Skip to main content
BMC Plant Biology logoLink to BMC Plant Biology
. 2022 Apr 20;22:205. doi: 10.1186/s12870-022-03543-7

Molecular and metabolic traits of some Egyptian species of Cassia L. and Senna Mill (Fabaceae-Caesalpinioideae)

Marwa M Eldemerdash 1,, Ashraf S A El-Sayed 1,, Hussein A Hussein 1, Samir S Teleb 1, Rania S Shehata 1,2
PMCID: PMC9020050  PMID: 35443606

Abstract

The genus Cassia and Senna have been classified under subfamily Caesalpinioideae of family Fabaceae (Leguminosae) of order Fabales. There is a scarce taxonomical studies of the genus Cassia and Senna inhabiting Egyptian environments, thus, the main objective of the current was to revise and authenticate the phylogenetic relationship between studied taxa of the species of the genera Cassia and Senna in Egypt using the recent tools of ITS barcoding, RAPD analysis and metabolic profiling, in comparing to the traditional taxonomical features. From the cluster analysis of the traditional 27 morphological characters, the studied taxa were categorized into two major clades with an average taxonomic distance of 4.3. The clade I include Cassia fistula, C. renigera, C. javanica L subsp. nodosa and C. roughiia that belongs to series Obolospermae, and C. grandis that belongs to series Grandes. The clade (II) includes Senna surattensis and S. alata at taxonomic level 3.6. The taxonomical description of the studied taxa was confirmed from the molecular analysis of ITS sequences and RAPD analysis. The ITS sequences of the tested plants species C. fistula L, C. grandis MD4, C. javanica subsp. nodosa MD7, C. roxburghii MD5, C. renigera MD5 were deposited at genbank with accession numbers MW367973, MZ960447, MW386305, MW326753 and MW32685, respectively. While, the ITS sequences of the S. surrattensis and S. alata were deposited into genbank accession # MD14 MW367670 and MD20 MW412635, respectively. Thus, from the molecular analysis, two clades were clearly separated into Clade I of Cassia and Clade II of Senna. The cluster I represented by C. fistula, C. renigera, C. roxburghii, and C. javanica sub nodosa, and the cluster II represented by S. alata and S. surattensis. From the PCA of RAPD, a clearly discrimination between the two Taxa was observed revealing the characteristic grouping of Cassia and Senna. The species Senna alata and Senna surattensis were grouped together, but the species of C. renigera, C. javanica, C. roxburghii and C. grandis was grouped on a distinct group. The separation of Cassia and Senna species into two clusters verify the segregation of the genus Cassia L. senso lato into two distinct genera namely Senna P. and Cassia L. The morphological, molecular traits of the studied plants were authenticated from the metabolic profiling by GC-MS analysis. Among the 23 identified metabolites, four compounds namely hexadecanoic acid, methyl ester, 9-Octadecenoic acid (Z)-ethyl ester and Vitamin E were detected with fluctuated concentrations, among C. fistula, C. grandis, C. javanica subsp. nodosa and C. roxburghii. Conclusively, the traditional morphological features, molecular barcoding using ITS sequences, RAPD analysis and metabolic traits by GC-MS analysis, authenticates the taxonomical diversity of the genus Cassia and Senna.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-022-03543-7.

Keywords: Cassia, Senna, Taxonomical features, ITS sequence, RAPD analysis, GC-MS profile

Introduction

The genus Cassia L. and Senna Mill. have been classified under subfamily Caesalpinioideae of family Fabaceae (Leguminosae) of order Fabales [1, 2]. Cassia and Senna were segregated into the three genera: Chamaecrista Moench., Senna Mill. and Cassia L. [311]. This segregation was subsequently reinforced based on ontogenetic floral development studies Tucker [12] as well as using the molecular biology tools [13]. The genus Cassia include only 30 species [14]. Comparing to about 400 species in Cassia sens. Lat. as reported by Brenan [15]. Five species of Cassia sens. Lat. were introduced as horticulture plants in Egypt [16]. The genus Senna Mill, Gard. Dict. includes around 350 species and spread over the world [3, 4, 17] among them 17 species were introduced as horticulture plants in Egypt. Species of Cassia and Senna are widely grown as ornamentals [18] extensively used in various parts of the world as remedies for various human ailments [19, 20]. Species of Cassia sens. Lat. and Senna are well known for their laxative and purgative uses [21, 22] antioxidant activity [23] anticancer [24] and antimicrobial activities [25, 26]. In addition, these plants were used to treat gastrointestinal disorders, some skin diseases and wound healing [27, 28]. The extensive variability in its growth habit ranging from tall trees to delicate annual herbs, numbers and size of the leaflets, form and foliar characteristics has added difficulties to taxonomists in identification of species or the intraspecific taxa for influence of habitat conditions [7]. Taxonomically, Senna and Cassia are very complex genus owing to the strong polymorphism of a number of species and the absence of intrageneric incompatibility.

Recently, various taxonomical tools have been implemented such as anatomical, cytological, serological, genetic characteristics and metabolic traits [2931], rather than floral and vegetative character, that have been reported as important features in determining the relationships and affinities of the plants. With the development of various taxonomical tools that based on the molecular and metabolic traits, new taxonomical systems have been evolved, exploring new criteria for assessing the evolutionary status of the individual taxa in the subtribe Cassiinae. Recently, several molecular markers for demonstrating the intra, and interspecific genetic variations have been implemented for the direct comparison of the plant variation at biochemical and molecular levels [32, 33]. Random amplified polymorphic DNA (RAPD) analysis and sequences of the internal transcribed spacer (ITS) are one of the recent molecular tools for separating the particular species from their ancestors. Unlike traditional morphological features, the molecular tools especially RAPD and ITS sequences are independent on the environmental changes that gave these approaches more credibility. RAPD is a reliable predictive, rapid tool to clarify areas of maximum diversity and evaluate natural genetic diversity in plant populations [34, 35]. The sequence of ITS region is one of the most authenticated molecular markers in the evolutionary investigations at various taxonomic levels. DNA sequence is the straightforward since the nrDNA sub-units contain large numbers of copies, with numerous copies of rRNA genes within a genome, relatively homogenous, coupled with the different subunits and spacer sections [36]. The ITS area is particularly common because of the highly nucleotide replacement rate of the transcribed intervals which allows a taxonomical comparison of the highly similar divergent species [37]. The ITS region is impacted by the coordinated evolution that homogenizes the tandem copies across individuals, making ribosomal DNA accessible to phylogenetic analysis [38, 39], as well as for determining the origin of plants and their derivatives [40, 41]. Comparison of DNA sequences within the species is a powerful approach for determining the evolutionary forces acting in specific gene regions, and also for determining the relevant aspects of the evolutionary history of the species [42]. Due to the higher rate of nucleotide substitution, relative feasibility of amplification and the large available sequence data, the internal transcribed spacer (ITS) regions of the nuclear ribosomal cistron (18S-5.8S-26S) has been considered as a very successful tool for species-level discrimination across flowering plants [4345].

Recently, the emergence of DNA sequence data allows the quantitative comparison of nucleotide polymorphism levels at species and populations and corresponding degrees of population sequence divergence [46]. In addition, metabolic profiling by GC-MS of plants is one of the major recent trends for authentication of the morphological taxonomical and molecular features of plants [47]. From literature, there is a scarce taxonomical studies of the genus Cassia and Senna inhabiting Egyptian environments, thus, the main objective of this study was to implement the various molecular and biochemical tools for confirming and revisiting the taxonomical identities of these plants. Thus, the objective of this study was to revise and authenticate the phylogenetic relationship between studied taxa of the species of the genera Cassia and Senna in Egypt using the recent tools of ITS barcoding, RAPD analysis and metabolic profiling, in comparing to the traditional morphological and taxonomical features.

Materials and method

Collection and identification of plant samples

Seven horticultural taxa representing the genus Cassia and Senna comprising six species and one subspecies were the subject of this study. Fresh plant material, for each one of them, was collected since April 2020 (Table 1). Cassia fistula L. was collected from Parks at Faculty of Science, Zagazig University, Zagazig, Egypt. Cassia grandis L.f. and Senna surattensis (Dc.) Irwin and Barneby were collected from Zohria Trial Gardens, Gezira, Giza, Egypt. Cassia javanica L. subsp. nodosa, Cassia renigera Benth. and Cassia roxburghii DC were collected from Orman Botanic Garden, Giza, Egypt (Table 1). The plants were obtained after permission from Zagazig University, Orman and Zohria Botanical gardens. The voucher herbarium specimens were prepared and matched for identification with the authentic ones at the Orman Botanical and Zohria Botanical garden, Giza, Egypt. The plants were identified by the official staff members of the Orman Botanical Garden (OBG), Zohria Botanical Garden (ZBG), Cairo university Botanical garden, with the identification numbers as included on Table 1.

Table 1.

The collection data of the taxa studied of Cassia and their assignment into their corresponding series [4]

Taxa ID number Locality longitude & latitude Series
Cassia fistula L. ZUBG-09 Parks at Faculty of Science, Zagazig University, Zagazig, Egypt.

30.5765°N

31.5041°E

Cassia
Cassia grandis L. f. ZBG-008 Zohria Trial Gardens, Gezira, Giza, Egypt.

30.0131°N

31.2089°E

Grandes
Cassia javanica L. subsp. nodosa (Roxb.) K. Larsen & S. S. Larsen OBG-109 Orman Botanic Garden, Giza, Egypt. Obolospermae
Cassia renigera Benth.(Synonym: Cassia javanica L. subsp. renigera Benth.) OBG-104 Orman Botanic Garden, Giza, Egypt. Obolospermae
Cassia roxburghii DC. (Synonym: Cassia marginata Roxb.) OBG-101 Orman Botanic Garden, Giza, Egypt. Obolospermae
Senna surattensis (Dc.) Irwin&Barneby ZBG-006 Zohria Trial Gardens, Gezira, Giza, Egypt Subverrucosae
Senna alata (L.)Roxb CUBG-002 Cairo University Botanical Garden

30.0444° N

31.235° E

Pictae

ZUBG Zagazig University Botanical Garden, ZBG Zohria Botanical Garden, OBG Orman Botanical Garden, CUBG Cairo University Botanical garden

Morphological studies

Twenty-eight characters were investigated according to the reference keys for taxonomic classification of Cassia and Senna [4850]. The morphological characters and character states were determined by examining of the living specimens, and were coded as multistate characters. Ten individuals from each plant were used for the morphological description. One individual has been used for the molecular and biochemical analyses. While one ind The data matrix was analyzed using multistate matrix. The data matrix was subjected to cluster analysis using UPGMA (Unweighted pair group method with arithmetic mean) and the phylogenetic relatedness was constructed to show the relationship among the taxa. All analyses were carried out using the program Past (Version 4.3c) [51]. The Morphological Characters descriptions were recorded in Table 2.

Table 2.

Primer sequence of ITS and RAPD analysis

Name Base Pair Primers (bp) Prime Primer Sequence (5-3) Source
RAPID ABI-07 10 bp GGTGACGCAG
ABI-08 10 bp GTCCACACGG
ABI-09 10 bp TGGGGGACTC
ABI-10 10 bp CTGCTGGGAC
ABI-11 10 bp GTAGACCCGT
ABI-12 10 bp CCTTGACGCA
ITS ITS2 2F 20 bp ATGCGATACTTGGTGTGAAT Chen et al., [52]
ITS2 3R 21 bp GACGCTTCTCCAGACTACAAT Gao et al., [53]

Molecular study

Molecular identification of the plant samples

The plant genomic DNA was extracted by CTAB lysis buffer [52]. Fresh weight of the plant tissue (0.1 g) was pulverized into fine powder in liquid nitrogen, the CTAB lysis buffer (500 μl) was added, vortex for 1 min, and centrifuged at 10000 rpm for 10 min [53]. Equal volume of chloroform was added to the supernatant, vigorously shaking, centrifuged at 10,000 rpm for 10 min, the upper layer was taken and amended with double volume of ethanol, incubated at − 20 °C for 30 min, centrifugation for 10 min to pellet the DNA. The DNA pellets were dissolved in 50 μl distilled water and stored at − 20 °C, and checked by 1.5% agarose gel, normalizing to 1 kb ladder (Cat. # PG010-55DI). The ITS primer sets were listed in Table 3. The reaction mixture contains 10 μl of 2 × PCR master mixture (i-Taq™, Cat. # 25,027), 2 μl of gDNA, 1 μl of the primers (10 pmol/μl), and completed to 20 μl with sterile distilled water. PCR amplification was performed at Thermal Cycler 006, programmed to initial denaturation 94 °C for 2 min, denaturation 94 °C for 20 s, annealing 51 °C for 30 s, extension 72 °C for 1 min for 35 cycles, with final extension 5 min at 72 °C. The PCR amplicons were analyzed by 1.5% agarose gel in 1 × TBE buffer, and sequenced by Applied Biosystem Sequencer (HiSQV Bases, Version 6.0). The obtained sequences were non-redundantly BLAST on the NCBI, and the FASTA sequences were aligned with Clustal W muscle algorithm [54].

Table 3.

Morhological charcaters of Cassia and Senna

Character Cassia fistula L Cassia grandis Cassia renigera Cassia roxburghii DC Cassia javanica Senna alata Senna. surattensis
1-Life Span perennial perennial perennial perennial perennial perennial perennial
2-Life form Tree Tree Tree Tree Tree Shrub Shrub
3-stem surfaces glabrous pubescent pubescent pubescent pubescent pubescent pubescent
4-Leaf duration deciduous deciduous deciduous deciduous deciduous evergreen evergreen
5-Leaflet pairs in numbers 8-14 pairs 14-20paris 16-20pairs 14-20 pairs 16-20 pairs 8-12 pairs 6-12 pairs
6-Leaflet shape ovate oblong oblong oblong oblong obovate-oblong obovate-oblong
7-Leaflet margin entire entire entire entire entire entire entire
8-Leaflet apex. acute obtuse obtuse obtuse acute obtuse obtuse
9-Leaflet base Obtuse Obtuse Obtuse Oblique Obtuse Oblique Oblique
10-Leaflet adaxial surface glabrous puberulent puberulent glabrous puberulent glabrous glabrous
11-Leaflet abaxial surface puberulent tomentose tomentose puberulent puberulent puberulent puberulent
12-Leaflet lenght 7.5-15 cm 5-7 cm 5-10 cm 7-10 cm 5.5-10 6-12 cm 2-5 cm
13- Leaflet width 2.5-7 cm 1-2 cm 0.4 -2 cm 1-2 cm 0,6-2 cm 3-6 cm 0.8-2 cm
14- Stipule cauducous cauducous cauducous cauducous cauducous Persistent cauducous
15- Stipule shape deltoid to ovate deltoid to ovate kidney kidney linear to lanceolate Triangular linear to lanceolate
16-Bract shape ovate Linear to lanceolate leafy Linear Ovate oblong to broadly ovate linear to lanceolate
17- Sepals shape ovate ovate ovate ovate ovate oblong ovate
18-Sepals colour green redish redish redish redish yellowish-green yellowish-green
19- Petals shape obovate obovate obovate Ovate Oblong obovate ovate obovate
20- Petals colour yellow pink pink pink pink yellow yellow
21-pod Curvature straight straight straight straight straight straight straight
22- Pod colour Black Dark brown Dark brown Dark brown Dark brown brown Dark brown
23- Pod Texture glabrous glabrous glabrous glabrous glabrous glabrous hairy
24- POD APEX rounded rounded rounded rounded rounded ACUMINATE rounded
25- Dehiscence of pod indehiscent indehiscent indehiscent indehiscent indehiscent dehiscent dehiscent
26- Seed shape elliptic obovate-elliptic obovate-elliptic elliptic obovate-elliptic deltoid obovate-oblong
27- Seed color Brown Brown Brown Brown Brown Black Dark brown

Sequence analysis

Alignment analysis of the ITS sequences were adjusted using BioEdit version 7.2.5 [55], for each sequence, length and GC contents were estimated using the Endmemo software (http://www.endmemo.com/bio/gc.php) (Table 4). The derived ITS nucleotide sequences were analyzed with MEGA version X software [56]. The sequences were manually checked and the pairwise sequence divergence between studied taxa in ITS1, 5.8S and ITS2 regions was calculated according to the Maximum Composite Likelihood (MCL) [56], verified by comparing with the sequences of other species by Basic Local Alignment Search Tool (BLAST). Positions containing gaps and missing data were eliminated from the dataset, support values of the internal branches of NJ tree were evaluated through bootstrap method (1000 replicates). The transition/transversion ratio ti/tv was estimated using the following formula R = [A*G*k1 + T*C*k2]/[(A + G)*(T + C)] with A, G, C, T as the corresponding frequencies of four nucleotides [57]. The number of nucleotide substitutions per site between sequences was estimated. The aligned sequences in the Mega files were analyzed with DnaSP software version 4.0 [58] to estimate polymorphism indices. The average of nucleotide differences (k) and the minimum number of recombination events (Rm) are also estimated. Selection neutrality was tested by both Tajima’s D [59] and Fu and Li’s D* and F* methods [60].

Table 4.

The studied taxa, location and their geographical distribution

Scientific name NCBI accession No. Length bp GC%
1-Cassia fistula L MW367973 796 bp 58.29
2- Cassia grandis. MZ960447 439 bp
3-Cassia renigera Benth (Synonym: Cassia javanica L. subsp. renigera Benth.) MW326851 738 bp 58.53
4-Cassia roxburghii DC. (Synonym: Cassia marginata Roxb.) MW326753 732 bp 63.25
5- Cassia javanica L subsp. nodosa (Roxb.) K. Larsen & S. S. Larsen MW386305 737 bp 59.52
6- Senna. surattensis (Burm. f) Irwin & Barneby MW367670 729 bp 60.08
7- Senna alata (L.) Roxb. (Synonym: Cassia alata Linn.) MW412635 403 bp 59.55

RAPD analysis

The molecular diversity of the studied Taxa was assessed by RAPD analysis [61]. The primer set of 20 random decamer oligonucleotides were purchased (Metabion International AG, Planegg, Germany) as listed in Table 3. The reaction mixture contains 10 μl of 2 × PCR master mixture, 2 μl of gDNA, 1 μl of each primers (10 pmol/μl), and completed to 20 μl with sterile distilled water. PCR amplification was performed at Thermal Cycler 006, programmed to initial denaturation 94 °C for 2 min, denaturation 94 °C for 20 s, annealing 51 °C for 30 s, extension 72 °C for 1 min for 35 cycles, with final extension 5 min at 72 °C. The PCR amplicons were analyzed by agarose gel in 1 × TBE buffer (Cat# AM9864). For each primer in RAPD PCR, the number of polymorphic and monomorphic bands was determined. Bands clearly visible in at least one genotype were scored (1) for present, and (0) for the absent and entered into a data matrix. Fragment size was estimated by interpolation from the migration distance of marker fragments. Percentage of Polymorphism Information Content (PIC) was calculated by applying the formula given by [62, 63], Where fi is the frequency of the ith allele, and the summation extends over alleles. Then PIC values were used to calculate marker index (MI). In addition, principal component analysis (PCA) scatter diagram was constructed based on Dice coefficient genetic similarity matrix by using PAST, ver. 4.02 software [51].

PIC=1-fi2ni=1

Where f i is the frequency of the ith alleles and the summation extends over n alleles.

Numerical analysis

Data analysis was performed using the PAST, ver. 4.02 software [51]. Jaccard’s similarity coefficients were used to generate a dendrogram using Unweighted Pair Group Method with Arithmetic Average (UPGMA) [64] and relationships between the samples were represented. In addition, principal component analysis (PCA) scatter diagram was constructed based on Dice coefficient [65] using SIMQUAL module of the program. The hierarchical clustering analysis was generated using (UPGMA).

GC-MS metabolic profiling

Preparation of plant leaves extracts

Harvested healthy fresh leaves from the collected specimens, for each taxon, were shade dried in the laboratory for 2 weeks and crushed to a dry powder using a kitchen blender. The powdered leaves (10 g) were extracted by cold maceration [47, 66, 67] with 50 ml methanol (1:5 w/v) for 72 h at room temperature in tightly sealed conical flasks. Each extract was filtered using muslin cloth, the filtrates were collected and centrifuged. The supernatant was collected and the solvent was evaporated to 5 ml final volume, and then stored in tightly sealed dark vials at 4 °C till use.

GC-MS analysis of the compounds from the leaves extracts

The chemical constituents of each extract was determined with the Trace GC1310-ISQ mass spectrometer (Thermo Scientific, Austin, TX, USA) using a direct capillary column TG-5MS (30 m × 0.25 mm × 0.25 μm film thickness). The column oven temperature was initially hold at 50 °C, then increased by 5 °C/min to 230 °C for 2 min, and increased to the final temperature 290 °C by 30 °C/min and hold for 2 min. The injector and MS transfer line temperatures were kept at 250 °C, and 260 °C respectively. Helium was used as a carrier gas at constant flow rate of 1 ml/min. The solvent delay was 3 min and diluted samples of 1 μl were injected automatically using Autosampler AS1300 coupled with GC in the split mode. EI mass spectra were collected at 70 eV ionization voltages over the range of m/z 40-1000 in full scan mode. The ion source temperature was set at 200 °C. The chemical identity of the components was identified by comparison of their retention times and mass spectra with those of WILEY 09 and NIST 11 mass spectral databases.

Results and discussions

Morphological analysis

Six species and one subsp. of Cassia and Senna were collected from different localities; Zagazig, Giza and Cairo Egypt, with different longitudes and latitudes as summarized in Table 1. Based on the traditional taxonomical criteria which approximately represented by 27 characters (Table S1), the different species of Cassia and Senna series were represented. Cassia fistula L. and C. grandis belonging to Cassia and Grandis series, respectively, were identified. While three species of namely; Cassia javanica, C. renigera and C. roxburghii were described to belongs to the series Obolospermae. As well as based on the above 27 taxonomical feature, the species Senna surattensis and S. alata were described to be belonging to Subverrucosae and Pictae, respectively [3, 4]. The universal morphological features of Cassia and Senna plants were described in Table 2. The UPGMA dendrogram clusters generated from the 27 morphological characters (Fig. 1) classified all studied taxa into two major clades and have an average taxonomic distance of about 4.3. The first clade was divided into three groups; group one includes Cassia fistula which belongs to series Cassia at taxonomic level 4.4. Cassia renigera, Cassia javanica L subsp. nodosa and Cassia roughiia which belongs to Series Obolospermae separated at in one group at a distance level at 2 taxonomic distance level third group includes Cassia grandis at taxonomic level 3.06. Clade (II) includes Senna surattensis and Senna alata at taxonomic level 3.6. The leaf morphological variations of all the plant species were shown (Table 3), that strongly agrees with the series level by [3, 4]. There is a considerable degree of genetic variety in several Cassiinae species derived via investigation by molecular markers, as coincide with other morphological markers [6870].

Fig. 1.

Fig. 1

UPGMA analysis (A) an PCA analysis (B) of Cassia and Senna species based on the morphological features

PCA analysis

The PCA analysis reflects the distribution and incidence of the different morphological traits of the experimented plants, by plotting the PC1 and PC2. From the PCA scatter plot, a clearly discrimination between the two Taxa was observed revealing the characteristic assemblage of Cassia and Senna. The species of S. alata and S. surattensis were grouped together; the species of C. renigera, C. javanica, C. roxburghii and C. grandis was separated on a distinct group (Fig. 1). The interspecific genetic divergence refers to the genetic variation within the species, with the clear separation of the two genera Cassia and Senna as coincident with the criteria of morphological and molecular features. The separation of Cassia and Senna species into two clusters prove the segregation of the genus Cassia L. senso lato into two distinct genera; Senna P. Mill., and Cassia L. senso stricto [3, 4].

Molecular analyses of the experimental plants

Internal transcribed spacers (ITS) analysis

The sequence of ITS region has been utilized as universal molecular phylogenetic marker for plant differentiation between various species [71]. The sequence of this has been frequently authenticated for differentiation of the interdependent and intra-specific interactions of plants [72, 73]. The genomic DNA of the plants were used as PCR primer for amplification of the ITS regions. From the PCR amplicons (Fig. 2), the size of DNA was around 600-700 bp, the products were sequenced and BLAST searched non-redundantly on NCBI database. According to the Neighbor-Joining (NJ) method, the studied taxa have been separated into two different clusters segregated the subtribe Cassiinae. The first cluster includes all Cassia species, while the second one includes all species of Senna. The first cluster (I) divided into two sub cluster, the first one include Cassia grandis MD4 MZ960447 that clearly separated, which belongs to Series Grandis while the other group includes and C. javanica subsp. nodosa MD7 MW386305. C. roxburghii MD5 MW326753, C. renigera MD5 MW32685, which belongs to Series oblospermaea the infra-generic arrangement of species in Cassia and Senna was in agreement with [3, 4], with an obvious deviations regarding to intrageneric relationships C. fistula MD1 MW3679973 in the same group. This might be due to the selection of a small number of species from such a large taxon for the present investigation and amplification of a small portion of the entire genome [74]. A significant difference in chromosome size, morphology and condensing behavior among members of the controversial subtribe Cassieae (Cassia, Chamaecrista and Senna) was revealed on the tribe to suggesting the heterogeneous group from the karyological view [3, 4, 75] (Irwin and Barneby 1982,1981, Souza and Benko-Iseppon, 2004). The second cluster includes S. surrattensis MD14 MW367670 and S. alata MD20 MW412635.

Fig. 2.

Fig. 2

Molecular Phylogenetic analysis of the Cassia species based the ITS sequences for Cassia fistula (A), Cassia grandis (B), Cassia renigera (C) and Cassia javanica subsp nodosa (D)

From the alignment profile, Cassia fistula displayed 99% similarity with various species of Cassia fistula, has been deposited on gene bank under accession number MW367973. Cassia fistula displayed a 99% similarity with Cassia fistula JX856431.1, JX85643.1, JX856430.1, MG283317.1, KJ638410.1, GU175310.1, MW326851.1 with E value zero and query coverage 96%. The ITS sequences of tested species of C. grandis MD4, C. roxburghii MD5, C. renigera MD5, C. javanica subsp. nodosa MD7 were deposited to the genbank with accession numbers MZ960447, MW326753, MW326851 and MW386305, respectively (Fig. 3). From the alignment profile, Cassia grandis MD4 MZ960447 displayed 99% similarity with different species of C. fistula MG283317.1, MW3674971.1, MW367522.1, MW32685.1, MW367973.1, and MW326753.1 with E value zero and query coverage 99%. From inspection of database deposited sequences there is no ITS sequences of C. grandis on the genbank, so, this is the first report confirming the taxonomical identity of C. grandis, inhabiting the Egyptian environment. Cassia roxburghii MD5 MW326753.1 displayed a 98% similarity with C. fistula MG283317, C. javanica FJ980413.1, KX372778.1, MW386315.1, MW386314.1 and MW386305.1 with E value zero and query coverage 98%. Obviously, there is no ITS sequences of C. roxburghii deposited on the database, so, the similarity has been conducted non-redundantly towards the database deposited sequences. Senna surattensis MD14 MW367670 displayed 99% similarity with S. surattensis KY611897.1, KY427088.1, KJ638427.1, JY427088.1, MW367547.1, MW367670.1 and MW325225.1 with E value zero and query coverage a 90%. Based on the ITS sequence, the phylogenetic analysis of the experimented Cassia and Senna (Fig. 3), two phylogenetic clades, in which Cassia belongs to Clade I, and Senna belongs Clade II. From the molecular relatedness, the two species of experimented Senna were apparently distinct from the tested Cassia plants, ensuring the difference on the conserved sequences of ITS regions, or might be due to evolutionary. These molecular discriminations being consistent with the recent taxonomical traits based on the morphological features. Traditional taxonomical features such as macro-morphological and micromorphological characters are restricted by the deficiency of clear criteria for character selection, lacking the uniform standard and credible coding data, so causing somewhat misidentification. Therefore, confirmation of the morphological taxonomical features with the recent molecular tools such as DNA barcoding and molecular markers are one the most recent trends for confirming the traditional morphological features, and exploring the phylogenetic relationships between closely related taxa and their effect on their morphological identification. From the traditional taxonomical traits, the subtribe Cassinnae contains the genus Cassia and Senna [3, 4]. From the molecular analysis, two clades were clearly separated into Clade I of Cassia and Clade II of Senna, thus, conclusively the molecular analysis and morphological features being consistent. The taxonomical features of the subtribe Cassinnae were described in details (Table S1), as result from the UPGMA dendrogram clustering algorithm using 27 morphological traits that indicated a strong relationship between seven taxa in two clusters (Fig. 1). The cluster I represented by C. fistula, C. renigera, C. roxburghii, and C. javanica sub nodosa, and the cluster II represented by S. alata and S. surattensis.

Fig. 3.

Fig. 3

Molecular Phylogenetic analysis of the Cassia and Senna species based the ITS sequences of S. surrattensis (A), S. alata (B), C. roxburghi (C). The phylogenetic relatedness of the Cassia and Senna

The number of nucleotides substitution from sequences of the ITS sequences from the tested Cassia and Senna species were represented in Table 5. Three parameters and seven nucleotide sequences were used in the study, including 1st + 2nd + 3rd + nonecoding codon positions [56]. For each pair of sequences all unclear locations were deleted (pairwise deletion option). The final dataset had a total of 837 locations. Analysis of distance matrix shows high level of genetic distance (1.470) was observed between MW367670, S. surattensis MD14, and MZ960447, C. grandis MD4. Low level of genetic diversity (0.0292) between MW367973 C. fistula MD1 and MW326851 C. renigera MD5 was observed.

Table 5.

Maximum composite likelihood estimate of the pattern of nucleotide substitution

A T C G
A 4.23 6.67 11.75
T 4.69 21.58 6.9
C 4.69 13.7 6.9
G 7.99 4.23 6.67

Each entry shows the probability of substitution (r) from one base (row) to another base (column) [1]. For simplicity, the sum of r values is made equal to 100. Rates of different transitional substitutions are shown in bold and those of transversionsal substitutions are shown in italics. The nucleotide frequencies are 20.86% (A), 18.83% (T/U), 29.65% (C), and 30.67% (G). The transition/ transversion rate ratios are k1 = 1.704 (purines) and k2 = 3.238 (pyrimidines). The overall transition/ transversion bias is R = 1.16, where R = [A*G*k1 + T*C*k2]/[(A + G)*(T + C)]. This analysis involved 7 nucleotide sequences. Codon positions included were 1st + 2nd + 3rd + Noncoding. All ambiguous positions were removed for each sequence pair (pairwise deletion option). There were a total of 837 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [2]

Length variation, GC content, nucleotide composition, and mutational events of ITS

The obtained sequences demonstrating the differences in the GC content of the investigated species (Table 4). The sizes of ITS sequences were varied from 403 bp to 796 bp in Senna alata MD20 and Cassia fistula MD1, respectively. The GC contents were ranged between 58.29 and 63.25% in C. renigera, C. roxburghii. The transition/transversion rate ratios are k1 = 1.704 (purines) and k2 = 3.238 (pyrimidines). The overall transition/transversion bias is R = 1.16, where R = [A*G*k1 + T*C*k2]/[(A + G)*(T + C)]. There were 7 nucleotide sequences in this study. Position 1st + 2nd + 3rd + noncoding was added for the codon. Every sequence pair of unclear places has been deleted (pairwise deletion option). The completed dataset has a total of 837 places, with the replacements (Table 5). The transitions on the intergenic spacer ITS are more common than transversion, there are 20.86% (A), 18.83% (T/U), 29.65% (C), and 30.67% of the nuclear frequencies (G) of species Cassia and Senna. According to these findings, the fluctuation in the composition of the ITS nucleotide alignment into the 837 character matrix indicated that there were 212 conserved sites, 582 variables comprising 159 informative sites, and 395 singleton loci (Table 6). The frequency of nucleotides composition was 20.86, 18.83, 29.65 and 30.67% accordingly for A, T, C and G, that being consistent with that reported for Quercus spp. [76]. Similar studies were reported for Wheat (597 - 605 bp) and Barley (595 - 598 bp) [77]. The whole ITS variation spanned between 650 and 850 bp in the Asteraceae family, the average nucleotide frequency was A (25%), T (24%), C (26%), and G (25%) Average GC content was 51% and AT 49% [78]. The mean length of Ficus carica of ITS was 697.5 bp and its composition was 19.7% (18.6%) [37]. The Chili ITS1-5.8S-ITS2 analyses indicated nuclear frequencies of 18.85% (A), 17.56% (T), 33.95% (C), guanine (G) and 29.64% (A) and average length of 620 bp of thymine (T), respectively [79] The ITS region in Coniferales, Cycadales, Ginkgoales and Gnetales was ranged between 575 and 700 bp in angiosperms and between the species of 975 and 3125 bp in the range [80] Phoenix dactylifera with the mean ITS level of genetic diversity is 2% in the overall data set. These findings are comparable to those observed in Quercus suber and Q. Trojana [81], Glycine max [82] and Tylosema esculentum [83]. The transition/ transversion ratio R of 1.16 registered in the entire ITS region that is lower than that the entire ITS region in Tunisian cultivars of date palm (ti/tv = 4.375) [84], Asteraceae (ti/tv = 1.43) [78], Capsicum sp. (ti/tv = 3.746) [79].

Table 6.

Nucleotide diversity, sequence polymorphism based on ribosomal DNA of Cassia and Senna species

Parameter Frequency
m 7
n 837
s 582
C 212
ps 0.695341
Θ 0.283812
π 0.228936
Eta 310
Tajima’s D −1.24870
Fu and Li′s D* −0.98694
Fu and Li′s F* −1.16035
Fu’s Fs statistic 1.474

This analysis involved 7 nucleotide sequences. Codon positions included were 1st + 2nd + 3rd + Noncoding. All ambiguous positions were removed for each sequence pair (pairwise deletion option). There were a total of 837 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [2]

Abbreviations: m Number of sequences, n Total number of sites, S Number of segregating sites, C Conserved sites, ps S/n, Θ ps/a1, π nucleotide diversity, and Total number of mutations, Eta Eta

Selective neutrality tests

Comparative analysis of the DNA sequences within and between species is one of the most powerful approaches for determining the evolutionary domains in specific gene regions, and for determining the relevant aspects of the evolutionary history within the species [42, 85]. The pattern of plant diversity was analyzed from the neutrality test of the experimental plants (Table 6). The ribosomal nuclear DNA sequence was notably different from the neutral balancing model. Selective neutrality for the detected variations was tested by both Tajima [59, 60] methods to examine the null hypothesis. Tajima D is − 1.24870. Fu and Li′s D* test statistic: − 0.98694 Statistical significance: P > 0.10 Fu and Li′s F* test statistic: − 1.16035. Statistical significance: Not significant, P > 0.10. Similar studies were reported for the Tunisian fig cultivars (Ficus carica L.; Moracea) and recorded higher and significant negative values for these parameter: Fu’s Fs = − 8.668 for ITS1, Fu’s Fs = − 7.093 for 5.8S gene, Fu’s Fs = − 4.40 for ITS2 and Fu’s Fs = − 5.88, for the intergenic spacer of ribosomal DNA (ITS) [37]. However, positive and not significant values of D*: 0.92037; P > 0.10, F*: 0.86550; P > 0.10 were recorded in the ITS region of Tunisian date palm cultivars (Phoenix dactylifera L) [84]. The neutrality statistics in D Tajima, Fu, Li and Fu support neutrality across the ribosomal DNA region (ITS). The average number of pairwise nucleotide differences, k: 99.667. Nucleotide diversity, Pi: 0.25887, Theta (per site) from Eta: 0.32865, Theta (per sequence) from Eta: 126.5306.

Random amplified polymorphic DNA (RAPD) analysis

The molecular similarity of the tested plants Cassia and Senna was verified from RAPD analyses. RAPD analysis has been recognized as one of the authentic molecular tools for confirmation of the traditional taxonomical features [13]. The genomic DNA of the plants was used as PCR template with a set of ten-mer oligonucleotide primers applied to the studied species of Cassia and Senna (Table 3). PCR was conducted with random six primer resulted reproducible profiles in the studied species of Cassia and Senna. The PCR amplicons for each primer for the tested plants were shown in Fig. 4. A total 130 bands were scored from PCR amplification of genomic DNA with all the species. In RAPD profiling, a total of 47 clear and reproducible bands was produced, of which 46 bands were polymorphic and only one band was monomorphic which generated by ABI-08 primer. The obtained bands were ranged in size from 100 to 1200 bp. The largest amplicon 1200 bp was amplified by the primers ABI-09, ABI-10 ABI-11, and the shortest amplicons 100 bp by ABI-12. Maximum numbers of 9 amplification products were obtained with primer ABI-09 followed by 8 products with primer ABI-07, ABI08, ABI-10, and ABI-12. Minimum numbers of RAPD products were generated with primers ABI-11. The polymorphic information contents (PIC) ranged from 0.33 to 0.45 with an average of 0.37. The highest RAPD marker index (MI) (4.05) was found in primer ABI-09 and the lowest (2.31) in ABI-08 (Table 7). Jaccard’s similarity index was ranged from 0.575 to 0.068, as shown in Table 8. The highest similarity value (0.575) was recorded between C. grandis, C. javanica subsp. nodosa and the lowest similarity value (0.068) between C. grandis, Senna surattensis and C. javanica subsp. nodosa and S. surattensis. The phylogenetic relatedness of RAPD analysis was constructed using UPGMA and the hierarchical clustering using PAST 4.3e as shown in Fig. 4. The RAPD analysis of the current genera was consistent with the morphological, conventional taxonomical features of the subtribe of Cassinnae as adopted by [3, 4]. From the results, the seven taxa of subtribe Cassinae were separated into two clusters for the genus Cassia and the genus Senna. The UPGMA phenogram generated from the hierarchical clustering analysis of RAPD marker illustrated that C. fistula is delimited as a different identity at distance coefficient of 4.5 from the remainder taxa which are clustered together in one group (Fig. 4). Within this group C. renigera is delimited as a different identity at a distance coefficient of 4.0 as revealed from the UPGMA clustering. Cassia javanica subsp. nodosa was delimited at a distance coefficient of about 3.8, while both of C. roxburghii and C. grandis were clustered together at a distance of about 0.74 (Fig. 4).

Fig. 4.

Fig. 4

UPGMA analysis of based on the RAPD Markers of seven different taxa of Cassia & Senna generated. A RPAD profile analysis of the experimented plants with the different primers, B PCA analysis of the tested plants based on the RAPD profile

Table 7.

Analysis of polymorphism among species of Cassia and Senna obtained with 6 random primers

Primers name Primer Sequence (5′-3′) Size Range of Amplified Product (bp) Total no. of amplicon Total number of bands No of Monomorphic bands Number of Polymorphic bands (%) Polymorphism PIC = 2 × fi × (1-fi) MI=PIC × Number of Polymorphic bands
ABI-07 GGTGACGCAG 1000-100 27 8 0 8 100 0.35 2.8
ABI-08 GTCCACACGG 1000-180 27 8 1 7 87.5 0.33 2.31
ABI-09 TGGGGGACTC 1200-250 24 9 0 9 100 0.45 4.05
ABI-10 CTGCTGGGAC 1200-200 21 8 0 8 100 0.40 3.2
ABI-11 GTAGACCCGT 1200-200 15 6 0 6 100 0.39 2.34
ABI-12 CCTTGACGCA 900-100 16 8 0 8 100 0.34 2.72
Total 130 47 46
Average 0.37
Table 8.

Jaccard’s coeffcient of similarity indices between 7 species of Cassia and senna as revealed from RAPD using 6 primer

Taxa Cassia fistula Cassia grandis Cassia renigera Cassia roxburghii DC Cassia javanica L.. subsp. nodosa Senna alata Senna. surattensis
Cassia fistula 100.00
Cassia grandis 0.512 1
Cassia renigera 0.297 0.518 1
Cassia roxburghiiDC 0.512 0.575 0.464 1
Cassia javanicaL.. subsp.nodosa 0.388 0.482 0.333 0.387 1
Senna alata 0.105 0.166 0.142 0.093 0.181 1
Senna. surattensis 0.117 0.068 0.111 0.068 0.1 0.076 1

The PCA analysis reflects the strength of the RAPD markers to classify the examined Taxa by plotting the PC1 and PC2. From the PCA scatter plot, a clearly discrimination between the two Taxa was observed revealing the characteristic grouping of Cassia and Senna. In addition, the species Senna alata and Senna surattensis were grouped together, but the species of C. renigera, C. javanica, C. roxburghii and C. grandis was grouped on a distinct group (Fig. 4C). The interspecific genetic divergence refers to the genetic variation within the species, with clear separation of the two genera Cassia and Senna, as revealed from the coincidence criteria of morphological and molecular features [3, 4]. The separation of Cassia and Senna species into two different clusters verify the segregation of the genus Cassia L. senso lato into two distinct genera namely Senna P. Mill., and Cassia L. senso stricto. The consistence of morphological and molecular taxonomical features of the subtribe Cassinae for grouping into two genera Cassia and Senna has been reported [86, 87]. Based on vegetative and reproductive characteristics, Cassia fistula was assigned to series Cassia a while C. renigera, C. javanica subsp. nodosa and C. roxburghii were included in series Obolospermae and C. grandis to series Grandes. Senna surratensis in series Peiranisia while Senna alata to series Interglandulosae.

GC-MS metabolic profiling analysis

The metabolic profiling pattern of the tested plants was analyzed as metabolic marker for confirming the traditional taxonomical features and molecular DNA barcoding analysis [47]. Gas chromatography-mass spectrometry has been established as a key technological tool for metabolic profiling and taxonomical tools to confirm the traditional taxonomical features. The GC-MS metabolic profiling has been used frequently for taxonomic purposes 129 species belonging to 29 genera of the Convolvulaceae [88], six species of Salvia (Lamiaceae) [89], three species of the tree-fern Cyathea (Cyatheaceae) [90]. Eleven species of Solanum (Solanaceae) [91] Centaurea galicicae and C. tomorosii (Asteraceae) [92] and also for 14 species of that family [93]. GC-MS has immensely contributed to the detection of bioactive constituents from plants which might be very useful for drug research and discovery [30, 94].

An extensive survey of literature elucidated that there is no evidence for the utility of GC-MS screening of phytochemicals has been generated for the taxonomic investigation of genus Cassia from Egypt or anywhere else. Conversely, an immense phytochemical interest using GC-MS has been paid on Cassia sens. Lat. (including species of Senna) as a result of their excellent medicinal values [24, 67]. From the GC-MS profile (Table 9), 23 metabolic compounds were identified in the methanol extracts of leaves of the taxa, with obvious fluctuation on their concentrations, as revealed from the area of the peaks of chromatograms of GC-MS. The identified compounds of the studied taxa with their retention times, molecular formula, molecular weight, chemical class and concentration were represented. The GC-MS chromatograms were shown in Figs. 5, 6 and 7. The identified compounds were assigned to various chemical classes such as organosiloxane, esters, fatty acid esters, fatty acids and alcohols, hydrocarbons, phenolic compounds, carboxylic sugar and fat-soluble Vitamin E. The first compound identified, in the leaf extracts, was Cyclooctasiloxane, hexadecamethyl at a retention time 17.97 min in Cassia fistula and C. grandis, while Vitamin E was the last compound at the retention time 58.49 min in all the taxa investigated except S. surtattensis. The compounds Neophytadiene, Hexadecanoic acid, ethyl ester, 16-Octadecenoic acid, methyl ester, 9-Octadecenoic acid, ethyl ester and Vitamin E was highly dominant in C. fistula. While, the compounds 2,4-Di-tert-butylphenol, 1-Nonadecene, Hexadecanoic acid, methyl ester, 9-Octadecenoic acid, methyl ester, 9,12-Octadecadienoic acid (Z,Z), methyl ester were the most frequent in C. grandis. Vitamin E and phytol were the most dominant metabolites in C. javanica subsp. nodosa followed by 9-Octadecenoic acid, ethyl ester and Hexadecanoic acid. Myo-Inositol was the most frequent metabolite in Cassia renigera (46.5%) followed C. roxburghii (19.8%). Remarkably, the biological and chemical identities of the metabolites of the genera Cassia was distinctly different from the genera of Senna. The most dominant compounds of S. alata and S. surratensis were different from that of Cassia sp., ensuring the metabolic difference of gene expression pattern on both genera. Out of the 23 phytochemical compounds identified, four compounds detected at different retention times and with varied concentrations displayed a consistent occurrence among the taxa investigated. These common compounds comprised Hexadecanoic acid, methyl ester; Hexadecanoic acid, ethyl ester; 9-Octadecenoic acid (Z)-ethyl ester and Vitamin E (Table 9). Several of the scored phytochemical compounds were demonstrated as unique chemical traits for individual species; such for instances C. fistula, C. grandis, C. javanica subsp. nodosa and C. roxburghii. Furthermore, the absence of 16-Octadecenoic acid, methyl ester and Oleic acid at the retention time 37.2 and 40.6 min, respectively, could be characteristic for C. grandis, while the absence of 1,2-benzenedicarboxylic acid, bis(2-ethylhexyl) ester could be diagnostic for C. renigera, S. alata and S. sutattensis (Table 9).

Table 9.

The identified phytocompounds in the methanolic extracts of leaves of the taxa studied of Cassia and Senna

RT Phytocompounds MF MW Chemical class Area %
sp1 sp2 sp3 sp4 sp5 Sp6 Sp7
17.97 Cyclooctasiloxane, hexadecamethyl- C16H48O8Si8 592 Organosiloxane 0.60 1.23
21.01 1-Hexadecanol C16H34O 242 Cetyl alcohol (16 C fatty alcohol) 2.06
22.85 2,4-Di-tert-butylphenol C14H22O 206 Alkyl benzene 2.57
23.24 2,6-Diflurobenzoic acid, tridec-2-ynyl ester C20H26F2O2 336 Ester 1.55
23.55 Phenol, 2-propyl- C9H12O 136 Propyl phenol 1.70
26.69 1-Nonadecene C19H38 266 Un-branched 19 C alkene 5.48
27.07 Guanosine C10H13N5O5 283 Purine nucleoside 6.38 2.60
28.08 Neophytadiene C20H38 278 Diene Hydrocarbon 4.63 3.87 3.16
28.94 Tetradecanoic acid C14H28O2 228 Fatty acid 1.37
32.54 Hexadecanoic acid, methyl ester C17H34O2 270 Fatty acid ester 2.44 12.45 3.93 3.46 2.44
34.01 Hexadecanoic acid, ethyl ester C18H36O2 284 Fatty acid ester 4.59 0.63 5.13 3.67 4.14 5.5 5.7
36.04 Myo-Inositol, 2-C-methyl- C7H14O6 194 Carbocyclic sugar 46.5 19.86 49.59
36.83 Phytol C20H40O 296 Acyclic diterpene alcohol 11.99 3.20 10.31
37.23 16-Octadecenoic acid, methyl ester C19H36O2 296 Fatty acid ester 3.07 3.96 3.61 4.06 2.24 4.74
37.26 9-Octadecenoic acid, methyl ester (E)- C19H36O2 296 Fatty acid ester 15.81
37.61 9,12-Octadecadienoic acid (Z,Z)-, methyl ester C19H34O2 294 Fatty acid ester 10.06
38.54 9-Octadecenoic acid (Z)-, ethyl ester C20H38O2 310 Fatty acid ester 7.13 1.15 9.30 8.63 3.58 5.25 0.61
40.60 Oleic acid C18H34O2 282 Fatty acid 2.93 1.43 1.25 0.82
43.80 Meadowlactone C20H38O2 310 Delta-lactone 4.47
45.72 9-Octadecenoic acid (Z)-, 2,3-dihydroxypropyl ester C21H40O4 356 Monoacylglycerol 2.08
48.62 1,2-Benzenedicarboxylic acid, bis(2-ethylhexyl) ester C24H38O4 390 Aromatic dicarboxylic acid ester (Ester) 1.44 1.75 1.00 0.71
53.68 Docosanoic acid, 1,2,3-propanetriyl ester C69H134O6 1058 Fatty acid ester 1.38 0.38
58.49 Vitamin E C29H50O2 430 Fat-soluble vitamin 5.11 0.64 18.67 3.57 1.39 2.04 0.57

- Absent, MF Molecular formula, MW Molecular weight, sp1Cassia fistula, sp2Cassia grandis, sp3Cassia javanica subsp. nodosa, sp4Cassia renigera, sp5Cassia roxburghii, Senna alata, sp6 Senna surattensis

Fig. 5.

Fig. 5

GC-MS chromatogram of methanol leaf extract of Cassia fistula and Cassia grandis

Fig. 6.

Fig. 6

.

Fig. 7.

Fig. 7

GC-MS chromatogram of methanol leaf extract of Senna alata, and Senna surattensis

The present study comparatively explores the taxonomic framework, phytochemical constituents of leaves of six species of Cassia and Senna and one subspecies of genus Cassia from Egypt via GC-MS screening for use as chemical markers for classification of plants, [91, 93], for the therapeutic agents, [30]. The chemical information of plants can provide new taxonomic diagnostic characters that help to improve classification of plants [95]. Hexadecanoic acid, methyl ester; Hexadecanoic acid, ethyl ester; 9-Octadecenoic acid (Z)-ethyl ester and Vitamin E displayed a consistent occurrence among the taxa investigated. Thus, they can be designated, here, as the chemotaxonomic markers for the taxa investigated of Cassia and Senna at the genus level. Besides, several of the identified were assigned as exclusive diagnostic chemical traits for individual taxa, for example, 9-octadecenoic acid, 2,3-dihydroxypropyl ester and Docosanoic acid, 1,2,3-propanetriyl ester for C. fistula, while 1-Hexadecanol, 2,4-Di-tert-butylphenol, 1-Nonadecene and others are diagnostic for Cassia grandis. The lack of certain compounds and presence of other compound at the same retention times may be considered as chemotaxonomic guides for some species. For example, the absence of 16-Octadecenoic acid, methyl ester and oleic acid may be characteristic for Cassia grandis, while the absence of 1,2-Benzenedicarboxylic acid, bis(2-ethylhexyl) ester may be diagnostic for C. renigera. Based on vegetative and reproductive characteristics, C. fistula was assigned to series Cassia and C. grandis to series Grandes, while C. javanica and C. roxburghii were included in series Obolospermae. Hence, the taxa studied of genus Cassia may find their sound to be utilized in identification of potential lead compounds very useful for discovery of novel pharmaceuticals. For instance, Heaxdecanoic acid, methyl ester was reported to exhibit anti-inflammatory and antifibrotic activities [96]. 9-Octadecenoic acid (Z)-,2,3-dihydroxypropyl ester was regarded as a magic lipid regarding its diverse application in pharmaceuticals, cosmetics, food and protein crystallization Powder- [97]. They added that this compound is known for its surfactant and emulsifying properties. Besides, its use as a drug delivery enhancer was documented [98]. Fatty acids are carboxylic acids with an aliphatic chain which are either saturated or unsaturated [99]. Monounsaturated and polyunsaturated fatty acids have been utilized to lower the risk of heart disease and also to enhance the immune system [100]. Herein, Oleic acid; is one of the unsaturated fatty acids, has been reported to exhibit various bioactivities such as anti-inflammatory, cancer preventive, hypochloestrolemic and dermatitigenic [101]. The compound 1,2-Benzenedicarboxylicacid, bis(2-ethylhexyl) ester was isolated from twigs of the dicot flowering plant Thevetia peruviana as a potential biomarker [102]. They added that this compound was proved to be a strong immunomodulatory B-cell stimulant. Moreover, this compound revealed positive anticancer activity on PC3, MCF and other cancer cell lines. Phytol is an acyclic diterpene alcohol which is a precursor for vitamins E and K1 [66] It results from the hydrolysis of chlorophyll and was found to be effective at different stages of arthritis [103]. Moreover, phytol was found to have antibacterial activities against Staphylococcus aureus [104]. Neophytadiene was reported as presenting antimicrobial and anti-inflammatory activities [105]. Vitamin E is a fat-soluble compound that functions as antioxidant in human body system [106]. 2,4-Di-tert-butyl phenol is a lipophilic phenol produced by various groups of organisms as a common toxic secondary metabolite [107].

Conclusions

Few taxonomical studies on the genus Cassia and Senna, were published regard to the biological identity of these plants as repertoire to various bioactive compound. Thus, the objective of the current was to revise and authenticate the phylogenetic relationship between studied taxa of the species of Cassia and Senna in Egypt using the recent tools of ITS barcoding, RAPD analysis and metabolic profiling, in comparing to the traditional taxonomical features. The taxonomical description of the studied taxa was confirmed from the molecular analysis of ITS sequences and RAPD analysis. Thus, from the molecular analysis, two clades were clearly separated into Clade I of Cassia and Clade II of Senna. The cluster I represented by C. fistula, C. renigera, C. roxburghii, and C. javanica sub nodosa, and the cluster II represented by S. alata and S. surattensis. The morphological, molecular traits of the studied plants were authenticated from the metabolic profiling by GC-MS analysis. The identified compounds were potentially useful for both the taxonomic purpose and pharmaceutical applications. The study highlighted the pharmaceutical significance of several of the identified phytochemicals. From the taxonomical view, the genetic links between members of the Cassiineae, namely the Cassia, Senna genus are solved and morphological observations support. Conclusively, the traditional morphological features, molecular barcoding using ITS sequences, RAPD analysis and metabolic traits by GC-MS analysis, authenticates the taxonomical diversity of the genus Cassia and Senna.

Supplementary Information

12870_2022_3543_MOESM1_ESM.docx (16.8KB, docx)

Additional file 1: Table S1. List of 28 morphological character and their state in the seven studied taxa of Cassia and Senna.

Additional file 2. (364.7KB, pdf)

Acknowledgements

We greatly appreciate the financial support from the Academy of Scientific Research and Technology, Egypt.

Authors’ contributions

M.M.E, H.A.H, R.S.S, and S.S.T conceptualize and write the original draft of the manuscript. A.S.E revise and edit the work. All of the authors read and approved the manuscript.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). The work has been partially funded from the Egyptian Academy of Scientific Research and Technology.

Availability of data and materials

The datasets used and analyzed during the current study available from the corresponding author on reasonable request. The accession numbers of the deposited ITS sequences were listed on Table 4.

Declarations

Ethics approval and consent to participate

This article does not contain any studies with human participants or animals. The collection materials of the plants, complies the relevant institutional, national, and international guidelines and legislation.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Marwa M. Eldemerdash, Email: m_demerdash81@yahoo.com

Ashraf S. A. El-Sayed, Email: ash.elsayed@gmail.com

Rania S. Shehata, Email: araniasalah@yahoo.com

References

  • 1.Lewis GP, Schrire B, Lock M. Legumes of the world. Kew: Royal Botanical Gardens; 2005. p. 591. [Google Scholar]
  • 2.Takhtajan A. Flowering plants. 2. Springer, Springer Science+Business Media B.V. 2009, ISBN: 978-1-4020-9608-2; 2009. pp. 350–351. [Google Scholar]
  • 3.Irwin HS, Barneby RC. The American Cassiineae, a synoptical revision of Leguminosae, tribe Cassieae, subtribe Cassinae in the New World. Mem New York Bot Gard. 1982;35:1–918. [Google Scholar]
  • 4.Irwin HS, Barneby RC. Cassieae Bronn. In: Polhill RM, Raven PH, editors. Advances in legume systematics. Royal Botanic Gardens: Kew; 1981. pp. 97–106. [Google Scholar]
  • 5.Randel BR. Revision of the Cassiinae in Australia. 2. Senna Miller Sect. Psilorhegma (J. Vogel) Irwin & Barneby. J Adelaide Bot Gard. 1989;12:165–270. [Google Scholar]
  • 6.Randel BR. Revision of the Cassiinae in Australia. 1. Senna Miller Sect. Chamaefistula. J Adelaide Bot Gard. 1990;13:1–16. [Google Scholar]
  • 7.Singh V. Journal of economic and taxonomic botany, additional series 18. Jodhpur: Scientifi c Publisher; 2001. Monograph of Indian subtribe Cassiinae (Caesalpinaceae) [Google Scholar]
  • 8.Endress PK. Diversity and evolutionary biology of tropical flowers. Cambridge: Cambridge University Press; 1994. [Google Scholar]
  • 9.Tucker SC. Trends in evolution of floral ontogeny in Cassia sensu stricto, Senna, and Chamaecrista (Leguminosae: Caesalpinioideae: Cassieae: Cassiinae); a study in convergence. Amer J Bot. 1996;83(6):687–711. doi: 10.1002/j.1537-2197.1996.tb12758.x. [DOI] [Google Scholar]
  • 10.Boonkerd T, Pechsri S, Baum BR. A phenetic study of Cassia sansu lato (Leguminosae Caesalpinioideae: Cassieae: Cassiinae) in Thailand. Plant Syst Evol. 2005;252:153–165. doi: 10.1007/s00606-004-0278-0. [DOI] [Google Scholar]
  • 11.Herendeen PS, Bruneau A, Lewis GP. Phylogenetic relationships in caesalpinioid legumes: a preliminary analysis based on morphological and molecular data advances in legume systematics, part 10. Kew: Royal Botanic Gardens; 2003. pp. 37–62. [Google Scholar]
  • 12.Tucker SC. The role of floral development in studies of legume evolution. Can J Bot. 1992;70:692–700. doi: 10.1139/b92-089. [DOI] [Google Scholar]
  • 13.Abdel-Hameed UK, El-Magly UI, Ishak IF, Tantawy ME. A contribution to the specification of Caesalpinioideae (L) based on morphological and molecular criteria. Beni-Suef Univ J Basic Appl Sci. 2013;2(1):120–127. [Google Scholar]
  • 14.Singh G. Plant systematics. An integrated approach. 4. CRC Press: Taylor & Francis Group; 2019. pp. 380–381. [Google Scholar]
  • 15.Brenan JPM. Leguminosae Subfamily Caesalpinioideae. In: Milne-Redhead E, Polhill RM, editors. Flora of tropical East Africa. London: White Friars Press, Crown Agents for Oversea Governments and Administrations; 1967. p. 230. [Google Scholar]
  • 16.Fawzi NM, Hanan SA, Mohamed AA. Numerical taxonomy of the tribe Cassieae (Leguminosae: Caesalpinioideae) in Egypt. Int J Environ. 2015;4:262–270. [Google Scholar]
  • 17.Marazzi B, Endress KP, de Queiroz LP, Conti E. Phylogenetic relationships within Senna (Leguminosae, Cassiinae) based on three chloroplast DNA regions: patterns in the evolution of floral symmetry and extrafloral nectaries. Am J Bot. 2006;93(2):288–303. doi: 10.3732/ajb.93.2.288. [DOI] [PubMed] [Google Scholar]
  • 18.Allaby MA. A dictionary of plant sciences. 2. Oxford, New York: Oxford University Press; 1998. p. 79. [Google Scholar]
  • 19.Deshpande HA, Bhalsing S. Recent advances in the phytochemistry of some medicinally important Cassia species. A review. Int J Pharm Med Biol Sci. 2013;2:60–78. [Google Scholar]
  • 20.Abdel Hakim F, Gad HA, Radwan RA, Ayuob N, El-Shazly M. Chemical constituents and biological activities of Cassia genus: a review. Arch Pharm Sci ASU. 2019;3:195–227. [Google Scholar]
  • 21.Bhalodia NR, Nariya PB, Acharya RN, Shukla VJ. In vitro antibacterial and antifungal activities of Cassia fistula Linn. fruitpulp extracts. Ayu. 2012;33:123–129. doi: 10.4103/0974-8520.100329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Srividhya M, Hridya H, Shanthi V, Ramanathan K. Bioactive Amento flavone isolated from Cassia fistula L. leaves exhibits therapeutic efficacy. 3 Biotech. 2017;7:33. doi: 10.1007/s13205-017-0599-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kolar FR, Gogi CL, Khudavand MM, Choudhari MS, Patil SB. Phytochemical and antioxidant properties of some Cassia species. Nat Prod Res. 2017;32:1324–8. [DOI] [PubMed]
  • 24.Safwat GM, Hamed MM, Moatamed SA. Studies of the biological activity of Cassia fistula. PhOL. 2018;1:75–85. [Google Scholar]
  • 25.Panda SK, Padhi LP, Mohanty G. Antibacterial activities and phytochemical analysis of Cassia fistula Linn. leaf. J Adv Pharm Technol Res. 2011;2:62–67. doi: 10.4103/2231-4040.79814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bhuvaneswari R, Gobalakrishnan R. Antimicrobial potential and structural elucidation of bioactive compounds from flower extract of Cassia javanica L. IJNPR. 2014;5:34–39. [Google Scholar]
  • 27.Elujoba AA, Abere AT, Adelusi SA. Laxative activities of Cassia pods sourced from Nigeria. Nig J Nat Prod Med. 1999;3:51–53. [Google Scholar]
  • 28.Limtrakul P, Yodkeeree S, Thippraphan P, Punfa W, Srisomboon J. Anti-aging and tyrosinase inhibition effects of Cassia fistula flower butanolic extract. BMC Complement Altern Med. 2016;16:497. doi: 10.1186/s12906-016-1484-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sermakkani M, Thangapandian V. GC-MS analysis of Cassia italica leaf methanol extract. Asian J Pharm Clin Res. 2012;5:90–94. [Google Scholar]
  • 30.Selvaraj D, Subramanian A, Samuel T. GC-MS analysis of Abelmoschus manihot (L.) Medik (Malvaceae) leaves. WJARR. 2020;5:67–79. [Google Scholar]
  • 31.Asraoui F, Kounnoun A, Cadi HE, Cacciola F, Majdoub YOE, Alibrando F, Mandolfino F, Dugo P, Mondello L, Louajri A. Phytochemical investigation and antioxidant activity of Globularia alypum L. Molecules. 2021;26:759. doi: 10.3390/molecules26030759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tripathi V, Goswami S. Assessment of genetic diversity in Berberis lycium Royle complex using RAPD markers. J Cell Biol Genet. 2011;3:1–13. doi: 10.5897/JCBG11.003. [DOI] [Google Scholar]
  • 33.Tilwari A, Chauhan D, Sharma R, Singh RK. Assessment of genetic variations among medicinal plant Cassia tora from different geographic regions of Central India using RAPD markers. Med Aromat Plants (Los Angel) 2016;5:276. [Google Scholar]
  • 34.Nybom H. Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plants. J Mol Ecol. 2004;13:1143–1155. doi: 10.1111/j.1365-294X.2004.02141.x. [DOI] [PubMed] [Google Scholar]
  • 35.Li JM, Jin ZX. High genetic differentiation revealed by RAPD analysis of narrowly endemic Sinocalycanthus chinensis Cheng et SY Chang, an endangered species of China. Biochem Syst Ecol. 2006;34:725–735. doi: 10.1016/j.bse.2006.06.010. [DOI] [Google Scholar]
  • 36.Downie SR, Kartz-Downie DS. A molecular phylogeny of Apiaceae subfamily Apioideae: evidence from nuclear ribosomal DNA internal transcribed spacer sequences. Am J Bot. 1996;83(2):234–251. doi: 10.1002/j.1537-2197.1996.tb12701.x. [DOI] [PubMed] [Google Scholar]
  • 37.Baraket G, Ben Abdelkrim A, Mars M, Salhi-Hannachi A. Genetic diversity and molecular evolution of the internal transcribed spacer (ITSs) of nuclear ribosomal DNA in the Tunisian fig cultivars (Ficus carica L.; Moracea) Biochem Syst Ecol. 2013;48:20–33. doi: 10.1016/j.bse.2012.11.017. [DOI] [Google Scholar]
  • 38.Hillis DM, Davis SK. Ribosomal DNA: interspecific polymorphism, concerted evolution, and phylogeny reconstruction. Syst Zool. 1988;37:63–66.4–251. doi: 10.2307/2413191. [DOI] [Google Scholar]
  • 39.Chiang TY, Schaal BA. The internal transcribed spacer 2 region of the nuclear ribosomal DNA and the phylogeny of the moss family Hylocomiaceae. Plant Syst Evol. 2000;224:127–137. doi: 10.1007/BF00986338. [DOI] [Google Scholar]
  • 40.Galimberti A, Casiraghi M, Bruni I, Guzzetti L, Cortis P, Berterame NM, Labra. From DNA barcoding to personalized nutrition: the evolution of food traceability. Curr Opin Food Sci. 2019;28:41–48. doi: 10.1016/j.cofs.2019.07.008. [DOI] [Google Scholar]
  • 41.Saravanan M, Mohanapriya G, Laha R, Sathishkumar R. DNA barcoding detects floral origin of Indian honey samples. Genome. 2019;62(5):341–348. doi: 10.1139/gen-2018-0058. [DOI] [PubMed] [Google Scholar]
  • 42.Ramos-Onsins SE, Rozas J. Statistical properties of new neutrality tests against population growth. Mol Biol Evol. 2002;19(12):2092–2100. doi: 10.1093/oxfordjournals.molbev.a004034. [DOI] [PubMed] [Google Scholar]
  • 43.Feng S, Jiang M, Shi Y, Jiao K, Shen C, Lu J, Ying Q, Wang H. Application of the ribosomal DNA ITS2 region of Physalis (Solanaceae): DNA barcoding and phylogenetic study. Front Plant Sci. 2016;7(1047):1–11. doi: 10.3389/fpls.2016.01047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hosseinzadeh-Colagar A, Haghighatnia M, Amiri Z, Mohadjerani M, Tafrihi M. Microsatellite (SSR) amplification by PCR usually led to polymorphic bands: evidence which shows replication slippage occurs in extendor nascent DNA strands. Mol Biol Res Commun. 2016;5(3):167–174. [PMC free article] [PubMed] [Google Scholar]
  • 45.Aghayeva P, Cozzolino S, Cafasso D, Ali-zade V, Fineschi S, Aghayeva D. DNA barcoding of native Caucasus herbal plants: potentials and limitations in complex groups and implications for phylogeographic patterns. Biodivers Data J. 2021;9:e61333. doi: 10.3897/BDJ.9.e61333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Nötralite İçin İstatistiksel Testler Statistical tests for neutrality: review. Turkiye Klinikleri J Biostat. 2017;9(2):167–174. doi: 10.5336/biostatic.2016-53446. [DOI] [Google Scholar]
  • 47.El-Demerdash M, El-Sayed AS, Georg NM, Abou-Elnour A, Nosier H. Biosystematic studies of some Egyptian species of Cestrum (Solanaceae) Mol Biol Rep. 2021;48(5):4497–4515. doi: 10.1007/s11033-021-06471-1. [DOI] [PubMed] [Google Scholar]
  • 48.Boulos L. Flora of Egypt. Cairo: Al-Hadara Publishing; 1999. [Google Scholar]
  • 49.Boulos L. Flora of Egypt. Cairo: Al-Hadara Publishing; 2000. [Google Scholar]
  • 50.Täckholm V. Students Flora of Egypt. 2. Cairo University; 1974. [Google Scholar]
  • 51.Hammer Ø, Harper DAT, Ryan PD. Past: paleontological statistics software package for education and data analysis. Palaeontol Electron. 2001;4:1–9. [Google Scholar]
  • 52.El-Sayed ASA. L-methioninase production by Aspergillus flavipes under solid-state fermentation. J Basic Microbiol. 2009;49:331–341. doi: 10.1002/jobm.200800318. [DOI] [PubMed] [Google Scholar]
  • 53.El-Sayed ASA, Abdel-Azim S, Ibrahim H, Yassin MA, Abdel- Ghany S, Esener S, Ali GS. Biochemical stability and molecular dynamic characterization of Aspergillus fumigatus cystathionine γ-Lyase in response to various reaction effectors. Enzym Microb Technol. 2015;81:31. doi: 10.1016/j.enzmictec.2015.08.004. [DOI] [PubMed] [Google Scholar]
  • 54.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis. 1999. [Google Scholar]
  • 56.El-Sayed ASA, Shindia AA, Zeid AAA, Yassin AM, Sitohy MZ, Sitohy B. Aspergillus nidulans thermostable arginine deiminase-dextran conjugates with enhanced molecular stability, proteolytic resistance, pharmacokinetic properties and anticancer activity. Enzym Microb Technol. 2019;131:109432. doi: 10.1016/j.enzmictec.2019.109432. [DOI] [PubMed] [Google Scholar]
  • 57.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Rozas J, Sanchez-Delbarrio JC, Messeguer X, Rozas R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 2003;19:2496–2497. doi: 10.1093/bioinformatics/btg359. [DOI] [PubMed] [Google Scholar]
  • 59.Tajima F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 1989;123:585–595. doi: 10.1093/genetics/123.3.585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Fu YX, Li WH. Statistical tests of neutrality of mutations. Genetics. 1993;133:693–709. doi: 10.1093/genetics/133.3.693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 1990;18(22):6531–6535. doi: 10.1093/nar/18.22.6531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.El-Sayed ASA, Hassan AEA, Shindia AA, Mohamed SG, Sitohy MZ. Aspergillus flavipes methionine γ-lyase-dextran conjugates with enhanced structural, proteolytic stability and anticancer efficiency. J Mol Catal B Enzym. 2016;133:S15–S24. doi: 10.1016/j.molcatb.2016.11.002. [DOI] [Google Scholar]
  • 63.Smith JSC, Chin LCE, Shu H, Smith SO, Wall JS, Senior LM, Michell ES, Kresovick S, Ziegle J. An evaluation of the utility of SSR loci as molecular markers in maize (Zea mays) comparison with data from RFLPs and pedigrees. Theor Appl Genet. 1997;95:163–173. doi: 10.1007/s001220050544. [DOI] [Google Scholar]
  • 64.Sneath PHA, Sokal RR. Numerical taxonomy: the principles and practice of numerical classification. San Francisco: Freeman; 1973. p. 573. [Google Scholar]
  • 65.Dice LR. Measures of the amount of ecologic association between species. Ecology. 1945;26:297–302. doi: 10.2307/1932409. [DOI] [Google Scholar]
  • 66.Patel JS, Vitoreli A, Palmateer AJ, El-Sayed A, Norman DJ, Goss EM, Brennan MS, Ali GS. Characterization of Phytophthora spp. isolated from ornamental plants in Florida. Plant Dis. 2016;100:500–509. doi: 10.1094/PDIS-05-15-0598-RE. [DOI] [PubMed] [Google Scholar]
  • 67.Socrates SH, Mohan SC. Phytochemical analysis of flower extracts of different Cassia species by using gas chromatography-mass spectrometry. Int J Biol Chem. 2019;13:1–11. doi: 10.3923/ijbc.2019.1.11. [DOI] [Google Scholar]
  • 68.Shyam AK, Vartak VD. Seed morphology of Indian Caesalpinaceae; Cassia. Seed Sci Technol. 1985;13:699–712. [Google Scholar]
  • 69.Bhattacharya A, Saha PK. SEM studies on extrafloral nectaies of the leguminales. Proc Indian National Sci Acad. 1992;37:11–30. [Google Scholar]
  • 70.Sahai K, Kaur H, Pal A. Macro and micro morphological seed characteristics of some Cassia species and their taxonomic signifi cance. Phytomorphology. 1997;47:273–279. [Google Scholar]
  • 71.Alvarez I, Wendel JF. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 2003;29:417–434. doi: 10.1016/S1055-7903(03)00208-2. [DOI] [PubMed] [Google Scholar]
  • 72.Jorgenson RD, Cluster PD. Modes and tempos in the evolution of ribosomal DNA: new characters for evolutionary studies and new markers for genetic and population studies. Ann Mo Bot Gard. 1988;75:1238–1247. doi: 10.2307/2399282. [DOI] [Google Scholar]
  • 73.El-Sayed AS, Khalaf SA, Abdel-Hamid G, El-Batrik MI. Screening, morphological and molecular characterization of fungi producing cystathionine γ-lyase. Acta Biol Hung. 2015;66:119–132. doi: 10.1556/ABiol.66.2015.1.10. [DOI] [PubMed] [Google Scholar]
  • 74.El- Sayed ASAFE, Fujimoto S, Yamada C, Suzuki H. Enzymatic synthesis of γ-glutamylglutamine, a stable glutamine analogue, by γ-glutamyltranspeptidase from Escherichia coli K-12. Biotechnol Lett. 2010;32:1877–1881. doi: 10.1007/s10529-010-0364-z. [DOI] [PubMed] [Google Scholar]
  • 75.Souza MGC, Benko-Iseppon AM. Cytogenetics and chromosome banding patterns in Caesalpinioideae and Papilionoideae species of Pará, Amazonas, Brazil. Bot J Linn Soc. 2004;144:181–191. doi: 10.1111/j.1095-8339.2003.00230.x. [DOI] [Google Scholar]
  • 76.Bellarosa R, Simeone MC, Papini A, Schirone B. Utility of ITS sequence data for phylogenetic reconstruction of Italian Quercus spp. Mol Phylogenet Evol. 2005;34:355–370. doi: 10.1016/j.ympev.2004.10.014. [DOI] [PubMed] [Google Scholar]
  • 77.Sharma S, Rustgi S, Balyan HS, Gupta PK. Internal transcribed spacer (ITS) sequences of ribosomal DNA of wild barley and their comparison with ITS sequences in common wheat. Barley Genet Newslett. 2002;32:32–45.
  • 78.El-Sayed ASA, Yassin MA, Ibrahim H. Coimmobilization of L-methioninase and glutamate dehydrogenase: novel approach for l -homoalanine synthesis. Biotechnol Appl Biochem. 2015;62:514–522. doi: 10.1002/bab.1299. [DOI] [PubMed] [Google Scholar]
  • 79.Kehie M, Kumaria S, Sangeeta Devi K, Tandon P. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA. Meta Gene. 2016;7:56–63. doi: 10.1016/j.mgene.2015.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Liston A, Robinson WA, Oliphant JM, Alvarez-Buylla ER. Length variation in the nuclear ribosomal DNA internal transcribed spacer region of non-flowering seed plants. Syst Bot. 1996;21(2):109–120. doi: 10.2307/2419742. [DOI] [Google Scholar]
  • 81.Bellarosa R, Delre V, Schirone B, Maggini F. Ribosomal RNA genes in Quercus spp (Fagaceae) Plant Syst Evol. 1990;172:127–139. doi: 10.1007/BF00937803. [DOI] [Google Scholar]
  • 82.Nickrent DL, Patrick JA. The nuclear ribps:osomal DNA intergenic spacers of wild and cultivated soybean have low variation and cryptic subrepeats. Genome. 1998;41(2):183–192. doi: 10.1139/g98-001. [DOI] [PubMed] [Google Scholar]
  • 83.Nepolo E, Chimwamurombe PM, Cullis CA, Kandawa-Schulz MA. Determining genetic diversity based on ribosomal intergenic spacer length variation in Marama bean (Tylosema esculentum) from the Omipanda area, Eastern Namibia. Afr J Plant Sci. 2010;4(9):368–373. [Google Scholar]
  • 84.Maina N, Baraket G, Salhi-Hannachi A, Sakka H. Sequence analysis and molecular evolution of Tunisian date palm cultivars (Phoenix dactylifera L.) based on the internal transcribed spacers (ITSs) region of the nuclear ribosomal DNA. Sci Hortic. 2019;247(2019):373–379. doi: 10.1016/j.scienta.2018.12.045. [DOI] [Google Scholar]
  • 85.El-Sayed ASA, Fathalla M, Yassin MA, Zein N, Morsy S, Sitohy M, Sitohy B. Conjugation of Aspergillus flavipes taxol with porphyrin increases the anticancer activity of taxol and ameliorates its cytotoxic effects. Molecules. 2020;25(2):263. doi: 10.3390/molecules25020263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Tripathi V. Generic relationship among Cassia L., Senna Mill. and Chamaecrista Moench using RAPD markers. Int J Biodivers Conserv. 2011;3(3):92–100. [Google Scholar]
  • 87.George NM, Hussein HA. Biochemical and molecular criteria of some Egyptian species of Cassia and Senna (Subfamily: Caesalpinioideae-Leguminosae); with reference to their taxonomic significance. Life Sci J. 2014;11(10):1055–1062. [Google Scholar]
  • 88.Schimming T, Jenett-Siems K, Mann P, Tofren-Reblin B, Milson J, Johnson RW, Deroin T, Austin DF, Eich E. Calystegines as chemotaxonomic markers in the Convolvulaceae. Phytochemistry. 2005;66:469–480. doi: 10.1016/j.phytochem.2004.12.024. [DOI] [PubMed] [Google Scholar]
  • 89.Salimpour F, Mazooji A, Darzikolaei SA. Chemotaxonomy of six Salvia species using essential oil composition markers. J Med Plant Res. 2011;5:1795–1805. [Google Scholar]
  • 90.Janakiraman N, Johnson MAA. GC-MS analysis of ethanolic extracts of Cyathea nilgirensis, C. gigantea and C. crinita. Egypt Pharm J. 2016;15:43–47. doi: 10.4103/1687-4315.184028. [DOI] [Google Scholar]
  • 91.El-Sayed ASA, Shindia AA, Ali GS, Yassin MA, Hussein H, Awad SA, Ammar HA. Production and bioprocess optimization of antitumor Epothilone B analogue from Aspergillus fumigatus, endophyte of Catharanthus roseus, with response surface methodology. Enzym Microb Technol. 2021;143:109718. doi: 10.1016/j.enzmictec.2020.109718. [DOI] [PubMed] [Google Scholar]
  • 92.Janaćković P, Gavrilović M, Vujisić L, Matevski V, Marin PD. Fatty acid composition of the cypselae of two endemic Centaurea species (Asteraceae) Bot Ser. 2017;41:3–9. [Google Scholar]
  • 93.El-Sayed AS, Shindia AA, Zaher YA. Purification and characterization of L-amino acid oxidase from the solid-state grown cultures of Aspergillus oryzae ASH. Microbiology (Russian Federation) 2013;82(6):762–771. [Google Scholar]
  • 94.El-Sayed ASA, Shindia AA, AbouZeid A, Koura A, Hassanein SE, Ahmed RM. Triggering the biosynthetic machinery of Taxol by Aspergillus flavipes via cocultivation with Bacillus subtilis: proteomic analyses emphasize the chromatin remodeling upon fungal-bacterial interaction. Environ Sci Pollut Res. 2021;28:39866–39881. doi: 10.1007/s11356-021-13533-1. [DOI] [PubMed] [Google Scholar]
  • 95.Maamoun HS, Rabie GH, Shaker I, Alaidaroos BA, El-Sayed ASA. Biochemical properties of tyrosinase from Aspergillus terreus and Penicillium copticola; undecanoic acid from Aspergillus flavus, an endophyte of Moringa oleifera, is a novel potent tyrosinase inhibitor. Molecules. 2021;26(5):1309. doi: 10.3390/molecules26051309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Dief HE-S, Hashem E-SA, Fawzan S, El-Sayed ASA. Alleviation of salt stress in Triticum aestivum by biopriming with Phanerochaete chrysosporium. J Crop Sci Biotechnol. 2021;24:103–116. doi: 10.1007/s12892-020-00064-3. [DOI] [Google Scholar]
  • 97.Powder-George YL, Mohamed FK. GC-MS analysis of the bioactive phytoconstituents of various organic crude extracts from the seed kernels of Manilkara bidentata (balata) collected in Trinidad, WI. Nat Prod Res. 2018;32:358–361. doi: 10.1080/14786419.2017.1354192. [DOI] [PubMed] [Google Scholar]
  • 98.Badr H, El-Baz A, Mohamed I, Shetaia Y, El-Sayed ASA, Sorour N. Bioprocess optimization of glutathione production by Saccharomyces boulardii: biochemical characterization of glutathione peroxidase. Arch Microbiol. 2021;203:6183–6196. doi: 10.1007/s00203-021-02584-0. [DOI] [PubMed] [Google Scholar]
  • 99.Iqrar I, Shinwari ZK, El-Sayed ASAF, Ali GS. Exploration of microbiome of medicinally important plants as biocontrol agents against Phytophthora parasitica. Arch Microbiol. 2021;203(5):2475–2489. doi: 10.1007/s00203-021-02237-2. [DOI] [PubMed] [Google Scholar]
  • 100.El-Sayed MT, El-Sayed ASA. Bioremediation and tolerance of zinc ions using fusarium solani. Heliyon. 2020;6(9):e05048. doi: 10.1016/j.heliyon.2020.e05048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Lakshmi PTV, Rajalakshmi P. Identification of phyto-components and its biological activities of Aloe vera through the gas chromatography-mass spectrometry. IRJP. 2011;2:247–249. [Google Scholar]
  • 102.El-Sayed ASA, Khalaf SA, Azez HA, Hussein HA, El-Moslamy SH, Sitohy B, El-Baz AF. Production, bioprocess optimization and anticancer activity of Camptothecin from Aspergillus terreus and Aspergillus flavus, endophytes of Ficus elastica. Process Biochem. 2021;107:59–73. doi: 10.1016/j.procbio.2021.05.007. [DOI] [Google Scholar]
  • 103.Ogunlesi M, Okiei W, Ofor E, Osibete AE. Analysis of the essential oil from the dried leaves of Euphorbia hirta Linn. (Euphorbiaceae), a potential medication for asthma. Afr J Biotechnol. 2009;8:7042–7050. [Google Scholar]
  • 104.Abdel-Fatah SS, El-Batal AI, El-Sherbiny GM, Khalaf MA, El-Sayed AS. Production, bioprocess optimization and γ-irradiation of Penicillium polonicum, as a new Taxol producing endophyte from Ginko biloba. Biotechnol Rep. 2021;30:e00623. doi: 10.1016/j.btre.2021.e00623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Mustapa AN, Martin A, Mato RB, Cocero MJ. Extraction of phytocompounds from the medicinal plant Clinacanthus nutans Lindau by microwave-assisted extraction and supercritical carbon dioxide extraction. Ind Crop Prod. 2015;74:83–94. doi: 10.1016/j.indcrop.2015.04.035. [DOI] [Google Scholar]
  • 106.Bell EF. History of vitamin E in infant nutrition. Am J Clin Nutr. 1987;46:183–186. doi: 10.1093/ajcn/46.1.183. [DOI] [PubMed] [Google Scholar]
  • 107.Abd El-Ghani MM, El-Sayed ASA, Moubarak A, Rashad R, Nosier H, Khattab A. Biosystematic study on some Egyptian species of Astragalus L. (fabaceae) Agriculture (Switzerland) 2021;11:125. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12870_2022_3543_MOESM1_ESM.docx (16.8KB, docx)

Additional file 1: Table S1. List of 28 morphological character and their state in the seven studied taxa of Cassia and Senna.

Additional file 2. (364.7KB, pdf)

Data Availability Statement

The datasets used and analyzed during the current study available from the corresponding author on reasonable request. The accession numbers of the deposited ITS sequences were listed on Table 4.


Articles from BMC Plant Biology are provided here courtesy of BMC

RESOURCES