Skip to main content
eLife logoLink to eLife
. 2022 May 12;11:e73941. doi: 10.7554/eLife.73941

Conserved structural elements specialize ATAD1 as a membrane protein extraction machine

Lan Wang 1,2,†,, Hannah Toutkoushian 1,2,†,, Vladislav Belyy 1,2, Claire Y Kokontis 1, Peter Walter 1,2,‡,
Editors: Franz-Ulrich Hartl3, Volker Dötsch4
PMCID: PMC9273213  PMID: 35550246

Abstract

The mitochondrial AAA (ATPase Associated with diverse cellular Activities) protein ATAD1 (in humans; Msp1 in yeast) removes mislocalized membrane proteins, as well as stuck import substrates from the mitochondrial outer membrane, facilitating their re-insertion into their cognate organelles and maintaining mitochondria’s protein import capacity. In doing so, it helps to maintain proteostasis in mitochondria. How ATAD1 tackles the energetic challenge to extract hydrophobic membrane proteins from the lipid bilayer and what structural features adapt ATAD1 for its particular function has remained a mystery. Previously, we determined the structure of Msp1 in complex with a peptide substrate (Wang et al., 2020). The structure showed that Msp1’s mechanism follows the general principle established for AAA proteins while adopting several structural features that specialize it for its function. Among these features in Msp1 was the utilization of multiple aromatic amino acids to firmly grip the substrate in the central pore. However, it was not clear whether the aromatic nature of these amino acids were required, or if they could be functionally replaced by aliphatic amino acids. In this work, we determined the cryo-EM structures of the human ATAD1 in complex with a peptide substrate at near atomic resolution. The structures show that phylogenetically conserved structural elements adapt ATAD1 for its function while generally adopting a conserved mechanism shared by many AAA proteins. We developed a microscopy-based assay reporting on protein mislocalization, with which we directly assessed ATAD1’s activity in live cells and showed that both aromatic amino acids in pore-loop 1 are required for ATAD1’s function and cannot be substituted by aliphatic amino acids. A short α-helix at the C-terminus strongly facilitates ATAD1’s oligomerization, a structural feature that distinguishes ATAD1 from its closely related proteins.

Research organism: E. coli, Human

Introduction

Mitochondria serve a multitude of functions, including ATP production, metabolism, and proteostasis that all require import of proteins from the cytosol (Pfanner et al., 2019). To ensure proper function, multiple mechanisms facilitate faithful protein targeting and efficient protein import into the organelle. One of these mechanisms is carried out by a protein on the mitochondrial outer membrane (MOM) named ATAD1 (in humans; Msp1 in yeast). ATAD1 has important roles in various biological contexts (Fresenius and Wohlever, 2019; Wang and Walter, 2020), including clearing out mistargeted proteins from the mitochondria (Chen et al., 2014; Nuebel et al., 2021; Okreglak and Walter, 2014), extracting mitochondrial precursor proteins stuck in the protein translocase channel during protein import overload (Weidberg and Amon, 2018), and mediating apoptosis by removing a BCL-family member protein (Winter et al., 2021). In addition, ATAD1 has also been implicated in the regulation of synaptic plasticity by mediating the endocytosis of neurotransmitter receptors from post-synaptic membranes (Wang and Walter, 2020; Zhang et al., 2011). Among these, the removal of mistargeted tail-anchored (TA) proteins from the MOM is ATAD1’s best understood function to date.

TA proteins are integral membrane proteins that are embedded in the membrane by a hydrophobic stretch at the extreme C-terminus. They are targeted to organellar membranes post-translationally. The endoplasmic reticulum (ER)-targeted TA proteins are delivered to the ER membrane by the TRC proteins (Get proteins in yeast) (Favaloro et al., 2008; Schuldiner et al., 2008; Stefanovic and Hegde, 2007). From there, they either stay on the ER membrane or travel to the peroxisome or other membranes along the secretory pathway. By contrast, TA proteins on the MOM either insert spontaneously (Chio et al., 2017) or are actively inserted by the mitochondrial import machinery (Doan et al., 2020). The partitioning of the ER- and the mitochondria-targeted TA proteins relies on different biophysical properties of their targeting signals (consisting of the transmembrane domain and the short segment C-terminal to it) (Chio et al., 2017). Due to a number of similarities between the ER- and mitochondria-targeted TA proteins, mistargeting happens in both directions. Recently, our lab and the Rutter lab independently discovered that Msp1/ATAD1 could recognize the mislocalized TA proteins and extract them from mitochondria (Chen et al., 2014; Okreglak and Walter, 2014). The extracted proteins are then correctly inserted into the ER membrane, from which they travel to their cognate organelle or become degraded by the proteasome (Dederer et al., 2019; Matsumoto et al., 2019).

ATAD1 is a member of a large family of proteins called the AAA (ATPase Associated with diverse cellular Activities) proteins. It is strictly conserved from yeast to humans. Previously, we determined a series of cryo-EM structures of the cytosolic domain of the Chaetomium thermophilum (C.t.) Msp1 in complex with a peptide substrate (Wang et al., 2020). The structures revealed that Msp1 follows the general principle established for many AAA proteins (Gates et al., 2017; Monroe et al., 2017; de la Peña et al., 2018; Puchades et al., 2020; Puchades et al., 2017; Zehr et al., 2017): six Msp1 subunits form a helical hexamer resembling a right-handed lock-washer that surrounds the substrate in a hydrophobic central pore. Elements at the intersubunit interface couple ATP hydrolysis with stepwise subunit translocation to unfold the substrate peptide in its central pore. The structures also revealed elements in Msp1 that are adapted for its function of removing membrane proteins, one of which is an unusually hydrophobic central pore. Whereas most AAA proteins extend only one short loop (pore-loop 1) containing a conserved aromatic amino acid to directly contact the substrate, Msp1 utilizes a total of three aromatic amino acids within two short loops to contact the substrate. We previously proposed that these aromatic amino acids enhance the bulkiness and hydrophobicity of the pore-loops, giving Msp1 a firm grip on the substrate to prevent it from backsliding, a feature that may be important for pulling hydrophobic membrane proteins out of the lipid bilayer.

To test the importance of the additional aromatic amino acids, we previously mutated the second (Y167 in Saccharomyces cerevisiae (S.c.), corresponding to Y188 in C.t.) and the third (H206 in S.c., corresponding to H227 in C.t.) aromatic amino acids to aliphatic or polar amino acids and measured their effects on yeast growth. Surprisingly, while the Y167A mutation impacted Msp1’s activity, the Y167V or H206A mutation did not have a significant impact on Msp1’s function. We hypothesized that this was perhaps because the yeast growth assay provides an indirect readout (cell death) of Msp1’s function. In other words, deficiencies in the protein’s activity could be masked by compensatory pathways promoting cell survival. Therefore, in this study, we aimed to establish an assay that would allow the direct visualization of protein mislocalization.

In addition to addressing these remaining questions concerning the pore-loops, we also explored unique structural elements in ATAD1 that are not observed in its closely related family members. Within the large AAA protein family, ATAD1 belongs to the ‘meiotic clade’ (AAAMC). Members of this clade include microtubule severing proteins such as katanin and spastin, as well as the protein that disassembles the ESCRT peptides, Vps4 (Frickey and Lupas, 2004). One of the unique structural elements shared by these family members is a C-terminal extension of the classic AAA protein fold, helix α12. α12 is important in hexamer assembly and protein function for AAAMC proteins (Sandate et al., 2019; Vajjhala et al., 2008). The secondary structure prediction of ATAD1, however, shows the lack of α12, and instead predicts a longer α11 (the alpha helix proceeding it, Figure 1—figure supplement 1). Of note, there are several disease-relevant mutations clustered around α11, making it particularly important to understand this region in molecular detail: R9H, D221H, and E290K are found in schizophrenia patients (Umanah et al., 2017); H357Rfs*15 (a frame shift mutation resulting in a 10 amino acid extension at the C-terminus) is found in a family of patients with encephalopathy (Piard et al., 2018); and E267stop results in a truncated protein that is missing a large portion of the C-terminal domain and is found in a family of patients suffering from hypertonia, seizure, and death (Ahrens-Nicklas et al., 2017). In the C.t. Msp1 structure, we did not observe density for α11, which could be due to degradation or lack of rigid secondary structure, leaving the structure and function of α11 unresolved. To address these questions, we determined the structure of ATAD1 and tested the individual functional contributions of salient structural features in a microscopy-based mislocalization assay.

Results

To obtain a homogenous sample for structural analysis, we expressed human ATAD1 lacking the first 40 amino acids (consisting of the transmembrane helix) with an N-terminal His-tag and bearing a commonly used ‘Walker B’ mutation that inactivates ATP hydrolysis but retains ATP binding (Δ40-ATAD1E193Q). Δ40-ATAD1E193Q formed oligomers as assessed by size exclusion chromatography (Figure 1—figure supplement 2). We took the fraction corresponding to hexamers and incubated it with ATP before preparing samples for cryo-EM imaging.

3D classification of the particles resulted in two distinct hexameric structures. In the first structure, the six ATAD1 subunits (M1–M6) are arranged in a right-handed spiral with an open seam between the top and the bottom subunits (45,003 particles analyzed, Figure 1—figure supplement 3B, Table 1), an arrangement resembling the ‘open state’ structure of Msp1 (Wang et al., 2020), as well as other related AAA proteins (Cooney et al., 2019; Han et al., 2020; Su et al., 2017; Sun et al., 2017; Twomey et al., 2019; Zehr et al., 2017; Figure 1A). Refinement of this structure resulted in a map with an average resolution of 3.7 Å. In the second structure, the subunits are arranged in a similar fashion as the first, with the exception of M6, which is in transition to convert into M1 as part of the AAA protein functional ATPase cycle and now bridges M1 and M5, closing the hexameric ring (96,577 particles analyzed). This structure closely resembles the ‘closed state’ structure observed in Msp1 (Figure 1B). Refinement of this structure yielded a map with an average resolution of 3.2 Å with most of the side chain densities clearly visible, which allowed us to build an atomic model. Noticeably, the density of the M6 subunit in the ‘closed state’ structure was less well defined than the rest of the complex (local resolution ranging from 4 to 6 Å, Figure 1—figure supplement 3C), indicating a mixture of different states. A similar dynamic nature of this subunit was also observed in the Msp1 structure (Wang et al., 2020) but the density was too poorly resolved to be interpreted. By contrast, for ATAD1, we could identify secondary structure elements clearly, which enabled us to build a polyalanine model for this subunit. In doing so, we were able to analyze the interactions between M6 and neighboring subunits in the closed state, which was not possible for Msp1.

Table 1. Cryo-EM data analysis.

Structure Δ40-ATAD1E193Q (closed)PDB ID: 7UPREMD-26674 Δ40-ATAD1E193Q (open)PDB ID: 7UPTEMD-26675
Data collection
 Microscope Titan Krios
 Voltage (keV) 300
 Nominal magnification 105,000×
 Exposure navigation Image shift
 Electron dose (e-2) 67
 Dose rate (e-/pixel/s) 15
 Detector K3 summit
 Pixel size (Å) 0.832
 Defocus range (μm) 0.6–2.0
 Micrographs 6937
Reconstruction
 Total extracted particles (no.) 478,463
 Final particles (no.) 96,577 45,003
 Symmetry imposed C1 C1
 FSC average resolution, masked (Å) 3.2 3.5
 FSC average resolution, unmasked (Å) 4.1 4.6
 Applied B-factor (Å) 121.9 119.2
 Reconstruction package Cryosparc v2.15 and Relion 3.0.8
Refinement
 Protein residues 1678 1694
 Ligands 19 19
 RMSD bond lengths (Å) 0.002 0.003
 RMSD bond angles (°) 0.571 0.802
 Ramachandran outliers (%) 0.00 0.06
 Ramachandran allowed (%) 7.10 7.34
 Ramachandran favored (%) 92.90 92.60
 Poor rotamers (%) 4.18 11.28
 CaBLAM outliers (%) 5.69 5.39
 Molprobity score 2.33 2.79
 Clash score (all atoms) 7.82 10.14
 B-factors (protein) 128.89 172.35
 B-factors (ligands) 106.10 162.46
 EMRinger score 1.45 1.19
 Refinement package Phenix 1.17.1-3660-000

Figure 1. Architecture of the Δ40-ATAD1E193Q-substrate complexes.

(A and B) Final reconstructions of Δ40-ATAD1E193Q (open) and Δ40-ATAD1E193Q (closed) complexes shown in top and side views. Each subunit (M1–M6) is assigned a distinct color, and the substrate is shown in black. The spiral seam of the open conformation (panel A) is denoted with dashed lines. In the top views, the membrane-facing side of ATAD1 is shown. (C) Schematic of individual domains and structural elements of human ATAD1. (D) Pore-loops 1 (showing those of the closed conformation) form a staircase around the substrate. The peptide density is shown in black mesh. (E) Pore-loops 2 form a second staircase below pore-loops 1. H206s directly contact the peptide backbone carbonyls.

Figure 1.

Figure 1—figure supplement 1. Sequence alignment of AAAMC proteins.

Figure 1—figure supplement 1.

Sequence alignment of AAAMC proteins showing the secondary structure of the C-terminal helices. While ATAD1 has a longer α11, the other members of the AAAMC subfamily have two shorter helices (α11 and α12) separated by a linker. Secondary structure assignment is based on experimentally determined structures: ATAD1 from this study; Spastin from PDB ID 6PEN; Vps4 from PDB ID: 6AP1, and Katanin from PDB ID: 6UGE.

Figure 1—figure supplement 2. Size exclusion chromatography (SEC) trace of Δ40-ATAD1E193Q.

Figure 1—figure supplement 2.

The SEC trace of Δ40-ATAD1E193Q shows that ATAD1 forms oligomeric species on the SEC column. The gray bar indicated the fraction that was imaged by cryo-EM. Size markers are indicated on the top.

Figure 1—figure supplement 3. Cryo-EM processing of the Δ40-ATAD1E193Q-substrate complexes.

Figure 1—figure supplement 3.

(A) Representative micrograph showing the quality of data used for the final reconstruction of the Δ40-ATAD1E193Q structures. (B) Data processing scheme showing the 2D and 3D classification done using the RELION software. After two rounds of 3D classification, particles corresponding to ATAD1 are imported into Cryosparc for another round of 2D classification to further purify particles. Particles selected from the 2D classification were then subjected to heterogeneous refinement in which the open and the closed conformations emerged as two distinct classes. CTF refinement followed by nonuniform refinement generated the final reconstruction at 3.2 and 3.5 Å for the closed and the open conformations, respectively. (C) Local resolution maps of the open and the closed conformations show that the core of the protein complex including the central pore and the nucleotide-binding pockets are the best resolved regions. (E) Fourier shell correlation (FSC) plots of the 3D reconstructions of Δ40-ATAD1E193Q: Δ40-ATAD1E193Q (closed) masked (orange), Δ40-ATAD1E193Q (closed) unmasked (gray), Δ40-ATAD1E193Q (open) masked (blue), Δ40-ATAD1E193Q (open) unmasked (yellow).

Figure 1—figure supplement 4. Hinge motion between the large and the small subdomain accompanies subunit movements.

Figure 1—figure supplement 4.

(A) In the open state, all six subunits have similar domain organization. M6 loses its bound nucleotide as it translocates from the bottom position to the closed position. The angle between the large and the small subdomain of M5 narrows (indicated by the orange lines). (B) M6 rebinds an ATP molecule as it continues to translocate upward to assume the top position in the open spiral (C). M5 loses contacts with M6 and the angle between its two subdomains widens. M6 is colored in dark blue, M5 in cyan, the rest of the subunits in white, and the peptide substrate in black. The blue arrow indicates the direction of M6 translocation and the orange arrow indicates the direction of hinge movement between the two subdomains of M5. (D) 90-degree flip from panel (B) showing the contact points between M6 and adjacent subunits. Multiple contact points exist between the M6 and the M5 subunits, whereas fewer contacts are made between the M6 and the M1 subunits. Among those, one is made by helix α11 (highlighted in the dashed circle).

Hinge motion between the large and the small AAA domains accompanies subunit translocation

The overall architecture of ATAD1 closely resembles that of Msp1, pointing to significant structure/function conservation throughout eukaryotic evolution. Six ATAD1 subunits rotate and translocate progressively to form a hexameric spiral assembly. Each ATAD1 subunit consists of two subdomains, a large subdomain followed by a small subdomain (Figure 1C), and the nucleotide is bound at the interface between the two. In the ‘open state’, all six subunits adopt similar overall structures. To initiate the subunit translocation, the M6 subunit loses its bound nucleotide, and translocates upward to bridge the gap with M1 (Figure 1—figure supplement 4A). Meanwhile, the small subdomain of M5 rotates toward its large subdomain, allowing it to establish contacts with the small subdomain of M6 in the ‘closed state’ structure (Figure 1—figure supplement 4B). In the next step of translocation, M6 continues to move upward, assuming the M1 position (top position) in the open spiral, detaching fully from M5, which now becomes the new M6, occupying the bottom position. Consequently, the angle between the two subdomains of M5 widens, and the subunit resumes its original conformation as it reaches the M6 position (Figure 1—figure supplement 4B, C). Similar hinge motions between the two subdomains were observed previously: the crystal structure of the monomeric S.c. Msp1 showed a near 180-degree flip between the small and the large AAA domains and complete disruption of the nucleotide-binding pocket (Wohlever et al., 2017). It remained unclear, however, whether the flip resulted from crystal packing forces or reflected a functionally relevant conformational change. The hinge motion in ATAD1 observed here strongly argues that the two domains are connected by a flexible linker and undergo significant rotations relative to each other in a nucleotide- and subunit position-dependent manner.

A unique α-helix at the C-terminus mediates intersubunit interactions

While examining the interactions of the mobile subunit (M6) in the closed conformation, we noticed that it is held in place by contacts on both sides: on the side of M5, substantial contacts exist between the large and the small subdomains of the two subunits (Figure 1—figure supplement 4D). By contrast, on the side of M1, M6 is held in place by two contact points. One structural element stood out as it was not observed previously in the C.t. Msp1 structure (Wang et al., 2020): an α-helix at the extreme C-terminus of M6 points toward the core β sheet of the large subdomain of M1. We next asked whether this α-helix also mediates intersubunit contacts within the other subunits in the spiral. Indeed, slightly extended EM density for this α-helix exists in other subunits as well (Figures 1C and 2A). We modeled an α-helix (α11, amino acids 333–346) followed by a short turn (amino acids 347–351) into this density. Density beyond that (amino acids 352–361) was not clearly visible indicating its lack of rigid structure. A similar α-helix existed in the crystal structure of the monomeric S.c. Msp1 (Wohlever et al., 2017). However, the last few amino acids in that α-helix in the S.c. Msp1 were replaced by amino acids left from protease cleavage, making it difficult to interpret the original structure of this region.

Figure 2. Helix α11 resides at the intersubunit interface of ATAD1.

(A) Schematic showing the position of helix α11 within each ATAD1 subunit. ATAD1 subunits are colored as in Figure 1. α11 is shown in cartoon representation. Different from Figure 1, here, the cytosol-facing side (instead of the membrane-facing side) of ATAD1 is shown, thus the order of subunits from M1, M2 to M6 goes counterclockwise. (B) to (D) zoomed-in view of α11 interaction with the neighboring subunits. (E) Helical wheel showing the amphipathic property of α11. Hydrophobic amino acids are colored in orange, positive charged amino acids in blue, negative charged amino acids in red, and polar amino acids in purple.

Figure 2.

Figure 2—figure supplement 1. Helices α11 form an additional spiral staircase beneath pore-loop 3.

Figure 2—figure supplement 1.

Cartoon representation of Δ40-ATAD1E193Q (open) showing the multiple staircases formed by three pore-loops and α11 that surround the substrate. Pore-loops 1, 2, and 3 are colored in pink, yellow, and dark red, respectively. Helix α11 is colored in green and the substrate peptide in black.
Figure 2—figure supplement 2. ATAD1 possesses a unique helix at the C-terminus that is structured differently from those in other AAAMC proteins.

Figure 2—figure supplement 2.

Structures of different AAAMC proteins shown in cartoon representation. The cytosol-facing side is shown. The C-terminal helices of each protein subunit (α11 for ATAD1, and α11–α12 for the others) are colored as in Figure 1. The rest of the protein is colored in white. Whereas α11 of ATAD1 contacts the counterclockwise subunit, the α12 of katanin (PDB ID: 6UGE), Vps4 (PDB ID: 6AP1), and spastin (PDB ID: 6PEN) reach across the intersubunit interface and contacts the clockwise subunit.

In ATAD1’s helical assembly, six α11s form a staircase beneath pore-loop 3, which does not contact the substrate directly but forms an interconnected network with pore-loops 1 and 2 that directly engage the substrate (Figure 2—figure supplement 1). Zooming in on α11 reveals that it lies at the interface between two adjacent subunits (Figure 2A). It forms extensive contacts with both the rest of the subunit and the counterclockwise (when viewed from the cytosol-facing side, as shown in Figure 4) adjacent subunit, bridging between the two (Figure 2). In α11M4, for example, L336, A339, and I340 pack against the core of M4 (Figure 2A); M343 rests on the interface created by M4 and M5, and A349 points to a hydrophobic groove formed by pore-loop 3 of the M5. Finally, both the side chain and the backbone carbonyl of S346 form hydrogen bonds with R254 of M5 (Figure 2D). A few charged amino acids (R254, K342, K344, K345, K347, E341, and D348) point into the cytosol (Figure 2C and E).

Interestingly, other AAAMC proteins such as katanin, spastin, and Vps4 are structured differently in this region (Han et al., 2020; Han et al., 2017; Sandate et al., 2019; Shin et al., 2019). For those proteins, α11 is shorter (consisting of three helical turns instead of four as seen in ATAD1). It is followed by a loop and another short helix, α12, that reaches across the intersubunit interface to contact the clockwise adjacent subunit (Figure 2—figure supplement 2). α12 is functionally important as its deletion impacts oligomer assembly and protein function both in vitro and in vivo (Vajjhala et al., 2008). Since ATAD1 lacks α12, and instead has a longer α11, we hypothesized that α11 could also mediate hexamer assembly. If so, we expected that a mutant version might fail to remove mislocalized membrane proteins in cells lacking wild-type (WT) ATAD1, but be unable to poison WT ATAD1’s activity, as it would not be able to incorporate into WT hexamers. In other words, we expected it to display a recessive phenotype, rather than a dominant one. To test this notion, we next sought to establish an assay that distinguishes between dominant and recessive ATAD1 mutations and allows us to measure the activity of ATAD1 variants in a direct and quantifiable way.

Direct visualization and quantification of ATAD1’s activity in cells

One of ATAD1’s established substrates is Gos28, a Golgi-localized TA SNARE protein. In cells lacking functional ATAD1, Gos28 localizes to mitochondria (Chen et al., 2014). We thus sought to use the localization of Gos28 as a readout for ATAD1’s activity (Figure 3A). To analyze the activity of ATAD1 mutants in the absence of the WT enzyme, we deleted both alleles of ATAD1 in HeLa cells using CRISPR/Cas9 (Figure 3—figure supplement 1). We next stably expressed Gos28 with an N-terminal EGFP tag in the ATAD1-/- cells and used confocal microscopy to visualize the localization of EGFP-Gos28. In ATAD1-/- cells, we observed two populations of Gos28 molecules: one visualized as an extended perinuclear region characteristic of the Golgi apparatus and the other in a spread-out network (Figure 3B, top row). Overlap of the EGFP signal with the signal from the mitochondria stain, MitoTracker Deep Red, showed that the latter population corresponds to the mitochondrial network, indicating that in ATAD1-/- cells, a portion of EGFP-Gos28 molecules are mislocalized to mitochondria, in line with a previous study (Chen et al., 2014). We then expressed WT ATAD1 labeled with a C-terminal HaloTag in the ATAD1-/- cells (Figure 3B, middle row) and observed a prominent shift of EGFP-Gos28 signal toward a Golgi-like distribution, indicating that ATAD1 cleared mislocalized EGFP-Gos28 from the mitochondria. Finally, we expressed the ATAD1 bearing a mutation that inactivates its ATPase activity, ATAD1E193Q. The result mimicked the localization pattern seen in the ATAD1-/- cells (Figure 3B, top row), indicating that the ability of clearing mislocalized EGFP-Gos28 was dependent on ATAD1’s enzymatic activity. We similarly observed ATAD1-dependent removal of mistargeted Pex26, a peroxisomal TA protein (Matsumoto et al., 2003), from mitochondria, suggesting that monitoring the clearance of a mislocalized protein is a reliable method to examine ATAD1-dependent TA protein extraction (Figure 3—figure supplement 2).

Figure 3. Microscopy assay allows for the direct measurement and quantification of ATAD1’s activity.

(A) Model for ATAD1-depedent extraction of Gos28: in cells expressing a functional ATAD1 (left panel), mislocalized Gos28 on the mitochondrial outer membrane (MOM) is extracted by ATAD1 and given a second chance to return to the Golgi apparatus. In cells expressing a dysfunctional ATAD1 (right panel), Gos28 accumulates on the MOM. (B) Representative average intensity projection images of live HeLa ATAD1-/- cells stably expressing EGFP-Gos28 (green channel) and transiently expressing empty vector (top row), ATAD1-HaloTag (middle row), and ATAD1(E193Q)-HaloTag (bottom row). Mitochondria are stained with MitoTracker (red channel). The individual channels are shown in black and white, and overlay of the EGFP and the MitoTracker channels are shown in the right-most column with Hoechst-stained nuclei in blue. Insets are included to better show the absence or presence of colocalization between EGFP-Gos28 and the mitochondria. (C) Workflow of the CellProfiler pipeline for measuring EGFP-Gos28 mislocalization. (D) Mean Pearson correlation coefficient (PCC) values and the SEM between EGFP-Gos28 and the mitochondria when expressing the indicated construct. Individual cell PCC values are represented as a single dot. Significance values were calculated using the Mann-Whitney test. ****p<0.0001. Figure 3—source data 1 describes the data analysis pipeline and the raw image files used in this pipeline are available on Dryad.

Figure 3—source data 1. Data analysis pipeline for live-cell imaging results.

Figure 3.

Figure 3—figure supplement 1. Verification of ATAD1 knockout by Western blot.

Figure 3—figure supplement 1.

Representative western on total protein extracts prepared from wild-type HeLa cells (left lane) and ATAD1-/- HeLa cells (right lane). Knockout of ATAD1 was shown by the absence of ATAD1 signal (41 kDa). Histone H3 (17 kDA) served as the loading control.
Figure 3—figure supplement 2. Live-cell imaging showing the ATAD1-dependent localization of EGFP-Pex26.

Figure 3—figure supplement 2.

Representative average intensity projection images of live HeLa ATAD1-/- cells stably expressing EGFP-Pex26 (top row) and transiently expressing ATAD1-HaloTag (bottom row). Mitochondria are stained with MitoTracker red. The individual channels are shown in black and white, and overlay of the EGFP and the MitoTracker red channels are shown in the right-most column with Hoechst-stained nuclei in blue.
Figure 3—figure supplement 3. Live-cell imaging showing the ATAD1-dependent localization of EGFP-Gos28 in wild-type (WT) HeLa cells.

Figure 3—figure supplement 3.

Representative average intensity projection images of live WT HeLa cells stably expressing EGFP-Gos28 (green channel) and transiently expressing empty vector (top row), ATAD1-HaloTag (middle row), and ATAD1(E193Q)-HaloTag (bottom row). Mitochondria are stained with MitoTracker (red channel). The individual channels are shown in black and white, and overlay of the EGFP and the MitoTracker channels are shown in the right-most column with Hoechst-stained nuclei in blue. Insets are included to better show the absence or presence of colocalization between EGFP-Gos28 and the mitochondria.

In addition to expressing the reporter in the ATAD1-/- cell line, we stably expressed Gos28 in a WT HeLa cell line. We expected ATAD1 variants that impact its ability to form proper oligomers to induce Gos28 mislocalization in the ATAD1-/- cell line, but not in the WT cell line. By contrast, inactive ATAD1 variants that retain their ability to assemble into hexamers should act as dominant inhibitors of the enzyme and induce substrate mislocalization.

To test the reliability of the system, we first expressed a known dominant-negative mutant, ATAD1E193Q, within the WT reporter cells (Figure 3—figure supplement 3). Expression of ATAD1E193Q induced mislocalization of EGFP-Gos28 to mitochondria, indicating that ATAD1E193Q was incorporated into hexamers, poisoning WT activity. As expected, expression of the WT ATAD1 or an empty vector did not induce EGFP-Gos28 mislocalization in this background.

Before proceeding to test the function of α11, we wanted to see if we could quantify the degree of EGFP-Gos28 mislocalization in an unbiased fashion and use it as a readout for ATAD1’s activity. To this end, we developed a data analysis pipeline using CellProfiler (McQuin et al., 2018; Figure 3C, Figure 3—source data 1). In brief, we first identified cells expressing ATAD1-HaloTag, using the cell-permeable JF549 dye (Grimm et al., 2017) to label and visualize Halo-tagged ATAD1. We then measured the colocalization of EGFP-Gos28 and mitochondria (stained with MitoTracker) in ATAD1-expressing cells using the Pearson correlation coefficient (PCC) as the metric, measured between the two channels for each cell (Figure 3D). As shown in Figure 3D, expression of an empty vector or ATAD1E193Q in the ATAD1-/- reporter cell line led to a PCC of 0.31±0.022 and 0.31±0.017, respectively. By contrast, transiently expressing WT ATAD1 showed a significantly lower PCC of 0.13±0.015 (p<0.0001), confirming the visually evident changes in EFGP-Gos28 localization and validating this approach for the evaluation of functional mutants of ATAD1.

With the EGFP-Gos28 reporter assay established in both an ATAD1-/- background and a WT background, we next used it to test α11’s function. To this end, we made two truncated versions of ATAD1: one in which we deleted 30 amino acids at the C-terminus (removing α11 and everything C-terminal to it, ATAD1Δα11, Figure 1C), and another in which we kept α11 and removed everything C-terminal to it (ATAD11-351, Figure 1C). We first expressed these variants in the ATAD1-/- cells. As shown in Figure 4A, EFGP-Gos28 showed significant mislocalization to mitochondria in cells expressing ATAD1Δα11 but not ATAD11-351, suggesting that the α11 helix is required for its function. By contrast, when expressed in the WT cells, ATAD1Δα11 did not induce significant mislocalization of EGFP-Gos28 (Figure 4B), indicating its recessive phenotype, that is, its lack of incorporation into and inactivating the WT hexamers present in these cells (the average values for the biological replicates are shown in Figure 4—figure supplement 1A and B). While expression of ATAD1Δα11 did not induce substrate mislocalization on average, it was evident by eye that a small population of WT cells expressing ATAD1Δα11 showed EGFP-Gos28 mislocalization (Figure 4—figure supplement 2A). We assume that this effect resulted from high ATAD1Δα11 expression in these outlier cells that compensated for ATAD1Δα11’s reduced oligomerization ability and allowed assembly into WT hexamers. Indeed, we observed a positive correlation between ATAD1Δα11 expression level and the degree of Gos28 mislocalization: cells that expressed more ATAD1Δα11 showed a higher degree of Gos28 mislocalization (Figure 4—figure supplement 2B), suggesting that ATAD1Δα11 incorporated into WT hexamers and inactivated them, or that the ATAD1Δα11 subunits prevented the WT enzyme from forming stable hexamers. These data combined showed that α11 plays an important role in both subunit oligomerization and hexamer function.

Figure 4. Helix α11 mediates hexamer assembly.

(A) Mean Pearson correlation coefficient (PCC) values and the SEM between EGFP-Gos28 and the mitochondria in ATAD1-/- HeLa cells, transiently expressing controls or the ATAD1Δα11 mutant. (B) Mean PCC values and the SEM between EGFP-Gos28 and the mitochondria in wild-type (WT) HeLa cells, transiently expressing controls or the ATAD1Δα11 mutant. Significance values were calculated using the Mann-Whitney test. *p<0.05, ****p<0.0001. The raw image files used for this analysis are available on Dryad. (C) Fluorescence polarization assay showing the different peptide-binding abilities of the Δ40-ATAD1 (WT) versus Δ40-ATAD1Δα11 (Δα11). ATAD1 concentrations are expressed as hexamer concentrations. Each dot represents an average of two replicates and the error bar represents SEM.

Figure 4.

Figure 4—figure supplement 1. Reproducibility of EGFP-Gos28 mislocalization in live-cell imaging with expression of ATAD1Δα11.

Figure 4—figure supplement 1.

Mean Pearson correlation coefficient (PCC) values derived from the localization pipeline from each biological replicate were plotted for each mutant in (A) ATAD-/- HeLa cells and (B) wild-type (WT) HeLa cells. Each dot represents a biological replicate, with an average of 47 cells per replicate.
Figure 4—figure supplement 2. ATAD1Δα11 expression level impacts substrate mislocalization in wild-type (WT) HeLa cells.

Figure 4—figure supplement 2.

(A) Representative average intensity projection images of live WT HeLa cells stably expressing EGFP-Gos28 and transiently expressing ATAD1Δα11-HaloTag. EGFP-Gos28 was only seen on the Golgi apparatus (bottom row). However, a small population of cells (top row) showed mislocalization of EGFP-Gos28 to the mitochondria. These cells also had a higher level of ATAD1Δα11-HaloTag expression (the Pearson correlation coefficient [PCC] of cells shown in the images are indicated in panel B by arrows of matching colors). (B) The expression level of ATAD1Δα11 was plotted against the PCC for each cell. Linear regression analysis was preformed and there was a significant positive correlation between the two variables (p<0.0001).
Figure 4—figure supplement 3. Size exclusion chromatography (SEC) of Δ40-ATAD1 and Δ40-ATAD1Δα11.

Figure 4—figure supplement 3.

The SEC traces of Δ40-ATAD1 (wild-type [WT]) and Δ40-ATAD1Δα11 (Δα11) show that the former forms oligomeric species on the SEC column while the latter is predominantly a monomer. The SEC trace of Δ40-ATAD1 is shown in a red line, and the SEC trace of Δ40-ATAD1Δα11 in a blue curve.
Figure 4—figure supplement 4. Testing the effect of the disease-relevant mutations of ATAD1.

Figure 4—figure supplement 4.

(A) Mean Pearson correlation coefficient (PCC) values and the SEM between EGFP-Gos28 and the mitochondria when expressing the ATAD1 bearing disease-relevant mutations. Individual cell PCC values are represented as a single dot. Significance values were calculated using the Mann-Whitney test. ****p<0.0001, *p<0.05. The raw image files used for this analysis are available on Dryad. (B) Mean PCC values derived from the localization pipeline from each biological replicate were plotted for each mutant in ATAD-/- HeLa cells. Each dot represents a biological replicate, with an average of 43 cells per replicate. (C) Representative average intensity projection images of live HeLa ATAD1-/- cells stably expressing EGFP-Gos28 and transiently expressing ATAD1 mutants (as indicated on the far-left panel). The individual channels are shown in black and white, and overlay of the EGFP and the MitoTracker channels are shown in the right-most column with Hoechst-stained nuclei in blue.
Figure 4—figure supplement 5. ATPase assay of Δ40-ATAD1 and Δ40-ATAD1Δα11.

Figure 4—figure supplement 5.

(A) Representative ATPase assay showing that the ATPase activity of Δ40-ATAD1 (wild-type [WT]) is stimulated by the substrate (P13) whereas Δ40-ATAD1Δα11 (Δα11) is not. (B) Quantification of panel (A). Each bar represents an average of three replicates and the error bar represents the SD. **p<0.01.

To further establish α11’s impact on ATAD1 oligomerization, we examined the elution profile of recombinantly expressed ATAD1 with and without the C-terminal helix. To this end, we purified the cytosolic domain of ATAD1 lacking the α11 helix (Δ40-ATAD1Δα11). On size exclusion, Δ40-ATAD1Δα11 eluted exclusively as a monomer. At similar concentrations, Δ40-ATAD1 formed oligomers (Figure 4—figure supplement 3), indicating that α11 mediates oligomerization in vitro. To evaluate the functional impact of a defect in hexamer formation, we next asked if the ability to bind a peptide substrate was affected for Δ40-ATAD1Δα11. To this end, we sought to identify a peptide that binds ATAD1. First, we designed a peptide array by stepping through ATAD1’s known substrates and measured the binding of individual peptides to ATAD1. We picked a few peptides that showed the strongest binding and tested their affinity to ATAD1 in solution using fluorescence polarization. Out of this group, a peptide (P13) that is derived from the sequence of the C-terminus of Pex26 (an established ATAD1 substrate) emerged as the strongest binder, which we then used to test the effect of truncating α11 on ATAD1’s substrate-binding affinity. As expected and consistent with its inability to form hexamers, Δ40-ATAD1Δα11 also showed substantially reduced peptide-binding affinity (Figure 4C).

Several disease-related mutations are close to the α11 region at the C-terminus (see Introduction). We tested these ATAD1 variants using our imaging assay to assess if their ability to remove mislocalized TA proteins would be impacted. Out of the variants tested, the E267stop variant impacted ATAD1’s function significantly, whereas the other variants (H357Rfs*15, D221H, R9H, and E290K) displayed WT-like phenotypes (Figure 4—figure supplement 4). These results indicate that the mechanism that underlies neurological disorders may be separate from the extraction of Gos28.

As previously mentioned, α11 packs against pore-loop 3 from the adjacent subunit and constitutes the additional layer of the interconnected network involving three pore-loops (Figure 2—figure supplement 1). The fact that it lies at the oligomerization interface and also contacts pore-loop 3 prompted us to ask whether α11 could couple oligomerization with substrate binding. Given that oligomerization usually enhances the ATPase activity of AAA proteins, we sought to measure the ATPase activity of Δ40-ATAD1 and Δ40-ATAD1Δα11 and asked whether the activities can be stimulated by the addition of substrate. As shown in Figure 4—figure supplement 5, Δ40-ATAD1Δα11 displays a much lower ATPase activity compared to Δ40-ATAD1, indicating the lack of functional hexamers. With the addition of a peptide substrate (P13), the activity of Δ40-ATAD1 is stimulated by around 41%, whereas no significant stimulation was observed for Δ40-ATAD1Δα11 (Figure 4—figure supplement 5). This results suggest that Δ40-ATAD1Δα11’s ability to oligomerize is significantly impacted and the addition of a substrate is not able to bring the monomeric subunits into a functional oligomeric form. Having examined the oligomer interface in detail, we next examined the substrate interactions within the central pore.

The highly aromatic central pore of ATAD1 is crucial for substrate binding and extraction

Upon building all of ATAD1’s amino acids into the EM density, we observed a piece of density in the central pore that resembles a linear peptide in both the closed and the open state structures. This density likely represents a composite of peptides that co-purified with ATAD1 from Escherichia coli. The side chain density was clearly visible, and we modeled the peptide as a 10-mer polyalanine. A peptide in the corresponding position was also observed in the Msp1 structures (Wang et al., 2020), suggesting the proteins’ high affinity for their substrates.

Like for Msp1, six ATAD1 subunits tightly surround the peptide in the central pore. As summarized in the introduction, amino acids used by ATAD1 to contact the substrate are phylogenetically conserved within the Msp1/ATAD1 family, but differ from other AAA proteins. Each ATAD1 subunit extends two short loops containing three aromatic amino acids to engage the substrate peptide (Figure 1D and E). Six pore-loops 1 form a spiral staircase surrounding the peptide substrate. Pore-loop 1 is comprised of a conserved KX1X2G motif, where X1 is a tryptophan (W166) and X2 a tyrosine (Y167). Both aromatic amino acids intercalate into the side chains of the translocating peptide (Figure 1D), holding it in place. Below pore-loop 1 is a second staircase formed by pore-loops 2, which use a histidine (H206) to contact the backbone of the substrate (Figure 1E). By contrast, in most other known AAA proteins, the X1 position within pore-loop 1 is an aromatic amino acid, and the X2 position is an aliphatic amino acid that does not contact the substrate. Also, their pore-loops 2 usually do not contact the substrate directly.

Multiple aromatic amino acids in the central pore are essential for ATAD1’s function

We next revisited our hypothesis that ATAD1 function, like Msp1 function, necessitates engagement of multiple aromatic amino acids in its central pore. To this end, we tested the effect of pore-loop mutations in the ATAD1-/- EGFP-Gos28 reporter cell line (Figure 5A) using our cell-based assay. Expression of ATAD1 bearing either the W166A (the first aromatic amino acid in pore-loop 1) or Y167A (the second aromatic amino acid in pore-loop 1) mutation led to significant mislocalization of EGFP-Gos28, suggesting that these mutations inactivate ATAD1. By contrast, expression of the aromatic mutant Y167F cleared Gos28 from mitochondria, indicating functional ATAD1, which is consistent with what we observed for Msp1. Interestingly, changing W166 or Y167 to an aliphatic amino impacted ATAD1’s activity: ATAD1W166V, ATAD1Y167V, and ATAD1 Y167L were inactive. The activity of ATAD1W166L was also impacted, albeit to a lesser degree (Figure 5A, Figure 5—figure supplements 1 and 2), supporting the notion that the aromaticity of this position is important. This observation, namely that an aliphatic amino acid did not functionally replace the aromatic amino acid in this position, contrasts with our data from corresponding mutations in Msp1 in the yeast growth assay (Wang et al., 2020), suggesting either a better sensitivity of the microscopy-based assay or an inherit difference between the yeast and the mammalian system. We also tested the effect of mutations on H206 (pore-loop 2) in our assay. While our structural data clearly showed an interaction between H206 and the substrate backbone, mutations in this position did not impact the function of ATAD1 in this context.

Figure 5. Pore-loop 1 aromatic amino acids are important for ATAD1’s function both in vivo and in vitro.

(A) Mean Pearson correlation coefficient (PCC) values and the SEM between EGFP-Gos28 and the mitochondria in cells expressing ATAD1 variants. Individual cell PCC values are represented as a single dot. Significance values were calculated relative to the wild-type (WT) condition using the Mann-Whitney test. **p<0.01, ****p<0.0001. The raw image files used for this analysis are available on Dryad. (B) Different ATAD1 variants’ peptide-binding abilities as measured by fluorescence polarization. ATAD1 concentrations are expressed as hexamer concentrations. Here, wild-type (WT) refers to Δ40-ATAD1, and each mutant refers to Δ40-ATAD1 bearing that mutation. Each dot represents the average of two replicates, and the error bar represents the SEM.

Figure 5.

Figure 5—figure supplement 1. Live-cell imaging showing the pore-loop dependent localization of EGFP-Gos28 in ATAD1-/- HeLa cells.

Figure 5—figure supplement 1.

Representative average intensity projection images of live HeLa ATAD1-/- cells stably expressing EGFP-Gos28 and transiently expressing ATAD1-HaloTag pore-loop mutants (as indicated on the far-left panel). The individual channels are shown in black and white, and overlay of the EGFP and the MitoTracker channels are shown in the right-most column with Hoechst-stained nuclei in blue.
Figure 5—figure supplement 2. Reproducibility of EGFP-Gos28 mislocalization in live-cell imaging with expression of pore-loop mutants.

Figure 5—figure supplement 2.

Mean Pearson correlation coefficient (PCC) values derived from the localization pipeline from each biological replicate were plotted for each pore-loop mutant in ATAD-/- HeLa cells. Each dot represents a biological replicate, with an average of 50 cells per replicate.

Having established the functional importance of the pore-loop 1 side chains in substrate extraction, we further examined their specific impact on ATAD1’s ability to bind a substrate in vitro. Consistent with the cell-based assay, ATAD1W166A, ATAD1W166V, ATAD1W166L, ATAD1Y166A, and ATAD1Y167V showed dramatically reduced (estimated >100-fold) binding to P13 compared to WT ATAD1. Both ATAD1H206A and ATAD1Y167F showed WT-like activities in the cell-based assay, but bound P13 with much weaker affinity than the WT enzyme in this assay. We reasoned that this difference arose either because the in vitro assay is more sensitive to small changes in activity that cell-based assays fail to capture, or because a different substrate was used in the cell-based assay (Gos28) than in the in vitro binding assay (P13, derived from Pex26). Taken together, the in vitro peptide-binding results, implications from the structure, and the cell-based assay all converge on the conclusion that the aromaticity of the second amino acid in pore-loop 1 is important for ATAD1’s function.

Discussion

In this work, we present the cryo-EM structures of the soluble domain of the mitochondrial AAA protein ATAD1 in complex with a peptide substrate. Our structures show that the overall architecture of ATAD1 is very similar to that of its yeast homolog Msp1. ATAD1’s architecture fully agrees with the conserved mechanism of hand-over-hand spiral propagation established for many AAA proteins in substrate translocation. We also discovered a distinct structural element, helix α11, that was present but remained structurally unresolved in Msp1, which differentiates ATAD1/Msp1 from other AAAMC proteins. Multiple lines of evidence including cell-based mislocalization, substrate binding, and ATPase activity all suggest that α11 is required for the formation of functional oligomers. Although we do not know why it is structured differently than the other AAAMC proteins (which adopt an α11–α12 organization), one possibility is that α11 is useful in adaptor interaction. In particular, yeast Msp1 docks to the proteosome to channel its substrate directly for degradation (Basch et al., 2020). Another study showed that during mitochondrial import stress, Msp1 is recruited to the TOM complex by the adaptor Cis1 to remove precursor proteins stuck in the TOM translocase (Weidberg and Amon, 2018). We reason that structural elements facing the cytosolic side of Msp1/ATAD1 (such as α11) may be evolutionarily adapted to interact with these factors. In this view, the α11–α12 organizational differences in different AAAMC protein subfamilies may have evolved to suit their specialized functions, such as binding to microtubules and ESCRT proteins for katanin and Vps4, respectively. This view is supported by the fact that ATAD1/Msp1 occupy the basal position in the evolutionary tree of this clade, and the other members (katanin, spastin, and Vps4) share a common evolutionary ancestor (Frickey and Lupas, 2004).

The cell-based imaging assay allowed us to directly quantify ATAD1-dependent substrate mislocalization and thereby revisit a hypothesis raised in the previous study (Wang et al., 2020) on the functional importance of the pore-loop amino acids. The notion that aromaticity of pore-loop/substrate-interacting side chains is important is supported by single molecule force measurements of other AAA protein translocases. A study on the bacterial AAA proteins ClpXP (Rodriguez-Aliaga et al., 2016), for example, showed that the flat, bulkier pore-loop amino acids give the protein a stronger grip, that is higher coupling efficiency between ATP hydrolysis and substrate unfolding, yet are compromised in the rate of substrate translocation (measured as protein unfolding with ClpXP). Given ATAD1’s function is to extract hydrophobic membrane proteins from the lipid membrane, having a tighter grip on the substrate may be important, even if it comes at the cost of a slower translocation speed. Similar to ATAD1, Cdc48, a protein that removes misfolded membrane proteins from the ER membrane, also possesses two aromatic amino acids in its pore-loop 1 (Cooney et al., 2019; Twomey et al., 2019), suggesting that the additional aromatic amino acids in the central pore evolved to aid in the removal of membrane proteins.

To conclude, while ATAD1/Msp1 utilize a conceptually similar mechanism for substrate translocation as many other AAA proteins, the high conservation of several unique features between ATAD1 and Msp1 suggests that evolution fine-tuned these enzymes early in eukaryotic cell evolution for their special role in membrane protein extraction and protein quality control. The phylogenetic comparison of structure and function, and the complementary experimental opportunities afforded by structural and cell-level analysis, allowed us to extract hints regarding important functional principles and assess their generality over a wide span of evolutionary time. The neurological phenotypes associated with a number of ATAD1 mutations still remain poorly understood, yet they serve to underscore the importance of proteostasis in human physiology and raise hope that understanding these principles may help to develop new treatments for combating devastating pathological dysfunctions arising from proteostasis imbalances.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene
(Homo sapiens)
ATAD1 IDT For human expression
Gene
(Homo sapiens)
ATAD1 IDT Codon-optimized for E. coli expression
Gene
(Homo sapiens)
EGFP-GOS28 TwistBioscience
Gene
(Homo sapiens)
EGFP-PEX26 TwistBioscience
Strain, strain background (Escherichia coli) BL21(DE3) Life Technologies Cat# C601003
Cell line (Homo sapiens) HeLa ATCC
Cell line (Homo sapiens) HeLa,
ATAD1KO
Synthego
Antibody Anti-ATAD1 (Mouse, monoclonal) NeuroMab Cat#
N125/10
WB (1:500)
Antibody Anti-Histone H3 (Rabbit, polyclonal) Abcam Cat# ab1791 WB (1:1500)
Recombinant DNA reagent 6xHis-thrombin-ATAD1E193Q (plasmid) This paper Materials and methods section ‘Molecular cloning’
Recombinant DNA reagent CMVd3-ATAD1-HaloTag This paper Materials and methods section ‘Molecular cloning’
Recombinant DNA reagent CMV-GOS28-EGFP This paper Materials and methods section ‘Molecular cloning’
Recombinant DNA reagent CMV-PEX26-EGFP This paper Materials and methods section ‘Molecular cloning’
Peptide, recombinant protein P13 GenScript 5-FAM-FSRLYQLRIR
Commercial assay or kit In-Fusion Snap Assembly Master Mix Takaro Bio Cat# 638948
Commercial assay or kit QuikChange II XL Site-Directed Mutagenesis Kit Agilent Cat#
200521
Chemical compound, drug Janelia Fluor 549 dye Janelia Fluor Dyes Gift of Dr Luke Lavis
Chemical compound, drug MitoTracker Deep Red FM Life Technologies Cat# M22426
Chemical compound, drug Hoechst 33342 Life Technologies Cat# H1399
Software, algorithm CellProfiler 4.0.5 https://doi.org/10.1371/journal.pbio.2005970
Software, algorithm MotionCor2 PMID:28250466 RRID: SCR_016499
Software, algorithm Relion PMID:23000701 RRID: SCR_016274
Software, algorithm CryoSPARC PMID:28165473 RRID: SCR_016501
Software, algorithm UCSF Chimera PMID:15264254 RRID: SCR_004097
Software, algorithm GCTF PMID:26592709 RRID: SCR_016500
Software, algorithm Phenix PMID:20124702 RRID: SCR_014224
Software, algorithm Coot PMID:20383002 RRID: SCR_014222

Molecular cloning

To generate the construct used for cryo-EM studies, the gene encoding the cytosolic domain of human Δ40-ATAD1 was PCR amplified and subcloned into a pET28 vector encoding an N-terminal 6xHis tag followed by a thrombin cleavage site. The Walker B mutation (E214Q) was introduced by QuickChange site-directed mutagenesis. To generate the constructs used for imaging, the gene blocks for the human ATAD1 was synthesized by IDT; the gene blocks for Gos28 and Pex26 were synthesized by Twist Bioscience. Gos28 or Pex26 was C-terminally fused to EGFP and cloned downstream of a CMV promoter within a lentivirus production vector. ATAD1 was N-terminally fused to HaloTag and cloned downstream of a truncated CMV promoter (CMVd3) for transient transfections. Mutations to ATAD1 were made by QuickChange site-directed mutagenesis. All the constructs are verified by Sanger sequencing.

Protein purification

His-Δ40-ATAD1E193Q was expressed and purified as previously described for His-Δ30-Msp1E214Q (Wang et al., 2020).

Sample preparation of cryo-EM

His-Δ40-ATAD1E193Q was diluted to around 100 μM in buffer containing 25 mM HEPES pH 7.5, 300 mM NaCl, 1 mM DTT, 2.5% glycerol, 2 mM ATP, and 2 mM MgCl2. The sample was incubated on ice for 1–2 hr before plunge freezing. A 3 µl aliquot of the sample were applied onto the Quantifoil R 1.2/1/3 400 mesh Gold grid and incubated for 15 s. A 0.5 µl aliquot of 0.1–0.2% Nonidet P-40 substitutes was added immediately before blotting. The entire blotting procedure was performed using Vitrobot Mark IV (FEI) at 10°C and 100% humidity.

EM data collection

Cryo-EM data was collected on a Titan Krios transmission electron microscope operating at 300 keV and micrographs were acquired using a Gatan K3 summit direct electron detector. The total dose was 60 e-2, fractioned over 100 frames during a 10 s exposure. Data was collected at 105,000× nominal magnification (0.832 Å/pixel at the specimen level) and nominal defocus range of –1.0 to –2.0 µm.

Cryo-EM data analysis

Micrograph frames were aligned using MotionCorr2. The contrast transfer function (CTF) parameters were estimated with GCTF (Zhang, 2016). Particles were automatically picked using Gautomatch and extracted in RELION (Scheres, 2012) using a 320-pixel box size. Images were down-sampled to a pixel size of 3.328 Å and classified in 2D in RELION. Classes that showed clear protein features were selected and extracted with re-centering and then subjected to 3D classification. Particles from the best class emerging from 3D classification were then subjected to 2D classification followed by another round of 3D classification to further purify the particles. Particles that showed clear hexameric features were then re-extracted (pixel size = 0.832 Å/pixel) and imported into cryoSPARC (Punjani et al., 2017). Within cryoSPARC, particles were subjected to another round of 2D classification followed by heterogenous refinement, from which two distinct conformations (the open versus the closed conformations) were discovered. CTF refinement followed by nonuniform refinement was performed on both conformations to yield final reconstructions of at 3.2 and 3.5 Å, for the closed and the open conformations. The final reconstructed maps are deposited into the EMDB under the accession codes EMD-26674 (closed conformation) and EMD-26675 (open conformation).

Atomic model building and refinement

Model building and refinement was done in a similar way as previously described (Wang et al., 2020). Briefly, the big and the small AAA domain of the crystal structure of the monomeric S.c. Msp1 (Wohlever et al., 2017) was used to generate the predicted structures of the human ATAD1 in SWISS-MODEL (Waterhouse et al., 2018). The six big AAA domains and the six small AAA domains were individually docked into the map of His-Δ40-ATAD1E193Q in UCSF Chimera (Pettersen et al., 2004) using the Fit in Map function. The resulting model was subjected to rigid body refinement in Phenix (Adams et al., 2010), followed by real space refinement in Coot (Emsley et al., 2010). After the protein part has been modeled, a piece of continuous density was left in the central pore, into which we modeled a polyalanine sequence. Significant density was visible in the nucleotide-binding pockets within subunits M1 through M5, and an ATP molecule was modeled into that density. For the M6 subunit, in the open conformation the density there was not clear enough to distinguish between ATP and ADP, so although an ADP molecule was modeled, we indicated in Figure 1 that it could be either. In the closed conformation, no significant density was observed in the nucleotide-binding pocket. The figures displaying structures were prepared with UCSF Chimera. The final models are deposited into the protein data bank (PDB) under the accession codes 7UPR (closed conformation) and 7UPT (open conformation).

Fluorescence polarization

All fluorescence polarization experiments were done in the FP assay buffer containing 25 mM HEPES (pH 7.5), 150 mM KCl, 2 mM MgCl2, 1 mM DTT, and 2 mM ATPγS, and measured in 384-well non-stick black plates using ClarioStar PLUS (BMG LabTech) at room temperature. Prior to the reaction setup, ATAD1 was diluted in twofold dilution series and incubated with 100 nM fluorescently labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 min at room temperature. Then, the mixture was subjected to measurement of parallel and perpendicular intensities (excitation: 482 nm, emission: 530 nm). Data was plotted using GraphPad Prism 8.

ATPase assay

ATPase activity of ATAD1 was measured using the oxidation of NADH as a readout of ATP hydrolysis. An enzyme mixture containing 0.2 mM NADH, 1 mM phosphoenol-pyruvate (PEP), 50 U/ml of pyruvate kinase, and lactate dehydrogenase was added to the wells of a 384-well black plate (Corning). Ten μM ATAD1, assay buffer (25 mM HEPES pH 7.5, 100 mM KCl, 2 mM MgCl2, 10 μM BSA, 0.05% Tween-20), and either 50 μM of the unlabeled version of P13 peptide (FSRLYQLRIR) or a blank was added to the enzyme mixture. Samples were incubated for 20 min at 37°C before 1 mM ATP was added to start the reactions. Absorbance at 340 nm was measured every 15 s for a total of 60 min using the CLARIOstar Plus (BMG LabTech) microplate reader. Data was plotted using GraphPad Prism 8.

Cell culture and transduction

HeLa cells were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin/streptomycin, and 6 mM L-glutamine. A pooled ATAD1-/- cell population was generated by Synthego with a guide RNA targeting Exon 5 (CGGUCAGUGUCGAAGGCUGA). Monoclonal populations were obtained using limiting dilution in a 96-well plate and expanding single cell populations into a six-well plates. Knockouts were confirmed by Sanger sequencing and Western blotting using anti-ATAD1 antibody (N125/10, NeuroMab) and anti-Histone H3 (ab1791, Abcam) as a loading control. WT HeLa cells are from ATCC. HeLa cells with ATAD1 knockout (pooled) comes from Synthego. Both cell lines test negative for mycoplasma.

WT HeLa and ATAD1-/- HeLa cell lines expressing the reporter EGFP-Gos28 were generated by lentiviral infection. In brief, vesicular stomatitis virus (VSV)-G pseudotyped lentiviral particles were produced in 293METR packaging cells (kind gift of Brian Ravinovich, formerly at MD Anderson Cancer Center, Camden, NJ) using standard protocols. WT and ATAD1-/- HeLa cells were infected with concentrated virus (supplemented with 8 μg/ml polybrene) by centrifugal inoculation at 2000 rpm for 2 hr. Viral supernatant was removed following overnight incubation and cells were expanded for FACS. EGFP-positive cells were sorted using SONY SH800 FACS into high and low EGFP-expressing populations. For all imaging experiments, the population that has high EGFP expression was used.

EGFP-Gos28 imaging

Expression of the ATAD1 variants in the cell-based assay was done through transient transfections. The day before transfections, cells were seeded on Ibidi 8-well glass bottom µ-slides in FluoroBrite DMEM (Life Technologies) media supplemented with glutamine and 10% FBS. Plasmids with the ATAD1 variants under a truncated CMVd3 promoter were transfected into cells using the FuGENE HD transfection reagent (Promega), following the manufacturer’s protocol. Cells were incubated for 48 hr before imaging. For visualizing cell structures, nuclei were stained with Hoechst 33342 and mitochondria were stained with MitoTracker Deep Red FM (ThermoFisher). Transfected cells were stained with 25 nM Janelia Fluor 549 dye conjugated with the HaloTag ligand (JF549-HaloTag; kind gift of Dr Luke Lavis). Cells were incubated with the dyes for 15 min at 37°C followed by three washes with FluoroBrite DMEM media.

Microscopy

Confocal imaging was carried out on a Nikon Ti-E inverted microscope equipped with a Yokogawa CSU-X high-speed confocal scanner unit and an Andor iXon 512×512 EMCCD camera. All images were acquired through a 40×1.3 NA oil immersion objective. Images were typically acquired with 60×EM gain and 100 ms exposure. The four lasers used were 405 nm (operated at 10 mW), 488 nm (operated at 25 mW), 561 nm (operated at 25 mW), and 640 nm (operated at 15 mW). All components of the microscope were controlled by the μManager open-source platform (Edelstein et al., 2010). The microscope stage was enclosed in a custom-built incubator that maintained preset temperature and CO2 levels for prolonged live-imaging experiments. To avoid unintentional selection bias, fields-of-view were selected by only looking at stained cell nuclei in the 405 nm channel. No cells or fields-of-view were subsequently excluded from analysis, ensuring that the data faithfully capture the distribution of fluorescence across the entire cell population.

Image quantification with CellProfiler

For each experiment, 15 fields-of-view were imaged per condition with an average number around 50 cells total. Average intensity z-projections were made for each image in each of the four channels and used as the input for the CellProfiler pipeline (McQuin et al., 2018). For automated image analysis, we developed a pipeline in CellProfiler 4.0.5. First, the images were background-corrected in every channel. Then, nuclei were identified as starting points for the propagation of cell body masks. Cells in which integrated ATAD1 signal (labeled with the JF549-HaloTag dye) passed a manually chosen threshold were identified as ATAD-positive cells. Integrated ATAD1 signal intensity was used as a proxy for ATAD1 expression level in each given cell. Within those cells, the MitoTracker signal was used to create a pseudo-cell boundary mask, closing all gaps. This serves as a reasonably good proxy for total cell area because the mitochondrial network is broadly distributed throughout HeLa cells. Measurements for colocalization were made inside this mask and outside of the nucleus. PCCs were calculated for each individual cell by performing a pixel-wise comparison of the EGFP and MitoTracker channels. The data analysis pipeline is described in Figure 3—source data 1.

Acknowledgements

We thank the Walter lab for helpful discussions throughout the course of this project; H Zhou and Z Yu of the Cryo-EM facility at the HHMI Janelia Research Campus. We thank the QB3 shared cluster for computational support. We also thank Hehua, and Obie for their constant support throughout this project. This work was supported by the National Institutes of Health (R01GM032384). Lan Wang is a Damon Runyon Cancer Research Foundation fellow supported by the Damon Runyon Cancer Research Foundation (DRG-2312-17), Vladislav Belyy is a Damon Runyon Fellow supported by the Damon Runyon Cancer Research Foundation (DRG-2284-17), and Peter Walter is an Investigator of the Howard Hughes Medical Institute.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Lan Wang, Email: lan@walterlab.ucsf.edu.

Peter Walter, Email: pwalter@altoslabs.com.

Franz-Ulrich Hartl, Max Planck Institute for Biochemistry, Germany.

Volker Dötsch, Goethe University, Germany.

Funding Information

This paper was supported by the following grants:

  • National Institutes of Health R01GM032384 to Lan Wang, Hannah Toutkoushian, Vladislav Belyy, Peter Walter.

  • Damon Runyon Cancer Research Foundation DRG-2312-17 to Lan Wang.

  • Damon Runyon Cancer Research Foundation DRG-2284-17 to Vladislav Belyy.

Additional information

Competing interests

No competing interests declared.

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – review and editing.

Data curation, Formal analysis, Methodology, Visualization, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing.

Additional files

Transparent reporting form

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files. The imaging analysis pipeline is described in Figure 3-source data 1. The raw images used for data analysis are deposited into dryad (https://doi.org/10.5061/dryad.q2bvq83n3). The final models are deposited into the protein data bank (PDB) under the accession codes 7UPR (closed conformation) and 7UPT (open conformation). The final reconstructed maps are deposited into the EMDB under the accession codes EMD-26674 (closed conformation) and EMD-26675 (open conformation).

The following datasets were generated:

Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Conserved structural elements specialize ATAD1 as a membrane protein extraction machine. Dryad Digital Repository.

Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (closed conformation) RCSB Protein Data Bank. 7UPR

Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (open conformation) RCSB Protein Data Bank. 7UPT

Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (closed conformation) Electron Microscopy Data Bank. EMD-26674

Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (open conformation) Electron Microscopy Data Bank. EMD-26675

References

  1. Adams PD, Afonine PV, Bunkóczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, Zwart PH. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica. Section D, Biological Crystallography. 2010;66:213–221. doi: 10.1107/S0907444909052925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ahrens-Nicklas RC, Umanah GKE, Sondheimer N, Deardorff MA, Wilkens AB, Conlin LK, Santani AB, Nesbitt A, Juulsola J, Ma E, Dawson TM, Dawson VL, Marsh ED. Precision therapy for a new disorder of AMPA receptor recycling due to mutations in ATAD1. Neurology. Genetics. 2017;3:e130. doi: 10.1212/NXG.0000000000000130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Basch M, Wagner M, Rolland S, Carbonell A, Zeng R, Khosravi S, Schmidt A, Aftab W, Imhof A, Wagener J, Conradt B, Wagener N. Msp1 cooperates with the proteasome for extraction of arrested mitochondrial import intermediates. Molecular Biology of the Cell. 2020;31:753–767. doi: 10.1091/mbc.E19-06-0329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen Y-C, Umanah GKE, Dephoure N, Andrabi SA, Gygi SP, Dawson TM, Dawson VL, Rutter J. Msp1/ATAD1 maintains mitochondrial function by facilitating the degradation of mislocalized tail-anchored proteins. The EMBO Journal. 2014;33:1548–1564. doi: 10.15252/embj.201487943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chio US, Cho H, Shan SO. Mechanisms of Tail-Anchored Membrane Protein Targeting and Insertion. Annual Review of Cell and Developmental Biology. 2017;33:417–438. doi: 10.1146/annurev-cellbio-100616-060839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cooney I, Han H, Stewart MG, Carson RH, Hansen DT, Iwasa JH, Price JC, Hill CP, Shen PS. Structure of the Cdc48 segregase in the act of unfolding an authentic substrate. Science. 2019;365:502–505. doi: 10.1126/science.aax0486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. de la Peña AH, Goodall EA, Gates SN, Lander GC, Martin A. Substrate-engaged 26S proteasome structures reveal mechanisms for ATP-hydrolysis-driven translocation. Science. 2018;362:eaav0725. doi: 10.1126/science.aav0725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dederer V, Khmelinskii A, Huhn AG, Okreglak V, Knop M, Lemberg MK. Cooperation of mitochondrial and ER factors in quality control of tail-anchored proteins. eLife. 2019;8:e45506. doi: 10.7554/eLife.45506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Doan KN, Grevel A, Mårtensson CU, Ellenrieder L, Thornton N, Wenz LS, Opaliński Ł, Guiard B, Pfanner N, Becker T. The Mitochondrial Import Complex MIM Functions as Main Translocase for α-Helical Outer Membrane Proteins. Cell Reports. 2020;31:107567. doi: 10.1016/j.celrep.2020.107567. [DOI] [PubMed] [Google Scholar]
  10. Edelstein A, Amodaj N, Hoover K, Vale R, Stuurman N. Computer control of microscopes using µManager. Current Protocols in Molecular Biology. 2010;Chapter 14:Unit14. doi: 10.1002/0471142727.mb1420s92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of Coot. Acta Crystallographica. Section D, Biological Crystallography. 2010;66:486–501. doi: 10.1107/S0907444910007493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Favaloro V, Spasic M, Schwappach B, Dobberstein B. Distinct targeting pathways for the membrane insertion of tail-anchored (TA) proteins. Journal of Cell Science. 2008;121:1832–1840. doi: 10.1242/jcs.020321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fresenius HL, Wohlever ML. Sorting out how Msp1 maintains mitochondrial membrane proteostasis. Mitochondrion. 2019;49:128–134. doi: 10.1016/j.mito.2019.07.011. [DOI] [PubMed] [Google Scholar]
  14. Frickey T, Lupas AN. Phylogenetic analysis of AAA proteins. Journal of Structural Biology. 2004;146:2–10. doi: 10.1016/j.jsb.2003.11.020. [DOI] [PubMed] [Google Scholar]
  15. Gates SN, Yokom AL, Lin J, Jackrel ME, Rizo AN, Kendsersky NM, Buell CE, Sweeny EA, Mack KL, Chuang E, Torrente MP, Su M, Shorter J, Southworth DR. Ratchet-like polypeptide translocation mechanism of the AAA+ disaggregase Hsp104. Science. 2017;357:273–279. doi: 10.1126/science.aan1052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Grimm JB, Brown TA, English BP, Lionnet T, Lavis LD. Super-Resolution Microscopy, Methods and Protocols. Methods Mol Biology. 2017;1663:179–188. doi: 10.1007/978-1-4939-7265-4. [DOI] [PubMed] [Google Scholar]
  17. Han H, Monroe N, Sundquist WI, Shen PS, Hill CP. The AAA ATPase Vps4 binds ESCRT-III substrates through a repeating array of dipeptide-binding pockets. eLife. 2017;6:e31324. doi: 10.7554/eLife.31324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Han H, Schubert HL, McCullough J, Monroe N, Purdy MD, Yeager M, Sundquist WI, Hill CP. Structure of spastin bound to a glutamate-rich peptide implies a hand-over-hand mechanism of substrate translocation. The Journal of Biological Chemistry. 2020;295:435–443. doi: 10.1074/jbc.AC119.009890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Matsumoto N, Tamura S, Fujiki Y. The pathogenic peroxin Pex26p recruits the Pex1p-Pex6p AAA ATPase complexes to peroxisomes. Nature Cell Biology. 2003;5:454–460. doi: 10.1038/ncb982. [DOI] [PubMed] [Google Scholar]
  20. Matsumoto S, Nakatsukasa K, Kakuta C, Tamura Y, Esaki M, Endo T. Msp1 Clears Mistargeted Proteins by Facilitating Their Transfer from Mitochondria to the ER. Molecular Cell. 2019;76:191–205. doi: 10.1016/j.molcel.2019.07.006. [DOI] [PubMed] [Google Scholar]
  21. McQuin C, Goodman A, Chernyshev V, Kamentsky L, Cimini BA, Karhohs KW, Doan M, Ding L, Rafelski SM, Thirstrup D, Wiegraebe W, Singh S, Becker T, Caicedo JC, Carpenter AE. CellProfiler 3.0: Next-generation image processing for biology. PLOS Biology. 2018;16:e2005970. doi: 10.1371/journal.pbio.2005970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Monroe N, Han H, Shen PS, Sundquist WI, Hill CP. Structural basis of protein translocation by the Vps4-Vta1 AAA ATPase. eLife. 2017;6:e24487. doi: 10.7554/eLife.24487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Nuebel E, Morgan JT, Fogarty S, Winter JM, Lettlova S, Berg JA, Chen Y-C, Kidwell CU, Maschek JA, Clowers KJ, Argyriou C, Chen L, Wittig I, Cox JE, Roh-Johnson M, Braverman N, Bonkowsky J, Gygi SP, Rutter J. The biochemical basis of mitochondrial dysfunction in Zellweger Spectrum Disorder. EMBO Reports. 2021;22:e51991. doi: 10.15252/embr.202051991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Okreglak V, Walter P. The conserved AAA-ATPase Msp1 confers organelle specificity to tail-anchored proteins. PNAS. 2014;111:8019–8024. doi: 10.1073/pnas.1405755111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. UCSF Chimera--A visualization system for exploratory research and analysis. Journal of Computational Chemistry. 2004;25:1605–1612. doi: 10.1002/jcc.20084. [DOI] [PubMed] [Google Scholar]
  26. Pfanner N, Warscheid B, Wiedemann N. Mitochondrial proteins: from biogenesis to functional networks. Nature Reviews. Molecular Cell Biology. 2019;20:267–284. doi: 10.1038/s41580-018-0092-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Piard J, Umanah GKE, Harms FL, Abalde-Atristain L, Amram D, Chang M, Chen R, Alawi M, Salpietro V, Rees MI, Chung S-K, Houlden H, Verloes A, Dawson TM, Dawson VL, Van Maldergem L, Kutsche K. A homozygous ATAD1 mutation impairs postsynaptic AMPA receptor trafficking and causes A lethal encephalopathy. Brain. 2018;141:651–661. doi: 10.1093/brain/awx377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Puchades C, Rampello AJ, Shin M, Giuliano CJ, Wiseman RL, Glynn SE, Lander GC. Structure of the mitochondrial inner membrane AAA+ protease YME1 gives insight into substrate processing. Science. 2017;358:eaao0464. doi: 10.1126/science.aao0464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Puchades C, Sandate CR, Lander GC. The molecular principles governing the activity and functional diversity of AAA+ proteins. Nature Reviews. Molecular Cell Biology. 2020;21:43–58. doi: 10.1038/s41580-019-0183-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Punjani A, Rubinstein JL, Fleet DJ, Brubaker MA. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods. 2017;14:290–296. doi: 10.1038/nmeth.4169. [DOI] [PubMed] [Google Scholar]
  31. Rodriguez-Aliaga P, Ramirez L, Kim F, Bustamante C, Martin A. Substrate-translocating loops regulate mechanochemical coupling and power production in AAA+ protease ClpXP. Nature Structural & Molecular Biology. 2016;23:974–981. doi: 10.1038/nsmb.3298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sandate CR, Szyk A, Zehr EA, Lander GC, Roll-Mecak A. An allosteric network in spastin couples multiple activities required for microtubule severing. Nature Structural & Molecular Biology. 2019;26:671–678. doi: 10.1038/s41594-019-0257-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Scheres SHW. RELION: implementation of a Bayesian approach to cryo-EM structure determination. Journal of Structural Biology. 2012;180:519–530. doi: 10.1016/j.jsb.2012.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Schuldiner M, Metz J, Schmid V, Denic V, Rakwalska M, Schmitt HD, Schwappach B, Weissman JS. The GET complex mediates insertion of tail-anchored proteins into the ER membrane. Cell. 2008;134:634–645. doi: 10.1016/j.cell.2008.06.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Shin SC, Im SK, Jang EH, Jin KS, Hur EM, Kim EE. Structural and Molecular Basis for Katanin-Mediated Severing of Glutamylated Microtubules. Cell Reports. 2019;26:1357–1367. doi: 10.1016/j.celrep.2019.01.020. [DOI] [PubMed] [Google Scholar]
  36. Stefanovic S, Hegde RS. Identification of a targeting factor for posttranslational membrane protein insertion into the ER. Cell. 2007;128:1147–1159. doi: 10.1016/j.cell.2007.01.036. [DOI] [PubMed] [Google Scholar]
  37. Su M, Guo EZ, Ding X, Li Y, Tarrasch JT, Brooks CL, Xu Z, Skiniotis G. Mechanism of Vps4 hexamer function revealed by cryo-EM. Science Advances. 2017;3:e1700325. doi: 10.1126/sciadv.1700325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sun S, Li L, Yang F, Wang X, Fan F, Yang M, Chen C, Li X, Wang HW, Sui SF. Cryo-EM structures of the ATP-bound Vps4E233Q hexamer and its complex with Vta1 at near-atomic resolution. Nature Communications. 2017;8:16064. doi: 10.1038/ncomms16064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Twomey EC, Ji Z, Wales TE, Bodnar NO, Ficarro SB, Marto JA, Engen JR, Rapoport TA. Substrate processing by the Cdc48 ATPase complex is initiated by ubiquitin unfolding. Science. 2019;365:eaax1033. doi: 10.1126/science.aax1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Umanah GKE, Pignatelli M, Yin X, Chen R, Crawford J, Neifert S, Scarffe L, Behensky AA, Guiberson N, Chang M, Ma E, Kim JW, Castro CC, Mao X, Chen L, Andrabi SA, Pletnikov MV, Pulver AE, Avramopoulos D, Bonci A, Valle D, Dawson TM, Dawson VL. Thorase variants are associated with defects in glutamatergic neurotransmission that can be rescued by Perampanel. Science Translational Medicine. 2017;9:eaah4985. doi: 10.1126/scitranslmed.aah4985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Vajjhala PR, Nguyen CH, Landsberg MJ, Kistler C, Gan A-L, King GF, Hankamer B, Munn AL. The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases. The FEBS Journal. 2008;275:1427–1449. doi: 10.1111/j.1742-4658.2008.06300.x. [DOI] [PubMed] [Google Scholar]
  42. Wang L, Myasnikov A, Pan X, Walter P. Structure of the AAA protein Msp1 reveals mechanism of mislocalized membrane protein extraction. eLife. 2020;9:e54031. doi: 10.7554/eLife.54031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wang L, Walter P. Msp1/ATAD1 in Protein Quality Control and Regulation of Synaptic Activities. Annual Review of Cell and Developmental Biology. 2020;36:141–164. doi: 10.1146/annurev-cellbio-031220-015840. [DOI] [PubMed] [Google Scholar]
  44. Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Research. 2018;46:W296–W303. doi: 10.1093/nar/gky427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Weidberg H, Amon A. MitoCPR-A surveillance pathway that protects mitochondria in response to protein import stress. Science (New York, N.Y.) 2018;360:eaan4146. doi: 10.1126/science.aan4146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Winter JM, Fresenius HL, Keys HR, Cunningham CN, Ryan J, Sirohi D, Berg JA, Agarwal P, Letai N, Sabatini A, Wohlever DM. Co-Deletion of ATAD1 with PTEN Primes Cells for BIM-Mediated Apoptosis. bioRxiv. 2021 doi: 10.1101/2021.07.01.450781. [DOI]
  47. Wohlever ML, Mateja A, McGilvray PT, Day KJ, Keenan RJ. Msp1 Is a Membrane Protein Dislocase for Tail-Anchored Proteins. Molecular Cell. 2017;67:194–202. doi: 10.1016/j.molcel.2017.06.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zehr E, Szyk A, Piszczek G, Szczesna E, Zuo X, Roll-Mecak A. Katanin spiral and ring structures shed light on power stroke for microtubule severing. Nature Structural & Molecular Biology. 2017;24:717–725. doi: 10.1038/nsmb.3448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhang J, Wang Y, Chi Z, Keuss MJ, Pai Y-ME, Kang HC, Shin J-H, Bugayenko A, Wang H, Xiong Y, Pletnikov MV, Mattson MP, Dawson TM, Dawson VL. The AAA+ ATPase Thorase regulates AMPA receptor-dependent synaptic plasticity and behavior. Cell. 2011;145:284–299. doi: 10.1016/j.cell.2011.03.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhang K. Gctf: Real-time CTF determination and correction. Journal of Structural Biology. 2016;193:1–12. doi: 10.1016/j.jsb.2015.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

Editor's evaluation

Franz-Ulrich Hartl 1

This study reports the cryo-EM structure of human ATAD1 (Msp1 in yeast), a AAA protein responsible for the extraction of mistargeted tail-anchored (TA) proteins from the mitochondrial outer membrane. The structure helps to understand the effects of disease-linked mutations on ATAD1/Msp1 activity.

Decision letter

Editor: Franz-Ulrich Hartl1
Reviewed by: Marta Carroni2

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Conserved structural elements specialize ATAD1 as a membrane protein extraction machine" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Volker Dötsch as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Marta Carroni (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

Main points:

1. Results of biological repeats should be presented for the microscopic mislocalization assay. It appears that the data shown is from a single experiment with multiple fields taken.

Also, if at all possible, an additional substrate protein should be tested. Considering the similarity in structural observations in this work and the last Msp1 paper, this additional cellular/reporter data would make the current work stand out.

2. Figure 2: The representation of subunits is different from Figure 1. This leads to substantial confusion with respect to the relative order of individual subunits. While in Figure 1 M1 is the clockwise subunit with respect to M6, it becomes the counterclockwise one in Figure 2. The depiction in Figure 2 seems unusual. M1 represents the top subunit in the spiral arrangement of ATAD1 subunits and the seam subunit M6 is on its way to become the new top subunit (new M1) during subunit cycling. Therefore, M1 is typically defined as clockwise subunit (see Figure 1) but not as the counterclockwise one (see Figure 2). The authors need to standardize the respective figures and data description and relate their findings to other AAA proteins depicted in the same way. Based on the current description it is not clear whether C-terminal a-helices of meiotic AAA+ proteins contact neighboring subunits differently (clockwise vs. counterclockwise) and whether they differ in their contributions to hexamer stabilization.

The authors should modify the figure caption to specify that the schematic is viewed from the C-terminus and should provide an additional schematic with the same colour code where the hexamer is viewed from the N-terminus.

3. Figures 3-5: It is unclear whether using SEM and the p-values (presumably calculated assuming normalcy) for PCC measurements is appropriate as PCC may not be normally distributed. A test of normalcy should be shown. Alternatively, a permutation test should be applied to calculate the p-values.

4. Page 14. Authors suggest that α11 couples subunit oligomerization with substrate binding, but the evidence presented suggests that ATAD1∆α11 simply fails to oligomerize robustly and that leads to reduced activity. If it does not oligomerize, it also won't bind peptide substrate. Therefore, inferring that α11 couples subunit oligomerization with substrate binding because peptide binding does not affect ATP hydrolysis seems weak. Can the authors provide more detail on the role of α11?

5. The authors speculate that a11 might bind to specific adaptors enabling targeting of ATAD1/Msp1 to the TOM complex or channeling substrates to the proteasome. Evidence for such role of a11 is however missing. It is also not clear how a11 should act as adaptor binding site. Its role in hexamer formation suggests that a11 accessibility will be largely restricted. This aspect should be taken into consideration.

6. Page 14/15. It is striking that the H206 residue is implicated so strongly in the structure with substrate binding, but has no effect in vivo. Why was the importance of H206 not analyzed for peptide binding in vitro to see if there was any defect using this more sensitive assay? The central substrate-binding pore-loop 1 of ATAD1 harbors two aromatic residues (W166/Y167). This is rather unusual as respective pore loops of other AAA+ proteins typically harbor only one aromatic residues. The authors propose that increased hydrophobicity of ATAD pore-loop 1 ensure a tighter grip on substrates, enabling ATAD1 to efficiently extract mislocalized TA-proteins from the lipid bilayer. While the authors demonstrate that Y167 can indeed not be replaced by a large aliphatic side chains, such an experiment was not performed for W166, which was only mutated to alanine. It is therefore crucial to also change W166 to valine or leucine residues to provide solid support for the original idea.

7. The authors state "By contrast, when expressed in the wild-type cells, ATAD1Da11 did not induce significant mislocalization of EGFP-Gos28 (Figure 4B), indicating its recessive phenotype, i.e., its lack of incorporation into and inactivating the wild-type hexamers present in these cells." This observation is very indirect, it could simply mean that incorporation is tolerated but maybe only up to a certain level of e.g. 2-3 subunits in the hexamer. In general, it would strengthen the work to run in vitro experiments where WT ATAD1 is substituted in solution with a11 deletion or mutants and the formation of hexameters as well as the ATPase activity is monitored.

8. The abstract is a bit confusing in that it mixes old and new data. The comparison between the old (Msp1) and new (ATAD1) structure should be organized more clearly.

Reviewer #1 (Recommendations for the authors):

Because of the conflicting results of the previous yeast assays suggesting that some structurally implicated aromatic pore 1 and 2 residues do not contribute to in vivo activity (Wang, et al., 2020) the authors develop a microscopy-based reporter assay (EGFP-Gos28) to monitor mistargeting of ATAD1 clients. They show that ATAD1∆a11 fails to remove reporters normally mistargeted to the mitochondria and does not show dominant effects. They demonstrate that both aromatic residues in pore 1 implicated for substrate binding in the current ATAD1 structure and in the prior Msp1 structure (Wang, et al., 2020) show deficiencies in removal of mistargeted proteins. Altering the histidine in pore 2 still has no effect on activity, calling into question the importance of this residue that is strongly implicated by the structure. Surprisingly, ATAD1 mutations implicated in neurological diseases do not seem to dramatically effect the function of ATAD1 in this assay.

Overall, this work extends our understanding of this family of AAA proteins responsible for extracting TA proteins mistargeted to the mitochondria. The role of the C-terminal α-helix 11 is clear from this work and the in vivo mislocalization reporter is a useful assay for sensitive in vivo activity of ATAD1 family proteins. It would be ideal to have additional in vivo assays (pull-downs, proximity labeling, etc) to validate these observations. Given the prior Msp1 structure from this same group and the largely similar observations, especially for the structural considerations, the conclusions of this work are not particularly surprising. Specific comments with the experimental methods, particularly with the microscopy assay, are detailed below.

Microscopy assay. Using mislocalization as a more sensitive assay is excellent. However, some of the statistics and reporting here could be improved. First, looking at the methods, it seems that the data shown is represented from a single experiment with multiple fields taken. Thus the mean PC shown is from a single biological replicate and therefore the variance/errors shown to compare between constructs is misleading. It would be ideal to have multiple biological replicates for each experimental condition and distinguish them from each other in the dot plots, representing the means for each of the replicates separately.

The other concern is that I'm not sure using SEM and the p-values (presumably calculated assuming normalcy) for PCC measurements as shown in figures 3-5 is appropriate as I don't know if PCC are normally distributed. It would be good to show test of normalcy or, better yet, use a permutation test to calculate the p-values. Ideally, promising results from this reporter assay would be confirmed with other assays in vivo, such as pull-downs, proximity labeling, or other evidence.

Page 14. The authors suggest that α11 couples subunit oligomerization with substrate binding, but all the evidence presented in this work suggests that ATAD1∆α11 simply fails to oligomerize robustly and that leads to reduced activity. If it does not oligomerize, it also won't bind peptide substrate. Therefore, inferring that α11 couples subunit oligomerization with substrate binding because peptide binding does not affect ATP hydrolysis seems weak.

Page 14/15. It is striking that the H206 residue is implicated so strongly in the structure with substrate binding, but has no effect in vivo. Was there a reason they did not test the importance of H206 in their in vitro peptide binding assays to see if there was any defect using this more sensitive assays?

Reviewer #2 (Recommendations for the authors):

The study reports on the cryo EM structure of ATAD1 and a novel activity assay that provides improved readout on ATAD1 derivatives in vivo. Both aspects of the study are nicely linked. The ATAD1 structure also illustrates new features (e.g. a11) as compared to published Ct Msp1. However, it remains largely unclear how those new features contribute to ATAD1 functional specificity (see comments below). This is reducing the novelty of the manuscript as the basic structural features have been described before (Ct Msp1). The manuscript is therefore in need of further experimental support and clarifications how unique sequence and structural features contribute to ATAD1/Msp1 specificity.

Figure 2: The representation of subunits is different from Figure 1. This leads to substantial confusion with respect to the relative order of individual subunits. While in Figure 1 M1 is the clockwise subunit with respect to M6, it becomes the counterclockwise one in Figure 2. The depiction in Figure 2 seems unusual. M1 represent the top subunit in the spiral arrangement of ATAD1 subunits and the seam subunit M6 is on its way to become the new top subunit (new M1) during subunit cycling. Therefore M1 is typically defined as counterclockwise subunit (see Figure 1) but not as the counterclockwise one (see Figure 2). The authors need to standardize the respective figures and data description and relate their findings to other AAA proteins depicted in the same way. Based on the current description it is not clear to this reviewer whether C-terminal a-helices of meiotic AAA+ proteins contact neighboring subunits differently (clockwise vs. counterclockwise) and whether they differ in their contributions to hexamer stabilization.

ATAD1/Msp1 differ from other meiotic AAA+ members by harboring an extended αa11 but not a short a11 that is followed by a12. For all AAA+ members the C-terminal a-helices contact the neighboring subunit and presumably contribute to hexamer stabilization and functional cycling. Why ATAD1/Msp1 harbor a long a11 remains unresolved. It is therefore unclear whether a11 contributes to functional specificity. The authors speculate that a11 might bind to specific adaptors enabling for ATAD1/Msp1 targeting to the TOM complex or channeling substrates to the proteasome. Evidence for such role of a11 is however missing. It is also not clear how a11 should act as adaptor binding site. Its role in hexamer formation suggests that a11 accessibility will be largely restricted.

The central substrate-binding pore-loop 1 of ATAD1 harbors two aromatic residues (W166/Y167). This is rather unusual as respective pore loops of other AAA+ proteins typically harbor only one aromatic residues. The authors propose that increased hydrophobicity of ATAD pore-loop 1 ensure a tighter grip to substrates, enabling ATAD1 to efficiently extract mislocalized TA-proteins from the lipid bilayer. While the authors demonstrate that Y167 can indeed not be replaced by a large aliphatic side chains, such experiment was not performed for W166, which was only mutated to alanine. It is therefore crucial to also change W166 to valine or leucine residues to provide solid support for the original idea.

Reviewer #3 (Recommendations for the authors):

There are a series of points I got curious about while reading the article. Maybe answers to these could make the paper even better.

1. Is there any indication from the structure on the mechanism by which ATAD1 facilitates re-insertion onto the right membrane?

2. In the Msp1 structure the authors describe the role of a0 as an important hook for substrate, what about the same element here? What about the lid domain in ATAD1?

3. In general the abstract could be changed, it is a bit confusing in mixing old and new data. It is actually good to compare with the Msp1 structure but then it has to be done in a clearer way e.g. on Msp1 we found this > on ATAD1 we find this.

4. Some references are not well stated, they only have ref written by the text.

5. To study better the motions of e.g. M6 in the closed state, did you try cryoDGRN or 3D variability in cryoSPARC?

6. The authors state "By contrast, when expressed in the wild-type cells, ATAD1Da11 did not induce significant mislocalization of EGFP-Gos28 (Figure 4B), indicating its recessive phenotype, i.e., its lack of incorporation into and inactivating the wild-type hexamers present in these cells." This observation is very indirect, it could simply mean that incorporation is acceptable but maybe only up to a certain level e.g. 2-3 subunits in the hexamer. In general, it would strengthen the work to run poisoning in vitro experiments where WT ATAD1 is substituted in solution with a11 deletion or mutants and the formation of hexameters as well as the ATPase activity is monitored.

7. When describing the density for the substrate in the map, you write that the side chains were clearly visible, but then you model a whole-alanine peptide stretch.

8. General question: can you say anything about the pulling force exerted by ATAD1 compared to other AAA+ of the same clade?

9. You state "ATAD1Y167F bound P13 with a ~10-fold weaker affinity than the wild-type enzyme, but still better than the other poreloop mutants. We reasoned that this difference resulted because the in vitro assay is more sensitive to small changes in activity that cell-based assays fail to capture". Could be instead because the cellular assay is only based on Gos28?

10. Discussing about the difference on a11 in ATAD1 or a11+a12in other AAA of the MC clade. Maybe a11 needs to be rigid? Have you considered inserting a G or P in the middle of a11 and see what happens?

11. In the table, also Relion should be mentioned, according to the material and methods.

12. The grids were prepared at a concentration of 100uM why so high? Was there a lot of aggregation? The SEC profile looks quite broad.

13. Looking at the actual maps. There is density present in the bottom of the closed structure at low threshold, what is it?

eLife. 2022 May 12;11:e73941. doi: 10.7554/eLife.73941.sa2

Author response


Reviewer #1 (Recommendations for the authors):

Microscopy assay. Using mislocalization as a more sensitive assay is excellent. However, some of the statistics and reporting here could be improved. First, looking at the methods, it seems that the data shown is represented from a single experiment with multiple fields taken. Thus the mean PC shown is from a single biological replicate and therefore the variance/errors shown to compare between constructs is misleading. It would be ideal to have multiple biological replicates for each experimental condition and distinguish them from each other in the dot plots, representing the means for each of the replicates separately.

We agree that it is important to report on the number of biological replicates for each mutant. We have adjusted the figures with PCC measurements in two ways: 1) We have summarized the results from each imaging experiment in the corresponding supplemental figure. The mean value from each biological replicate is plotted for each mutant and the individual values are represented in the main text figures. 2) We have pooled the data from each biological replicate for the main text figures to better represent the data as a whole. The conclusions drawn from the experiments remain unaltered.

The other concern is that I'm not sure using SEM and the p-values (presumably calculated assuming normalcy) for PCC measurements as shown in figures 3-5 is appropriate as I don't know if PCC are normally distributed. It would be good to show test of normalcy or, better yet, use a permutation test to calculate the p-values. Ideally, promising results from this reporter assay would be confirmed with other assays in vivo, such as pull-downs, proximity labeling, or other evidence.

We have performed a normalcy test on the distributions for each mutant. For the most part, we do indeed see that they follow a normal distribution, however, there are a couple of mutants that do not. To account for this, we used the nonparametric Mann-Whitney test, which does not assume the normal distribution of data, to calculate the p-value. Each of the figures with PCC measurements have been updated to reflect this. The conclusions drawn from the experiments remain unaltered.

Page 14. The authors suggest that α11 couples subunit oligomerization with substrate binding, but all the evidence presented in this work suggests that ATAD1∆α11 simply fails to oligomerize robustly and that leads to reduced activity. If it does not oligomerize, it also won't bind peptide substrate. Therefore, inferring that α11 couples subunit oligomerization with substrate binding because peptide binding does not affect ATP hydrolysis seems weak.

We have modified our main text and indicated that instead of coupling substrate binding and oligomerization, the experiment simply shows that ATAD1∆a11’s ability to oligomerize is heavily impacted such that even the addition of a peptide substrate could not bring it to form functional oligomers.

Page 14/15. It is striking that the H206 residue is implicated so strongly in the structure with substrate binding, but has no effect in vivo. Was there a reason they did not test the importance of H206 in their in vitro peptide binding assays to see if there was any defect using this more sensitive assays?

Thanks for your suggestion. We purified the soluble ATAD1 protein bearing an H206A mutation. In our FP assay, we indeed detected a much weaker peptide binding affinity of this mutant compared to the wild-type protein. We incorporated the results in Figure 5 and also included them in the main text.

Reviewer #2 (Recommendations for the authors):

Figure 2: The representation of subunits is different from Figure 1. This leads to substantial confusion with respect to the relative order of individual subunits. While in Figure 1 M1 is the clockwise subunit with respect to M6, it becomes the counterclockwise one in Figure 2. The depiction in Figure 2 seems unusual. M1 represent the top subunit in the spiral arrangement of ATAD1 subunits and the seam subunit M6 is on its way to become the new top subunit (new M1) during subunit cycling. Therefore M1 is typically defined as counterclockwise subunit (see Figure 1) but not as the counterclockwise one (see Figure 2). The authors need to standardize the respective figures and data description and relate their findings to other AAA proteins depicted in the same way. Based on the current description it is not clear to this reviewer whether C-terminal a-helices of meiotic AAA+ proteins contact neighboring subunits differently (clockwise vs. counterclockwise) and whether they differ in their contributions to hexamer stabilization.

Thank you for pointing out the different subunit depictions in Figures 1 and 2. In Figure 1, the membrane proximal side of ATAD1 is shown, as this is also the way that the previous Msp1 structures and other related AAA protein structures are displayed. In Figure 2, the opposite side of ATAD1, that is, the cytosol-facing side, is shown. The reason is because helix a11 resides on the cytosol-facing side, and we wanted to show the positions of a11. To avoid confusion, we added descriptions in the figure legends related to this point. Regarding the interactions made by a11, as shown in Figure 2 and Figure 2 —figure supplement 2, ATAD1 uses a11 to contact the counterclockwise subunit (looking from the cytosol-facing side) whereas other meiotic clade AAA proteins use a12 to contact the clockwise subunit.

ATAD1/Msp1 differ from other meiotic AAA+ members by harboring an extended αa11 but not a short a11 that is followed by a12. For all AAA+ members the C-terminal a-helices contact the neighboring subunit and presumably contribute to hexamer stabilization and functional cycling. Why ATAD1/Msp1 harbor a long a11 remains unresolved. It is therefore unclear whether a11 contributes to functional specificity. The authors speculate that a11 might bind to specific adaptors enabling for ATAD1/Msp1 targeting to the TOM complex or channeling substrates to the proteasome. Evidence for such role of a11 is however missing. It is also not clear how a11 should act as adaptor binding site. Its role in hexamer formation suggests that a11 accessibility will be largely restricted.

Based on the structure, a11 resides in the cytosol-facing side of the protein (see revised Figure 2). While its hydrophobic side is buried, its hydrophilic side is exposed to the cytosol (Figure 2E), available for potential adaptor binding interactions. We agree with the reviewer that the precise reason why ATAD1 has a long a11 instead of a short a11 and a short a12 is not yet clear, thus we only mentioned this adaptor-binding function as a plausible possibility in the discussion.

The central substrate-binding pore-loop 1 of ATAD1 harbors two aromatic residues (W166/Y167). This is rather unusual as respective pore loops of other AAA+ proteins typically harbor only one aromatic residues. The authors propose that increased hydrophobicity of ATAD pore-loop 1 ensure a tighter grip to substrates, enabling ATAD1 to efficiently extract mislocalized TA-proteins from the lipid bilayer. While the authors demonstrate that Y167 can indeed not be replaced by a large aliphatic side chains, such experiment was not performed for W166, which was only mutated to alanine. It is therefore crucial to also change W166 to valine or leucine residues to provide solid support for the original idea.

Thank you for the suggestion. We made the W166V and the W166L mutations in ATAD1 and tested the mutants’ function in both the cell-based assay and the peptide binding assay. As shown in the updated Figure 5, both ATAD1W166V and ATAD1W166L showed reduced activity in extracting mislocalized Gos28 in cells. In agreement with this result, both mutants showed reduced peptide binding activity in the peptide binding assay (see updated Figure 5). Together, these results show that ATAD1 requires both aromatic amino acids (W166 and Y167) in pore-loop 1 for its proper function.

Reviewer #3 (Recommendations for the authors):

There are a series of points I got curious about while reading the article. Maybe answers to these could make the paper even better.

1. Is there any indication from the structure on the mechanism by which ATAD1 facilitates re-insertion onto the right membrane?

This is a good question. The current structure only captures the substrate bound in the central pore. However, previous studies (Matsumoto et al., Mol Cell 2019; Dederer et al., eLife 2019) on Msp1 showed that some extracted tail-anchored proteins are re-inserted to the ER membrane where they are either degraded or trafficked from there to the correct organelle. This has been shown for the yeast Msp1, but not yet for the mammalian ATAD1. It also remains unclear what factors are needed to facilitate the translocation from the mitochondria to the ER, whether is it a direct handover by Msp1/ATAD1, or requires another chaperone/targeting factor is unknown.

2. In the Msp1 structure the authors describe the role of a0 as an important hook for substrate, what about the same element here? What about the lid domain in ATAD1?

Thank you for raising this point. Many amino acids that are involved in substrate binding in Msp1’s N-domain are conserved in ATAD1 as well (Li et al., EMBO J 2019). Thus, it is possible that they are also important in engaging substrates in ATAD1. In the Msp1 structure, we observed the conformational change in helix a0 within the hexamer. We proposed that the melting of this helix reveal the hydrophobic amino acids that could constitute a potential substrate binding site (Wang et al., 2020 eLife). In the ATAD1 structures, we observed similar conformational changes in helix a0 (see Author response image 1), and similar positioning of the hydrophobic amino acids within the linker domain.

Author response image 1. Structure details of the linker domain (LD).

Author response image 1.

(A) EM map of D40-ATAD1 (open) showing that helix a0 within the LD is well-folded in the central four subunits and disordered in M1 and M6. (B) and (C) showing most of the hydrophobic amino acids within the LD are buried by the well-folded a0 and revealed when a0 becomes disordered. These hydrophobic amino acids make up a plausible substrate binding site. a0 is colored in white and hydrophobic amino acids in gold. Helix a0 is colored in green, hydrophobic amino acids in gold, and the substrate peptide is colored in black.

3. In general the abstract could be changed, it is a bit confusing in mixing old and new data. It is actually good to compare with the Msp1 structure but then it has to be done in a clearer way e.g. on Msp1 we found this > on ATAD1 we find this.

Thank you for your suggestion. We modified our abstract to more clearly distinguish the new/ATAD1-specific insights from what was previously known from Msp1.

4. Some references are not well stated, they only have ref written by the text.

Thank you for spotting this. We fixed the references.

5. To study better the motions of e.g. M6 in the closed state, did you try cryoDGRN or 3D variability in cryoSPARC?

Yes, we tried the 3D variability analysis in cryoSPARC. One of the modes of motion showed clearly that the M6 subunit is indeed mobile and moves around the equilibrium position both vertically and horizontally. Please see Author response image 2 for different states captured by the 3D variability analysis.

Author response image 2. 3D variability analysis of D 40-ATAD1E193QDa11 (open) 3D variability analysis was performed in cryoSPARC to capture the movements of the flexible regions of the molecule.

Author response image 2.

Twenty different frames were used to capture the full trajectory of the movements. Within the twenty frames, the start and the end frames (representing the two extreme states of the movement) are overlayed and shown in the figure. The M6 subunit is colored in blue (start frame) or pink (end frame) and the rest of the protein in light grey.

6. The authors state "By contrast, when expressed in the wild-type cells, ATAD1Da11 did not induce significant mislocalization of EGFP-Gos28 (Figure 4B), indicating its recessive phenotype, i.e., its lack of incorporation into and inactivating the wild-type hexamers present in these cells." This observation is very indirect, it could simply mean that incorporation is acceptable but maybe only up to a certain level e.g. 2-3 subunits in the hexamer. In general, it would strengthen the work to run poisoning in vitro experiments where WT ATAD1 is substituted in solution with a11 deletion or mutants and the formation of hexameters as well as the ATPase activity is monitored.

To clarity the question, our interpretation of the data is that ATAD1 Da11 failed to poison the wild-type hexamers, because its ability to oligomerize with wild-type ATAD1 is impacted. The alternative interpretation raised by the reviewer is that perhaps the intrinsic ability for ATAD1Da11 to oligomerize with wild-type subunits is not impacted, but rather, in our experiments, due to low expression levels, only 2-3 subunits of ATAD1Da11 got incorporated into the each WT hexamer, and therefore it could not poison the WT hexamer. We do not think this is the case, we compared our observations of ATAD1Da11 to those of ATAD1E193Q. First, both two mutants are inactive, that is, in ATAD1 knockout cells, neither could remove mislocalized Gos28 from the mitochondria (see Figure 4A in the manuscript). However, in wildtype cells, one mutant (ATAD1E193Q) managed to completely poison the wild-type enzyme (dominant negative), and the other (ATAD1Da11) had little effect (see Figure 4B in the manuscript). Interestingly, both mutants were expressed at similar levels in wild-type cells (see Author response image 3 for quantification). This is to say that at similar expression levels, one inactive mutant (ATAD1E193Q) could poison the wild-type enzyme, and the other inactive mutant (ATAD1Da11) could not. Having ruled out the expression level difference, the most plausible explanation to this phenotypic difference between the two mutants is that, ATAD1E193Q can oligomerize with wild-type ATAD1 efficiently (as we know this is a property of the “Walker B” mutant), but ATAD1Da11 has an impaired ability to oligomerize, therefore was not incorporated into a hexamer formed mostly of wild-type subunits.

Author response image 3. Quantification of ATAD1 variant expression levels in the WT background.

Author response image 3.

The average fluorescent intensity for cells expressing ATAD1-HaloTag were plotted for each biological replicate as a proxy for expression levels. ATAD1Da11 is expressed at similar, if not higher, levels when compared to ATAD1E193Q.

7. When describing the density for the substrate in the map, you write that the side chains were clearly visible, but then you model a whole-alanine peptide stretch.

The side chain density is indeed clearly visible as shown in Figure 1, meaning that there is density that goes beyond the peptide backbone. However, we could not assign the identity of the side chains based on the current density, which is why a poly-alanine stretch was modeled.

8. General question: can you say anything about the pulling force exerted by ATAD1 compared to other AAA+ of the same clade?

To compare the force exerted by ATAD1 and other AAA proteins, specific force measurements will have to be performed using a single molecule setup that go beyond the scope of this paper. However, we did comment on this point in our discussion, speculating that the extra aromatic amino acids possibly give ATAD1 a stronger grip, which adapts it for its function of removing membrane proteins.

9. You state "ATAD1Y167F bound P13 with a ~10-fold weaker affinity than the wild-type enzyme, but still better than the other poreloop mutants. We reasoned that this difference resulted because the in vitro assay is more sensitive to small changes in activity that cell-based assays fail to capture". Could be instead because the cellular assay is only based on Gos28?

Yes, that is also a possibility that the differences between the in vitro and the cellbased assays arise from the different substrates used. We included this possibility in our revised manuscript.

10. Discussing about the difference on a11 in ATAD1 or a11+a12in other AAA of the MC clade. Maybe a11 needs to be rigid? Have you considered inserting a G or P in the middle of a11 and see what happens?

We have indeed considered this, however, trying to break a11 into two shorter helices that mimic the a11+ a12 arrangement in other AAA proteins has one problem, which is the a12 region would have to be adapted to interacting with the counterclockwise subunit. Thus, if the experiment shows that breaking a11 kills ATAD1’s activity, it could either mean that the a11+ a12 arrangement does not work for ATAD1, or simply the new “a12” is not properly positioned to interact with the rest of the protein. Also, given that a11 is an amphipathic helix (see Figure 2E), inserting one amino acid in between will cause shifts in the positions of the side chains which will alter the way the helix interacts with the rest of the protein. Thus, we do not think this is a good experiment to study the role of a11.

11. In the table, also Relion should be mentioned, according to the material and methods.

Thanks for pointing this out. We added Relion in Table 1.

12. The grids were prepared at a concentration of 100uM why so high? Was there a lot of aggregation? The SEC profile looks quite broad.

We added some detergent to help improve particle orientation distribution (same protocol as used in the previous Msp1 purification). The addition of detergent drives particles towards carbon, which is why a higher protein concentration was required to see the same concentration of particles in ice. The majority of particles were well-dispersed in most micrographs and we were able to obtain high-resolution reconstructions based on those particles. The SEC profile was indeed broad, as is also seen in the previous Msp1 purification (Wang et al., 2020 eLife). This is not surprising as we have observed that both Msp1 and ATAD1’s oligomerization is dependent on the subunit concentration, thus some on-column dissociation of hexamers might have happened that causes the broad peaks.

13. Looking at the actual maps. There is density present in the bottom of the closed structure at low threshold, what is it?

Thank you for noticing this. That is most likely the 6XHis-tag at the N-terminus of the protein that was not cleaved off.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Conserved structural elements specialize ATAD1 as a membrane protein extraction machine. Dryad Digital Repository. [DOI] [PMC free article] [PubMed]
    2. Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (closed conformation) RCSB Protein Data Bank. 7UPR
    3. Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (open conformation) RCSB Protein Data Bank. 7UPT
    4. Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (closed conformation) Electron Microscopy Data Bank. EMD-26674
    5. Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (open conformation) Electron Microscopy Data Bank. EMD-26675

    Supplementary Materials

    Figure 3—source data 1. Data analysis pipeline for live-cell imaging results.
    Transparent reporting form

    Data Availability Statement

    All data generated or analyzed during this study are included in the manuscript and supporting files. The imaging analysis pipeline is described in Figure 3-source data 1. The raw images used for data analysis are deposited into dryad (https://doi.org/10.5061/dryad.q2bvq83n3). The final models are deposited into the protein data bank (PDB) under the accession codes 7UPR (closed conformation) and 7UPT (open conformation). The final reconstructed maps are deposited into the EMDB under the accession codes EMD-26674 (closed conformation) and EMD-26675 (open conformation).

    The following datasets were generated:

    Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Conserved structural elements specialize ATAD1 as a membrane protein extraction machine. Dryad Digital Repository.

    Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (closed conformation) RCSB Protein Data Bank. 7UPR

    Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (open conformation) RCSB Protein Data Bank. 7UPT

    Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (closed conformation) Electron Microscopy Data Bank. EMD-26674

    Wang L, Toutkoushian H, Belyy V, Kokontis CY, Walter P. 2022. Human mitochondrial AAA protein ATAD1 (with a catalytic dead mutation) in complex with a peptide substrate (open conformation) Electron Microscopy Data Bank. EMD-26675


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES