Abstract
Piglets suffer from diarrhea caused by the Shiga toxin-producing Escherichia coli (STEC) and can be carriers of the bacteria, with public health consequences in developing countries. The aim of the present study was to study the prevalence of STEC O157 in feces of 465 piglets and 54 food mixes from backyard systems, the antimicrobial susceptibility of STEC and the frequency of genes encoding extended-spectrum β-lactamases. The E. coli was isolated from 75.90 % of the evaluated feces. The STEC strains were identified in 33.11% of the sampled population and in 43.60% of the piglets carrying E. coli. Among STEC strains, the stx1 gene was the most frequent (22.30%). The rfbO157 gene was amplified in 47.40% of the STEC strains. High frequencies of STEC strains were not susceptible to ampicillin, carbenicillin and tetracycline. The blaTEM gene (52) was the most frequent among strains not susceptible to ampicillin. Class 1 integrons were the most frequent in those strains. Of the identified STEC strains, 48.70% were considered as multi-drug resistant and 1.90% were considered extensively drug resistant. In the supplied food, STEC O157 strains were identified in 25.00% of the STEC strains. We conclude that the piglets from backyard systems are carriers of STEC O157 strains not susceptible to common antibiotics, including penicillins and tetracyclines. In addition, supplied food is a source of this type of pathogenic bacteria. Through their direct contact with humans, the piglets and food represent a potential source of bacterial dissemination capable of producing gastrointestinal infections in humans.
Key Words: Antimicrobial susceptibility, Carrier, Diarreagenic Escherichia coli, Prevalence, Zoonosis
Introduction
Escherichia coli is a zoonotic agent with the greatest impact on swine systems, causing acute enteritis with watery diarrhea in post-weaning piglets.1 The high mortality and medication of piglets cause economic losses ranging from 25.00 to 50.00% of the profits of swine systems. 2 The pathogenic strains of E. coli in pigs include Shiga toxin-producing E. coli (STEC).3 The serotype O157:H7 of STEC has become an important pathogen causing diarrhea, hemorrhagic colitis and hemolytic uremic syndrome in humans throughout the world.4 Currently, the main concern of researchers is the increasing spread of E. coli strains carrying a group of β-lactamases known as extended-spectrum β-lactamases (ESBLs) having the ability to cause resistance to new beta-lactam antibiotics and other antibiotic families.5,6
Some studies have examined the prevalence of O157 and non-O157 STEC strains in piglets in Mexico.7,8 However, most of these studies were carried out with piglets of intensive and semi-intensive swine farms, in which there is a strict control of sanitary measures and not much has been studied in swine backyard systems.
Swine backyard farming is a production system characteristic of certain regions of Mexico and other countries in the world representing a source of income and animal protein for families in rural communities. Despite its benefits, this type of systems is associated with a high risk of contamination by pathogens and an inappropriate use of antibiotics. 9
Whether the piglets and food supplied in backyard systems can carry STEC O157 with antibiotic resistance mediated by ESBL has not been previously investigated and it was the main motivation for this study. The goal of this study was to investigate the prevalence of STEC O157 in piglets’ feces and food supplied in backyard systems in Chiapas, Mexico, the antimicrobial susceptibility of STEC strains and the frequency of genes encoding ESBL.
Materials and Methods
Study population. The study population consisted of 465 healthy hybrid (Yorkshire x Duroc) piglets (from 1 to 6 weeks of age) being randomly selected. The study period lasted from the winter of 2016 to the summer of 2018. Animal studies were approved by the Ethics Committee of the University of Sciences and Arts of Chiapas (approval #049/02-2018). All piglets came from backyard farms being located in Chiapas, Mexico. The average number of pigs in each pen was between one and ten. These piglets were maintained in pens made of wooden or masonry walls having roofs made from metal sheets or locally found materials, dirt or concrete floors, simple drinkers and feeders made from hollowed-out trunks, with no waste treatment system in place. Agricultural residues and food waste from homes, restaurants and markets constitute the food source. Fifty-four samples (150 g each) of a food mix (tortillas, fruits and vegetables) were collected, placed in sterilized plastic bottles and transported to the laboratory.
Isolation of E. coli. The samples were taken directly from the rectum of piglets using sterile swabs and placed in Stuart's medium (Copan Diagnostics, Murrieta, USA); the swabs and bottles were transported in cold chain for microbiological analysis. Sub-samples (100 g) from each sample of food mix were placed in a sterile plastic bag and lactose broth was added to reach a 1:10 (10-1) final dilution.10 These sub-samples were mixed for 1 min. The swabs and foods dilution were simultaneously inoculated onto the eosin-methylene blue agar (Sigma-Aldrich, Steinheim, Germany) and incubated at 37.00 ˚C for 24 hr. The lactose-fermenting colonies were subjected to the series of biochemical tests to confirm the identity of E. coli strains. The identity of E. coli strains was also genetically confirmed by polymerase chain reaction (PCR) through the amplification of uidA gene.11 MacConkey agar with sorbitol (Sigma-Aldrich) was used to detect the serotype O157:H7 of STEC.12
Identification of STEC by PCR. In the PCR, the E. coli strain ATCC® 25922TM was used as a negative control and the STEC EDL933 strain (O157:H7) as a positive control. The strains were provided by Dr. Teresa Estrada García of CINVESTAV, Mexico, and deposited in the bacterial collection of University of Sciences and Arts of Chiapas, Chiapas, Mexico.13 To obtain DNA, bacterial lysates from each of the previously selected colonies were prepared, suspended in 1.00 mL of deionized water and then boiled for 10 min. The bacterial lysates were centrifuged at 10,000 rpm for 5 min; the supernatant containing DNA was removed and stored at – 80.00 ˚C. The gene primers specific for Shiga toxin-producing E. coli (stx1 and stx2 genes) were amplified by PCR.14 Shiga toxin-producing E. coli O157 was studied by amplifying the rfb gene (specific O-polysaccharide).15 The amplification of ESBL genes blaTEM, blaSHV, blaCTXM, blaOXA and blaCMY was carried out using the primers and conditions reported previously.16 The primers for amplification of class 1 and 2 integrons genes were used as described by Mazel et al., and White et al., respectively.17,18 The primer sequences used in this study are provided in Table 1. The PCR reactions were run in a thermal cycler C1000 (Bio-Rad Laboratories, Hercules, USA) and the PCR products were analyzed through agarose gel electrophoresis (2.00%) at 80.00 V for 1 hr. The agarose gels were stained with Sybr Green® (Invitrogen, Carlsbad, USA) and visualized with the Molecular Imager® Gel DocTM XR System (Bio-Rad). Lambda molecular weight markers (10 and 1000 bp; Invitrogen) were also used.
Table 1.
Primers used in this study
| Primer pair | Sequence (5’-3’) | Encoded protein | Size (pb) | Reference |
|---|---|---|---|---|
| uidA | F: AAAACGGCAAGAAAAAGCAG | β-glucuronidase | 147 | |
| R: ACGCGTGGTTAACAGTCTTGCG | ||||
| Stx1 | F: CTGGATTTAATGTCGCATAGTG | Shiga toxin 1 | 150 | |
| R: AGAACGCCCACTGAGATCATC | ||||
| Stx2 | F: GGCACTGTCTGAAACTGCTCC | Shiga toxin 2 | 255 | |
| R: TCGCCAGTTATCTGACATTCTG | ||||
| rfb O157 | F: CGGACATCCATGTGATATGG | Specific O-polysaccharide | 259 | |
| TTGCCTATGTACAGCTAATCC | ||||
| blaTEM | F: ATAAAATTCTTGAAGACGAAA | beta-lactamase TEM | 1080 | |
| R: GACAGTTACCAATGCTTAATC | ||||
| blaSHV | F: TTATCTCCCTGTTAGCCACC | beta-lactamase SHV | 795 | |
| R: GATTTGCTGATTTCGCTCGG | ||||
| blaCTXM | F: CGCTTTGCGATGTGCAG | beta-lactamase SHV | 550 | |
| R: ACCGCGATATCGTTGGT | ||||
| blaOXA | F: TCAACTTTCAAGATCGCA | beta-lactamase OXA | 591 | |
| R: GTGTGTTTAGAATGGTGA | ||||
| blaCMY | F: GACAGCCTCTTTCTCCACA | beta-lactamase CMY | 1000 | |
| R: TGG AACGAAGGCTACGTA | ||||
| IntI | F: GGGTCAAGGATCTGGATTTCG | intI1 | 483 | |
| R: ACATGCGTGTAAATCATCGTCG | ||||
| Int2 | F: CGGGATCCCGGACGGCATGCACGATTTGTA | class 2 integron | variable | |
| R: GATGCCATCGCAAGTACGAG |
Antimicrobial susceptibility analysis. The disk diffusion method was performed following the recommendations of Clinical and Laboratory Standards Institute.19 The following antimicrobial susceptibility discs (BD BBL™ Sensi-Disc™, Becton, Dickinson and Company, San Jose, USA) were used for different anti-microbial categories: β-lactamic: ampicillin (10.00 µg), carbenicillin (100 µg) and oxacillin (1.00 µg), aminoglycosides: amikacin (30.00 µg), netilmicin (30.00 µg) and gentamicin (10.00 µg), cephalosporins: cefalotin (30.00 µg) and cefotaxime (30.00 µg), quinolones: ciprofloxacin (5.00 µg) and norfloxacin (10.00 µg), phenicols: chloramphenicol (30.00 µg), folate inhibitors: trimethoprim-sulfamethoxazole (25.00 µg), furans: nitrofurantoin (300 µg) and tetracyclines: tetracycline (30.00 µg). The β-lactam-resistant strains were subsequently analyzed using the disc diffusion method with amoxicillin-clavulanic acid discs (20.00/10.00 µg). The E. coli strains (intermediate and resistant phenotypes) not susceptible to at least three antibiotics belonging to different antimicrobial categories were classified as multi-drug resistant strains (MDRs); while, the strains not susceptible to at least one antibiotic belonging to each of the tested antimicrobial categories were classified as extensively drug resistant (XDR).20
Results
A total of 353 (75.90%) strains of E. coli were isolated from fecal samples collected from 465 piglets. The STEC strains were identified in 33.11% (154/465) of the sampled piglets and detected in 43.60% (154/353) of the piglets carrying E. coli. Among STEC strains, 22.30% (79/154) strains were carriers of the stx1 gene, 6.80% (24/154) of the stx2 gene and 14.40% (51/154) of both the stx1 and the stx2 genes. The rfbO157 genetic marker was amplified by PCR in 47.40% (73/154) of the STEC strains. In the supplied food, STEC strains were isolated from 14.80% (8/54) of the sampled food mix and identified in 16.00% (8/50) of the sampled food mix carrying E. coli; while, the rfbO157 genetic marker was amplified in 25.00% (2/8) of the STEC strains.
Antimicrobial susceptibility profile. Susceptibility of STEC strains to antibiotics used to treat gastrointestinal infections caused by E. coli was evaluated. More than three thirds of the identified STEC strains were not susceptible to ampicillin and carbenicillin. Half of the strains were not susceptible to tetracycline. The susceptibility of O157 strain was also evaluated; more than three thirds of the strains were not susceptible to ampicillin, carbenicillin and tetracycline (Table 2). The frequency of genes encoding β-lactamase in all 142 STEC strains not susceptible to ampicillin was also assessed. The blaTEM gene (52) was the most frequent among STEC strains, followed by blaCTX (25) and blaSHV (8). Seventeen STEC strains not susceptible to ampicillin turned out to be carriers of both the blaTEM genes and blaCTX genes; while, five strains were carriers of the blaTEM, blaCTX and blaSHV genes (Table 3).
Table 2.
Antimicrobial non-susceptibility profile of the Shiga toxin-producing Escherichia coli (STEC) strains
| Antimicrobial | Percentage of non-susceptibility (n) | ||||
|---|---|---|---|---|---|
| STEC (n = 154) | stx 1 (n = 79) | stx 2 (n = 24) | stx 1 /stx 2 (n = 51) | O157 (n = 73) | |
| Ampicillin | 81.10 (125) | 89.80 (71) | 83.30 (20) | 66.60 (34) | 91.70 (67) |
| Amoxicillin-clavulanic acid | 25.30 (39) | 26.50 (21) | 20.80 (5) | 25.50 (13) | 43.80 (32) |
| Carbenicillin | 66.80 (103) | 67.10 (53) | 70.80 (17) | 64.70 (33) | 82.10 (60) |
| Oxacillin | 5.80 (9) | 3.80 (3) | 8.30 (2) | 7.80 (4) | 10.90 (8) |
| Amikacin | 20.70 (32) | 17.70 (14) | 25.00 (6) | 23.50 (12) | 36.90 (27) |
| Gentamicin | 15.60 (24) | 12.60 (10) | 20.80 (5) | 17.60 (9) | 28.70 (21) |
| Netilmicin | 11.70 (18) | 11.40 (9) | 16.70 (4) | 9.80 (5) | 19.10 (14) |
| Cefalotin | 26.60 (41) | 25.30 (20) | 33.30 (8) | 25.50 (13) | 42.40 (31) |
| Cefotaxime | 11.00 (17) | 11.40 (9) | 12.50 (3) | 9.80 (5) | 23.20 (17) |
| Ciprofloxacin | 11.70 (18) | 11.40 (9) | 16.70 (4) | 9.80 (5) | 21.90 (16) |
| Norfloxacin | 14.90 (24) | 16.40 (13) | 25.00 (6) | 9.80 (5) | 30.40 (22) |
| Chloramphenicol | 27.90 (43) | 32.90 (26) | 20.80 (5) | 23.50 (12) | 34.20 (25) |
| Trimethoprim-sulfamethoxazole | 21.40 (33) | 25.30 (20) | 29.00 (7) | 11.70 (6) | 35.60 (26) |
| Nitrofurantoin | 8.40 (12) | 10.30 (8) | 8.30 (2) | 3.90 (2) | 12.30 (9) |
| Tetracycline | 48.00 (74) | 43.00 (34) | 62.50 (15) | 49.00 (25) | 83.50 (61) |
Table 3.
Genes of extended spectrum β-lactamase producing Shiga toxin-producing Escherichia coli (STEC) strains isolated from piglets
| STEC groups (n) | Non-susceptible profile β-lactamic: Ampicillin | β-lactamase gene | Number of isolates |
|---|---|---|---|
| STEC stx1 (79) | 71 |
TEM
CTX SHV TEM+CTX TEM+CTX+SHV |
32 13 5 8 2 |
| STEC stx2 (24) | 20 |
TEM
CTX SHV TEM+CTX TEM+CTX+SHV |
5 4 1 3 2 |
| STEC stx1/stx2 (51) | 51 |
TEM
CTX SHV TEM+CTX TEM+CTX+SHV |
15 8 2 6 1 |
Of the identified STEC strains, 48.70% (n = 75) were not susceptible to at least one antibiotic in three different anti-microbial categories; these strains were considered as MDR. Also, 1.90% (n = 3) of STEC strains, predominantly STEC stx2, were not susceptible to at least one antibiotic in all tested categories; these strains were considered XDR. Class 1 integrons were detected in 74 STEC strains from 142 isolates not susceptible to ampicillin. Class 2 integrons were not detected (Table 4). The susceptibility of STEC strains isolated in food mix was evaluated. All the identified STEC strains were not susceptible to ampicillin and carbenicillin. Eight STEC strains not susceptible to ampicillin turned out to be carriers of the blaTEM gene; while, two STEC strains not susceptible to ampicillin turned out to be carriers of both the blaTEM genes and blaCTX genes. Of the identified STEC strains (n = 8), two strains were considered as MDR, class 1 integrons were detected in four STEC strains and class 2 integrons were not detected (data not showed).
Table 4.
Non susceptible profiles in STEC strains isolates from piglets
| Class (No.) | Non susceptible phenotype | No. | ESBL gene (No.) | Integron class | Genetic marker | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| STEC stx1 (n=79) | ||||||||||
| (0) | 0 | 4 | ||||||||
| (1) | AMP | 9 | TEM (4), CTX (5) | |||||||
| (1) | CAR | 1 | ||||||||
| (1) | AMP CAR | 13 | TEM (7), CTX (6) | |||||||
| (2) | AMP STX | 1 | Class 1 | |||||||
| (2) | AMP CEF | 1 | ||||||||
| (2) | AMP CHL | 1 | ||||||||
| (2) | AMP NIT | 1 | ||||||||
| (2) | AMP CAR CEF | 2 | TEM | Class 1 | ||||||
| (2) | AMP AMK CAR | 2 | TEM | Class 1 | ||||||
| MDR (3) | AMP STX TET | 1 | CTX | Class 1 | O157 | |||||
| (2) | AMP CAR TET | 1 | TEM | Class 1 | ||||||
| MDR (3) | CHL STX TET | 1 | Class 1 | O157 | ||||||
| (2) | AMP CAR CHL | 3 | TEM (3) | |||||||
| MDR (3) | AMP CHL TET | 1 | TEM | Class 1 | ||||||
| MDR (3) | AMP CAR CHL TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (3) | CAR CEF CTX NOR | 1 | O157 | |||||||
| MDR (3) | AMP AMC CHL TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (3) | AMP CAR STX TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (3) | AMP CAR CHL TET | 2 | SHV (1) | Class 1 | ||||||
| MDR (4) | CAR CEF CHL TET | 1 | Class 1 | O157 | ||||||
| (2) | AMP AMC CAR CEF | 1 | TEM | O157 | ||||||
| MDR (3) | AMP AMK CEF CTX | 1 | TEM | O157 | ||||||
| MDR (4) | AMP CHL STX TET | 1 | CTX | Class 1 | O157 | |||||
| MDR (3) | AMP CAR CTX TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (3) | AMP AMC CAR STX TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (3) | AMP AMC AMK CAR TET | 1 | CTX | Class 1 | O157 | |||||
| MDR (3) | AMP CAR CEF CTX NET | 1 | SHV | O157 | ||||||
| MDR (4) | AMP AMK CEF STX TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (5) | AMP CAR NOR CHL STX TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (3) | AMP AMC CAR CIP NOR TET | 1 | CTX | Class 1 | O157 | |||||
| MDR (5) | AMP AMC AMK CEF STX TET | 1 | SHV | Class 1 | O157 | |||||
| MDR (4) | AMP AMC CAR CEF CHL STX | 1 | TEM | Class 1 | ||||||
| MDR (4) | AMP AMK CAR GEN NET CTX TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR AMK GEN CIP NOR | 1 | CTX | O157 | ||||||
| MDR (5) | AMP AMC CAR AMK GEN CEF NET | 1 | TEM | Class 1 | O157 | |||||
| MDR (6) | AMP AMC CAR CHL STX NIT TET | 3 | TEM+CTX+ SHV | Class 1 | ||||||
| MDR (5) | AMP AMC CAR OXA CEF CHL STX TET | 1 | TEM+CTX | Class 1 | ||||||
| MDR (6) | AMP NET CTX CIP NOR CHL TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (6) | AMP AMC CAR AMK GEN CEF CHL TET | 1 | CTX | Class 1 | O157 | |||||
| MDR (6) | AMP AMC CAR CEF CHL STX NIT TET | 1 | TEM | Class 1 | O157 | |||||
| MDR (7) | AMP CAR GEN CEF CIP NOR STX NIT TET | 1 | TEM+CTX | Class 1 | O157 | |||||
| MDR (5) | AMP CAR GEN NET CEF CTX CIP NOR TET | 1 | TEM+CTX | Class 1 | O157 | |||||
| MDR (6) | AMP AMC CAR AMK CIP NOR CHL NIT TET | 1 | TEM+CTX | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR AMK GEN NET CEF NOR TET | 1 | TEM+CTX+SHV | Class 1 | O157 | |||||
| MDR (7) | AMP AMC CAR AMK NET NOR CHL STX NIT TET | 1 | TEM+CTX | Class 1 | O157 | |||||
| MDR (7) | AMP AMC CAR OXA GEN NET CIP NOR CHL STX TET | 1 | TEM+CTX | Class 1 | O157 | |||||
| MDR (7) | AMP AMC CAR OXA AMK GEN CEF CTX CIP NOR CHL STX TET | 1 | TEM+CTX | Class 1 | O157 | |||||
| MDR (7) | AMP AMC CAR GEN NET CEF CTX CIP NOR CHL STX TET | 1 | TEM+CTX+SHV | Class 1 | O157 | |||||
| STEC stx2 (24) | ||||||||||
| (0) | 0 | (2) | ||||||||
| (1) | AMP | (4) | ||||||||
| (1) | AMP CAR | (1) | ||||||||
| MDR (3) | CAR CHL TET | (1) | Class 1 | O157 | ||||||
| (2) | AMP CAR TET | (2) | TEM | Class 1 | O157 | |||||
| MDR (3) | CAR NOR CHL | (1) | O157 | |||||||
| MDR (3) | AMP CAR NOR STX | (1) | TEM | Class 1 | O157 | |||||
| MDR (3) | AMP CAR NET TET | (1) | CTX | Class 1 | O157 | |||||
| MDR (3) | AMP CAR CEF TET | (2) | TEM (1), CTX (1) | Class 1 | ||||||
| MDR (3) | AMP CAR SXT TET | (1) | SHV | Class 1 | ||||||
| MDR (4) | AMP CEF SXT TET | (1) | CTX | Class 1 | O157 | |||||
| MDR (3) | AMP CAR CEF TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (4) | AMP AMC CAR AMK GEN TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| MDR (4) | AMP AMK CAR GEN STX TET | (1) | CTX | Class 1 | O157 | |||||
| MDR (6) | AMP AMC CAR OXA AMK GEN NET CEF CTX CIP NOR CHL TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| MDR (6) | AMP AMC CAR AMK GEN NET CEF CTX CIP NOR SXT TET | (1) | TEM+CTX+SHV | Class 1 | O157 | |||||
| XDR (8) | AMP AMC CAR AMK NET CEF CIP NOR CHL SXT NIT TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| XDR (8) | AMP AMC CAR OXA AMK GEN CEF CTX CIP NOR CHL SXT NIT TET | (1) | TEM+CTX+SHV | Class 1 | O157 | |||||
| STEC stx1/stx2 (n=51) | ||||||||||
| (0) | 0 | (10) | ||||||||
| (1) | AMP | (3) | ||||||||
| (1) | CHL | (2) | ||||||||
| (1) | CAR | (2) | ||||||||
| (1) | AMP CAR | (3) | TEM (3) | |||||||
| (2) | CEF TET | (1) | ||||||||
| (1) | AMP AMK CAR | (1) | CTX | O157 | ||||||
| (2) | AMP AMK GEN | (1) | CTX | |||||||
| (2) | AMP CAR GEN | (1) | CTX | |||||||
| (2) | AMP CAR TET | (1) | TEM | Class 1 | O157 | |||||
| (2) | AMP CAR CHL | (1) | CTX | O157 | ||||||
| (2) | AMP CAR GEN NET | (1) | CTX | O157 | ||||||
| MDR (3) | AMP CAR CIP TET | (1) | SHV | Class 1 | O157 | |||||
| MDR (3) | AMP CAR CEF TET | (1) | SHV | Class 1 | O157 | |||||
| MDR (4) | CAR CHL STX TET | (1) | Class 1 | O157 | ||||||
| MDR (3) | AMP CAR CHL TET | (2) | TEM (2) | Class 1 | O157 | |||||
| MDR (4) | AMP CAR AMK CEF TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (4) | AMP CAR CIP STX TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (4) | AMP CAR AMK GEN TET | (1) | CTX | Class 1 | O157 | |||||
| MDR (3) | AMP AMC CAR OXA CIP TET | (1) | CTX | Class 1 | O157 | |||||
| MDR (4) | AMP CAR CHL STX TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (3) | AMP CAR GEN NET CEF | (1) | TEM | Class 1 | O157 | |||||
| MDR (4) | AMP CAR AMK CTX TET | (1) | CTX | Class 1 | O157 | |||||
| MDR (3) | AMP AMC CAR AMK GEN TET | (1) | TEM | Class 1 | ||||||
| MDR (4) | AMP AMC AMK CEF CTX TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (4) | AMP AMC CAR CHL NIT TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR CEF NOR STX TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (4) | AMP AMC CAR OXA CIP NOR CHL TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR AMK CEF CHL TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR AMK CEF NOR TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (4) | AMC AMK CAR CEF CTX CHL TET | (1) | TEM | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR GEN NET CEF STX TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR AMK CEF CTX NOR TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| MDR (5) | AMP AMC CAR OXA AMK GEN NET CEF NOR TET | (1) | TEM+CTX | Class 1 | O157 | |||||
| XDR (8) | AMP AMC CAR OXA GEN NET CEF CTX CIP CHL STX NIT TET | (1) | TEM+CTX+SHV | Class 1 | O157 | |||||
MDR; Multi Drug-Resistant, XDR; Extensively Drug-Resistant; AMP: Ampicillin, AMC: Amoxicillin, AMK: Amikacin, CAR: Carbenicillin, OXA: Oxacillin, GEN: Gentamicin, NET: Netilmicin, CEF: Cefalotin, NOR: Norfloxacin, CTX: Cefotaxime CIP: Ciprofloxacin, CHL: Chloramphenicol, STX: Trimethoprim-sulfamethoxazole, NIT: Nitrofurantoin TET: Tetracycline.
Discussion
Swine backyard farming systems are common in Mexico and developing countries worldwide. However, important problems have been described in these production systems, such as the lack of adequate technologies and technical assistance, which leads to a high prevalence of diseases.21 This is the first study conducted in Mexico that reports the presence of STEC (43.60%) carrying the stx1 and/or stx2 genes in piglets from backyard systems. Of these STEC strains, 47.40% amplified the rfbO157 genetic marker. In contrast, another study has shown low presence of the stx1 and stx2 genes (0.10% and 1.00%, respectively) in STEC strains isolated from piglets of farms located in the central region of Mexico.7 In this context, a low prevalence (2.10%) of E. coli O157 was reported in pigs from farms located in the central region of Mexico.8 Unlike intensive and semi- intensive swine systems, in which there is a strict control of the personnel and application of sanitary measures, backyard systems are characterized by poor animal health management and, in many cases, no biosecurity measures, explaining the contrast in these results.
Our hypothesis is that the acquisition and dissemination of STEC O157 and non-O157 strains in piglets from back-yard systems could be related to the origin of the food provided to pigs and to direct contact between pigs, humans and pets. Unlike specialized farms, in backyard systems the pigs diet is based on fruit and vegetable waste, stale tortillas and bread, etc. This variety of ingredients is associated with a greater variability of the intestinal bacterial population, which is considered beneficial to the health of host.22 However, there is a high risk of conta-mination with the pathogens present in the pigs’ food due to poor sanitary management. Pathotypes of diarrheagenic E. coli, including STEC, have been identified in ready-to-eat cooked vegetable salads (1.40%) distributed by restaurants in Mexico23 and tomatoes (6.00%) purchased from public markets in Pachuca, Mexico.24 These results are consistent with the findings of our work, suggesting that STEC could be acquired and disseminated through the vegetable waste provided as a feed to pigs. Although the sample size analyzed here was small, we did detect STEC O157 in supplied food, indicating that these foods represent a potential source of bacterial dissemination for piglets. Swine backyard farming systems are characterized by the involvement of women and other family members in animal management activities as well as people outside the family during the sale process. Direct contact between humans and animals is a major factor in the spread of STEC, especially in developing countries with a high prevalence of gastrointestinal infections in humans caused by diarrheagenic E. coli.25,26 Moreover, the presence of pets and other domestic animals (cattle, sheep and birds) inside the house as well as proliferation of harmful fauna are also factors involving in the spread of harmful germs, since this type of animals are important reservoirs of diarrheagenic E. coli, including the O157:H7 serotype, participating in gastrointestinal infections in humans.27,28
In this work, STEC strains were resistant mainly to ampicillin (81.10%), followed by carbenicillin (66.80%) and tetracycline (48.00%). This trend was similar for STEC O157. In addition, about half of the identified STEC strains were resistant to at least one antibiotic in three of the tested antimicrobial categories (MDR). The results of the present work showed a high frequency of resistance mainly to β-lactams in STEC strains isolated form piglets of backyard systems, similar to what being reported by other authors in intensive and semi-intensive swine systems. For example, high resistance to tetracycline (79.57%) and ampicillin (48.79%) was reported in STEC strains isolated from pig feces of farms located in the city of Chongqing, China.29 Recently, the phenotype of resistance to ampicillin (99.50%) and carbenicillin (99.00%) was identified in STEC strains isolated from pigs of farms located in central Thailand.30 It has been reported that some beta-lactam antibiotics, such as penicillin and ampicillin, lose viability when use as a first-line of choice during chemotherapeutic treatment of an infectious process affecting pigs throughout the world due to the acquisition of resistance mechanisms.5 The present study demonstrated the presence of genes encoding β-lactamase in STEC strains isolated from piglets of backyard systems, mainly the blaTEM (52), blaCTX (25) and blaSHV (8) genes. Moreover, class 1 integrons were also identified. These findings are consistent with those reported by Samanta et al.31 The presence of E. coli with high resistance to ampicillin is common in piglets due to the presence of ESBLs blaCTX-M and blaTEM and class 1 integrons.32,33 The results confirm that backyard piglets can be a carrier of ESBL- producing E. coli; however, further studies regarding the presence of specific bla profile are suggested. Bacteria carrying class 1 integrons play a role in the spread of resistance genes and pose a serious health risk to humans if transmitted to them.34
The present study showed that piglets from backyard systems are carriers of STEC O157 and non-O157 strains not susceptible to penicillins and tetracyclines. It also showed that the most of these strains have genes that code ESBLs, mainly blaTEM, blaCTX and blaSHV. In addition, we showed that STEC O157 and non-O157 could be acquired and disseminated through the food mix provided to pigs. These results could be used for the development of more efficient preventive measures, diagnostic methods and antimicrobial alternatives in swine backyard farming systems, in order to reduce a risk for public health.
Conflicts of interest
The authors declare that the study was carried out in the absence of commercial or financial relationships that could be interpreted as a potential conflict of interest and all persons gave their informed consent prior to their inclusion in the study.
Acknowledgment
Thanks to Edgar Ruiz Sánchez and Diana Laura Vázquez Vázquez for their collaboration in field and laboratory work. Thanks are also given to the people working in swine backyard farms in Chiapas, Mexico, for their collaboration with this study.
References
- 1.Heo JM, Opapeju FO, Pluske J R, et al. Gastrointestinal health and function in weaned pigs: a review of feeding strategies to control post‐weaning diarrhoea without using in‐feed antimicrobial compounds. J Anim Physiol Amim Nutr (Berl) 2013;97(2):207–237. doi: 10.1111/j.1439-0396.2012.01284.x. [DOI] [PubMed] [Google Scholar]
- 2.Malgarin CM, Takeuti KL, de Lara AC, et al. Virulence factors and antimicrobial resistance profile of Escherichia coli isolated from nursery piglets and drinking water. Acta Sci Vet. 2018;46(1):6. [Google Scholar]
- 3.Yang GY, Guo L, Su JH, et al. Frequency of diarrheagenic virulence genes and characteristics in Escherichia coli isolates from pigs with diarrhea in china. Micro-organisms. 2019;7(9):308. doi: 10.3390/microorganisms7090308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ibama O, Ibegbulem EO, Onwuli D, et al. The health implication of enterohaemorrhagic Escherichia coli (EHEC) 0157: H7: A review on haemolytic uraemic syndrome. AJRIMPS. 2019;7(4):1–10. [Google Scholar]
- 5.Ungureanu V, Corcionivoschi N, Gundogdu O, et al. The emergence of beta-lactamase producing Escherichia coli and the problems in assessing their potential contribution to foodborne illness: a review. AgroLife Sci J. 2019;8(1):248–260. [Google Scholar]
- 6.Smith MG, Jordan D, Gibson JS, et al. Phenotypic and genotypic profiling of antimicrobial resistance in enteric Escherichia coli communities isolated from finisher pigs in Australia. Aust Vet J. 2016;94(10):371–376. doi: 10.1111/avj.12491. [DOI] [PubMed] [Google Scholar]
- 7.Toledo A, Gómez D, Cruz C, et al. Prevalence of virulence genes in Escherichia coli strains isolated from piglets in the suckling and weaning period in Mexico. J Med Microbiol. 2012;61(Pt 1):148–156. doi: 10.1099/jmm.0.031302-0. [DOI] [PubMed] [Google Scholar]
- 8.Callaway TR, Anderson RC, Tellez G, et al. Prevalence of Escherichia coli O157 in cattle and swine in central Mexico. J Food Prot. 2004;67(10):2274–2276. doi: 10.4315/0362-028x-67.10.2274. [DOI] [PubMed] [Google Scholar]
- 9.Montero-López EM, Martínez-Gamba RG, Herradora-Lozano MA, et al. Alternatives for small-scale pig production [Spanish] Coyoacan, Mexico: National Autonomous University of Mexico. 2015:17–35. [Google Scholar]
- 10.Cerna-Cortés JF, Gómez-Aldapa CA, Rangel-Vargas E, et al. Presence of indicator bacteria, Salmonella and diarrheagenic E coli pathotypes on mung bean sprouts from public markets in Pachuca, Mexico. Food Control. 2013;31(2):280–283. [Google Scholar]
- 11.Tsai YL, Palmer CJ, Sangermano LR. Detection of Escherichia coli in sewage and sludge by polymerase chain reaction. Appl Environ Microbiol. 1993;59(2):353–357. doi: 10.1128/aem.59.2.353-357.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Tarr PI, Gordon CA, Chandler WL. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 2005;365(9464):1073–1086. doi: 10.1016/S0140-6736(05)71144-2. [DOI] [PubMed] [Google Scholar]
- 13.Gutiérrez-Jiménez J, Luna-Cazárez LM, Mendoza-Orozco MI, et al. Organization, maintenance, and preservation of the bacterial culture collection of the biological sciences institute, university of science and arts of Chiapas (UNICACH), Mexico [Spanish] Rev Soc Ven Microbiol. 2015;35(2):95–102. [Google Scholar]
- 14.López-Saucedo C, Cerna JF, Villegas-Sepulveda N, et al. Single multiplex polymerase chain reaction to detect diverse loci associated with diarrheagenic Escherichia coli. Emerg Infect Dis. 2003;9(1):127–131. doi: 10.3201/eid0901.01-0507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx stx2 eaeA enterohemorrhagic coli hlyA, rfbO111, and rfbO157. J Clin Microbiol. 1998;36(2):598–602. doi: 10.1128/jcm.36.2.598-602.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ahmed AM, Motoi Y, Sato M, et al. Zoo animals as reservoirs of gram-negative bacteria harboring integrons and antimicrobial resistance genes. Appl Environ Microbiol. 2007;73(20):6686–6690. doi: 10.1128/AEM.01054-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Mazel D, Dychinco B, Webb VA. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother. 2000;44(6):1568–1574. doi: 10.1128/aac.44.6.1568-1574.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.White PA, McIver CJ, Rawlinson WD. Integrons and gene cassettes in the enterobacteriaceae. Antimicrob Agents Chemother. 2001;45(9):2658–2661. doi: 10.1128/AAC.45.9.2658-2661.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Wayne PA. Performance standards for antimicrobial susceptibility testing; 24th informational supplement. Document M100-S24 Clinical and laboratory standards institute (CLSI) 2014;50:110. [Google Scholar]
- 20.Magiorakos AP, Srinivasan A, Carey RB, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- 21.Saavedra‐Montañez M, Carrera‐Aguirre V, Castillo‐Juárez H, et al. Retrospective serological survey of influenza viruses in backyard pigs from Mexico City. Influenza Other Respir Viruses. 2013;7(5):827–832. doi: 10.1111/irv.12063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chen L, Wang L, Yassin AK, et al. Genetic characterization of extraintestinal Escherichia coli isolates from chicken, cow and swine. AMB Express. 2018;8(1):117 . doi: 10.1186/s13568-018-0646-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Bautista‐De León H, Gómez‐Aldapa CA, Rangel‐Vargas E, et al. Frequency of indicator bacteria, Salmonella and diarrhoeagenic Escherichia coli pathotypes on ready‐to‐eat cooked vegetable salads from Mexican restaurants. Lett Appl Microbiol. 2013;56(6):414–420. doi: 10.1111/lam.12063. [DOI] [PubMed] [Google Scholar]
- 24.Gómez-Aldapa CA, Torres-Vitela Mdel R, Acevedo-Sandoval OA, et al. Presence of Shiga toxin–producing Escherichia coli enteroinvasive E coli, enteropathogenic E coli, and enterotoxigenic E coli on tomatoes from public markets in Mexico. J Food Prot. 2013;76(9):1621–1625. doi: 10.4315/0362-028X.JFP-13-071. [DOI] [PubMed] [Google Scholar]
- 25.Paredes‐Paredes M, Okhuysen PC, Flores J, et al. Seasonality of diarrheagenic Escherichia coli pathotypes in the US students acquiring diarrhea in Mexico. J Travel Med. 2011;18(2):121–125. doi: 10.1111/j.1708-8305.2010.00488.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Canizalez-Roman A, Flores-Villaseñor HM, Gonzalez-Nuñez E, et al. Surveillance of diarrheagenic Escherichia coli strains isolated from diarrhea cases from children, adults and elderly at Northwest of Mexico. Front Microbiol. 2016;7:1924. doi: 10.3389/fmicb.2016.01924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Amézquita-López BA, Quiñones B, Soto-Beltrán M, et al. Antimicrobial resistance profiles of Shiga toxin-producing Escherichia coli O157 and Non-O157 recovered from domestic farm animals in rural communities in Northwestern Mexico. Antimicrob Resist Infect Control. 2016;5:1. doi: 10.1186/s13756-015-0100-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Hasan MS, Yousif A, Alwan MJ. Detection of virulent genes in E coli O157: H7 isolated from puppies and adult dogs by polymerase chain reaction. Res J Vet Pract. 2016;4(1):1–6. [Google Scholar]
- 29.Meng Q, Bai X, Zhao A, et al. Characterization of Shiga toxin-producing Escherichia coli isolated from healthy pigs in China. BMC Microbiol. 2014;14:5. doi: 10.1186/1471-2180-14-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Buranasinsup S, Kulpeanprasit S, Kong-ngoen T, et al. Prevalence of the multi-drug resistance of Shiga toxin-producing Escherichia coli isolated from pigs in central Thailand. Chiang Mai J Sci. 2018;45(1):21–32. [Google Scholar]
- 31.Samanta I, Joardar SN, Mahanti A, et al. Approaches to characterize extended spectrum beta-lactamase/beta-lactamase producing Escherichia coli in healthy organized vis-a-vis backyard farmed pigs in India. Infect Genet Evol. 2015;36:224–230. doi: 10.1016/j.meegid.2015.09.021. [DOI] [PubMed] [Google Scholar]
- 32.Changkaew K, Intarapuk A, Utrarachkij F, et al. Antimicrobial resistance, extended-spectrum β-lactamase productivity, and class 1 integrons in Escherichia coli from healthy swine. J Food Prot. 2015;78(8):1442–1450. doi: 10.4315/0362-028X.JFP-14-445. [DOI] [PubMed] [Google Scholar]
- 33.Delmani FA, Jaran AS, Al Tarazi Y, et al. Characterization of ampicillin resistant gene (blaTEM-1) isolated from E coli in Northern Jordan. Asian J Biomed Pharmaceut Sci. 2017;7(61):11–15. [Google Scholar]
- 34.Nagachinta S, Chen J. Integron-mediated antibiotic resistance in Shiga toxin-producing Escherichia coli. J Food Prot. 2009;72(1):21–27. doi: 10.4315/0362-028x-72.1.21. [DOI] [PubMed] [Google Scholar]