NRF2 Serves a Critical Role in Regulation of Immune Checkpoint Proteins (ICPs) During Trophoblast Differentiation

Kyunghee Hong; Sribalasubashini Muralimanoharan; Youn-Tae Kwak; Carole R Mendelson

doi:10.1210/endocr/bqac070

. 2022 May 21;163(7):bqac070. doi: 10.1210/endocr/bqac070

NRF2 Serves a Critical Role in Regulation of Immune Checkpoint Proteins (ICPs) During Trophoblast Differentiation

Kyunghee Hong ¹, Sribalasubashini Muralimanoharan ², Youn-Tae Kwak ³, Carole R Mendelson ^4,^5,^6,^7,^✉

PMCID: PMC9197021 PMID: 35596653

Abstract

Using cultured human trophoblast stem cells (hTSCs), mid-gestation human trophoblasts in primary culture, and gene-targeted mice, we tested the hypothesis that the multinucleated syncytiotrophoblast (SynT) serves a critical role in pregnancy maintenance through production of key immune modulators/checkpoint proteins (ICPs) under control of the O₂-regulated transcription factor, NRF2/NFE2L2. These ICPs potentially act at the maternal-fetal interface to protect the hemiallogeneic fetus from rejection by the maternal immune system. Using cultured hTSCs, we observed that several ICPs involved in the induction and maintenance of immune tolerance were markedly upregulated during differentiation of cytotrophoblasts (CytTs) to SynT. These included HMOX1, kynurenine receptor, aryl hydrocarbon receptor, PD-L1, and GDF15. Intriguingly, NRF2, C/EBPβ, and PPARγ were markedly induced when CytTs fused to form SynT in a 20% O₂ environment. Notably, when hTSCs were cultured in a hypoxic (2% O₂) environment, SynT fusion and the differentiation-associated induction of NRF2, C/EBPβ, aromatase (CYP19A1; SynT differentiation marker), and ICPs were blocked. NRF2 knockdown also prevented induction of aromatase, C/EBPβ and the previously mentioned ICPs. Chromatin immunoprecipitation-quantitative PCR revealed that temporal induction of the ICPs in hTSCs and mid-gestation human trophoblasts cultured in 20% O₂ was associated with increased binding of endogenous NRF2 to putative response elements within their promoters. Moreover, placentas of 12.5 days postcoitum mice with a global Nrf2 knockout manifested decreased mRNA expression of C/ebpβ, Pparγ, Hmox1, aryl hydrocarbon receptor, and Nqo1, another direct downstream target of Nrf2, compared with wild-type mice. Collectively, these compelling findings suggest that O₂-regulated NRF2 serves as a key regulator of ICP expression during SynT differentiation.

Keywords: trophoblast, NRF2, C/EBPβ, immune modulators/checkpoint proteins (ICPs)

The placental syncytiotrophoblast (SynT) serves an essential role in pregnancy maintenance via transport of O₂ and nutrients, and synthesis of protein and steroid hormones (1). In this study, we have focused on the potential role of the SynT in sustaining pregnancy through production of immune modulators/checkpoint proteins (ICPs), to promote immune tolerance at the maternal-fetal interface/decidua and protect the fetus from rejection by the maternal immune system (2, 3). Using chromatin immunoprecipitation-sequencing, we recently found that genes manifesting increased binding of both Pol II and active histone marks during SynT differentiation were enriched for those involved in immune response and immune modulation (4).

Previously, we explored mechanisms that underlie human trophoblast differentiation and effects of O₂ tension by analyzing placenta-specific expression of the human aromatase (hCYP19A1) gene, which is controlled by tissue-specific promoters that lie upstream of tissue-specific first exons (5). The placenta-specific first exon of hCYP19A1 (exon I.1), which encodes the unique 5′-untranslated region of its mRNA (5, 6), lies ~100 000 bp upstream of the translation initiation site in exon II. In studies using transfected cells and transgenic mice, we observed that as little as 246 bp immediately upstream of exon 1.I controls placenta-specific and temporal regulation of expression (7-9). Human trophoblast stem cells (hTSCs) and cytotrophoblasts (CytTs) do not express aromatase; however, when CytTs fuse to form SynT, aromatase is markedly induced (9, 10). By contrast, when CytTs are cultured in a hypoxic (2% O₂) environment, SynT differentiation and induction of hCYP19A1 are prevented by increased binding of transcriptional repressors, MASH-2/ASCL2 (11) and USF1/2 (12), which are degraded upon SynT differentiation in 20% O₂ (13). This allows assembly of an enhanceosome comprising transcription factors Sp1 (9), estrogen receptor α (14), estrogen-related receptor γ (15) and glial cells missing 1 (16, 17), which serves a crucial role in placental development and SynT fusion (18, 19). Interestingly, this complex also contains the redox-regulated transcription factor, nuclear erythroid 2-related factor 2 (NRF2/NFE2L2), which is essential for O₂-mediated aromatase mRNA induction in cultured human trophoblasts (20).

Intriguingly, we discovered that NRF2 and coregulated transcription factors, CCAAT-enhancer-binding protein β (C/EBPβ) and peroxisome proliferator activated receptor γ (PPARγ), were markedly induced when CytTs fuse to form SynTs (20). NRF2 knockdown (KD) blocked the induction of hCYP19A1, as well as the upregulation of C/EBPβ and PPARγ (20). NRF2 deficiency has been implicated in preeclampsia (20-22), a hypertensive disorder of pregnancy associated with shallow implantation, placental hypoxia, and inflammation (23-26). In mice, C/ebpα and C/ebpβ are functionally redundant; targeted deletion of both genes caused arrest of embryonic development at embryonic day 10 (E10), due to defects in placental labyrinth formation (27). Pparγ null mouse embryos also die at E10, because of pronounced labyrinth defects (28), whereas Pparγ null mouse TSC fail to differentiate into SynT (29). Pparγ expression in mouse TSC was inhibited by hypoxia in a hypoxia-inducible factor-independent manner, suggesting the role of other redox-regulated factors (30), such as Nrf2. Mice with a global knockout of Nrf2 were reported to manifest impaired fetal and placental growth, reduced labyrinth (31), increased placental inflammation, oxidative stress, and susceptibility to preterm labor induction (32).

NRF2, described as a “primary mediator of cellular adaptation to oxidative stress,” is a cap “n” collar, bZIP transcription factor that interacts with small MAF proteins and binds to antioxidant response elements in promoters of antioxidant genes (eg, HMOX1, MnSOD) (33). NRF2 is regulated at different levels in response to changes in cellular redox state. At relatively low O₂ tension, NRF2 is repressed because of its covalent interaction in the cytoplasm with KEAP1, a cysteine-rich adaptor that facilitates NRF2 ubiquitination and degradation by the 26S proteasome (34). We observed that NRF2 was markedly upregulated during differentiation of human trophoblasts cultured in 20% O₂; however, NRF2 induction was prevented when CytT were cultured in a hypoxic environment (20).

In the present study, using hTSCs and human trophoblasts in primary culture, we observed that several ICPs involved in the induction and maintenance of immune tolerance were markedly upregulated during differentiation of CytT to SynT. These included: heme oxygenase I (HMOX1); the kynurenine receptor, aryl hydrocarbon receptor (AhR); programmed death-ligand 1 (PD-L1), and growth and differentiation factor 15 (GDF15), which we found to be secreted into the culture medium with SynT differentiation. Induction of these genes was dependent on expression and binding of NRF2. We also found that placentas of mice with a global deficiency in Nrf2 were significantly smaller than wild-type (WT) at 10.5 and 12.5 days postcoitum and expressed decreased levels of C/ebpβ, Pparγ, Hmox1, and Ahr mRNA. The Nrf2-deficient fetuses also were significantly smaller in size. These and other findings have led us to hypothesize that O₂-regulated NRF2, and coregulated C/EBPβ and PPARγ, serve as key modulators of ICP expression during SynT differentiation. We posit that these ICPs are secreted into maternal blood within the intervillous space, or directly into the decidua, where they act on immune cells to maintain maternal tolerance to the hemiallogeneic fetus. We also propose that decreased placental expression of ICPs during late gestation contributes to a physiological “break” in maternal-fetal tolerance leading to labor at term, whereas their premature decline can lead to preterm parturition or preeclampsia.

Materials and Methods

Mice

All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center. Nfe2l2^tm1Ywk (NRF2) knockout mice (stock number: 017009) were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice at 6 to 8 weeks of age were time-mated overnight and pregnant mice were euthanized by isoflurane inhalation and cervical dislocation at 12.5 days postcoitum. After the fetuses were removed from their amniotic sacs together with their placentas, the decidual layers were removed; placentas were harvested and frozen in liquid nitrogen for subsequent RNA isolation. Placentas from fetuses of both sexes were used for this study.

Differentiation of hTSCs to SynT

hTSCs were generously provided by Drs. Hiroaki Okae and Takahiro Arima (Tohoku University Graduate School of Medicine, Sendai, Japan) and cultured as described (35). Briefly, a 100-mm culture dish or 6-well plate was precoated with 5 μg/mL Collagen (Col) IV (Corning, Corning, NY) for at least 1 hour at 37°C and washed twice with PBS. Stem cells were maintained in basal hTSC medium (DMEM/F12 supplemented with 0.1 mM 2-mercaptoethanol, 0.2% fetal bovine serum, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS-X supplement, 1.5 μg/ml L-ascorbic acid, 50 ng/mL EGF, 2 μM CHIR99021, 0.5 μM A83-01, 1 μM SB431542, 0.8 mM VPA, and 5 μM Y27632) at 37°C in 5% CO₂. When cells reached 80% confluence, they were detached with TrypLE for 15 minutes at 37 °C and passaged to new Col IV-coated 100-mm plates at 1 to 2 × 10⁵ cells per plate.

To promote SynT differentiation, hTSCs were seeded at a density of 1.5 × 10⁵ cells per 6-well plate or 1 × 10⁶ cells per 100-mm dish and cultured in SynT medium (DMEM/F12 supplemented with 0.1 mM 2-mercaptoethanol, 0.5% Penicillin-Streptomycin, 0.3% BSA, 1% ITS-X supplement, 2.5 μM Y27632, 2 μM forskolin, and 4% knockout serum replacement) at 20% O₂ in a standard CO₂ incubator, or at 2% O₂ in a HypOxystation (5% CO₂, 93% N₂). Fresh SynT medium was replaced on day 3 and the cells were harvested for RNA and protein analysis at 1, 3, and/or 5 days of culture. Before SynT differentiation, hTSCs were also harvested at (0 days), which is considered as CytT control.

Transient Transfection

RNAiMAX transfection reagent (Life Technologies) was used for NRF2 loss-of-function experiments according to the manufacturer’s instructions. Briefly, 1.5 × 10⁵ cells in 2 mL of basal hTSC culture medium were seeded onto Col IV precoated-6-well plate and transfected with On-TARGETplus nontargeting control siRNA or siRNA against human NFE2L2 (NRF2) (Dharmacon, Lafayette, CO) at a final concentration of 50 nM. After 24 hours, medium was replaced with fresh SynT differentiating medium and retransfected with the same concentration of siRNA. At 3 and 5 days posttransfection, cells were harvested for subsequent RNA analysis.

RT quantitative PCR

Total RNA was purified using QIAzol lysis reagent and a miRNeasy Mini Kit (Qiagen, Valencia, CA). The relative abundance of each transcript was deter1mined by RT-quantitative PCR (RT-qPCR) using SYBR Green PCR Master Mix (Bio-Rad Laboratories, Hercules, CA) or TaqMan Universal PCR Master Mix (Thermo Fisher Scientific, Waltham, MA). Mouse IL-1β TaqMan primer (Mm00434228_m1) and mouse 36B4 (Rplp0) TaqMan primer (Mm01974474-gH) were purchased from Thermo Fisher Scientific. All other primer sets used for RT-qPCR are listed in Table 1. The relative fold changes were calculated using the comparative cycle times method with 36B4 as an internal control on a Bio-Rad CFX384 real-time PCR detection system.

Table 1.

Primer sequences used for RT-qPCR

Gene name	Forward (5′ to 3′)	Reverse (5′ to 3′)
Human
36B4	TGCATCAGTACCCCATTCTATCA	AAGGTGTAATCCGTCTCCACAGA
NRF2	GTGGATCTGCCAACTACTCCC	TACAAACGGGAATGTCTGCG
Aromatase	ACGGAAGGTCCTGTGCTCG	GTATCGGGTTCAGCATTTCCA
CGB3	CGAGGTATAAAGCCAGGTACAC	CTCCTTGGATGCCCATGTC
PSG4	CAGAGGAGAACACACAAGCA	GGGCGGATTCCAGAAGTTTA
C/EBPβ	TTCATGCAACGCCTGGT	TCCGCCTCGTAGTAGAAGTT
PPARγ	GTCGTGTCTGTGGAGATAAA	ACCTGATGGCATTATGAGAC
Hmox1	GGTGAAGAAGAGGCCAAGACT	GCAGAATCTTGCACTTTGTTGCT
AhR	CATACCGAAGACCGAGCTGA	TCATTGCCAGAAAACCAGATGA
GDF15	ATGCACGCGCAGATCAA	ATGAGCACCATGGGATTGTAG
PD-L1	TCAATGCCCCATACAACAAA	GCTTGTCCAGATGACTTCG
IDO1	GGCTTTGCTCTGCCAAATCC	TTCTCAACTCTTTCTCGAAGCTG
Mouse
36B4	CACTGGTCTAGGACCCGAGAAG	GGTGCCTCTGGAGATTTTCG
NRF2	CTCCGTGGAGTCTTCCATTTAC	GCACTATCTAGCTCCTCCATTTC
C/EBPβ	ATCGACTTCAGCCCCTACCT	TCACGTAACCGTAGTCGG
PPARγ	CAAGAATACCAAAGTGCGATCAA	GAGCTGGGTCTTTTCAGAATAATAAG
Hmox1	GTACACATCCAAGCCGAGAA	TGGTACAAGGAAGCCATCAC
AhR	GGCAGCTTATTCTGGGCTATAC	TGCCACTTTCTCCAGTCTTAATC
NQO1	GACAACGGTCCTTTCCAGAATA	CTCTGAATCGGCCAGAGAATG

Open in a new tab

Abbreviations: AhR, aryl hydrocarbon receptor; CGB, chorionic gonadotropin subunit β; C/EBPβ, CCAAT-enhancer-binding protein β; GDF15, growth and differentiation factor 15; Hmox, heme oxygenase I; IDO, indoleamine 2, 3-dioxygenase; NRF2, nuclear erythroid 2-related factor 2; PD-L1, programmed death-ligand 1; PPARγ, peroxisome proliferator activated receptor γ; PSG, pregnancy specific beta-1-glycoprotein.

Western Blot Analysis

Nuclear and cytoplasmic extracts were prepared from hTSCs using a NE-PER extraction reagent kit (Pierce, Rockford, IL). Protein concentrations were determined by Pierce BCA Protein assay kit (Thermo Fisher Scientific) and equal amounts of protein (20-50 μg/lane) were loaded on a NuPAGE 4% to 12% Bis-Tris protein gel (Thermo Fisher Scientific). The following antibodies were used: rabbit anti-NRF2 antibody (ab62352, Abcam, Cambridge, UK) (36), goat anti-Keap1 antibody (ab166721, Abcam) (37), rabbit anti-C/EBPβ antibody (ab32358, Abcam) (38), mouse anti-PPARγ antibody (clone E-8; sc-7273, Santa Cruz Biotechnology) (39), rabbit anti-HMOX1 antibody (catalog no. 70081, Cell Signaling, Denver, MA) (40), rabbit anti-AhR antibody (catalog no. 83200, Cell Signaling) (41), rabbit anti-PD-L1 (catalog no. 13684, Cell Signaling) (42), and mouse anti-GDF15 antibody (clone G-5; sc-377195, Santa Cruz Biotechnology) (43). Anti-histone H3 antibody (catalog no. 17-168-1-AP; Proteintech, Rosemont, IL) (44) and anti-β-actin (ab8227, Abcam) (45) were used as loading controls for nuclear and cytoplasmic proteins, respectively. Horseradish peroxidase–conjugated anti-rabbit, anti-goat, and anti-mouse immunoglobulins (Igs) (Santa Cruz Biotechnology) (46-48) were used as secondary antibodies. The polyvinylidene fluoride membranes were incubated with enhanced SuperSignal West Pico chemiluminescent substrate (Thermo Fisher Scientific) and exposed to X-ray film.

Human GDF15 ELISA

hTSCs were cultured at a density of 0.6 × 10⁵ cells per 12-well plate in SynT differentiation medium in an atmosphere of 20% O₂ or 2% O₂; the supernatants were collected before (0 days) and after 5 days of culture. The levels of human GDF15 in the culture media were quantified using a human GDF15 Quantikine ELISA kit (DGD150, R&D Systems, Abingdon, UK) (49) according to the manufacturer’s instructions.

Chromatin immunoprecipitation-qPCR

Cells were treated with 1% formaldehyde on a 100-mm culture plate to crosslink proteins and DNA; the reaction was stopped by adding glycine at a final concentration of 125 mM. After washing with cold PBS 2 to 3 times, cells were collected, and nuclear extracts were prepared with 1% SDS chromatin immunoprecipitation (ChIP) Lysis Buffer. The chromatin was sheared by sonication to produce DNA fragments; equivalent amounts of sheared DNA were used for immunoprecipitation with antibodies against NRF2 (Abcam) (36) or an equal amount of preimmune rabbit IgG (Millipore) (50). The same amount of crosslinked sheared DNA without antibody precipitation was processed in the same manner and served as an input control. Following immunoprecipitation, enriched DNA was purified and quantified by qPCR using the following primers: proximal h (human) HMOX1 promoter, forward, 5′- GTCCCCTTGGGACTTGATGC-3′, reverse, 5′-GAGCCTGGGGTTGCTAAGTT-3′; proximal hAhR promoter, forward, 5′-CCGTCTCTCAAACAGGTGAAG-3′, reverse, 5′- GGTAGCCATCTTCGTGCATAG-3′; proximal hPD-L1 promoter, forward, 5′-ATCGGCGGAAGCTTTCAGTT-3′, reverse, 5′-TCTTCGAAACTCTTCCCGGTG-3′; proximal hGDF15 promoter, forward, 5′-CCAGGAAGGGCAACCTTGAT-3′, reverse, 5′-CCTATGTGTCTGGCCCTGTG-3′. The qPCR was performed using SYBR Green PCR master mix (Applied Biosystems) on a Bio-Rad CFX384 real-time PCR detection system. Signals were normalized to input samples and expressed relative to that for control IgG. Samples from 3 independent ChIP experiments were analyzed for each treatment at each time point.

Morphological Analysis of Trophoblast Stem Cell Fusion

The hTSCs were seeded onto Col VI-coated Nunc Lab-Tek II Chamber slides (Thermo Fisher Scientific) in SynT differentiation medium for 5 days and fixed with 4% paraformaldehyde for 20 minutes at room temperature. After 3 washes with PBS, cells were blocked with 3% BSA in PBS and incubated with a primary anti-plakoglobin antibody (1:250, clone 15; BD Biosciences, San Jose, CA) (20, 51, 52) overnight at 4°C. Then, the cells were washed with PBS 3 times and incubated in Alexa Fluor 488-conjugated secondary antibodies (1:500, Life Technologies) (53) for 1 hour at room temperature. The chamber slides were then washed 3 times with PBS and the nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2000; Sigma-Aldrich, St. Louis, MO), and mounted using Mounting Medium (Fluoroshield; Sigma-Aldrich). Images were captured using a Zeiss confocal microscope at ×400 magnification (Carl Zeiss, Oberkochen, Germany).

Statistical Analyses

Data are expressed as the mean ± standard error of the mean. Differences between groups were analyzed by 1-way ANOVA followed by a Tukey post hoc test using GraphPad Prism 7.03. Statistical significance was set as P values of < 0.05, and each experiment was performed at least 3 times.

Results

Hypoxia Impairs SynT Differentiation and Syncytialization of hTSCs

Changes in placental oxygen tension caused by spiral artery remodeling starting after 8 to 10 weeks of gestation contribute to trophoblast differentiation. During the first trimester, blood flow is low and the placenta is relatively hypoxic (1%-2% O₂) (54), promoting CytT proliferation. The oxygen gradient within the placenta during the second trimester is dramatically increased as the development of maternal spiral arterioles occurs, resulting in formation of an oxygen-rich environment to support SynT differentiation (54, 55). On the other hand, defects in these processes result in placental hypoxia, which is believed to be an underlying cause of preeclampsia. Because trophoblast differentiation is an oxygen-dependent process, we investigated the effects of low oxygen tension (2% O₂, ~14 mm Hg) on expression of SynT specific markers, and on trophoblast fusion. When hTSCs were cultured in medium containing forskolin to promote SynT differentiation in 20% O₂ (simulates O₂ milieu of trophoblasts in direct contact with maternal arterial blood, which is estimated to be 90 to 100 mm Hg (54)), SynT-specific markers, including aromatase (CYP19A1), chorionic gonadotropin subunit β (CGB) 3, and pregnancy specific beta-1-glycoprotein (PSG) 4, were significantly induced during SynT differentiation, whereas hypoxic conditions (2% O₂) prevented SynT-specific gene expression (Fig. 1A-C). The marked induction of these placenta-specific genes supports the authentication of these cells as human trophoblasts, as characterized in detail by Okae et al (35).

Figure 1. — Hypoxia inhibits cell fusion and mRNA expression of SynT-specific markers in cultured hTSCs. hTSCs were cultured in medium containing 2 μM forskolin to promote SynT differentiation. The cells were cultured in 20% O₂ or 2% O₂ for 1, 3, or 5 days. (A-C) Hypoxia inhibited the temporal induction of SynT differentiation markers (aromatase, CGB3, and PSG4), compared with cells cultured in 20% O₂. (D) Plakoglobin immunostaining (green) of hTSCs after 5 days of culture in 20% O₂ or 2% O₂. Nuclei were stained with DAPI (blue). Shown is a representative confocal fluorescence image (magnification: 400×). ImageJ was used to quantify fused cells in 10 fields in each condition. Fusion index = (N − S)/T×100%. N refers to the number of nuclei in the syncytia, S refers to the number of syncytia, and T refers to the total number of nuclei. Scale bar: 40 μm. Values are the mean ± SEM (n ≥ 3); *P < 0.05, **P < 0.01, ***P < 0.001 vs 0 d; ^#P < 0.05, ^##P < 0.01, ^###P < 0.001 vs 20% O₂.

To define the underlying mechanisms whereby hypoxia prevents SynT differentiation, hTSCs were cultured in a 20% or 2% O₂ environment for up to 5 days and the cells were immunostained with antibodies to plakoglobin (green). Plakoglobin, also known as γ-catenin, is a cytoplasmic component of desmosomes and adherens junctions, which facilitates cell-cell adhesion by linking desmosomal cadherins to the cytoskeleton (56). Nuclei were visualized by staining with 4′,6-diamidino-2-phenylindole (blue). The cells cultured in 20% O₂ exhibited clear syncytium formation, whereas those cultured in 2% oxygen manifested a significantly reduced percentage of fused cells as well as a decreased size of syncytia compared to cells cultured at 20% O₂ (Fig. 1D). Thus, hypoxia inhibited the induction of SynT-specific gene expression and cell fusion.

Hypoxia Prevents Upregulation of NRF2, C/EBPβ, and Immune Modulatory Genes/ICPs on SynT Differentiation

We previously discovered that the redox-sensitive transcription factor NRF2 mediates the induction of miR-1246, one of the most highly upregulated miRNAs during SynT differentiation of human trophoblasts in primary culture (20). Transcription factors C/EBPβ and PPARγ have been identified as downstream regulators of NRF2 transactivation; NRF2 was found to directly bind to AREs in the C/EBPβ promoter region during the early stages of adipocyte differentiation (57). Thus, to identify the effects of hypoxia on transcription factors important for SynT differentiation, we analyzed expression of NRF2, C/EBPβ, and PPARγ in hTSCs cultured in 20% or 2% O₂ for 5 days. We observed that NRF2 and C/EBPβ were dramatically upregulated at both mRNA and protein levels upon culture in 20% O₂; this induction was significantly reduced in cells cultured in 2% O₂ (Fig. 2A, B, D). Protein expression levels of Keap1, which binds and targets NRF2 for proteasomal degradation, were significantly downregulated during SynT differentiation of hTSCs cultured in a 20% O₂ environment (Fig. 2D). By contrast, Keap1 protein levels were unaffected in hTSCs cultured in 2% O₂ compared with undifferentiated CytT (Fig. 2D). Because BACH1 (BTB domain and cap “n” collar homolog 1) is another known transcriptional repressor of NRF2, which competes with NRF2 for binding to antioxidant-response elements in promoters of target genes (58), we measured BACH1 expression at 20% O₂ or 2% O₂ during SynT differentiation. Unexpectedly, our findings showed that BACH1 mRNA was induced at 20% O₂ and was significantly inhibited at 2% O₂, whereas BACH1 nuclear protein was barely detectable and not changed at 2% O₂ (data not shown). Thus, reduction of NRF2 protein under hypoxic conditions may be regulated, at least in part, by Keap1 induction and binding. On the other hand, we found that mRNA expression of PPARγ did not change significantly during SynT differentiation in 20% O₂, or in response to culture in a 2% O₂ environment (Fig. 2C), whereas its protein levels were modestly, but significantly, reduced in 2% O₂ (Fig. 2G, I), suggesting that hypoxia-mediated factors may contribute to regulation of PPARγ protein stability. Indeed, it has been suggested that the stability of PPARγ is downregulated by CUL4B, which is directly activated in response to hypoxia, specifically via hypoxia-inducible factor-1α (59, 60).

Figure 2. — Hypoxia inhibits expression of transcription factors NRF2 and C/EBPβ in cultured hTSCs. hTSCs cultured in SynT differentiation medium containing forskolin in 20% O₂ or 2% O₂ for 1, 3, or 5 days were harvested for analysis by RT-qPCR and western blotting. mRNA (A) and nuclear protein levels (D, E) of NRF2 increased markedly during culture of hTSCs in 20% O₂ and were inhibited in response to culture in a hypoxic (2% O₂) environment after 3 and 5 days of culture. (A, D, E). Keap1 protein expression was reduced during SynT differentiation after 5 days of culture in 20% oxygen and remained increased at levels similar to those of undifferentiated CytT after 5 days of culture in 2% O₂ (D, F). Expression of C/EBPβ at both mRNA (B) and protein (G, H) levels was markedly increased after 3 and 5 days of culture in SynT differentiation medium in 20% O₂ and was inhibited in response to culture in 2% O₂. Shown are representative images of immunoblots (D, G) and quantifications of the scans of blots (E-I). Values are the means ±SEM of data from 3 to 5 independent experiments; *P < 0.05; **P < 0.01; ***P < 0.001 vs 0 d; ^#P < 0.05; ^##P < 0.01; ^###P < 0.001 vs 20% O₂ at 5 days.

We previously observed that NRF2 mediated the induction C/EBPβ during differentiation of mid-gestation human trophoblasts in primary culture (20). Moreover, NRF2 has multiple direct or indirect downstream targets in various cell types comprising ICPs, including HMOX1, AhR, PD-L1, and GDF15 (58, 61-63). Thus, we next determined the effects of culture of hTSCs for up to 5 days in 2% vs 20% O₂ on mRNA and protein expression of ICPs. We observed a marked temporal induction of HMOX1, AhR, PD-L1, and GDF15 mRNA (Fig. 3A-D) and protein (Fig. 3E-I) in cells cultured in a 20% O₂ environment for up to 5 days, but these increases were significantly inhibited in cells cultured in 2% O₂ after 3 and 5 days of culture (Fig. 3). Importantly, hypoxia resulted in ~75% and 85% reduction of AhR and GDF15 protein compared with cells cultured in 20% O₂, respectively, indicating that hypoxia has a stronger effect on protein expression than mRNA expression of ICPs (Fig. 3E, G, and I). This suggests that hypoxia-mediated factors may also contribute to the regulation of their protein expression along with differentiation-induced transcription factors, NRF2, and C/EBPβ.

Figure 3. — Expression of ICPs was increased during hTSC differentiation to SynT and was inhibited by hypoxia. hTSCs were cultured for up to 5 days in SynT differentiation medium in 20% or 2% O₂ and analyzed for HMOX1, AhR, PD-L1, and GDF15 mRNA (A-D) and protein (E-I) expression. (A-D) mRNA expression of the ICPs increased significantly during SynT differentiation in 20% O₂ and was inhibited by culture in 2% O₂. (E) Representative immunoblots of HMOX1, AhR, PD-L1, and GDF15 protein levels in hTSCs before (CytT) and after culture for 5 days in 20% or 2% O₂. (F-I) Quantifications of scans of immunoblots from at least 3 independent experiments. (J) Consistent with GDF15 protein levels in cell lysates, the secreted form of GDF15, measured by human GDF15 ELISA of the culture medium, was increased during SynT differentiation in 20% O₂, but inhibited by culture in 2% O₂. Values are the means ± SEM of data from ≥ 3 independent experiments; *P < 0.05; **P < 0.01; ***P < 0.001 vs 0 d (CytT); ^#P < 0.05; ^##P < 0.01; ^###P < 0.001 vs 20% O₂.

Importantly, mature GDF15 is secreted following intracellular cleavage, and serum GDF15 levels are higher during pregnancy than in the nonpregnant state (64). This leads to the question of whether GDF15 levels in the culture medium may also increase during SynT differentiation. Intriguingly, GDF15 levels in culture medium collected at 0 day were 0.6 ng/mL and were markedly increased to 16 ng/mL after 5 days of SynT differentiation in 20% O₂, whereas its secretion was significantly reduced in cells cultured in 2% O₂ (Fig. 3J), consistent with changes in intracellular GDF15 levels measured by immunoblotting (Fig. 3E, I). This suggests that SynT-derived secreted form of GDF15 may not only have an impact on the immediate microenvironment, but also travel through the maternal blood and send a signal to different tissues/organs.

NRF2 Mediates the Induction of SynT-specific Genes, Transcription Factors, and ICPs in hTSCs

To investigate the role of the redox-sensitive transcription factor NRF2 in the expression of the ICPs induced during SynT differentiation, hTSCs were transiently transfected with small interfering RNA against Nrf2 or nontargeting control for 3 and 5 days. First, we confirmed that transfection of the hTSCs with NRF2 siRNA achieved an 80% KD of endogenous NRF2 mRNA (Fig. 4A) and confirmed previously reported knockdown efficiency of NRF2 siRNA by immunoblotting in primary trophoblasts (20). NRF2 KD blocked SynT differentiation-mediated induction of C/EBPβ (Fig. 4B) as well as SynT-specific genes, including aromatase and CGB3 (Fig. 4D and E). We also observed an induction of PPARγ during SynT differentiation of hTSCs, but NRF2 knockdown only modestly and insignificantly downregulated its expression (Fig. 4C), indicating that inhibition of NRF2 alone was insufficient to downregulate PPARγ mRNA expression. Thus, it is likely that NRF2 together with upstream regulators may act to induce PPARγ expression. NRF2 KD caused a statistically significant reduction in HMOX1, AhR, PD-L1, and GDF15 (Fig. 4F-I). The NRF2 KD-mediated reduction in HMOX1, AhR, and PD-L1 was also evident in human trophoblasts in primary culture isolated from mid-gestation placenta (Supplemental Fig. 1) (65). Interestingly, during SynT differentiation of mid-gestation human trophoblasts in primary culture, we also observed induction of indoleamine 2, 3-dioxygenase (IDO) 1 (Supplemental Fig. 1) (65), which has been reported to be important for maintaining immune tolerance at the maternal-fetal interface (66). The induction of IDO1 in primary human trophoblasts was blocked by NRF2 KD (Supplemental Fig. 1) (65). By contrast, IDO1 was not detectable in hTSCs during SynT differentiation in culture and was decreased during SynT differentiation of primary trophoblasts isolated from term placenta (data not shown). These findings indicate that hTSCs derived from first-trimester human placenta have the ability to recapitulate most, but not all of the biological processes observed during differentiation of mid-gestation human trophoblasts in primary culture. Collectively, our findings indicate that NRF2 is an important mediator of immune tolerance during trophoblast differentiation. Further, this may contribute to immune suppression at the maternal-fetal interface.

Figure 4. — NRF2 knockdown (KD) inhibits induction of C/EBPβ, aromatase, CGB3, and ICPs during hTSC differentiation. Inhibition of NRF2 by transfection of NRF2 siRNA (A) inhibited mRNA expression of C/EBPβ (B), SynT differentiation markers aromatase and CGB3 (D, E), and ICPs (F-I). Values are the means ± SEM of data from at least 3 independent experiments (n ≥ 3); *P < 0.05, ***P < 0.001 vs 0 day; ^##P < 0.01, ^{^###}P < 0.001 vs transfection of nontargeting control.

NRF2 Binds Directly to the Promotors of ICPs in hTSCs During SynT Differentiation

Next, to determine whether NRF2 regulates the previously mentioned ICPs by direct binding to their promoters during SynT differentiation, we searched 1 kb upstream of transcription start sites of the each of the ICPs for putative NRF2-binding site using TFBIND (https://tfbind.hgc.jp/) (67) and/or PROMO algorithm (http://alggen.lsi.upc.es/) (68) and performed ChIP-qPCR using hTSCs (Fig. 5) and primary trophoblasts freshly isolated from mid-gestation human placenta (Supplemental Fig. 2) (65). We found that temporal induction of the ICPs, HMOX1, AhR, PD-L1, and GDF15 in hTSCs and primary trophoblasts from mid-gestation human placenta was associated with increased binding of endogenous NRF2 to their promoters during SynT differentiation (Fig. 5A-D and Supplemental Fig. 2) (65). In addition, the induction of IDO1 in primary human trophoblasts from mid-gestation human placentas was associated with increased binding of NRF2 to its promoter (Supplemental Fig. 2) (65). Taken together, our findings suggest that NRF2 serves a role as a master regulator in the maintenance of immune privilege during pregnancy by transcriptional regulation of ICPs.

Figure 5. — Binding of endogenous NRF2 to promoters of *ICPs* in hTSCs increases during SynT differentiation. ChIP-qPCR was used to analyze binding of endogenous NRF2 to promoters of genes encoding HMOX1 (A), AhR (B), PD-L1 (C), and GDF15 (D) before (0 days) and after 1 and 3 days of culture in SynT differentiation medium. Nonimmune IgG was used as a nonspecific control. Values are shown as percentage input. Values are the means ± SEM of data from at least 3 independent experiments (n ≥ 3); *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 vs NRF2 binding at 0 hours.

Global Nrf2 KO Mice Display an Inhibition of Selective ICPs and an Increase in IL-1β During Mid-gestation

Because it has been reported that global NRF2 deletion in mice resulted in significantly reduced fetal weight and labyrinth/placental volume (31), we next evaluated the expression of ICPs in placentas of WT vs Nrf2 KO mice at E12.5, which is considered to be mid-gestation in the mouse. Importantly, mid-gestation is a critical period for successful pregnancy because it has been shown that genes involved in immune tolerance, angiogenesis, and cell differentiation/mobility are upregulated in mid-gestation placentas, compared with those at later stages of pregnancy (69). RNA was prepared from at least 12 placentas of Nrf2 KO mice and from 8 gestation-matched placentas of WT mice at e12.5. We confirmed that NRF2 mRNA expression was completely ablated in placentas of Nrf2 KO mice (Fig. 6A). We previously observed that NRF2 KD inhibited differentiation-associated expression of C/EBPβ and PPARγ in mid-gestation human trophoblasts in primary culture (20). C/EBPβ and PPARγ have been reported to function as key transcription factors in mouse placental development (27, 28). In the present study, we observed that Nrf2 KO resulted in a significant inhibition of C/EBPβ and PPARγ mRNA expression at E12.5 (Fig. 6B). Furthermore, we found that HMOX1, AhR, and NQO1 mRNA were significantly reduced in Nrf2 KO placentas compared with WT (Fig. 6C). Notably, with Nrf2 KO, the pro-inflammatory cytokine IL-1β was up-regulated in mouse placentas at E12.5 (Fig. 6D). By contrast, TNFα and IL-6 were not changed and CXCL15, the human homolog of IL-8, was not detectable (data not shown). These findings suggest that Nrf2 KO may upregulate ROS and oxidative stress that, in turn, activates the inflammasome and increases IL-1β production in placenta. Taken together, NRF2 may play an important immunomodulatory role during early placental development by inducing ICPs and reducing inflammatory signaling in the form of IL-1β.

Figure 6. — Placental immune modulator gene expression is significantly decreased, whereas proinflammatory IL-1β is increased in *Nrf2* global KO mice at E12.5. (A) Abrogated mRNA expression of *Nrf2* in placentas of *Nrf2* KO mice was confirmed by qRT-PCR. (B, C) Placentas of *Nrf2* KO mice at E12.5 displayed a significant decrease in C/EBPβ, PPARγ, HMOX1, AhR, and another direct downstream target of *Nrf2*, Nqo1. (D) IL-1β mRNA was significantly increased in placentas of *Nrf2* KO mice, compared with wild-type (WT). (n ≥ 8 for WT; n ≥ 12 for *Nrf2* KO.) *P < 0.05; **P < 0.01; ***P < 0.001 vs WT.

Discussion

In this study, we have demonstrated that the redox-regulated transcription factor, NRF2, which is markedly induced during human SynT differentiation, via upregulation of C/EBPβ (20), serves an important regulatory role in the increased expression of ICPs, including HMOX1, AhR, PD-L1, and GDF15 (summarized in Fig. 7). These factors, which have been reported to be important inducers of an immunosuppressive/tolerogenic phenotype of immune cells (70-75), were found in the present study to be downstream targets of NRF2 (Figs. 4 and 5, Supplemental Figs. 1 and 2) (65). Based on the potential role of NRF2 as a redox-sensitive transcription factor, we observed that, compared with cells cultured in 20% O₂, hypoxia (2% O₂) caused a reduction in nuclear NRF2 protein levels, whereas cytoplasmic levels of its negative regulator, KEAP1, increased and were similar to those of undifferentiated CytT (Fig. 2). Moreover, we found reduced levels of C/EBPβ and the previously mentioned ICPs in cells cultured in 2% vs 20% O₂ (Figs. 2 and 3), and in response to NRF2 knockdown (Fig. 4). This suggests an important role of NRF2 in trophoblast expression of multiple ICPs, which may affect immune tolerance at the maternal-fetal interface.

Figure 7. — Increased O₂ tension promotes SynT differentiation with induction of the redox-sensitive transcription factor, NRF2, which induces expression of *C/EBPβ*, aromatase/*CYP19a1* and *ICPs* through binding to their promoters. In this manner, NRF2 and downstream *ICP* target genes serve a critical role in the maintenance of immune tolerance at the maternal-fetal interface.

Single-cell transcriptome analysis of human trophoblast, decidual, and immune cell types revealed a large number of ligand-receptor pair interactions between SynT and decidual cells, suggesting that the decidua is the focus of signaling from the SynT (76). Immune tolerance is thought to be maintained throughout most of pregnancy in mice and humans by decidual immunosuppressive cells, including regulatory T cells (Tregs) (77), decidual natural killer cells (dNK) (78) and alternatively activated (M2) macrophages (Mϕ) (79). dNK cells comprise ~70% of decidual immune cells during early pregnancy and are critical for trophoblast invasion and vascular remodeling (80, 81). These cells may act with immature dendritic cells to promote expansion of Tregs and to protect the fetus from maternal rejection (82). Moreover, dNK cells express the antimicrobial peptide Granulysin, which selectively targets bacterial infection without killing trophoblasts and can be transported to extravillous trophoblasts (EVTs) by nanotubes for host defense against intracellular bacterial infection (83). Importantly, dNK cells decline before labor at term. Notably, ~25% of the immune cells in decidua during early to mid-pregnancy are Mϕ, which predominately express an M2/immunosuppressive phenotype (84). However, in mice, Mϕ that invade the decidua near term manifest an inflammatory M1 phenotype (85).

The placenta is a unique and transient organ consisting of trophoblasts, which are the earliest differentiated cells derived from the blastocyst, specialized to deliver essential nutrients for adequate fetal growth. There has been a critical need to develop in vitro culture models that recapitulate differentiation of trophoblast lineages that arise throughout gestation. Over the past 2 decades, we have studied trophoblast differentiation using primary trophoblasts freshly isolated from mid-gestation human placenta (4, 13, 20, 51). Others have used either first trimester (86) or term placental cells, immortalized cell lines established from first trimester extravillous trophoblast (ie, HTR-8/SVneo) (87) or choriocarcinoma cells (ie, BeWo and JEG-3) derived from metastatic cancer cells (88, 89). However, these cell lines have limitations because they cannot mimic proliferative villous cytotrophoblasts that are capable of differentiation to either EVT or SynT. Okae et al recently reported the derivation of hTSCs from first trimester human placental CytT (35). These cells are maintained in a proliferative state and can be differentiated into the 2 main trophoblast lineages, SynT or EVT (35). Our findings in the present study provide further evidence that these hTSCs offer a robust and biologically relevant system for identifying genes, pathways, and mechanisms underlying the control of ICP gene expression during human SynT differentiation. Using this system, we observed that upon culture of hTSCs under conditions that lead to SynT differentiation, ~50% of the cells underwent cell fusion/syncytialization with marked induction of SynT markers (aromatase, CGB3, and PSG4), which is similar to what we observed using primary trophoblasts isolated from mid-gestation human placenta (51). Overall, our findings indicate that hTSCs serve as a relevant culture model for studies of gene regulation and function of human trophoblasts.

The increase in oxygen availability following enlargement of the placental spiral arteries after mid-gestation has a critical impact on trophoblast differentiation and function. As placental blood flow markedly increases, the increased O₂ tension causes induction of trophoblast fusion and SynT differentiation (54). By contrast, the low ambient oxygen accessibility during early gestation promotes CytT proliferation (28) and prevents cell fusion and differentiation (29, 30) (Fig. 7). As mentioned, NRF2 plays a central transcriptional role in the response of cells to changes in redox state (90). Indeed, NRF2 deficiency in women has been implicated in preeclampsia, which is characterized by abnormal placentation with impaired vascularization and hypoxia (91). Accordingly, NRF2 KO mice manifested impaired fetal and placental growth, reduced labyrinth volume (31), and a marked reduction in expression of the labyrinth-specific gene Distal-Less Homeobox 3 (92). Nrf2 KO mice also manifested increased placental expression of the proinflammatory cytokine IL-1β (Fig. 6D) and an enhanced susceptibility to preterm birth induction by intrauterine injection of lipopolysaccharide (32). Using cultured hTSCs, we observed that the hypoxia-mediated reduction of NRF2 led to inhibition of cell fusion/syncytialization and the repression of genes encoding ICPs, which protect the fetus from maternal rejection.

The multinucleated SynT covering the surface of chorionic villi is bathed in maternal blood and thus can interact with maternal and fetal immune cells within the local environment. Emerging evidence suggests that the SynT may contribute to immune tolerance at the maternal-fetal interface via secretion of ICPs to protect the hemiallogeneic fetus from rejection by the maternal immune system (70). We observed that differentiation of hTSCs (Figs. 4 and 7) and freshly isolated CytT from mid-gestation human placenta to SynT (20), resulted in marked induction of NRF2, C/EBPβ, and PPARγ. Moreover, C/EBPβ and PPARγ have been found to act as signaling partners of NRF2 and are implicated in the development of an anti-inflammatory M2 Mϕ phenotype (93, 94). Further, C/EBPβ was reported to be important for B-cell development, whereas C/EBPβ-deficient mice were highly susceptible to Listeria monocytogenes infection (95, 96). Notably, the PPARγ agonist, rosiglitazone, induced M2 Mϕ polarization in circulating blood mononuclear cells (93) and reduced the rate of lipopolysaccharide-induced preterm birth and decidual M1 Mϕ activation in pregnant mice (85). Notably, we observed that PPARγ expression was not significantly affected by NRF2 KD or by culture of hTSCs under hypoxic conditions. On the other hand, we found that Pparγ was significantly decreased in Nrf2 KO mouse placentas at E12.5 compared with WT, suggesting that multiple cell types within the placenta may play a cooperative role in the regulation of PPARγ.

SynTs are a major source of placenta-derived microvesicles, and exosomes, which play a key role in immune tolerance by delivery of bioactive signaling molecules and immunomodulatory factors from the fetus to the mother (97). Specifically, placental exosomes were found to contain ICPs, such as PD-L1, TGF-β, and TRAIL (98). Intriguingly, PD-L1 is one of several known direct downstream targets of NRF2 (62). PD-L1 is one of the most studied ICPs; PD-1/PD-L1 signaling downregulates the function and proliferation of effector T cells and induces differentiation and immunosuppressive capacity of Tregs (71). We discovered that PD-L1 was highly expressed in hTSCs upon SynT differentiation in 20% O₂ (Fig. 3), and its expression was directly mediated by NRF2 binding to the PD-L1 promoter in hTSCs (Fig. 5) and in mid-gestation human SynTs in primary culture (Supplemental Figure S2) (65). Furthermore, PD-L1 was significantly downregulated when hTSCs were cultured in a hypoxic environment (Fig. 3). Interestingly, PD-L1 mRNA was unchanged in global Nrf2 KO mouse placentas at E12.5 compared with WT; however, PDL-1 was found to be significantly reduced in Nrf2 KO placentas at E10.5 (data not shown). This suggests that the Nrf2-PD-L1 axis may be more important at earlier stages of pregnancy in mice.

HMOX1 and AhR are other direct downstream targets of NRF2 involved in immune modulation (58, 61). HMOX1 was observed to regulate placental vascular development and to play a key role in immune homeostasis in mice by maintaining a tolerogenic dendritic cell environment (70). Carbon monoxide produced by the enzymatic action of HMOX1 has been found to increase the expansion and differentiation of myeloid cells, which are important for maintenance of tissue homeostasis and immune tolerance (72). In addition, AhR null mice exhibited reduced fertility because of abnormal placental development and impaired generation of Tregs (73). We found that HMOX1 and AhR were induced during SynT differentiation of mid-gestation human trophoblasts in primary culture (Supplemental Figure S1) (65) and in hTSCs during SynT differentiation (Fig. 3); this induction was directly mediated by NRF2 (Supplemental Figure S2, Figs. 4 and 5) (65), suggesting a conserved role of NRF2 in the regulation of immunomodulatory factors in humans and mice.

GDF15, a TGFβ superfamily member, also has been proposed to promote immunosuppression by inducing differentiation of tolerogenic DCs and Tregs (74, 75). GDF15 is most highly expressed in the placenta, compared with other normal tissues, and its deficiency is associated with miscarriage and preeclampsia (99, 100). We found that during SynT differentiation, GDF15 was inhibited by hypoxia, as well as by NRF2 knockdown (Figs. 3 and 4). Importantly, we observed that GDF15 protein was secreted into the culture medium bathing hTSCs; its levels increased > 25-fold during SynT differentiation and were markedly inhibited in cells cultured in a hypoxic environment (Fig. 3J). Thus, hypoxia-mediated reduction in NRF2 likely results in inhibition of immunosuppressive GDF15, together with other ICPs, HMOX1, AhR, and PD-L1.

Importantly, these ICPs also are expressed in a variety of tumors and invading leukocytes, where they function to promote immune evasion, tumor metastasis, and progression (101). In fact, among a wide range of tumor types, GDF15 was found to be the most highly overexpressed soluble factor (102). Thus, NRF2 likely serves a key role in the regulation of immune tolerance to enhance both tumor progression (103) and placental development (31). These findings suggest that a variety of cancers have usurped the role of NRF2 to protect themselves from rejection by the host’s immune system.

Author Contributions

Y.-T.K. and S.M. contributed to the studies using isolation and culture of human primary trophoblasts (Supplemental figures) (65); K.H. carried out all other experiments; K.H. and C.R.M. contributed to the conceptual design, interpreted the data, and wrote the manuscript. All authors have reviewed and commented on the manuscript.

Glossary

Abbreviations

AhR: aryl hydrocarbon receptor
BACH1: BTB domain and cap “n” collar homolog 1
CGB: chorionic gonadotropin subunit β
C/EBPβ: CCAAT-enhancer-binding protein β
ChIP: chromatin immunoprecipitation
Col: collagen
CyT: cytotrophoblast
dNK: decidual natural killer cell
EVT: extravillous trophoblast
GDF15: growth and differentiation factor 15
Hmox1: heme oxygenase I
hTSC: human trophoblast stem cell
ICP: immune modulators/checkpoint protein
IDO: indoleamine 2, 3-dioxygenase
Ig: immunoglobulin
KD: knockdown
NRF2: nuclear erythroid 2-related factor 2
PD-L1: programmed death-ligand 1
PPARγ: peroxisome proliferator activated receptor γ
PSG: pregnancy specific beta-1-glycoprotein
RT-qPCR: RT-quantitative PCR
SynT: syncytiotrophoblast
Treg: T regulatory cell
WT: wild-type

Contributor Information

Kyunghee Hong, Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038, USA.

Sribalasubashini Muralimanoharan, Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038, USA.

Youn-Tae Kwak, Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038, USA.

Carole R Mendelson, Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038, USA; Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, TX 75390-9032, USA; Cecil H. and Ida Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center, Dallas, TX 75390-8511, USA; North Texas March of Dimes Birth Defects Center, University of Texas Southwestern Medical Center, Dallas, TX 75390-9038, USA.

Funding

This work was supported by NIH-P01-HD087150 and Burroughs Wellcome Preterm Birth Grant #1019823.

Disclosure Summary

The authors have no conflicts of interest to disclose.

Data Availability

Original data generated and analyzed during this study are included in this published article or in the data repositories listed in References.

References

1. Maltepe E, Bakardjiev AI, Fisher SJ. The placenta: transcriptional, epigenetic, and physiological integration during development. J Clin Invest. 2010;120(4):1016-1025. doi: 10.1172/JCI41211. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Arck PC, Hecher K. Fetomaternal immune cross-talk and its consequences for maternal and offspring’s health. Nat Med. 2013;19(5):548-556. doi: 10.1038/nm.3160. [DOI] [PubMed] [Google Scholar]
3. PrabhuDas M, Bonney E, Caron K, et al. Immune mechanisms at the maternal-fetal interface: perspectives and challenges. Nat Immunol. 2015;16(4):328-334. doi: 10.1038/ni.3131. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Kwak YT, Muralimanoharan S, Gogate AA, Mendelson CR. Human trophoblast differentiation is associated with profound gene regulatory and epigenetic changes. Endocrinology 2019;160(9):2189-2203. doi: 10.1210/en.2019-00144. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Kamat A, Hinshelwood MM, Murry BA, Mendelson CR. Mechanisms in tissue-specific regulation of estrogen biosynthesis in humans. Trends Endocrinol Metab. 2002;13(3):122-128. doi: 10.1016/s1043-2760(02)00567-2. [DOI] [PubMed] [Google Scholar]
6. Means GD, Kilgore MW, Mahendroo MS, Mendelson CR, Simpson ER. Tissue-specific promoters regulate aromatase cytochrome P450 gene expression in human ovary and fetal tissues. Mol Endocrinol. 1991;5(12):2005-2013. doi: 10.1210/mend-5-12-2005. [DOI] [PubMed] [Google Scholar]
7. Kamat A, Graves KH, Smith ME, Richardson JA, Mendelson CR. A 500-bp region, approximately 40 kb upstream of the human CYP19 (aromatase) gene, mediates placenta-specific expression in transgenic mice. Proc Natl Acad Sci USA. 1999;96(8):4575-4580. doi: 10.1073/pnas.96.8.4575. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Kamat A, Smith ME, Shelton JM, Richardson JA, Mendelson CR. Genomic regions that mediate placental cell-specific and developmental regulation of human Cyp19 (aromatase) gene expression in transgenic mice. Endocrinology 2005;146(5):2481-2488. doi: 10.1210/en.2004-1606. [DOI] [PubMed] [Google Scholar]
9. Kamat A, Alcorn JL, Kunczt C, Mendelson CR. Characterization of the regulatory regions of the human aromatase (P450arom) gene involved in placenta-specific expression. Mol Endocrinol. 1998;12(11):1764-1777. doi: 10.1210/mend.12.11.0190. [DOI] [PubMed] [Google Scholar]
10. Fournet-Dulguerov N, MacLusky NJ, Leranth CZ, et al. Immunohistochemical localization of aromatase cytochrome P-450 and estradiol dehydrogenase in the syncytiotrophoblast of the human placenta. J Clin Endocrinol Metab. 1987;65(4):757-764. doi: 10.1210/jcem-65-4-757. [DOI] [PubMed] [Google Scholar]
11. Jiang B, Kamat A, Mendelson CR. Hypoxia prevents induction of aromatase expression in human trophoblast cells in culture: potential inhibitory role of the hypoxia-inducible transcription factor Mash-2 (mammalian achaete-scute homologous protein-2). Mol Endocrinol. 2000;14(10):1661-1673. doi: 10.1210/mend.14.10.0539. [DOI] [PubMed] [Google Scholar]
12. Jiang B, Mendelson CR. USF1 and USF2 mediate inhibition of human trophoblast differentiation and CYP19 gene expression by Mash-2 and hypoxia. Mol Cell Biol. 2003;23(17):6117-6128. doi: 10.1128/MCB.23.17.6117-6128.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Jiang B, Mendelson CR. O2 enhancement of human trophoblast differentiation and hCYP19 (aromatase) gene expression are mediated by proteasomal degradation of USF1 and USF2. Mol Cell Biol. 2005;25(20):8824-8833. doi: 10.1128/MCB.25.20.8824-8833.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Kumar P, Kamat A, Mendelson CR. Estrogen receptor alpha (ERalpha) mediates stimulatory effects of estrogen on aromatase (CYP19) gene expression in human placenta. Mol Endocrinol. 2009;23(6):784-793. doi: 10.1210/me.2008-0371. [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Kumar P, Mendelson CR. Estrogen-related receptor gamma (ERRgamma) mediates oxygen-dependent induction of aromatase (CYP19) gene expression during human trophoblast differentiation. Mol Endocrinol. 2011;25(9):1513-1526. doi: 10.1210/me.2011-1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Yamada K, Ogawa H, Honda S, Harada N, Okazaki T. A GCM motif protein is involved in placenta-specific expression of human aromatase gene. J Biol Chem. 1999;274(45):32279-32286. doi: 10.1074/jbc.274.45.32279. [DOI] [PubMed] [Google Scholar]
17. Kumar P, Luo Y, Tudela C, Alexander JM, Mendelson CR. The c-Myc-regulated microRNA-17~92 (miR-17~92) and miR-106a~363 clusters target hCYP19A1 and hGCM1 to inhibit human trophoblast differentiation. Mol Cell Biol. 2013;33(9):1782-1796. doi: 10.1128/MCB.01228-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Anson-Cartwright L, Dawson K, Holmyard D, Fisher SJ, Lazzarini RA, Cross JC. The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta. Nat Genet. 2000;25(3):311-314. doi: 10.1038/77076. [DOI] [PubMed] [Google Scholar]
19. Schreiber J, Riethmacher-Sonnenberg E, Riethmacher D, et al. Placental failure in mice lacking the mammalian homolog of glial cells missing, GCMa. Mol Cell Biol. 2000;20(7):2466-2474. doi: 10.1128/MCB.20.7.2466-2474.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Muralimanoharan S, Kwak YT, Mendelson CR. Redox-sensitive transcription factor NRF2 enhances trophoblast differentiation via induction of miR-1246 and aromatase. Endocrinology 2018;159(5):2022-2033. doi: 10.1210/en.2017-03024. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Chigusa Y, Tatsumi K, Kondoh E, et al. Decreased lectin-like oxidized LDL receptor 1 (LOX-1) and low Nrf2 activation in placenta are involved in preeclampsia. J Clin Endocrinol Metab. 2012;97(10):E1862-E1870. doi: 10.1210/jc.2012-1268. [DOI] [PubMed] [Google Scholar]
22. Yu L, Wang T, Que R, et al. The potentially protective role of ATP-binding cassette transporters in preeclampsia via Nrf2. Pregnancy Hypertens 2019;18:21-28. doi: 10.1016/j.preghy.2019.08.002. [DOI] [PubMed] [Google Scholar]
23. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science 2005;308(5728):1592-1594. doi: 10.1126/science.1111726. [DOI] [PubMed] [Google Scholar]
24. Ness RB, Sibai BM. Shared and disparate components of the pathophysiologies of fetal growth restriction and preeclampsia. Am J Obstet Gynecol. 2006;195(1):40-49. doi: 10.1016/j.ajog.2005.07.049. [DOI] [PubMed] [Google Scholar]
25. Pineles BL, Romero R, Montenegro D, et al. Distinct subsets of microRNAs are expressed differentially in the human placentas of patients with preeclampsia. Am J Obstet Gynecol. 2007;196(3):261e261-261e266. [DOI] [PubMed] [Google Scholar]
26. Fisher SJ. Why is placentation abnormal in preeclampsia? Am J Obstet Gynecol. 2015;213(4 Suppl):S115-S122. doi: 10.1016/j.ajog.2015.08.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Begay V, Smink J, Leutz A. Essential requirement of CCAAT/enhancer binding proteins in embryogenesis. Mol Cell Biol. 2004;24(22):9744-9751. doi: 10.1128/MCB.24.22.9744-9751.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Barak Y, Nelson MC, Ong ES, et al. PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell. 1999;4(4):585-595. doi: 10.1016/s1097-2765(00)80209-9. [DOI] [PubMed] [Google Scholar]
29. Parast MM, Yu H, Ciric A, Salata MW, Davis V, Milstone DS. PPARgamma regulates trophoblast proliferation and promotes labyrinthine trilineage differentiation. PLoS One. 2009;4(11):e8055. doi: 10.1371/journal.pone.0008055. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Tache V, Ciric A, Moretto-Zita M, et al. Hypoxia and trophoblast differentiation: a key role for PPARgamma. Stem Cells Dev. 2013;22(21):2815-2824. doi: 10.1089/scd.2012.0596. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Kweider N, Huppertz B, Rath W, et al. The effects of Nrf2 deletion on placental morphology and exchange capacity in the mouse. J Matern Fetal Neonatal Med. 2017;30(17):2068-2073. doi: 10.1080/14767058.2016.1236251. [DOI] [PubMed] [Google Scholar]
32. Sussan TE, Sudini K, TalbotCC, Jr, et al. Nrf2 regulates gene-environment interactions in an animal model of intrauterine inflammation: implications for preterm birth and prematurity. Sci Rep. 2017;7:40194. doi: 10.1038/srep40194. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Polvani S, Tarocchi M, Galli A. PPARgamma and oxidative stress: Con(beta) catenating NRF2 and FOXO. PPAR Res 2012;2012:641087. doi: 10.1155/2012/641087. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Zhang DD, Lo SC, Cross JV, Templeton DJ, Hannink M. Keap1 is a redox-regulated substrate adaptor protein for a Cul3-dependent ubiquitin ligase complex. Mol Cell Biol. 2004;24(24):10941-10953. doi: 10.1128/MCB.24.24.10941-10953.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Okae H, Toh H, Sato T, et al. Derivation of human trophoblast stem cells. Cell Stem Cell 2018;22(1):50-63.e6. doi: 10.1016/j.stem.2017.11.004. [DOI] [PubMed] [Google Scholar]
36.RRID:AB_944418, https://scicrunch.org/resolver/AB_944418.
37.RRID:AB_2895561, https://scicrunch.org/resolver/AB_2895561.
38.RRID:AB_726796, https://scicrunch.org/resolver/AB_726796.
39.RRID:AB_628115, https://scicrunch.org/resolver/AB_628115.
40.RRID:AB_2799772, https://scicrunch.org/resolver/AB_2799772.
41.RRID:AB_2800011, https://scicrunch.org/resolver/AB_2800011.
42.RRID:AB_2687655, https://scicrunch.org/resolver/AB_2687655.
43.RRID:AB_2895563, https://scicrunch.org/resolver/AB_2895563.
44.RRID:AB_2716755, https://scicrunch.org/resolver/AB_2716755.
45.RRID:AB_2305186, https://scicrunch.org/resolver/AB_2305186.
46.RRID:AB_631746, https://scicrunch.org/resolver/AB_631746.
47.RRID:AB_631728, https://scicrunch.org/resolver/AB_631728.
48.RRID:AB_631736, https://scicrunch.org/resolver/AB_631736.
49.RRID:AB_2877710, https://scicrunch.org/resolver/AB_2877710.
50.RRID:AB_1031062, https://scicrunch.org/resolver/AB_1031062.
51. Zhang M, Muralimanoharan S, Wortman AC, Mendelson CR. Primate-specific miR-515 family members inhibit key genes in human trophoblast differentiation and are upregulated in preeclampsia. Proc Natl Acad Sci USA. 2016;113(45):E7069-E7076. doi: 10.1073/pnas.1607849113. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.RRID:AB_823448, https://scicrunch.org/resolver/AB_823448.
53.RRID:AB_141362, https://scicrunch.org/resolver/AB_141362.
54. Genbacev O, Zhou Y, Ludlow JW, Fisher SJ. Regulation of human placental development by oxygen tension. Science 1997;277(5332):1669-1672. doi: 10.1126/science.277.5332.1669. [DOI] [PubMed] [Google Scholar]
55. Rodesch F, Simon P, Donner C, Jauniaux E. Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet Gynecol. 1992;80(2):283-285. [PubMed] [Google Scholar]
56. Lu J, Zhang S, Nakano H, et al. A positive feedback loop involving Gcm1 and Fzd5 directs chorionic branching morphogenesis in the placenta. PLoS Biol. 2013;11(4):e1001536. doi: 10.1371/journal.pbio.1001536. [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Hou Y, Xue P, Bai Y, et al. Nuclear factor erythroid-derived factor 2-related factor 2 regulates transcription of CCAAT/enhancer-binding protein beta during adipogenesis. Free Radic Biol Med. 2012;52(2):462-472. doi: 10.1016/j.freeradbiomed.2011.10.453. [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Reichard JF, Motz GT, Puga A. Heme oxygenase-1 induction by NRF2 requires inactivation of the transcriptional repressor BACH1. Nucleic Acids Res. 2007;35(21):7074-7086. doi: 10.1093/nar/gkm638. [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Huang W, Zhang J, Huo M, et al. CUL4B promotes breast carcinogenesis by coordinating with transcriptional repressor complexes in response to hypoxia signaling pathway. Adv Sci (Weinh) 2021;8(10):2001515. doi: 10.1002/advs.202001515. [DOI] [PMC free article] [PubMed] [Google Scholar]
60. Li P, Song Y, Zan W, et al. Lack of CUL4B in adipocytes promotes PPARgamma-mediated adipose tissue expansion and insulin sensitivity. Diabetes. 2017;66(2):300-313. doi: 10.2337/db16-0743. [DOI] [PubMed] [Google Scholar]
61. Shin S, Wakabayashi N, Misra V, et al. NRF2 modulates aryl hydrocarbon receptor signaling: influence on adipogenesis. Mol Cell Biol. 2007;27(20):7188-7197. doi: 10.1128/MCB.00915-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Zhu B, Tang L, Chen S, et al. Targeting the upstream transcriptional activator of PD-L1 as an alternative strategy in melanoma therapy. Oncogene 2018;37(36):4941-4954. doi: 10.1038/s41388-018-0314-0. [DOI] [PubMed] [Google Scholar]
63. Fujiwara T, Ikeda T, Nagasaka Y, et al. A low-molecular-weight compound K7174 represses hepcidin: possible therapeutic strategy against anemia of chronic disease. PLoS One. 2013;8(9):e75568. doi: 10.1371/journal.pone.0075568. [DOI] [PMC free article] [PubMed] [Google Scholar]
64. Andersson-Hall U, Svedin P, Mallard C, Blennow K, Zetterberg H, Holmang A. Growth differentiation factor 15 increases in both cerebrospinal fluid and serum during pregnancy. PLoS One. 2021;16(5):e0248980. doi: 10.1371/journal.pone.0248980. [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Hong KMS, Kwak Y-T, Mendelson CR. Data from: supplementary data for “NRF2 serves a critical role in regulation of immune checkpoint proteins (ICPs) during trophoblast differentiation.” Figshare 2021. Deposited 2022/4/11. 10.6084/m9.figshare.19576456. [DOI] [PMC free article] [PubMed]
66. Zong S, Li C, Luo C, et al. Dysregulated expression of IDO may cause unexplained recurrent spontaneous abortion through suppression of trophoblast cell proliferation and migration. Sci Rep. 2016;6:19916. doi: 10.1038/srep19916. [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Farre D, Roset R, Huerta M, et al. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003;31(13):3651-3653. doi: 10.1093/nar/gkg605. [DOI] [PMC free article] [PubMed] [Google Scholar]
68. Tsunoda T, Takagi T. Estimating transcription factor bindability on DNA. Bioinformatics 1999;15(7-8):622-630. doi: 10.1093/bioinformatics/15.7.622. [DOI] [PubMed] [Google Scholar]
69. Uuskula L, Mannik J, Rull K, et al. Mid-gestational gene expression profile in placenta and link to pregnancy complications. PLoS One. 2012;7(11):e49248. doi: 10.1371/journal.pone.0049248. [DOI] [PMC free article] [PubMed] [Google Scholar]
70. Ozen M, Zhao H, Lewis DB, Wong RJ, Stevenson DK. Heme oxygenase and the immune system in normal and pathological pregnancies. Front Pharmacol. 2015;6:84. doi: 10.3389/fphar.2015.00084. [DOI] [PMC free article] [PubMed] [Google Scholar]
71. Francisco LM, Sage PT, Sharpe AH. The PD-1 pathway in tolerance and autoimmunity. Immunol Rev. 2010;236(1):219-242. doi: 10.1111/j.1600-065X.2010.00923.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
72. Wegiel B, Hedblom A, Li M, et al. Heme oxygenase-1 derived carbon monoxide permits maturation of myeloid cells. Cell Death Dis. 2014;5:e1139. doi: 10.1038/cddis.2014.97. [DOI] [PMC free article] [PubMed] [Google Scholar]
73. Hao N, Whitelaw ML. The emerging roles of AhR in physiology and immunity. Biochem Pharmacol. 2013;86(5):561-570. doi: 10.1016/j.bcp.2013.07.004. [DOI] [PubMed] [Google Scholar]
74. Segerer SE, Rieger L, Kapp M, et al. MIC-1 (a multifunctional modulator of dendritic cell phenotype and function) is produced by decidual stromal cells and trophoblasts. Hum Reprod. 2012;27(1):200-209. doi: 10.1093/humrep/der358. [DOI] [PubMed] [Google Scholar]
75. Wischhusen J, Melero I, Fridman WH. Growth/differentiation factor-15 (GDF-15): from biomarker to novel targetable immune checkpoint. Front Immunol. 2020;11:951. doi: 10.3389/fimmu.2020.00951. [DOI] [PMC free article] [PubMed] [Google Scholar]
76. Pavlicev M, Wagner GP, Chavan AR, et al. Single-cell transcriptomics of the human placenta: inferring the cell communication network of the maternal-fetal interface. Genome Res. 2017;27(3):349-361. [DOI] [PMC free article] [PubMed] [Google Scholar]
77. Quinn KH, Parast MM. Decidual regulatory T cells in placental pathology and pregnancy complications. Am J Reprod Immunol. 2013;69(6):533-538. doi: 10.1111/aji.12077. [DOI] [PubMed] [Google Scholar]
78. Gomez-Lopez N, StLouis D, Lehr MA, Sanchez-Rodriguez EN, Arenas-Hernandez M. Immune cells in term and preterm labor. Cell Mol Immunol. 2014;11(6):571-581. doi: 10.1038/cmi.2014.46. [DOI] [PMC free article] [PubMed] [Google Scholar]
79. Svensson J, Jenmalm MC, Matussek A, Geffers R, Berg G, Ernerudh J. Macrophages at the fetal-maternal interface express markers of alternative activation and are induced by M-CSF and IL-10. J Immunol. 2011;187(7):3671-3682. doi: 10.4049/jimmunol.1100130. [DOI] [PubMed] [Google Scholar]
80. Fu B, Li X, Sun R, et al. Natural killer cells promote immune tolerance by regulating inflammatory TH17 cells at the human maternal-fetal interface. Proc Natl Acad Sci USA. 2013;110(3):E231-E240. doi: 10.1073/pnas.1206322110. [DOI] [PMC free article] [PubMed] [Google Scholar]
81. Hanna J, Goldman-Wohl D, Hamani Y, et al. Decidual NK cells regulate key developmental processes at the human fetal-maternal interface. Nat Med. 2006;12(9):1065-1074. doi: 10.1038/nm1452. [DOI] [PubMed] [Google Scholar]
82. Vacca P, Cantoni C, Vitale M, et al. Crosstalk between decidual NK and CD14+ myelomonocytic cells results in induction of Tregs and immunosuppression. Proc Natl Acad Sci USA. 2010;107(26):11918-11923. doi: 10.1073/pnas.1001749107. [DOI] [PMC free article] [PubMed] [Google Scholar]
83. Crespo AC, Mulik S, Dotiwala F, et al. Decidual NK cells transfer granulysin to selectively kill bacteria in trophoblasts. Cell 2020;182(5):1125-1139.e18. doi: 10.1016/j.cell.2020.07.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
84. Svensson-Arvelund J, Mehta RB, Lindau R, et al. The human fetal placenta promotes tolerance against the semiallogeneic fetus by inducing regulatory T cells and homeostatic M2 macrophages. J Immunol. 2015;194(4):1534-1544. doi: 10.4049/jimmunol.1401536. [DOI] [PubMed] [Google Scholar]
85. Xu Y, Romero R, Miller D, et al. An M1-like macrophage polarization in decidual tissue during spontaneous preterm labor that is attenuated by rosiglitazone treatment. J Immunol. 2016;196(6):2476-2491. doi: 10.4049/jimmunol.1502055. [DOI] [PMC free article] [PubMed] [Google Scholar]
86. Robinson JF, Kapidzic M, Gormley M, et al. Transcriptional dynamics of cultured human villous cytotrophoblasts. Endocrinology 2017;158(6):1581-1594. doi: 10.1210/en.2016-1635. [DOI] [PMC free article] [PubMed] [Google Scholar]
87. Graham CH, Hawley TS, Hawley RG, et al. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res. 1993;206(2):204-211. doi: 10.1006/excr.1993.1139. [DOI] [PubMed] [Google Scholar]
88. Abou-Kheir W, Barrak J, Hadadeh O, Daoud G. HTR-8/SVneo cell line contains a mixed population of cells. Placenta 2017;50:1-7. doi: 10.1016/j.placenta.2016.12.007. [DOI] [PubMed] [Google Scholar]
89. Steinberg ML, Robins JC. Cellular models of trophoblast differentiation. Semin Reprod Med. 2016;34(1):50-56. doi: 10.1055/s-0035-1570026. [DOI] [PubMed] [Google Scholar]
90. Tonelli C, Chio IIC, Tuveson DA. Transcriptional regulation by Nrf2. Antioxid Redox Signal. 2018;29(17):1727-1745. doi: 10.1089/ars.2017.7342. [DOI] [PMC free article] [PubMed] [Google Scholar]
91. Tal R. The role of hypoxia and hypoxia-inducible factor-1alpha in preeclampsia pathogenesis. Biol Reprod. 2012;87(6):134. doi: 10.1095/biolreprod.112.102723. [DOI] [PubMed] [Google Scholar]
92. Morasso MI, Grinberg A, Robinson G, Sargent TD, Mahon KA. Placental failure in mice lacking the homeobox gene Dlx3. Proc Natl Acad Sci USA. 1999;96(1):162-167. doi: 10.1073/pnas.96.1.162. [DOI] [PMC free article] [PubMed] [Google Scholar]
93. Bouhlel MA, Derudas B, Rigamonti E, et al. PPARgamma activation primes human monocytes into alternative M2 macrophages with anti-inflammatory properties. Cell Metab. 2007;6(2):137-143. doi: 10.1016/j.cmet.2007.06.010. [DOI] [PubMed] [Google Scholar]
94. Bradley MN, Zhou L, Smale ST. C/EBPbeta regulation in lipopolysaccharide-stimulated macrophages. Mol Cell Biol. 2003;23(14):4841-4858. doi: 10.1128/MCB.23.14.4841-4858.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
95. Ruffell D, Mourkioti F, Gambardella A, et al. A CREB-C/EBPbeta cascade induces M2 macrophage-specific gene expression and promotes muscle injury repair. Proc Natl Acad Sci USA. 2009;106(41):17475-17480. doi: 10.1073/pnas.0908641106. [DOI] [PMC free article] [PubMed] [Google Scholar]
96. Chen X, Liu W, Ambrosino C, et al. Impaired generation of bone marrow B lymphocytes in mice deficient in C/EBPbeta. Blood 1997;90(1):156-164. [PubMed] [Google Scholar]
97. Bai K, Li X, Zhong J, et al. Placenta-derived exosomes as a modulator in maternal immune tolerance during pregnancy. Front Immunol. 2021;12:671093. doi: 10.3389/fimmu.2021.671093. [DOI] [PMC free article] [PubMed] [Google Scholar]
98. Mincheva-Nilsson L, Baranov V. Placenta-derived exosomes and syncytiotrophoblast microparticles and their role in human reproduction: immune modulation for pregnancy success. Am J Reprod Immunol. 2014;72(5):440-457. doi: 10.1111/aji.12311. [DOI] [PubMed] [Google Scholar]
99. Kaitu’u-Lino TJ, Bambang K, Onwude J, Hiscock R, Konje J, Tong S. Plasma MIC-1 and PAPP-alpha levels are decreased among women presenting to an early pregnancy assessment unit, have fetal viability confirmed but later miscarry. PLoS One. 2013;8(9):e72437. doi: 10.1371/journal.pone.0072437. [DOI] [PMC free article] [PubMed] [Google Scholar]
100. Chen Q, Wang Y, Zhao M, Hyett J, da Silva Costa F, Nie G. Serum levels of GDF15 are reduced in preeclampsia and the reduction is more profound in late-onset than early-onset cases. Cytokine. 2016;83:226-230. doi: 10.1016/j.cyto.2016.05.002. [DOI] [PubMed] [Google Scholar]
101. Rogers TJ, Christenson JL, Greene LI, et al. Reversal of triple-negative breast cancer EMT by miR-200c decreases tryptophan catabolism and a program of immunosuppression. Mol Cancer Res. 2019;17(1):30-41. doi: 10.1158/1541-7786.MCR-18-0246. [DOI] [PMC free article] [PubMed] [Google Scholar]
102. Welsh JB, Sapinoso LM, Kern SG, et al. Large-scale delineation of secreted protein biomarkers overexpressed in cancer tissue and serum. Proc Natl Acad Sci U S A. 2003;100(6):3410-3415. doi: 10.1073/pnas.0530278100 [DOI] [PMC free article] [PubMed] [Google Scholar]
103. Sanchez-Ortega M, Carrera AC, Garrido A. Role of NRF2 in lung cancer. Cells 2021;10(8):1879. doi: 10.3390/cells10081879. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Original data generated and analyzed during this study are included in this published article or in the data repositories listed in References.

[CIT0001] 1. Maltepe E, Bakardjiev AI, Fisher SJ. The placenta: transcriptional, epigenetic, and physiological integration during development. J Clin Invest. 2010;120(4):1016-1025. doi: 10.1172/JCI41211. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0002] 2. Arck PC, Hecher K. Fetomaternal immune cross-talk and its consequences for maternal and offspring’s health. Nat Med. 2013;19(5):548-556. doi: 10.1038/nm.3160. [DOI] [PubMed] [Google Scholar]

[CIT0003] 3. PrabhuDas M, Bonney E, Caron K, et al. Immune mechanisms at the maternal-fetal interface: perspectives and challenges. Nat Immunol. 2015;16(4):328-334. doi: 10.1038/ni.3131. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0004] 4. Kwak YT, Muralimanoharan S, Gogate AA, Mendelson CR. Human trophoblast differentiation is associated with profound gene regulatory and epigenetic changes. Endocrinology 2019;160(9):2189-2203. doi: 10.1210/en.2019-00144. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0005] 5. Kamat A, Hinshelwood MM, Murry BA, Mendelson CR. Mechanisms in tissue-specific regulation of estrogen biosynthesis in humans. Trends Endocrinol Metab. 2002;13(3):122-128. doi: 10.1016/s1043-2760(02)00567-2. [DOI] [PubMed] [Google Scholar]

[CIT0006] 6. Means GD, Kilgore MW, Mahendroo MS, Mendelson CR, Simpson ER. Tissue-specific promoters regulate aromatase cytochrome P450 gene expression in human ovary and fetal tissues. Mol Endocrinol. 1991;5(12):2005-2013. doi: 10.1210/mend-5-12-2005. [DOI] [PubMed] [Google Scholar]

[CIT0007] 7. Kamat A, Graves KH, Smith ME, Richardson JA, Mendelson CR. A 500-bp region, approximately 40 kb upstream of the human CYP19 (aromatase) gene, mediates placenta-specific expression in transgenic mice. Proc Natl Acad Sci USA. 1999;96(8):4575-4580. doi: 10.1073/pnas.96.8.4575. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0008] 8. Kamat A, Smith ME, Shelton JM, Richardson JA, Mendelson CR. Genomic regions that mediate placental cell-specific and developmental regulation of human Cyp19 (aromatase) gene expression in transgenic mice. Endocrinology 2005;146(5):2481-2488. doi: 10.1210/en.2004-1606. [DOI] [PubMed] [Google Scholar]

[CIT0009] 9. Kamat A, Alcorn JL, Kunczt C, Mendelson CR. Characterization of the regulatory regions of the human aromatase (P450arom) gene involved in placenta-specific expression. Mol Endocrinol. 1998;12(11):1764-1777. doi: 10.1210/mend.12.11.0190. [DOI] [PubMed] [Google Scholar]

[CIT0010] 10. Fournet-Dulguerov N, MacLusky NJ, Leranth CZ, et al. Immunohistochemical localization of aromatase cytochrome P-450 and estradiol dehydrogenase in the syncytiotrophoblast of the human placenta. J Clin Endocrinol Metab. 1987;65(4):757-764. doi: 10.1210/jcem-65-4-757. [DOI] [PubMed] [Google Scholar]

[CIT0011] 11. Jiang B, Kamat A, Mendelson CR. Hypoxia prevents induction of aromatase expression in human trophoblast cells in culture: potential inhibitory role of the hypoxia-inducible transcription factor Mash-2 (mammalian achaete-scute homologous protein-2). Mol Endocrinol. 2000;14(10):1661-1673. doi: 10.1210/mend.14.10.0539. [DOI] [PubMed] [Google Scholar]

[CIT0012] 12. Jiang B, Mendelson CR. USF1 and USF2 mediate inhibition of human trophoblast differentiation and CYP19 gene expression by Mash-2 and hypoxia. Mol Cell Biol. 2003;23(17):6117-6128. doi: 10.1128/MCB.23.17.6117-6128.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0013] 13. Jiang B, Mendelson CR. O2 enhancement of human trophoblast differentiation and hCYP19 (aromatase) gene expression are mediated by proteasomal degradation of USF1 and USF2. Mol Cell Biol. 2005;25(20):8824-8833. doi: 10.1128/MCB.25.20.8824-8833.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0014] 14. Kumar P, Kamat A, Mendelson CR. Estrogen receptor alpha (ERalpha) mediates stimulatory effects of estrogen on aromatase (CYP19) gene expression in human placenta. Mol Endocrinol. 2009;23(6):784-793. doi: 10.1210/me.2008-0371. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0015] 15. Kumar P, Mendelson CR. Estrogen-related receptor gamma (ERRgamma) mediates oxygen-dependent induction of aromatase (CYP19) gene expression during human trophoblast differentiation. Mol Endocrinol. 2011;25(9):1513-1526. doi: 10.1210/me.2011-1012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0016] 16. Yamada K, Ogawa H, Honda S, Harada N, Okazaki T. A GCM motif protein is involved in placenta-specific expression of human aromatase gene. J Biol Chem. 1999;274(45):32279-32286. doi: 10.1074/jbc.274.45.32279. [DOI] [PubMed] [Google Scholar]

[CIT0017] 17. Kumar P, Luo Y, Tudela C, Alexander JM, Mendelson CR. The c-Myc-regulated microRNA-17~92 (miR-17~92) and miR-106a~363 clusters target hCYP19A1 and hGCM1 to inhibit human trophoblast differentiation. Mol Cell Biol. 2013;33(9):1782-1796. doi: 10.1128/MCB.01228-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0018] 18. Anson-Cartwright L, Dawson K, Holmyard D, Fisher SJ, Lazzarini RA, Cross JC. The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta. Nat Genet. 2000;25(3):311-314. doi: 10.1038/77076. [DOI] [PubMed] [Google Scholar]

[CIT0019] 19. Schreiber J, Riethmacher-Sonnenberg E, Riethmacher D, et al. Placental failure in mice lacking the mammalian homolog of glial cells missing, GCMa. Mol Cell Biol. 2000;20(7):2466-2474. doi: 10.1128/MCB.20.7.2466-2474.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0020] 20. Muralimanoharan S, Kwak YT, Mendelson CR. Redox-sensitive transcription factor NRF2 enhances trophoblast differentiation via induction of miR-1246 and aromatase. Endocrinology 2018;159(5):2022-2033. doi: 10.1210/en.2017-03024. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0021] 21. Chigusa Y, Tatsumi K, Kondoh E, et al. Decreased lectin-like oxidized LDL receptor 1 (LOX-1) and low Nrf2 activation in placenta are involved in preeclampsia. J Clin Endocrinol Metab. 2012;97(10):E1862-E1870. doi: 10.1210/jc.2012-1268. [DOI] [PubMed] [Google Scholar]

[CIT0022] 22. Yu L, Wang T, Que R, et al. The potentially protective role of ATP-binding cassette transporters in preeclampsia via Nrf2. Pregnancy Hypertens 2019;18:21-28. doi: 10.1016/j.preghy.2019.08.002. [DOI] [PubMed] [Google Scholar]

[CIT0023] 23. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science 2005;308(5728):1592-1594. doi: 10.1126/science.1111726. [DOI] [PubMed] [Google Scholar]

[CIT0024] 24. Ness RB, Sibai BM. Shared and disparate components of the pathophysiologies of fetal growth restriction and preeclampsia. Am J Obstet Gynecol. 2006;195(1):40-49. doi: 10.1016/j.ajog.2005.07.049. [DOI] [PubMed] [Google Scholar]

[CIT0025] 25. Pineles BL, Romero R, Montenegro D, et al. Distinct subsets of microRNAs are expressed differentially in the human placentas of patients with preeclampsia. Am J Obstet Gynecol. 2007;196(3):261e261-261e266. [DOI] [PubMed] [Google Scholar]

[CIT0026] 26. Fisher SJ. Why is placentation abnormal in preeclampsia? Am J Obstet Gynecol. 2015;213(4 Suppl):S115-S122. doi: 10.1016/j.ajog.2015.08.042. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0027] 27. Begay V, Smink J, Leutz A. Essential requirement of CCAAT/enhancer binding proteins in embryogenesis. Mol Cell Biol. 2004;24(22):9744-9751. doi: 10.1128/MCB.24.22.9744-9751.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0028] 28. Barak Y, Nelson MC, Ong ES, et al. PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell. 1999;4(4):585-595. doi: 10.1016/s1097-2765(00)80209-9. [DOI] [PubMed] [Google Scholar]

[CIT0029] 29. Parast MM, Yu H, Ciric A, Salata MW, Davis V, Milstone DS. PPARgamma regulates trophoblast proliferation and promotes labyrinthine trilineage differentiation. PLoS One. 2009;4(11):e8055. doi: 10.1371/journal.pone.0008055. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0030] 30. Tache V, Ciric A, Moretto-Zita M, et al. Hypoxia and trophoblast differentiation: a key role for PPARgamma. Stem Cells Dev. 2013;22(21):2815-2824. doi: 10.1089/scd.2012.0596. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0031] 31. Kweider N, Huppertz B, Rath W, et al. The effects of Nrf2 deletion on placental morphology and exchange capacity in the mouse. J Matern Fetal Neonatal Med. 2017;30(17):2068-2073. doi: 10.1080/14767058.2016.1236251. [DOI] [PubMed] [Google Scholar]

[CIT0032] 32. Sussan TE, Sudini K, TalbotCC, Jr, et al. Nrf2 regulates gene-environment interactions in an animal model of intrauterine inflammation: implications for preterm birth and prematurity. Sci Rep. 2017;7:40194. doi: 10.1038/srep40194. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0033] 33. Polvani S, Tarocchi M, Galli A. PPARgamma and oxidative stress: Con(beta) catenating NRF2 and FOXO. PPAR Res 2012;2012:641087. doi: 10.1155/2012/641087. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0034] 34. Zhang DD, Lo SC, Cross JV, Templeton DJ, Hannink M. Keap1 is a redox-regulated substrate adaptor protein for a Cul3-dependent ubiquitin ligase complex. Mol Cell Biol. 2004;24(24):10941-10953. doi: 10.1128/MCB.24.24.10941-10953.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0035] 35. Okae H, Toh H, Sato T, et al. Derivation of human trophoblast stem cells. Cell Stem Cell 2018;22(1):50-63.e6. doi: 10.1016/j.stem.2017.11.004. [DOI] [PubMed] [Google Scholar]

[CIT0036] 36.RRID:AB_944418, https://scicrunch.org/resolver/AB_944418.

[CIT0037] 37.RRID:AB_2895561, https://scicrunch.org/resolver/AB_2895561.

[CIT0038] 38.RRID:AB_726796, https://scicrunch.org/resolver/AB_726796.

[CIT0039] 39.RRID:AB_628115, https://scicrunch.org/resolver/AB_628115.

[CIT0040] 40.RRID:AB_2799772, https://scicrunch.org/resolver/AB_2799772.

[CIT0041] 41.RRID:AB_2800011, https://scicrunch.org/resolver/AB_2800011.

[CIT0042] 42.RRID:AB_2687655, https://scicrunch.org/resolver/AB_2687655.

[CIT0043] 43.RRID:AB_2895563, https://scicrunch.org/resolver/AB_2895563.

[CIT0044] 44.RRID:AB_2716755, https://scicrunch.org/resolver/AB_2716755.

[CIT0045] 45.RRID:AB_2305186, https://scicrunch.org/resolver/AB_2305186.

[CIT0046] 46.RRID:AB_631746, https://scicrunch.org/resolver/AB_631746.

[CIT0047] 47.RRID:AB_631728, https://scicrunch.org/resolver/AB_631728.

[CIT0048] 48.RRID:AB_631736, https://scicrunch.org/resolver/AB_631736.

[CIT0049] 49.RRID:AB_2877710, https://scicrunch.org/resolver/AB_2877710.

[CIT0050] 50.RRID:AB_1031062, https://scicrunch.org/resolver/AB_1031062.

[CIT0051] 51. Zhang M, Muralimanoharan S, Wortman AC, Mendelson CR. Primate-specific miR-515 family members inhibit key genes in human trophoblast differentiation and are upregulated in preeclampsia. Proc Natl Acad Sci USA. 2016;113(45):E7069-E7076. doi: 10.1073/pnas.1607849113. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0052] 52.RRID:AB_823448, https://scicrunch.org/resolver/AB_823448.

[CIT0053] 53.RRID:AB_141362, https://scicrunch.org/resolver/AB_141362.

[CIT0054] 54. Genbacev O, Zhou Y, Ludlow JW, Fisher SJ. Regulation of human placental development by oxygen tension. Science 1997;277(5332):1669-1672. doi: 10.1126/science.277.5332.1669. [DOI] [PubMed] [Google Scholar]

[CIT0055] 55. Rodesch F, Simon P, Donner C, Jauniaux E. Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet Gynecol. 1992;80(2):283-285. [PubMed] [Google Scholar]

[CIT0056] 56. Lu J, Zhang S, Nakano H, et al. A positive feedback loop involving Gcm1 and Fzd5 directs chorionic branching morphogenesis in the placenta. PLoS Biol. 2013;11(4):e1001536. doi: 10.1371/journal.pbio.1001536. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0057] 57. Hou Y, Xue P, Bai Y, et al. Nuclear factor erythroid-derived factor 2-related factor 2 regulates transcription of CCAAT/enhancer-binding protein beta during adipogenesis. Free Radic Biol Med. 2012;52(2):462-472. doi: 10.1016/j.freeradbiomed.2011.10.453. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0058] 58. Reichard JF, Motz GT, Puga A. Heme oxygenase-1 induction by NRF2 requires inactivation of the transcriptional repressor BACH1. Nucleic Acids Res. 2007;35(21):7074-7086. doi: 10.1093/nar/gkm638. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0059] 59. Huang W, Zhang J, Huo M, et al. CUL4B promotes breast carcinogenesis by coordinating with transcriptional repressor complexes in response to hypoxia signaling pathway. Adv Sci (Weinh) 2021;8(10):2001515. doi: 10.1002/advs.202001515. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0060] 60. Li P, Song Y, Zan W, et al. Lack of CUL4B in adipocytes promotes PPARgamma-mediated adipose tissue expansion and insulin sensitivity. Diabetes. 2017;66(2):300-313. doi: 10.2337/db16-0743. [DOI] [PubMed] [Google Scholar]

[CIT0061] 61. Shin S, Wakabayashi N, Misra V, et al. NRF2 modulates aryl hydrocarbon receptor signaling: influence on adipogenesis. Mol Cell Biol. 2007;27(20):7188-7197. doi: 10.1128/MCB.00915-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0062] 62. Zhu B, Tang L, Chen S, et al. Targeting the upstream transcriptional activator of PD-L1 as an alternative strategy in melanoma therapy. Oncogene 2018;37(36):4941-4954. doi: 10.1038/s41388-018-0314-0. [DOI] [PubMed] [Google Scholar]

[CIT0063] 63. Fujiwara T, Ikeda T, Nagasaka Y, et al. A low-molecular-weight compound K7174 represses hepcidin: possible therapeutic strategy against anemia of chronic disease. PLoS One. 2013;8(9):e75568. doi: 10.1371/journal.pone.0075568. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0064] 64. Andersson-Hall U, Svedin P, Mallard C, Blennow K, Zetterberg H, Holmang A. Growth differentiation factor 15 increases in both cerebrospinal fluid and serum during pregnancy. PLoS One. 2021;16(5):e0248980. doi: 10.1371/journal.pone.0248980. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0065] 65. Hong KMS, Kwak Y-T, Mendelson CR. Data from: supplementary data for “NRF2 serves a critical role in regulation of immune checkpoint proteins (ICPs) during trophoblast differentiation.” Figshare 2021. Deposited 2022/4/11. 10.6084/m9.figshare.19576456. [DOI] [PMC free article] [PubMed]

[CIT0066] 66. Zong S, Li C, Luo C, et al. Dysregulated expression of IDO may cause unexplained recurrent spontaneous abortion through suppression of trophoblast cell proliferation and migration. Sci Rep. 2016;6:19916. doi: 10.1038/srep19916. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0067] 67. Farre D, Roset R, Huerta M, et al. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003;31(13):3651-3653. doi: 10.1093/nar/gkg605. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0068] 68. Tsunoda T, Takagi T. Estimating transcription factor bindability on DNA. Bioinformatics 1999;15(7-8):622-630. doi: 10.1093/bioinformatics/15.7.622. [DOI] [PubMed] [Google Scholar]

[CIT0069] 69. Uuskula L, Mannik J, Rull K, et al. Mid-gestational gene expression profile in placenta and link to pregnancy complications. PLoS One. 2012;7(11):e49248. doi: 10.1371/journal.pone.0049248. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0070] 70. Ozen M, Zhao H, Lewis DB, Wong RJ, Stevenson DK. Heme oxygenase and the immune system in normal and pathological pregnancies. Front Pharmacol. 2015;6:84. doi: 10.3389/fphar.2015.00084. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0071] 71. Francisco LM, Sage PT, Sharpe AH. The PD-1 pathway in tolerance and autoimmunity. Immunol Rev. 2010;236(1):219-242. doi: 10.1111/j.1600-065X.2010.00923.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0072] 72. Wegiel B, Hedblom A, Li M, et al. Heme oxygenase-1 derived carbon monoxide permits maturation of myeloid cells. Cell Death Dis. 2014;5:e1139. doi: 10.1038/cddis.2014.97. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0073] 73. Hao N, Whitelaw ML. The emerging roles of AhR in physiology and immunity. Biochem Pharmacol. 2013;86(5):561-570. doi: 10.1016/j.bcp.2013.07.004. [DOI] [PubMed] [Google Scholar]

[CIT0074] 74. Segerer SE, Rieger L, Kapp M, et al. MIC-1 (a multifunctional modulator of dendritic cell phenotype and function) is produced by decidual stromal cells and trophoblasts. Hum Reprod. 2012;27(1):200-209. doi: 10.1093/humrep/der358. [DOI] [PubMed] [Google Scholar]

[CIT0075] 75. Wischhusen J, Melero I, Fridman WH. Growth/differentiation factor-15 (GDF-15): from biomarker to novel targetable immune checkpoint. Front Immunol. 2020;11:951. doi: 10.3389/fimmu.2020.00951. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0076] 76. Pavlicev M, Wagner GP, Chavan AR, et al. Single-cell transcriptomics of the human placenta: inferring the cell communication network of the maternal-fetal interface. Genome Res. 2017;27(3):349-361. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0077] 77. Quinn KH, Parast MM. Decidual regulatory T cells in placental pathology and pregnancy complications. Am J Reprod Immunol. 2013;69(6):533-538. doi: 10.1111/aji.12077. [DOI] [PubMed] [Google Scholar]

[CIT0078] 78. Gomez-Lopez N, StLouis D, Lehr MA, Sanchez-Rodriguez EN, Arenas-Hernandez M. Immune cells in term and preterm labor. Cell Mol Immunol. 2014;11(6):571-581. doi: 10.1038/cmi.2014.46. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0079] 79. Svensson J, Jenmalm MC, Matussek A, Geffers R, Berg G, Ernerudh J. Macrophages at the fetal-maternal interface express markers of alternative activation and are induced by M-CSF and IL-10. J Immunol. 2011;187(7):3671-3682. doi: 10.4049/jimmunol.1100130. [DOI] [PubMed] [Google Scholar]

[CIT0080] 80. Fu B, Li X, Sun R, et al. Natural killer cells promote immune tolerance by regulating inflammatory TH17 cells at the human maternal-fetal interface. Proc Natl Acad Sci USA. 2013;110(3):E231-E240. doi: 10.1073/pnas.1206322110. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0081] 81. Hanna J, Goldman-Wohl D, Hamani Y, et al. Decidual NK cells regulate key developmental processes at the human fetal-maternal interface. Nat Med. 2006;12(9):1065-1074. doi: 10.1038/nm1452. [DOI] [PubMed] [Google Scholar]

[CIT0082] 82. Vacca P, Cantoni C, Vitale M, et al. Crosstalk between decidual NK and CD14+ myelomonocytic cells results in induction of Tregs and immunosuppression. Proc Natl Acad Sci USA. 2010;107(26):11918-11923. doi: 10.1073/pnas.1001749107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0083] 83. Crespo AC, Mulik S, Dotiwala F, et al. Decidual NK cells transfer granulysin to selectively kill bacteria in trophoblasts. Cell 2020;182(5):1125-1139.e18. doi: 10.1016/j.cell.2020.07.019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0084] 84. Svensson-Arvelund J, Mehta RB, Lindau R, et al. The human fetal placenta promotes tolerance against the semiallogeneic fetus by inducing regulatory T cells and homeostatic M2 macrophages. J Immunol. 2015;194(4):1534-1544. doi: 10.4049/jimmunol.1401536. [DOI] [PubMed] [Google Scholar]

[CIT0085] 85. Xu Y, Romero R, Miller D, et al. An M1-like macrophage polarization in decidual tissue during spontaneous preterm labor that is attenuated by rosiglitazone treatment. J Immunol. 2016;196(6):2476-2491. doi: 10.4049/jimmunol.1502055. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0086] 86. Robinson JF, Kapidzic M, Gormley M, et al. Transcriptional dynamics of cultured human villous cytotrophoblasts. Endocrinology 2017;158(6):1581-1594. doi: 10.1210/en.2016-1635. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0087] 87. Graham CH, Hawley TS, Hawley RG, et al. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res. 1993;206(2):204-211. doi: 10.1006/excr.1993.1139. [DOI] [PubMed] [Google Scholar]

[CIT0088] 88. Abou-Kheir W, Barrak J, Hadadeh O, Daoud G. HTR-8/SVneo cell line contains a mixed population of cells. Placenta 2017;50:1-7. doi: 10.1016/j.placenta.2016.12.007. [DOI] [PubMed] [Google Scholar]

[CIT0089] 89. Steinberg ML, Robins JC. Cellular models of trophoblast differentiation. Semin Reprod Med. 2016;34(1):50-56. doi: 10.1055/s-0035-1570026. [DOI] [PubMed] [Google Scholar]

[CIT0090] 90. Tonelli C, Chio IIC, Tuveson DA. Transcriptional regulation by Nrf2. Antioxid Redox Signal. 2018;29(17):1727-1745. doi: 10.1089/ars.2017.7342. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0091] 91. Tal R. The role of hypoxia and hypoxia-inducible factor-1alpha in preeclampsia pathogenesis. Biol Reprod. 2012;87(6):134. doi: 10.1095/biolreprod.112.102723. [DOI] [PubMed] [Google Scholar]

[CIT0092] 92. Morasso MI, Grinberg A, Robinson G, Sargent TD, Mahon KA. Placental failure in mice lacking the homeobox gene Dlx3. Proc Natl Acad Sci USA. 1999;96(1):162-167. doi: 10.1073/pnas.96.1.162. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0093] 93. Bouhlel MA, Derudas B, Rigamonti E, et al. PPARgamma activation primes human monocytes into alternative M2 macrophages with anti-inflammatory properties. Cell Metab. 2007;6(2):137-143. doi: 10.1016/j.cmet.2007.06.010. [DOI] [PubMed] [Google Scholar]

[CIT0094] 94. Bradley MN, Zhou L, Smale ST. C/EBPbeta regulation in lipopolysaccharide-stimulated macrophages. Mol Cell Biol. 2003;23(14):4841-4858. doi: 10.1128/MCB.23.14.4841-4858.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0095] 95. Ruffell D, Mourkioti F, Gambardella A, et al. A CREB-C/EBPbeta cascade induces M2 macrophage-specific gene expression and promotes muscle injury repair. Proc Natl Acad Sci USA. 2009;106(41):17475-17480. doi: 10.1073/pnas.0908641106. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0096] 96. Chen X, Liu W, Ambrosino C, et al. Impaired generation of bone marrow B lymphocytes in mice deficient in C/EBPbeta. Blood 1997;90(1):156-164. [PubMed] [Google Scholar]

[CIT0097] 97. Bai K, Li X, Zhong J, et al. Placenta-derived exosomes as a modulator in maternal immune tolerance during pregnancy. Front Immunol. 2021;12:671093. doi: 10.3389/fimmu.2021.671093. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0098] 98. Mincheva-Nilsson L, Baranov V. Placenta-derived exosomes and syncytiotrophoblast microparticles and their role in human reproduction: immune modulation for pregnancy success. Am J Reprod Immunol. 2014;72(5):440-457. doi: 10.1111/aji.12311. [DOI] [PubMed] [Google Scholar]

[CIT0099] 99. Kaitu’u-Lino TJ, Bambang K, Onwude J, Hiscock R, Konje J, Tong S. Plasma MIC-1 and PAPP-alpha levels are decreased among women presenting to an early pregnancy assessment unit, have fetal viability confirmed but later miscarry. PLoS One. 2013;8(9):e72437. doi: 10.1371/journal.pone.0072437. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0100] 100. Chen Q, Wang Y, Zhao M, Hyett J, da Silva Costa F, Nie G. Serum levels of GDF15 are reduced in preeclampsia and the reduction is more profound in late-onset than early-onset cases. Cytokine. 2016;83:226-230. doi: 10.1016/j.cyto.2016.05.002. [DOI] [PubMed] [Google Scholar]

[CIT0101] 101. Rogers TJ, Christenson JL, Greene LI, et al. Reversal of triple-negative breast cancer EMT by miR-200c decreases tryptophan catabolism and a program of immunosuppression. Mol Cancer Res. 2019;17(1):30-41. doi: 10.1158/1541-7786.MCR-18-0246. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0102] 102. Welsh JB, Sapinoso LM, Kern SG, et al. Large-scale delineation of secreted protein biomarkers overexpressed in cancer tissue and serum. Proc Natl Acad Sci U S A. 2003;100(6):3410-3415. doi: 10.1073/pnas.0530278100 [DOI] [PMC free article] [PubMed] [Google Scholar]

[CIT0103] 103. Sanchez-Ortega M, Carrera AC, Garrido A. Role of NRF2 in lung cancer. Cells 2021;10(8):1879. doi: 10.3390/cells10081879. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

NRF2 Serves a Critical Role in Regulation of Immune Checkpoint Proteins (ICPs) During Trophoblast Differentiation

Kyunghee Hong

Sribalasubashini Muralimanoharan

Youn-Tae Kwak

Carole R Mendelson

Abstract

Materials and Methods

Mice

Differentiation of hTSCs to SynT

Transient Transfection

RT quantitative PCR

Table 1.

Western Blot Analysis

Human GDF15 ELISA

Chromatin immunoprecipitation-qPCR

Morphological Analysis of Trophoblast Stem Cell Fusion

Statistical Analyses

Results

Figure 1.

Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 6.

Discussion

Figure 7.

Author Contributions

Glossary

Abbreviations

Contributor Information

Funding

Disclosure Summary

Data Availability

References

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases