.Becker M.G., Haddadi P., Wan J., Adam L., Walker P., Larkan N.J., Daayf F., Borhan M.H., Belmonte M.F. Transcriptome analysis of Rlm2-mediated host immunity in the Brassica napus–Leptosphaeria maculans pathosystem. Mol. Plant-Microbe Interact. 2019;32:1001–1012. doi: 10.1094/MPMI-01-19-0028-R. [DOI] [PubMed] [Google Scholar]
  • 34.Dilmaghani A., Balesdent M.H., Didier J.P., Wu C., Davey J., Barbetti M.J., Li H., Moreno-Rico O., Phillips D., Despeghel J.P., et al. The Leptosphaeria maculans–Leptosphaeria biglobosa species complex in the American continent. Plant Pathol. 2009;58:1044–1058. doi: 10.1111/j.1365-3059.2009.02149.x. [DOI] [Google Scholar]
  • 35.Fitt B.D.L., Hu B.C., Li Z.Q., Liu S.Y., Lange R.M., Kharbanda P.D., Butterworth M.H., White R.P. Strategies to prevent spread of Leptosphaeria maculans (phoma stem canker) onto oilseed rape crops in China; costs and benefits. Plant Pathol. 2008;57:652–664. doi: 10.1111/j.1365-3059.2008.01841.x. [DOI] [Google Scholar]
  • 36.Jacques N., Balesdent M., Rouxel T., Laval V. New specific quantitative real-time PCR assays shed light on the epidemiology of two species of the Leptosphaeria maculans–Leptosphaeria biglobosa species complex. Plant Pathol. 2021;70:643–654. doi: 10.1111/ppa.13323. [DOI] [Google Scholar]
  • 37.West J.S., Balesdent M.H., Rouxel T., Nancy J.P., Huang Y.J., Roux J., Steed J.M., Fitt B.D.L., Schmit J. Colonisation of winter oilseed rape tissues by A/Tox+ and B/Tox0 Leptosphaeria maculans (phoma stem canker) in France and England. Plant Pathol. 2002;5:311–321. doi: 10.1046/j.1365-3059.2002.00689.x. [DOI] [Google Scholar]
  • 38.Mazáková J., Urban J., Zouhar M., Ryšánek P. Analysis of Leptosphaeria species complex causing phoma leaf spot and stem canker of winter oilseed rape (Brassica napus) in the Czech Republic. Crop Pasture Sci. 2017;68:254–264. doi: 10.1071/CP16308. [DOI] [Google Scholar]
  • 39.Liu S.Y., Liu Z., Fitt B.D.L., Evans N., Foster S.J., Huang Y.J., Latunde-Dada A.O., Lucas J.A. Resistance to Leptosphaeria maculans (phoma stem canker) in Brassica napus (oilseed rape) induced by L. biglobosa and chemical defence activators in field and controlled environments. Plant Pathol. 2006;55:401–412. doi: 10.1111/j.1365-3059.2006.01354.x. [DOI] [Google Scholar]
  • 40.Martyn J.D. Induced resistance to fusarium wilt of watermelon under simulated field conditions. Plant Dis. 1991;75:874–877. doi: 10.1094/PD-75-0874. [DOI] [Google Scholar]
  • 41.Eckert M., Maguire K., Urban M., Foster S., Fitt B., Lucas J., Hammond-Kosack K. Agrobacterium tumefaciens-mediated transformation of Leptosphaeria spp. and Oculimacula spp. with the reef coral gene DsRed and the jellyfish gene gfp. FEMS Microbiol. Lett. 2005;253:67–74. doi: 10.1016/j.femsle.2005.09.041. [DOI] [PubMed] [Google Scholar]
  • 42.Hubbard M., Peng G. Quantitative resistance against an isolate of Leptosphaeria maculans (blackleg) in selected Canadian canola cultivars remains effective under increased temperatures. Plant Pathol. 2018;67:1329–1338. doi: 10.1111/ppa.12832. [DOI] [Google Scholar]
  • 43.Ikeuchi M., Iwase A., Rymen B., Lambolez A., Kojima M., Takebayashi Y., Heyman J., Watanabe S., Seo M., De Veylder L., et al. Wounding Triggers Callus Formation via Dynamic Hormonal and Transcriptional Changes. Plant Physiol. 2017;175:1158–1174. doi: 10.1104/pp.17.01035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Schneider C.A., Rasband W.S., Eliceiri K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods. 2012;9:671–675. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Liban S.H., Cross D.J., Kutcher H.R., Peng G., Fernando W.G.D. Race structure and frequency of avirulence genes in the western Canadian Leptosphaeria maculans pathogen population, the causal agent of blackleg in Brassica species. Plant Pathol. 2016;65:1161–1169. doi: 10.1111/ppa.12489. [DOI] [Google Scholar]
  • 46.Huang Y.J., Karandeni-Dewage C.S., Fitt B.D.L. Importance of Leptosphaeria biglobosa as a cause of phoma stem canker on winter oilseed rape in the UK. Asp. Appl. Biol. 2014;127:117–122. [Google Scholar]
  • 47.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.


Articles from Plants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES