Abstract
Calibrachoa Cerv., Fabiana Ruiz & Pav., and Petunia Juss. form a clade within tribe Petunieae (Solanaceae). Phylogenetic studies of Petunieae, either as part of a family-wide analysis or focusing on the genera Calibrachoa and Petunia, have either left Fabiana unsampled or included only a single species. These studies have found conflicting relationships among the three genera with all three possible topologies obtained. Petuniapatagonica (Speg.) Millán, originally described in the genus Nierembergia Ruiz & Pav., is morphologically distinct within Petunia and geographically disjunct from other members of the genus. For the first time, in this study we include multiple species of Fabiana, Calibrachoa, and Petunia, including P.patagonica. Using three chloroplast DNA regions and the nuclear gene GBSSI, or “waxy,” our results provide strong support for a sister group relationship between Calibrachoa and Fabiana and for the placement of P.patagonica within Fabiana. Since there is already a species Fabianapatagonica Speg., we provide the new name Fabianaaustralis Alaria nom. nov. to replace Petuniapatagonica.
Keywords: Fabianaaustralis , Patagonia, Petuniapatagonica , Petunieae, phylogeny
Introduction
Solanaceae Juss. are one of the most important families among Angiosperms not only for their fundamental contribution to the human diet but also for their diversity and ecological functions in many ecosystems wordwide, especially in the Neotropics (Olmstead 2013). Solanaceae are a family of approximately 90 genera and ca. 2700–2800 species (Olmstead and Bohs 2007; Olmstead et al. 2008, but see Knapp et al. 2004 for a higher estimate). Molecular phylogenetic studies in Solanaceae, initially based on chloroplast DNA sequence data (Olmstead and Palmer 1992; Spooner et al. 1993; Olmstead and Sweere 1994; Olmstead et al. 1999; Gemeinholzer and Wink 2001; Santiago-Valentin and Olmstead 2003; Clarkson et al. 2004; Bohs 2005; Levin et al. 2005, 2006; Weese and Bohs 2007; Olmstead et al. 2008), and more recently using a combination of chloroplast and nuclear loci and with nearly all genera and over 1,000 species sampled, have produced a robust dated molecular phylogeny (Goldberg et al. 2010; Särkinen et al. 2013; Ng and Smith 2015; Dupin et al. 2016).
Molecular phylogenetic studies unraveled relationships that were not consistent with traditional classification of the family and split up tribe Nicotianeae and resurrected tribe Petunieae to include most of the former Nicotianeae, excluding Nicotiana L., but including Brunfelsia L. (Olmstead et al. 1999, 2008; Olmstead and Bohs 2007). These results showed that the genera Petunia Juss., Calibrachoa Cerv., and Fabiana Ruiz & Pav. form a strongly supported clade and provided weak evidence suggesting that Fabiana is sister to Calibrachoa and that together they are sister to Petunia. The tribe Petuniae has been subject to several phylogenetic studies, with most of the focus on Petunia and Calibrachoa (Ando et al. 2005; Kulcheski et al. 2006; Stehmann et al. 2009; Fregonezi et al. 2012, 2013; Reck-Kortmann et al. 2014, 2015; Mäder and Freitas 2019). Few of these studies have included representatives of Fabiana, and when they do, relationships among the three genera sometimes do not agree (e.g., Särkinen et al. 2013; Reck-Kortmann et al. 2015; Mäder and Freitas 2019). Also, the rare species Petuniapatagonica (Speg.) Millán, which is morphologically distinct and geographically disjunct from other Petunia species, has an uncertain placement in Petunieae (Stehmann and Greppi 2013; Reck-Kortmann et al. 2015).
Fabiana is endemic to South America, distributed in southern Peru, Bolivia, Chile, and Argentina, with 15 species of shrubs adapted to the high Andean deserts of Puna, Prepuna, Monte, and Patagonia, growing from sea level to 4900 m elevation in sandy, rocky soils of very low fertility, low organic matter and variable salt content (Barboza and Hunziker 1993; Alaria and Peralta 2013; Alaria 2015). Fabiana species have characteristic morphological adaptations: leaflessness or small leaves, photosynthetic and resinous stems, and flat or cushion growth habits (Alaria 2015), and they play an important ecological role as codominant shrubs in some plant communities. Petuniapatagonica is restricted to the Patagonian region of Argentina, and its identity is controversial; it was first described in Nierembergia Ruiz & Pav. by Spegazzini (1897) and subsequently transferred to Petunia by Millán (1941).
In this study we explore the relationships among these three genera using sequences of the plastid trnS-trnG, trnL-trnF and psbA-trnH regions and partial sequences of the nuclear GBSSI or “waxy” gene, providing the first evidence of relationships among species of Fabiana and resolving the systematic position of the enigmatic species Petuniapatagonica.
Materials and methods
Taxon sampling
Leaf samples were obtained from fresh material collected in the natural habitat of species or from cultivated plants, and preserved in silica gel. Data, including collecting site, voucher, and herbarium where the voucher has been deposited, are indicated in Appendix 1 for specimens of tribe Petunieae: Bouchetia Dunal (1 species), Brunfelsia (1), Calibrachoa (4), Fabiana (9), Nierembergia (1), and Petunia (8, including P.patagonica), and outgroup taxa in the genera Benthamiella Speg. (1 species), Nicotiana (3), Pantacantha Speg. (1), and Solanum L. (1).
Additional specimens were analyzed for morphological traits, mainly species of Calibrachoa, Fabiana, Nierembergia, and Petunia in the Argentinean herbaria: BAB, CORD, CTES, LP, LIL, MEN, MERL, and SI, as well as in herbaria in Bolivia: LPB and HSB; Chile: LS; Perú: USM; and England: K (all acronyms are in accordance to Index Herbariorum; http://sweetgum.nybg.org/science/ih/). Specimens of Petuniapatagonica were examined and are cited after the species description in the Discussion.
DNA amplification and sequencing
DNA extraction was performed using the Qiagen DNeasy Plant Mini Kit (http://www.qiagen.com). Three regions of chloroplast DNA were amplified. For the trnL-trnF region, the primers and amplification conditions of Taberlet et al. (1991) were used. This region was included in the phylogenetic analysis of Olmstead et al. (2008), where it provided essential characters for their classification of Solanaceae. Two other plastid fragments were selected for being more variable molecular markers in Calibrachoa (Fregonezi et al. 2012) and Petunia (Lorenz-Lemke et al. 2006; Kulcheski et al. 2006): the trnS-trnG region and the psbA-trnH region. For the trnS-trnG region, the primers and amplification conditions of Hamilton (1999) were used, and for the psbA-trnH region, the primers and amplification conditions of Sang et al. (1997) were used. The nuclear gene GBSSI or “waxy”, which has a single copy in tomato (Solanumlycopersicum L.) and diploid potato varieties (Solanumtuberosum L.) (van der Leij et al. 1991), was selected because it is an informative marker for phylogenetic analyses in Solanaceae (Peralta and Spooner 2001; Walsh and Hoot 2001; Levin and Miller 2005; Yuan et al. 2006; Spooner et al. 2008; Levin et al. 2011; Särkinen et al. 2013). The first waxy sequences of Fabiana specimens were obtained with primers initially designed for Solanumlycopersicum (Peralta and Spooner 2001), but new Petunieae-specific primers were generated: WAXY 5´ GTGGGTACTGAGGTTGGTCCTT and WAXY 3´ GGGCTCACTGTAACCACCCTAT, improving amplification of representative samples. Tomato and potato specimens were also amplified for waxy as controls for the expected fragment length, using a known molecular mass marker (Lambda/EcoRI-HindIII Marker). Purified PCR products were sequenced using standard Sanger sequencing methods at the Biogenomics Unit of the Institute of Biotechnology of the National Institute of Agricultural Technology (INTA Castelar), Buenos Aires, Argentina.
Editing and aligning of chloroplast and nuclear sequences
The sequences were manually edited with PROcessor of SEQuences (PROSEQ) version 2.9 (Filatov 2002). Alignment was performed in BioEdit version 5.0.6. (Hall 2004), first using ClustalW and then adjusted by manual alignment. Waxy alignments were made by comparing sequences with the gene in Solanumtuberosum (GenBank accession X83220). Chloroplast fragments were aligned with Petuniaaxillaris sequences for trnS-trnG (JF918370), trnL-trnF (AY098702), and psbA-trnH (DQ225610).
Phylogenetic analysis
We created three datasets for phylogenetic analyses. One dataset consisted of the three plastid loci for 21 species. A second dataset comprising 20 samples consisted of the nuclear waxy sequences. The third dataset comprising 18 samples consisted of the three plastid loci and the nuclear waxy gene concatenated for each species for which sequences for waxy and at least two of the three plastid loci were available. For each locus, we compared nucleotide substitution models using the Akaike Information Criterion from analyses in jModeltest 2.1.4 (Guindon and Gascuel 2003; Darriba et al. 2012) and chose an appropriate model within the 95% confidence interval. Phylogenetic analyses were performed using two different inference methods, maximum likelihood (ML) and Bayesian. In analyses with a concatenated sequence dataset, each locus was treated as a separate partition, and the GTR + gamma model of nucleotide substitution was used for each partition. In analyses with just waxy, the HKY + gamma model was chosen. We performed ML analyses using GARLI 2.0 (Zwickl 2006). We executed four replicates of each full search, and used a generation threshold for termination of 20,000 and score threshold for termination of 0.001. Default settings were used for all other parameters. We additionally performed bootstrap searches using a generation threshold for termination of 10,000. For concatenated datasets, 500 bootstrap replicates were done, and for the waxy dataset, 1,000 bootstrap replicates were done. Bayesian analyses were done in MrBayes 3.2.1 (Ronquist et al. 2012) with two runs with four chains each. For concatenated datasets, analyses were run for 10,000,000 generations, sampling every 1,000 generations. For the waxy dataset, analyses were run for 5,000,000 generations with a sampling frequency of 500 generations. We determined that convergence was attained when the average standard deviation of split frequencies was <0.05 and the estimated sample size of parameters was >200 in Tracer 1.5 (Rambaut and Drummond 2009). Majority-rule consensus trees were constructed after discarding the initial 25% of samples as burn-in.
Results
The analyses of concatenated chloroplast sequences (Fig. 1) confirmed monophyly of the genera Calibrachoa, Fabiana, and Petunia, with the exclusion of P.patagonica (see below) and the phylogenetic relationships among the three genera was the same found by Olmstead et al. (2008) with Petunia sister to Fabiana and Calibrachoa, and the last two sister to each other. With limited sampling in the rest of tribe Petunieae and outgroups, Nierembergia is weakly supported as sister to Nicotiana. The analysis also strongly supports the placement of Petuniapatagonica within Fabiana.
Figure 1.
Chloroplast DNA tree of 17 Petunieae species and four outgroups. Phylogeny based on maximum likelihood analysis of concatenated trnS-trnG, trnL-trnF, and psbA-trnH chloroplast fragments. Maximum likelihood bootstrap values and Bayesian posterior probabilities shown at nodes.
Waxy amplifications always showed a single band for a fragment of similar size to the one in potato and tomato controls. Although waxy gene copy number is unknown in Fabiana, Calibrachoa, and Petunia, it is expected to be a single copy and orthologous in the analyzed taxa, as has been demonstrated in other diploid Solanaceae species (van der Leij et al. 1991). The waxy phylogeny of 20 taxa (Fig. 2) is consistent with the chloroplast DNA analyses in recovering the monophyly of Calibrachoa, Fabiana, and Petunia, and the same relationships among them. Similarly, Petuniapatagonica is included within Fabiana. With strong support, Nierembergia is resolved as sister to Bouchetia.
Figure 2.
Nuclear waxy tree of 20 Petunieae species. Phylogeny based on maximum likelihood analysis of the nuclear waxy gene. Maximum likelihood bootstrap values and Bayesian posterior probabilities shown at nodes.
The results of the analyses of the concatenated sequences of chloroplast loci and waxy combined also recovered the same major relationships (Fig. 3). Monophyly of Fabiana with Petuniapatagonica nested within it is strongly supported (posterior probability = 1.0). In these analyses, P.patagonica is weakly supported as sister to Fabianaimbricata Ruiz and Pav. Additionally, Fabiana is resolved as sister to Calibrachoa with strong support, and Petunia is sister to the clade comprising Fabiana and Calibrachoa. Nierembergia forms a clade with the remaining representatives of Petunieae with strong support.
Figure 3.
Combined chloroplast and nuclear DNA tree of 14 Petunieae species and four outgroups. Phylogeny based on maximum likelihood analysis of chloroplast fragments trnS-trnG, trnL-trnF and psbA-trnH and the nuclear waxy gene concatenated. Maximum likelihood bootstrap values and Bayesian posterior probabilities shown at nodes.
Discussion
Sequences of three chloroplast markers and the nuclear gene waxy were informative for the inference of phylogenetic relationships among Calibrachoa, Fabiana, and Petunia in tribe Petunieae. Both the analyses of the combined chloroplast regions and the nuclear gene waxy corroborated Calibrachoa as sister to Fabiana with strong support, as obtained by Olmstead et al. (2008). A few studies of Petunieae with a single species of Fabiana sampled obtained results with Fabiana either sister to Petunia plus Calibrachoa (Särkinen et al. 2013) or Petunia (Reck-Kortmann et al. 2015; Mäder and Freitas 2019), in contrast to our results. All of our analyses also found Petuniapatagonica to be nested within Fabiana. This result is consistent with that of Reck-Kortmann et al. (2015), who found P.patagonica sister to F.imbricata and the combined clade sister to the rest of Petunia; but with only a single representative of Fabiana, that study was not able to reveal conclusively the placement of P.patagonica within Fabiana. Considering these phylogenetic results as well as shared morphological characteristics, geographical distribution, and chromosomal number between Fabiana and Petuniapatagonica (Reck-Kortmann et al. 2015), the transfer of Petuniapatagonica to the genus Fabiana is strongly supported.
Circumscription of Fabiana and transfer of Petuniapatagonica to Fabiana
This study resolves the phylogenetic position of Petuniapatagonica, an enigmatic species of controversial generic affinity. Spegazzini (1897) originally described this species in the genus Nierembergia based on a specimen collected in Gulf Saint George, Argentina. The corolla and androecium resemble other Nierembergia species, with a narrow base to the corolla tube that expands distally. Subsequently, in a review of Nierembergia, Millán (1941) transferred the species to Petunia, considering its floral characters as closer to this genus. The species has several characteristics that differentiate it from all other Petunia species and has been considered an outlier in the genus based on its geographic distribution and chromosome number (Stehmann and Greppi 2013; Reck-Kortmann et al. 2015). The species was included in a molecular phylogenetic study with several species of Petunia, two species of Calibrachoa, but only one species of Fabiana and was found in a small clade with F.imbricata, which was sister to a clade comprising the other species of Petunia (Reck-Kortmann et al. 2015).
Traditional classifications of Petuniapatagonica have relied primarily on morphology, but with the insight gained from molecular phylogenetic studies, we can see that taxonomists weighed different floral traits in assigning the species first to Nierembergia and then to Petunia, while overlooking the similarities with Fabiana, including the resinous stems and dorsifixed anthers. Other characteristics, such as the chromosome number of Petuniapatagonica (n = 9), match those found in Fabiana species (Acosta et al. 2006). The particular distribution of this species in southern Patagonia (Fig. 4) and the environment where it grows, are similar to those of other Fabiana species (e.g., F.imbricata, F.foliosa (Speg.) S.C.Arroyo and F.nana (Speg.) S.C.Arroyo). The results of the molecular phylogenetic analyses obtained in this work also support its transfer to the genus Fabiana.
Figure 4.
Geographic distribution of the genera Fabiana, Calibrachoa, Petunia, and Nierembregia, and the species Fabianaaustralis Alaria. Flowers and seeds of representative species: Fabianapatagonica Speg (first flower scale: 2.5 mm, second flower scale: 5 mm, seed scale: 0.5 mm, surface details magnifications 600× and 1,500×); Calibrachoaparviflora (Juss.) D’Arcy (first flower scale: 2.5 mm, second flower scale: 5 mm, seed scale: 0.5mm, surface details magnifications 500× and 1,500×); Petuniaaxillaris (Lam.) Britton, Sterns & Poggenb. (first flower scale= 5mm, second flower scale: 10mm, seed scale: 0.5mm, surface details magnifications 600× and 1,500×); Nierembergiapulchella Gillies ex Miers (first flower scale: 5mm, second flower scale: 10mm, seed scale: 0.5mm, surface details magnifications 600× and 1,500×). Photograph IBODA, Flora Argentina database.
. Fabiana australis
Alaria nom. nov.
A69084F1-6D0C-586A-B3BC-E646C78DF656
urn:lsid:ipni.org:names:77297063-1
Figure 5.
Fabianaaustralis Alaria. A plant B flowering branch C flower D corolla deployed showing gynoecium and stamens of different length E stigma F anthers G capsule H capsule showing seeds, I capsule valve J seeds. Scale bars: 10 mm (A); 4 mm (B); 5 mm (C); 2.5 mm (D); 1 mm (E); 0.5 mm (F); 2 mm (G, H). Illustration by Cecilia Scoones.
Petunia patagonica (Speg.) Millán. Darwiniana 5: 544 1941.
Basionym.
Nierembergiapatagonica Speg. Revista Fac. Agron. Univ. Nac. La Plata 3: 357. 1897, non Fabianapatagonica Speg. (1897). Type: Argentina. Prov. Santa Cruz, Golfo de San Jorge, C. Ameghino, Febr. 1896, “in campis aridis glariosis” (holotype: LP 006658!).
Description.
Densely branched shrubs forming compact cushions of approximately 50 cm tall and up to 2.5 (-4) m in diameter; stems erect, leafy, glandular-pubescent, resinous. Leaves alternate but apparently verticillated by shortening of the internodes, sessile, fleshy, glandular; linear, elliptical or obovate, blade 3–4 (5) mm long by 1–2 mm wide. Flowers terminal, solitary, erect; flowering pedicels of 4–6 mm. Calyx tubular or slightly campanulate, (8–) 11–12 mm long, externally with dense glandulous indumentum, internally with scattered glandulous pubescence, short and broadly triangular lobes, 2–3 mm long by 2–3.5 mm wide, almost as long as wide. Corolla yellow with marked violet nerves, but also with color variation from light purple to deep violet, infundibuliform, 20–25 (–30) mm long, externally glandular, broad triangular lobes 2.5–5 mm long by 6–10 mm wide. Stamens heterodynamous, adhered to the middle third of the corolla, about 9 mm from the base of the corolla; filaments 2 short and 3 long, somewhat geniculate at the point of insertion with short glandular hairs scattered at the base; ellipsoid anthers of 1–1.5 mm. Ovary obovoid, 2.5–3 mm long, 1.2–1.5 mm wide, with nectariferous disc surrounding the base, 10–15 mm long style, truncated stigma, shallowly split. Capsule ovoid, 5–9 mm long by 3–5.5 mm wide. Seeds numerous, polyhedrical in shape, 2–2.5 mm long.
Common name.
“Mogote” meaning mound shape (Santa Cruz: Arroyo 1999)
Geographical distribution and habitat.
Endemic to Patagonian Argentina, in the provinces of Chubut and Santa Cruz, from 90 to 700 m elevation, inhabiting dry and cold environments, on stony, sandy soils, sometimes rich in silt and clay, poor in organic matter. It forms large populations of cushion shrubs with numerous showy flowers (Fig. 6).
Figure 6.
Fabianaaustralis Alaria. Plants habit and flower details (Zuloaga FO 13991, SI). Photograph IBODA, Flora Argentina database.
Taxonomic notes.
The epithet autralis was selected based on the restricted distribution of this species in southern Argentina. It is not possible to use patagonica as a specific epithet in Fabiana, because it is already in use in Fabianapatagonica Speg. Fabianaaustralis is one of the southernmost species of the genus. It shares with F.foliosa and F.nana a similar habit forming dense cushions in dry, cold, and poor soils of Patagonian Argentina.
Representative specimens examined.
Argentina: Santa Cruz: Dpto. Corpen Aike, G.E. Barboza 3706 (CORD); O. Boelcke 16264 (BAB); A.A. Cocucci 3684 & 3723 (CORD); M.N. Correa 6527 (BAB); R.H. Fortunato 7492 (BAB); C.A. O’Donell 3794 (CORD00015699). Dpto. Deseado, L.M. Bernardello & M.R. Figueroa Romero 335 (CORD00015696!); O. Boelcke, 12214 (BAB); A.A. Cocucci 4175 (CORD); M.N. Correa 2644 & 6697 (BAB); B.E Leuenberger 4100 (B: D-14191 Berlin); M.C. Romanczuk 989 (UEC); F.B. Vervoorst 5658 (CORD 00015700!). Dpto. Güer Aike, A. Soriano 5062 (BAB). Dpto. Lago Argentino, G.E. Barboza 3732 (CORD); A.A. Cocucci 471 (CORD 00015694!); R.H. Fortunato 4967 (BAB, ARIZ, NY, HRP); C. Guerrido 785 (SI). Dpto. Magallanes, G.E. Barboza 3704 (CORD); O. Boelcke 15394 (BAB); Iter Patagonicum 762 L. Hauman & C.M. Hicken (SI); B.E. Leuenberger & S. Arroyo 3710 (CORD 00015698!). Dpto. Río Chico, M.N. Correa & E.G. Nicora 3517 (BAB; CORD 00015697!); G.E. Barboza 3696 (CORD); G.E. Barboza 3746 (CORD; SI 063988!); G.E. Barboza 3748 (CORD); O. Boelcke 12810 (BAB); J.M. Bonifacino 2986 (SI); C.M. Hicken 10245 (SI); F.O. Zuloaga 13978 & 13991 (SI). Valle del Río Santa Cruz C. Burmeister s.n. & 95 (SI); M. Gentili 330 (BAB); J. Koslowsky 122 (CORD 00015695!). Without locality A. Donat 206 (SI); P.K.H. Dusén 5496 (SI); E. Molina Massey 31 (SI); Tessleff 5496 (SI). Chubut: Dpto. Futaleufú, A.A. Cocucci 3997 (CORD 00022097!); Dpto. Paso de Indios, S.C. Arroyo 208 (BAB, LIL, K); Dpto. Sarmiento, A. Alaria 321 (MERL). Dpto. Languiñeo, A. Alaria 324 (MEN).
Taxonomic characters differentiating Calibrachoa, Fabiana, Petunia, and Nierembregia are described in the following key. Geographic distribution of the four genera and Petuniapatagonica, as well as photographs of flowers and seeds of representative species of each genus, are illustrated in Figure 4.
Key to genera
| 1 | Resinous shrubs to camephytes, stems densely leafy to partially foliated and even aphyllous; reduced membranaceous, slightly fleshy or leathery leaves. Dorsifixed anthers, usually elongated | Fabiana |
| – | Non resinous, annual or perennial herbs, rarely subshrubs; leafy stems, developed membranaceous to fleshy leaves. Ventrifixed anthers with different shapes: reniform, globose, or ovate | 2 |
| 2 | Hypocrateriform corolla with narrow and cylindrical tube. Androecium with 5 fertile stamens equal in length or heterodynamous, generally with 2 longer and 3 shorter stamens, adnate at the top edge of the corolla tube and generally connivent around the style; wide stigma usually tightly arranged between the anthers; staminal filaments and style apex usually straight. Nectary absent. Polyhedral seed, straight embryo | Nierembergia |
| – | Infundibuliform to campanulate, rarely hypocrateriform, corolla with wide tube. Androecium with 5 fertile heterodynamous stamens, generally with 2 longer, 2 medium length, and one shorter stamen, or 4 subequal and one shorter stamen, adnate at the top edge of the corolla tube but rarely connivent around the style; narrow stigma, staminal filaments and apex style usually curved. Nectary present. Ellipsoid, round, or reniform seed, straight or slightly curved embryo | 3 |
| 3 | Corolla with reciprocative aestivation, the induplicated anterior lobe covering the other four conduplicated lobes, or rarely imbricate aestivation; calyx usually divided nearly to the middle, lobes narrowing towards the apex; seed episperm with straight anticlinal cell walls | Calibrachoa |
| – | Corolla with imbricate aestivation; deeply lobed calyx, lobes linear or spatulate, widening towards the apex; seed episperm with wavy anticlinal cell walls | Petunia |
Supplementary Material
Acknowledgements
The authors thank Gloria Barboza and Sandra Knapp for their taxonomic insights into tribe Petunieae, Cecilia Scoones for botanical illustrations, and Cinthia Costa for map and photograph designs. This study was supported by CONICET and SIIP - UNCuyo awards. The authors have declared that no competing interests exist.
Appendix 1
Voucher and locality information for specimens of species collected for this study and GenBank accession numbers for sequences used, with those generated for this study in bold.
Table A1.
| Species | Voucher | Location | Coordinates | trnL-trnF | trnS-trnG | psbA-trnH | waxy |
|---|---|---|---|---|---|---|---|
| Petunieae Tribe | |||||||
| Bouchetiaerecta DC ex Dunal | D’Arcy 18213 MO | Mexico | – | – | – | – | OK120263 |
| Brunfelsiaamericana L. | no voucher | Cultivated. USA, Matthaei Bot Gard | – | – | – | – | OK166947 |
| Calibrachoahumilis (R.E.Fr.) Stehmann & Semir | no voucher | Cultivated. Argentina, FCA, UNCuyo | 33°00'28.2"S, 68°52'16.4"W | MZ855907 | OK120228 | MZ855925 | OK120243 |
| Calibrachoaparviflora (Juss) D´Arcy | Alaria 432 MERL | Cultivated. Argentina, FCA, UNCuyo | 33°00'28.2"S, 68°52'16.4"W | MZ855908 | OK120229 | MZ855926 | OK120244 |
| Calibrachoamissionica Stehmann & Semir | no voucher | Cultivated. Argentina, FCA, UNCuyo | 33°00'28.2"S, 68°52'16.4"W | MZ855909 | OK120230 | MZ855927 | – |
| Calibrachoathymifolia (A.St.-Hil.) Stehmann & Semir | no voucher | Cultivated. Argentina, FCA, UNCuyo | 33°00'28.2"S, 68°52'16.4"W | MZ855910 | – | MZ855928 | OK120245 |
| Fabianabryoides Phil. | Alaria 444 MERL | Argentina, Jujuy | 22°31'47.8"S, 66°18'45.4"W | MZ855911 | OK120231 | MZ855929 | _____ |
| Fabianadensa J. Rémy | Alaria 365 MERL | Bolivia, Potosi | 19°52'48.2"S, 65°40'44.4"W | MZ855912 | OK120232 | MZ855930 | OK120246 |
| Fabianadenudata Miers | Alaria 356 MERL | Argentina, Mendoza | 32°29'16.3"S, 69°05'07.5"W | MZ855913 | OK120233 | MZ855931 | OK120247 |
| Fabianafoliosa (Speg.) S.C.Arroyo | Barboza 3760 CORD | Argentina, Santa Cruz | 47°20'09"S, 70°59'05"W | – | – | MZ855932 | OK120248 |
| Fabianaimbricata Ruiz & Pav. | Alaria 397 MERL | Argentina, Mendoza | 35°51'451"S, 69°48'27.5"W | MZ855914 | OK120234 | MZ855933 | OK120249 |
| Fabiananana (Speg.) S.C.Arroyo | Alaria 316 MERL | Argentina, Chubut | 45°47'44.5"S, 69°04'56.7"W | MZ855915 | OK120235 | MZ855934 | OK120250 |
| Fabianapatagonica Speg. | Alaria 359 MERL | Argentina Jujuy | 22°57'30"S, 65°25'39"W | MZ855916 | OK120236 | MZ855935 | OK120251 |
| Fabianapeckii Niederl. | Alaria 403 MERL | Argentina, Mendoza | 34°31'55.2"S, 68°28'14.7"W | MZ855917 | OK120237 | MZ855936 | OK120252 |
| Fabianapunensis S.C.Arroyo | Alaria 048 MERL | Argentina, Tucumán | 26°38'39.5"S, 65°49'12.5"W | MZ855918 | OK120238 | MZ855937 | OK120253 |
| Nierembergiascoparia Sendtn. | Alaria 431 MERL | Cultivated. Argentina, FCA, UNCuyo | 33°00'28.2"S, 68°52'16.4"W | MZ855920 | OK120240 | MZ855939 | OK120255 |
| Petuniaaltiplana T. Ando & Hashim | – | – | – | AY772868 | DQ792185 | DQ791917 | – |
| Petuniaaxillaris (Lam.) Britton, Sterns & Poggenb. | Alaria 430 MERL | Argentina, Mendoza | 32°58'45.7"S, 68°58'8"W | AY098702 | JF918370 | DQ225610 | OK120258 |
| Petuniaexserta Stehmann | Chau 312 WTU | Cultivated. USA, University of Washington | – | – | – | – | OK120259 |
| Petuniainflata R.E. Fr. | Olmstead S-62 WTU | Cultivated. USA, seed from Birmingham seed collection | – | – | – | – | OK120260 |
| Petuniaintegrifolia (Hook.) Schinz & Tell. | Chau 311 WTU | Cultivated. USA, University of Washington | – | AY772873 | JN565848 | DQ208151 | OK120261 |
| Petunianyctaginiflora Juss. | Olmstead S-63 WTU | Cultivated. USA, seed from Birmingham seed collection | – | – | – | – | OK120262 |
| Petuniapatagonica (Speg.) Millán | Alaria 321 MERL | Argentina, Chubut | 45°56'16.8"S, 69°09'12.4"W | MZ855919 | OK120239 | MZ855938 | OK120254 |
| Petuniascheideana L.B. Sm. & Downs | – | – | – | AY772870 | DQ792448 | DQ792149 | – |
| Outgroups | |||||||
| Benthamiellapycnophylloides Speg | Barboza 3688 CORD | Argentina, Santa Cruz | 46°57'2"S, 67°22'24.6"W | MZ855921 | OK120241 | MZ855940 | – |
| Nicotianaattenuata Torr. Ex S. Watson | – | – | – | AY098697 | AJ584953 | MG182422 | KR083023 |
| Nicotianalongiflora Cav. | Alaria 437 MERL | Argentina, Mendoza | 32°59'47.7"S, 68°56'1.5"W | MZ855923 | AJ584951 | MZ855942 | OK120256 |
| Nicotiananoctiflora Hook. | Alaria 438 MERL | Argentina, Mendoza | 32°59'49.4"S, 68°55'56.6"W | MZ855924 | AJ584975 | GQ248352 | OK120257 |
| Pantacanthaameghinoi Speg. | Barboza 3775 CORD | Argentina, Neuquén | 38°52'0"S, 70°34'36.2"W | MZ855922 | OK120242 | MZ855941 | – |
| Solanumlycopersicum L. | – | – | – | KY887587 | HQ856092 | KY887587 | DQ169036 |
Citation
Alaria A, Chau JH, Olmstead RG, Peralta IE (2022) Relationships among Calibrachoa, Fabiana and Petunia (Petunieae tribe, Solanaceae) and a new generic placement of Argentinean endemic Petunia patagonica. PhytoKeys 194: 75–93. https://doi.org/10.3897/phytokeys.194.68404
References
- Acosta MC, Ordonez Adel V, Cocucci AA, Moscone EA. (2006) Chromosome reports in South American Nicotianeae (Solanaceae), with particular referece to Nierembergia. Annals of the Missouri Botanical Garden 93(4): 634–646. 10.3417/0026-6493(2006)93[634:CRISAN]2.0.CO;2 [DOI]
- Alaria AS. (2015) Género Fabiana Ruiz et Pav. (Solanaceae): Diversidad, Distribución, Taxonomía y Filogenia basada en caracteres moleculares y morfológicos. Trabajo de Tesis para optar al grado académico de Doctor en Ciencias Biológicas Programa de Posgrado en Biología PROBIOL. Universidad Nacional de Cuyo, Mendoza, Argentina.
- Alaria AS, Peralta IE. (2013) Las especies de Fabiana Ruiz et Pav. (Solanaceae) que crecen en Chile. Chloris Chilensis 16(1): 1–24. http://www.chlorischile.cl [Google Scholar]
- Ando T, Kokubun H, Watanabe H, Tanaka N, Yukawa T, Hashimoto G, Marchesi E, Suárez E, Basualdo IL. (2005) Phylogenetic analysis of Petunia sensu Jussieu (Solanaceae) using chloroplast DNA RFLP. Annals of Botany 96(2): 289–297. 10.1093/aob/mci177 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arroyo SC. (1999) Petunia. In: Correa MN. (Ed.) Flora Patagónica.Parte VI. Dicotiledoneas. Gamopétalas (Ericaceae a Calyceraceae). INTA, Buenos Aires, 279–282.
- Barboza GE, Hunziker AT. (1993) Estudios en Solanaceae XXXIV. Revisión taxonómica de Fabiana. Kurtziana 22: 109–153.
- Bohs L. (2005) Major clades in Solanum based on ndhF sequence data. In: Keating RC, Hollowell VC, Croat TB. (Eds) A festchrift for William G. D’Arcy: the legacy of a taxonomist.Monographs in Systematic Botany from the Missouri Botanical Garden 104: 27–49.
- Clarkson JJ, Knapp S, Aoki S, Garcia VF, Olmstead RG, Chase MW. (2004) Phylogenetic relationships in Nicotiana (Solanaceae) inferred from multiple plastid DNA regions. Molecular Phylogenetics and Evolution 33(1): 75–90. 10.1016/j.ympev.2004.05.002 [DOI] [PubMed] [Google Scholar]
- Darriba D, Taboada GL, Doallo R, Posada D. (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9(8): e772. 10.1038/nmeth.2109 [DOI] [PMC free article] [PubMed]
- Dupin J, Matzke NJ, Särkinen T, Knapp S, Olmstead RG, Bohs L, Smith SD. (2016) Bayesian estimation of global biogeographic history of Solanaceae. Journal of Biogeography 44(4): 887–899. 10.1111/jbi.12898 [DOI] [Google Scholar]
- Filatov DA. (2002) PROSEQ: A software for preparation and evolutionary analysis of DNA sequence data sets. Molecular Ecology Notes 2(4): 621–624. 10.1046/j.1471-8286.2002.00313.x [DOI] [Google Scholar]
- Fregonezi JN, Freitas LB, Bonatto S, Semir J, Stehmann JR. (2012) Infrageneric classification of Calibrachoa (Solanaceae) based on morphological and molecular evidence. Taxon 61(1): 120–130. 10.1002/tax.611009 [DOI] [Google Scholar]
- Fregonezi JN, Turchetto C, Bonatto SL, Freitas LB. (2013) Biogeographical history and diversification of Petunia and Calibrachoa (Solanaceae) in the Neotropical Pampas grassland. Botanical Journal of the Linnean Society 171(1): 140–153. 10.1111/j.1095-8339.2012.01292.x [DOI] [Google Scholar]
- Gemeinholzer B, Wink M. (2001) Solanaceae: occurrence of secondary compounds versus molecular phylogeny. In: van den Berg RG, Barendse GWM, van der Weerden GM, Mariani C. (Eds) Solanaceae V: Advances in taxonomy and utilization.Nijmegen University Press, Nijmegen, The Netherlands, 165–177.
- Goldberg EE, Kohn JR, Lande R, Robertson KA, Smith SA, Igic B. (2010) Species selection maintains self-incompatibility. Science 330(6003): 493–495. 10.1126/science.1194513 [DOI] [PubMed] [Google Scholar]
- Guindon S, Gascuel O. (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52(5): 696–704. 10.1080/10635150390235520 [DOI] [PubMed] [Google Scholar]
- Hall T. (2004) BioEdit version 5.0.6. http://www.mbio.ncsu.edu/BioEdit/bioedit.html
- Hamilton MB. (1999) Four primers pairs for the amplification of chloroplast intergenic regions with intraspecific variation. Molecular Ecology 8: 513–525. [PubMed] [Google Scholar]
- Knapp S, Bohs L, Nee M, Spooner DM. (2004) Solanaceae-A Model for Linking Genomics with Biodiversity. International Journal of Genomics 5(3): 285–291. 10.1002/cfg.393 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kulcheski FR, Muschner VC, Lorenz-Lemke AP, Stehmann JR, Bonatto SL, Salzano FM, Freitas LB. (2006) Molecular phylogenetic analysis of Petunia Juss. (Solanaceae). Genetica 126(1–2): 3–14. 10.1007/s10709-005-1427-2 [DOI] [PubMed] [Google Scholar]
- Levin RA, Miller JS. (2005) Relationships within tribe Lycieae (Solanaceae): Paraphyly of Lycium and multiple origins of gender dimorphism. American Journal of Botany 92(12): 2044–2053. 10.3732/ajb.92.12.2044 [DOI] [PubMed] [Google Scholar]
- Levin RA, Watson K, Bohs L. (2005) A four gene study of evolutionary relationships in SolanumsectionAcanthophora. American Journal of Botany 92(4): 603–612. 10.3732/ajb.92.4.603 [DOI] [PubMed]
- Levin RA, Myers NR, Bohs L. (2006) Phylogenetic relationships among the “spiny solanums” (SolanumsubgenusLeptostemonum, Solanaceae). American Journal of Botany 93(1): 157–169. 10.3732/ajb.93.1.157 [DOI] [Google Scholar]
- Levin RA, Bernardello G, Whiting C, Miller JS. (2011) A new generic circumscription of tribe Lycieae (Solanaceae). Taxon 60(3): 681–690. 10.1002/tax.603005 [DOI] [Google Scholar]
- Lorenz-Lemke AP, Mäder G, Muschner VC, Stehmann JR, Bonatto SL, Salzano FM, Freitas LB. (2006) Diversity and natural hybridization in a highly endemic species of Petunia (Solanaceae): A molecular and ecological analysis. Molecular Ecology 15(14): 4487–4497. 10.1111/j.1365-294X.2006.03100.x [DOI] [PubMed] [Google Scholar]
- Mäder G, Freitas LB. (2019) Biogeographical, ecological, and phylogenetic analyses clarifying the evolutionary history of Calibrachoa in South American grasslands. Molecular Phylogenetics and Evolution 141: e106614. 10.1016/j.ympev.2019.106614 [DOI] [PubMed]
- Millán AR. (1941) Revisión de las Especies del género Nierembergia (Solanaceae). Darwiniana 5: 487–547. [Google Scholar]
- Ng J, Smith SD. (2015) Widespread flower color convergence in Solanaceae via alternate biochemical pathways. The New Phytologist 209(1): 407–417. 10.1111/nph.13576 [DOI] [PubMed] [Google Scholar]
- Olmstead RG. (2013) Phylogeny and biogeography in Solanaceae, Verbenaceae, and Bignoniaceae: A comparision of continental and intercontinental diversification patterns. Botanical Journal of the Linnean Society 171(1): 80–102. 10.1111/j.1095-8339.2012.01306.x [DOI] [Google Scholar]
- Olmstead RG, Bohs L. (2007) A summary of molecular systematic research in Solanaceae: 1982-2006. In: Spooner DM, Bohs L, Giovannoni J, Olmstead RG, Shibata D. (Eds) Solanaceae VI: Genomics Meets Biodiversity. Proceedings of the Sixth International Solanaceae Conference.Acta Horticulturae 745: 255–268. 10.17660/ActaHortic.2007.745.11 [DOI]
- Olmstead RG, Palmer JD. (1992) A chloroplast DNA phylogeny of the Solanaceae: Subfamilial relationships and character evolution. Annals of the Missouri Botanical Garden 79(2): 346–360. 10.2307/2399773 [DOI] [Google Scholar]
- Olmstead RG, Sweere JA. (1994) Combining data in phylogenetic systematics: An empirical approach using three molecular data sets in the Solanaceae. Systematic Biology 43(4): 467–481. 10.1093/sysbio/43.4.467 [DOI] [Google Scholar]
- Olmstead RG, Sweere JA, Spangler RE, Bohs L, Palmer JD. (1999) Phylogeny and provisional classification of the Solanaceae based on chloroplast DNA. In: Nee M, Symon D, Lester RN, Jessop J. (Eds) Solanaceae IV: Advances in Biology and Utilization.Royal Botanic Gardens, Kew, 111–137.
- Olmstead RG, Bohs L, Abdel Migid H, Santiago-Valentin E, Garcia VF, Collier SM. (2008) A molecular phylogeny of the Solanaceae. Taxon 57(4): 1159–1181. 10.1002/tax.574010 [DOI] [Google Scholar]
- Peralta IE, Spooner DM. (2001) GBSSI gene phylogeny of wild tomatoes (SolanumL.sectionLycopersicon [Mill.] Wettst. subsection Lycopersicon). American Journal of Botany 88(10): 1888–1902. 10.2307/3558365 [DOI] [PubMed] [Google Scholar]
- Rambaut A, Drummond AJ. (2009) Tracer, version 1.5. http://tree.bio.ed.ac.uk/software/tracer [accessed 10.10.2020]
- Reck-Kortmann M, Silva-Arias GA, Segatto ALA, Mäder G, Bonatto SL, Freitas LB. (2014) Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Molecular Phylogenetics and Evolution 81: 19–28. 10.1016/j.ympev.2014.08.022 [DOI] [PubMed]
- Reck-Kortmann M, Silva-Arias GA, Stehmann JR, Greppi JA, Freitas LB. (2015) Phylogenetic relationships of Petuniapatagonica (Solanaceae) revealed by molecular and biogeographical evidence. Phytotaxa 222(1): 17–32. 10.11646/phytotaxa.222.1.2 [DOI] [Google Scholar]
- Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sang T, Crawford DJ, Stuessy TF. (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84(8): 1120–1136. 10.2307/2446155 [DOI] [PubMed] [Google Scholar]
- Santiago-Valentin E, Olmstead RG. (2003) Phylogenetics of the Antillean Goetzeoideae (Solanaceae) and their relationships within the Solanaceae based on chloroplast and ITS DNA sequence data. Systematic Botany 28: 452–460. [Google Scholar]
- Särkinen T, Bohs L, Olmstead RG, Knapp SD. (2013) A phylogenetic framework for evolutionary study of the nightshades (Solanaceae): A dated 1000-tip tree. BMC Evolutionary Biology 13(1): e214. 10.1186/1471-2148-13-214 [DOI] [PMC free article] [PubMed]
- Spegazzini CL. (1897) Nierembergiapatagonica. Revista de la Facultad de Agronomía y Veterinaria, La Plata 3: e557.
- Spooner DM, Anderson GJ, Jansen RK. (1993) Chloroplast DNA evidence for the interrelationships of tomatoes, potatoes, and pepinos (Solanaceae). American Journal of Botany 80(6): 676–688. 10.1002/j.1537-2197.1993.tb15238.x [DOI] [Google Scholar]
- Spooner DM, Rodriguez F, Polgar Z, Ballard HE, Jansky SH. (2008) Genomic origins of potato polyploids: GBSSI gene sequencing data. Crop Science 48(S1): S27–S36. 10.2135/cropsci2007.09.0504tpg [DOI]
- Stehmann JR, Greppi JA. (2013) Petunia. Solanaceae. In: Zuloaga FO, Belgrano MJ, Anton AMR. (Eds) Flora Vascular de la República Argentina, vol.13. Estudio Sigma S.R.L, Buenos Aires, 127–134.
- Stehmann JR, Lorenz-Lemke AP, Freitas LB, Semir J. (2009) The Genus Petunia. In: Gerats T, Strommer J. (Eds) Petunia evolutionary, developmental and physiological genetics.Springer, New York, 1–28. 10.1007/978-0-387-84796-2_1 [DOI]
- Taberlet P, Gielly L, Pautou G, Bouvet J. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17(5): 1105–1109. 10.1007/BF00037152 [DOI] [PubMed] [Google Scholar]
- van der Leij FR, Visser RGF, Ponstein AS, Jacobsen E, Feenstra WJ. (1991) Sequence of the structural gene for granule- bound starch synthase of potato (Solanumtuberosum L.) and evidence for a single point deletion in the amf allele. Molecular & General Genetics 228(1–2): 240–248. 10.1007/BF00282472 [DOI] [PubMed] [Google Scholar]
- Walsh BM, Hoot SB. (2001) Phylogenetic relationships of Capsicum (Solanaceae) using DNA sequences from two noncoding regions: The chloroplast atpB-rbcL spacer region and nuclear waxy introns. International Journal of Plant Sciences 162(6): 1409–1418. 10.1086/323273 [DOI] [Google Scholar]
- Weese TL, Bohs L. (2007) A three gene phylogeny of the genus Solanum (Solanaceae). Systematic Botany 32(2): 445–463. 10.1600/036364407781179671 [DOI] [Google Scholar]
- Yuan Y, Zhang ZY, Chen ZD, Olmstead RG. (2006) Tracking ancient polyploids: A retroposon reveals an extinct diploid ancestor in the polyploid ancestry of Belladonna. Molecular Biology and Evolution 23: 2263–2267. 10.1093/molbev/msl099 [DOI] [PubMed]
- Zwickl DJ. (2006) Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. PhD dissertation, University of Texas at Austin, USA, 125 pp. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






