Skip to main content
BMC Oral Health logoLink to BMC Oral Health
. 2022 Aug 13;22:350. doi: 10.1186/s12903-022-02384-y

Inhibitory effect of ficin on Candida albicans biofilm formation and pre-formed biofilms

Jiantao Yu 1,#, Fan Wang 1,#, Yan Shen 1,#, Fangzheng Yu 1, Lili Qiu 1, Lingjun Zhang 1, Yanhan Chen 1, Qing Yuan 1, Huan Zhang 1,, Yan Sun 1,, Keke Zhang 1,2,
PMCID: PMC9375270  PMID: 35964034

Abstract

Background

To investigate the effect of ficin, a type of proteases, on Candida albicans (C. albicans) biofilm, including forming and pre-formed biofilms.

Methods

Crystal violet tests together with colony forming unit (CFU) counts were used to detect fungal biofilm biomass. Live/dead staining of biofilms observed by confocal laser scanning microscopy was used to monitor fungal activity. Finally, gene expression of C. albicans within biofilms was assessed by qRT-PCR.

Results

According to our results, biofilm biomass was dramatically reduced by ficin in both biofilm formation and pre-formed biofilms, as revealed by the crystal violet assay and CFU count (p < 0.05). Fungal activity in biofilm formation and pre-formed biofilms was not significantly influenced by ficin according to live/dead staining. Fungal polymorphism and biofilm associated gene expression were influenced by ficin, especially in groups with prominent antibiofilm effects.

Conclusions

In summary, ficin effectively inhibited C. albicans biofilm formation and detached its preformed biofilm, and it might be used to treat C. albicans biofilm associated problems.

Keywords: Candida albicans, Ficin, Biofilm formation, Pre-formed biofilm

Introduction

Fungal infections are usually difficult to diagnose, with delayed diagnosis, and efficacious antifungal strategies are lacking [1]. Candida albicans (C. albicans) is the most familiar opportunistic pathogen and is regarded as the foremost cause of invasive candidiasis. Infection of this fungus can be transmitted from the mucosa to the bloodstream, and is especially severe in immunocompromised people, such as AIDS patients [2, 3]. As an opportunistic oral fungal pathogen, C. albicans has been reported to be closely related to denture stomatitis and has been used in several protocols to construct an animal model of denture stomatitis [4, 5]. In addition, C. albicans prevalence shows a positive correlation with severity of early childhood caries, and a synergic relationship between this fungus and opportunistic cariogenic Streptococcus mutans has been gradually revealed [6]. What’s more, C. albicans colonization may be related to peri-implant infections in the oral cavity [7].

Most diseases caused by C. albicans are associated with its biofilm. Progressive C. albicans biofilms, once formed, can provide protection to the fungi residing within it, thus making C. albicans resistant to most antifungal drugs, including fluconazole and amphotericin B, which are commonly used [8]. C. albicans within biofilms is 1000 times more resistant to antifungal agent than planktonic cells [9]. Antifungal drug resistance mechanisms of C. albicans biofilms include extracellular matrix, persister cells, enhanced drug efflux pumps, enhancive cell density, stress response while depressed metabolic activity [2, 10]. Moreover, commonly used antifungal agents have facilitated the appearance and dissemination of drug resistant C. albicans such as fluconazole-resistant clinical isolates [11, 12]. Therefore, a new strategy to control C. albicans biofilms is urgent needed to manage C. albicans biofilm associated diseases especially in the so called post-antibiotic era.

Enzymatic degradation of biofilms has been proposed as an alternative strategy due to superiority of rare resistance development [13]. Ficin is a sulfhydryl proteases with inherent peroxidase-like activity [14]. The antibiofilm effect of ficin was first reported in Staphylococcus aureus (S. aureus) together with Staphylococcus epidermidis (S. epidermidis), and these two kinds of biofilms were effectively destroyed by this protease [15]. When ficin is immobilized in chitosan, it also shows anti-biofilm and wound-healing activity [16]. Our previous study displayed that ficin not only significantly inhibits biofilm formation of opportunistic cariogenic Streptococcus mutans (S. mutans), but also suppresses its cariogenic virulence including acid production and EPS synthesis [17]. Most recently, ficin was reported to have effectivity against Salmonella Enterica serovar Thompson biofilms [18]. However, the effect of ficin on fungal biofilms remains unknown. Therefore, in this study, we evaluated the ficin’s anti-biofilm characteristics of ficin against C. albicans biofilm to evaluate its potential to control C. albicans biofilms.

Materials and methods

Fungi and culture conditions

C. albicans strain SC5314 used in this experiment (Institute of Stomatology, School and Hospital of Stomatology, Wenzhou Medical University). Briefly, a single clone grown on Sabouraud’s agar plates (SDA; Solarbio Science& Technology Co., Ltd., China) was cultured overnight for proliferation in yeast peptone dextrose broth (YPD, Solarbio Science & Technology Co., Ltd., Beijing, China) at 37 °C under aerobic conditions.

A total of 5 × 105 CFU/mL of overnight cultured C. albicans was inoculated in morpholinepropanesulfonic acid (MOPS, Solarbio Science & Technology Co., Ltd., Beijing, China) modified RPMI-1640 media (Gibco, Bethesda, MD, USA) with different concentrations of ficin, followed by 48 h of biofilm formation. For pre-formed biofilm, after 48 h of biofilm formation without ficin, the culture media was replaced by MOPS modified RPMI-1640 media supplemented with different ficin contents for another 48 h. Media without ficin was set as a blank control and 80 μM fluconazole served as a positive control [8].

Crystal violet assay

Biofilms in 96-well platez (200 μL culture volume) were fixed with methanol, and stained for 30 min by 0.1% (w/v) crystal violet. The dyed biofilms were observed and photographed using a stereomicroscope (Nikon SMZ800N, Nikon Corporation, Japan). Then, 150 μL of 33% acetic acid solution was added to elute the crystal violet stain from the biofilms. The eluent was transferred to another 96-well plates, and the OD at 590 nm was recorded by a microplate reader (SpectraMaxM5, Molecular Devices, USA) [19].

Colony forming unit (CFU) counts

Biofilms in 96-well plates (200 μL culture volume) were collected in PBS and sonicated/vortexed completely. After gradient dilution with PBS, 100 μL of fungal suspensions was spread onto SDA solid medium and cultured for 48 h at 37 °C aerobically to support fungal growth. The clones grown on medium were counted [20].

Live/dead staining and CLSM imaging

Heat-polymerized acrylic resin (Jianchi Dental Equipment, Changzhi, China) was used to support C. albicans in this test as previously described [20]. Specimens were cut into 1 cm squares that were 2 mm thick, polished and sterilized by ethylene oxide.

Biofilms in 24-well plates (2 mL culture volume) were dyed by LIVE/DEAD® BacLight™ Bacterial Viability Kits (Thermo Fisher Scientific, Waltham, MA, USA) according to the product manual. Both SYTO 9 and propidium iodide were used to stain live and dead C. albicans for 30 min, respectively. The stained biofilms were randomly captured with a 60 × objective lens by CLSM (Nikon A1, Nikon Corporation, Japan). The live fungal ratio was analyzed according to fungal coverage with Image Pro Plus 6.0 software (Media Cybernetics, Inc., Silver Spring, MD, USA) based on 5 random pictures in each group.

RNA isolation and qRT-PCR

C. albicans biofilms in 96-well plate (200 μL culture volume) were collected, and total RNA was isolated by a TRIzol dependent method [8]. Then quality testing of RNA was conducted by Nanodrop 2000 spectrophotometer (Fisher Scientific, Pittsburg, PA, USA) and electrophoresis. Then reverse transcription was presented using a PrimeScript™ RT reagent Kit with gDNA Eraser (Takara Bio Inc., Otsu, Japan) following the manufacturer's instructions. The qRT-PCR was carried out with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus, Takara Bio Inc., Otsu, Japan), and the reaction volume was 20 μL (primers are listed in Table 1). PCR procedure (95 °C for 30 s, and 35 cycles including 95 °C for 5 s, 55 °C for 30 s, 72 °C for 30 s) was run in a Step One Plus Real-Time PCR System (Applied Biosystems, CA, USA), and gene expression was normalized by the 2−ΔΔCT method.

Table 1.

Primers used in this study

Primers Nucleotide sequence (5’-3’) References
18S-f CACGACGGAGTTTCACAAGA [21]
18S-r CGATGGAAGTTTGAGGCAAT
hwp1-f GCTCCTGCTCCTGAAATGAC [21]
hwp1-r CTGGAGCAATTGGTGAGGTT
ywp1-f GCTACTGCTACTGGTGCTA [21]
ywp1-r AACGGTGGTTTCTTGAC
als1-f GACTAGTGAACCAACAAATACCAGA [22]
als1-r CCAGAAGAAACAGCAGGTGA
als3-f CAACTTGGGTTATTGAAACAAAAACA [21]
als3-r AGAAACAGAAACCCAAGAACAACC
bgl2-f ATGGGTGATTTGGCTTTCAA [23]
bgl2-r CAGCTGGACCAAGGTTTTGT

Statistical analysis

All tests were repeated at least three times independently. All data are presented as the mean ± standard deviation. One-way analysis of variance (ANOVA) and Tukey’s multiple comparison tests were used to analyze statistical significance (p < 0.05) using SPSS software 16.0 (SPSS Inc., Chicago, IL, USA).

Results

Fungal biofilm formation and pre-formed biofilms were suppressed by ficin, as revealed by the crystal violet assay

Images of crystal violet stained biofilms showed that 15.625 and 31.25 μg/mL ficin had limited effects on biofilm formation and pre-formed biofilms of C. albicans (Fig. 1). Treatment with 62.5 and 125 μg/mL ficin not only inhibited C. albicans biofilm formation, but also significantly suppressed pre-formed biofilms (Fig. 1). Little biofilm was detected in these two concentrations. Fluconazole, a positive control, significantly suppressed biofilm formation but had little effect on pre-formed biofilm (Fig. 1). Quantitative results were similar, with 62.5 and 125 μg/mL ficin prominently reducing the OD (Fig. 2).

Fig. 1.

Fig. 1

Crystal violet stained biofilms

Fig. 2.

Fig. 2

Quantitative analysis of crystal violet stained biofilm. A OD values of 48 h C. albicans biofilm (biofilm formation). B OD values of 96 h C. albicans biofilm (pre-formed biofilm). Different letters indicate statistically significant differences

Ficin decreased the CFU of C. albicans biofilm

Ficin decreased the CFU of C. albicans both in biofilm formation and pre-formed biofilms (Fig. 3). During biofilm formation, 62.5 and 125 μg/mL ficin and fluconazole caused reduction of 2.57, 2.21 and 1.53 log10(CFU) respectively (Fig. 3A, p < 0.05). For pre-formed biofilm, fluconazole only led to 0.25 log10(CFU) decrease, which revealed a limited effect (Fig. 3B). However, 62.5 and 125 μg/mL ficin caused decreases of 2.14 and 2.05 log10(CFU) (Fig. 3B, p  < 0.05).

Fig. 3.

Fig. 3

CFU of C. albicans. A 48 h C. albicans biofilm (biofilm formation). B 96 h C. albicans biofilm (pre-formed biofilms). Different letters indicate statistically significant differences

Ficin did not change fungal activity within biofilms

According to live/dead staining results, ficin did not significantly change fungal activity within biofilm formation and pre-formed biofilms (Figs. 4 and 5). Although 62.5 and 125 μg/mL ficin inhibited and detached biofilms, respectively, it did not prominently influence fungal activity. Fluconazole seemed to affect biofilm activity in biofilm formation and had a limited effect on pre-formed biofilms (Figs. 4 and 5).

Fig. 4.

Fig. 4

Live/dead staining of C. albicans biofilm. Live C. albicans stained green, dead C. albicans stained red, scale bar = 50 μm

Fig. 5.

Fig. 5

Live C. albicans within biofilms. A Live fungi ratio in 48 h C. albicans biofilm (biofilm formation). B Live fungi ratio in 96 h C. albicans biofilm (pre-formed biofilms). Different letters indicate statistically significant differences

Ficin affected gene expression of C. albicans within two biofilm associated processes

During C. albicans biofilm formation, expression of most gene including hwp1, als1, als3, and bgl2 was suppressed significantly in the 62.5 and 125 μg/mL groups (p < 0.05); however, ywp1 was upregulated but not significantly (Fig. 6A, p  > 0.05). In the 15.625 and 31.25 μg/mL groups, hwp1, als3 and bgl2 were upregulated, but als1 was downregulated (Fig. 6A, p  < 0.05). In pre-formed biofilms, ywp1 and als3 were upregulated, whereas hwp1 (except 62.5 μg/mL) was downregulated significantly in all ficin groups (Fig. 6B, p  < 0.05). hwp1, als1 and bgl2 expression was inhibited in the 15.625 and 31.25 μg/mL groups (Fig. 6B, p  < 0.05). In the 62.5 and 125 μg/mL group, als1 and bgl2 were upregulated (Fig. 6B, p  < 0.05).

Fig. 6.

Fig. 6

Gene expression of C. albicans in biofilms. A Gene expression of fungi in 48 h C. albicans biofilm (biofilm formation). B Gene expression of fungi in 96 h C. albicans biofilm (pre-formed biofilms). * indicated statistically significant differences when compared with control

Discussion

In this study, we explored the effect of ficin on C. albicans biofilms. Our results showed that ficin not only inhibits C. albicans biofilm formation, but also detaches pre-formed biofilms, which for the first time indicates its anti-fungal biofilm effect. Previous studies have confirmed that ficin controls bacterial biofilms, including those of S. aureus, S. epidermidis, S. mutans and Salmonella Enterica [1518]. Combined with the findings of this study, we conclude that ficin controls not only bacterial biofilms but also fungal biofilms. Pre-formed biofilms show stronger resistance to stress than biofilm formation [24]. Therefore, studies have reported that antibiofilm agents, including the antifungal fluconazole, inhibit biofilm formation but do not suppress pre-formed biofilms [2426]. The effectiveness of ficin on both biofilm formation and pre-formed biofilm reveals its advantage over fluconazole to some extent, except for the preponderance of enzymatic degradation to control biofilms, rare resistance [13].

The antibiofilm mechanism of ficin against C. albicans in this study is unknown. Our data show that ficin barely influences fungal activity within biofilms, as disclosed by biofilm live/dead staining, which was consistent with previous studies [15, 17]. In S. aureus and S. epidermidis biofilms, matrix proteins are hydrolyzed by ficin without germicidal effects [15]. For biofilm formation of S. mutans, ficin reduced total biofilm proteins and decreased the molecular weight of isolated extracellular proteins, but did not affect bacterial growth and activity [17]. The extracellular matrix plays a vital role in mature C. albicans biofilm structures, in which the most abundant components are proteins (approximately 55%) [27]. Because it is a protease, the anti-biofilm effect of ficin might occur through degradation of extracellular proteins. In addition, as ficin showed an anti-biofilm effect without a fungicidal effect, to eradicate biofilms thoroughly, combination therapy that combines ficin with a fungicidal agent without antagonistic action might be a good choice, enabling ficin to inhibit and detach biofilms and fungicidal agents to eliminate nonbiofilm cells simultaneously [15].

Polymorphism is important for the pathogenicity of C. albicans. The hyphal form is more invasive, whereas the yeast form is related to dissemination [28]. This might partly explain why the yeast form associated gene ywp1 tended to upregulated but the hypha formation related gene hwp1 was suppressed at ficin concentrations that both inhibited biofilm formation and detached pre-formed biofilms significantly. Biofilm associated genes, including adhesion als1, als3 and bgl2, which encode β-glucans, were repressed during the biofilm formation process, whereas t they were upregulated in preformed biofilms under marked antibiofilm ficin concentration. One possibility is that C. albicans within pre-formed biofilm upregulates those biofilm genes to attempt to maintain its biofilm form and that C. albicans barely formes biofilms at those concentrations, thus downregulating expression of als1, als3 and bgl2 in preparation for diffusion to another hospitable environment in the biofilm formation process.

One limitation of the present study is that a biofilm model involving one species was used. In nature, biofilms always exist in mixed-species, including C. albicans associated infections [29, 30]. Multi-species biofilms show more resistance than single species biofilms [31, 32]. In addition, the virulence and pathogenicity of C. albicans are enhanced in biofilms containing oral bacteria [33]. Though ficin showed a predominant anti-C. albicans biofilm effect at a safe concentration in this study, complex C. albicans involved biofilm models or in situ C. albicans containing biofilm models should be used to further evaluate the anti-biofilm effect of ficin [17]. Furthermore, in vivo experiments are encouraged to assess antifungal biofilm effect of ficin. Moreover, modifying materials with ficin to obtain antibiofilm characteristics is a research direction for the future.

Conclusions

Ficin exhibits an inhibitory effect against C. albicans biofilm, and it might has potential in the management of C. albicans biofilm associated problems.

Acknowledgements

We thank Yi Zheng and Yuqin Zhu from the School of Laboratory Medicine and Life Science, Wenzhou Medical University, and Zhejiang Provincial Key Laboratory for Medical Genetics for their CLSM support.

Author contributions

KZ, YS and HZ conceived the idea and designed this project. JY, FW and YS did all the experiments. YC, QY, LQ, FY and LZ analyzed the data. KZ, YS and HZ discussed and interpreted the results. JY, FW and YS wrote the manuscript. KZ and YS critically revised the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by National Natural Science Foundation of China under grant (82001041), Zhejiang Provincial Natural Science Foundation of China (LGF20H140001).

Availability of data and materials

Data are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Jiantao Yu, Fan Wang and Yan Shen contributed to this article equally.

Contributor Information

Huan Zhang, Email: 406470854@qq.com.

Yan Sun, Email: sunyan2246@wmu.edu.cn.

Keke Zhang, Email: zhangkk@wmu.edu.cn.

References

  • 1.Kalimuthu S, Alshanta OA, Krishnamoorthy AL, Pudipeddi A, Solomon AP, McLean W, et al. Small molecule based anti-virulence approaches against Candida albicans infections. Crit Rev Microbiol. 2022; 1–27. 10.1080/1040841X.2021.2025337. [DOI] [PubMed]
  • 2.Lohse MB, Gulati M, Johnson AD, Nobile CJ. Development and regulation of single- and multi-species Candida albicans biofilms. Nat Rev Microbiol. 2018;16(1):19–31. doi: 10.1038/nrmicro.2017.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liao B, Ye X, Chen X, Zhou Y, Cheng L, Zhou X, Ren B. The two-component signal transduction system and its regulation in Candida albicans. Virulence. 2021;12(1):1884–1899. doi: 10.1080/21505594.2021.1949883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Moraes GS, Albach T, Ramos IE, Kopacheski MG, Cachoeira VS, Sugio CYC, et al. A novel acrylic resin palatal device contaminated with Candida albicans biofilm for denture stomatitis induction in Wistar rats. J Appl Oral Sci. 2021;29:e20200865. doi: 10.1590/1678-7757-2020-0865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhou Y, Cheng L, Lei YL, Ren B, Zhou X. The Interactions between Candida albicans and mucosal immunity. Front Microbiol. 2021;12:652725. doi: 10.3389/fmicb.2021.652725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Du Q, Ren B, He J, Peng X, Guo Q, Zheng L, et al. Candida albicans promotes tooth decay by inducing oral microbial dysbiosis. ISME J. 2021;15(3):894–908. doi: 10.1038/s41396-020-00823-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Souza JGS, Costa RC, Sampaio AA, Abdo VL, Nagay BE, Castro N, et al. Cross-kingdom microbial interactions in dental implant-related infections: Is Candida albicans a new villain? iScience. 2022;25(4):103994. doi: 10.1016/j.isci.2022.103994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.He Y, Cao Y, Xiang Y, Hu F, Tang F, Zhang Y, et al. An evaluation of norspermidine on anti-fungal effect on mature Candida albicans biofilms and angiogenesis potential of dental pulp stem cells. Front Bioeng Biotechnol. 2020;8:948. doi: 10.3389/fbioe.2020.00948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Nett JE, Sanchez H, Cain MT, Ross KM, Andes DR. Interface of Candida albicans biofilm matrix-associated drug resistance and cell wall integrity regulation. Eukaryot Cell. 2011;10(12):1660–1669. doi: 10.1128/EC.05126-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lee Y, Puumala E, Robbins N, Cowen LE. Antifungal drug resistance: molecular mechanisms in Candida albicans and beyond. Chem Rev. 2021;121(6):3390–3411. doi: 10.1021/acs.chemrev.0c00199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Harley BK, Neglo D, Tawiah P, Pipim MA, Mireku-Gyimah NA, Tettey CO, et al. Bioactive triterpenoids from Solanum torvum fruits with antifungal, resistance modulatory and anti-biofilm formation activities against fluconazole-resistant Candida albicans strains. PLoS ONE. 2021;16(12):e0260956. doi: 10.1371/journal.pone.0260956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Reis de Sá LF, Toledo FT, Gonçalves AC, Sousa BA, Dos Santos AA, Brasil PF, et al. Synthetic organotellurium compounds sensitize drug-resistant Candida albicans clinical isolates to fluconazole. Antimicrob Agents Chemother. 2016;61(1):e01231. doi: 10.1128/AAC.01231-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Pleszczyńska M, Wiater A, Bachanek T, Szczodrak J. Enzymes in therapy of biofilm-related oral diseases. Biotechnol Appl Biochem. 2017;64(3):337–346. doi: 10.1002/bab.1490. [DOI] [PubMed] [Google Scholar]
  • 14.Yang Y, Shen D, Long Y, Xie Z, Zheng H. Intrinsic peroxidase-like activity of ficin. Sci Rep. 2017;7:43141. doi: 10.1038/srep43141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Baidamshina DR, Trizna EY, Holyavka MG, Bogachev MI, Artyukhov VG, Akhatova FS, et al. Targeting microbial biofilms using Ficin, a nonspecific plant protease. Sci Rep. 2017;7:46068. doi: 10.1038/srep46068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Baidamshina DR, Koroleva VA, Trizna EY, Pankova SM, Agafonova MN, Chirkova MN, et al. Anti-biofilm and wound-healing activity of chitosan-immobilized Ficin. Int J Biol Macromol. 2020;164:4205–4217. doi: 10.1016/j.ijbiomac.2020.09.030. [DOI] [PubMed] [Google Scholar]
  • 17.Sun Y, Jiang W, Zhang M, Zhang L, Shen Y, Huang S, et al. The inhibitory effects of ficin on Streptococcus mutans biofilm formation. Biomed Res Int. 2021;2021:6692328. doi: 10.1155/2021/6692328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Nahar S, Jeong HL, Cho AJ, Park JH, Han S, Kim Y, et al. Efficacy of ficin and peroxyacetic acid against Salmonella enterica serovar Thompson biofilm on plastic, eggshell, and chicken skin. Food Microbiol. 2022;104:103997. doi: 10.1016/j.fm.2022.103997. [DOI] [PubMed] [Google Scholar]
  • 19.Hu X, Wang M, Shen Y, Zhang L, Pan Y, Sun Y, et al. Regulatory effect of Irresistin-16 on competitive dual-species biofilms composed of Streptococcus mutans and Streptococcus sanguinis. Pathogens. 2022;11(1):70. doi: 10.3390/pathogens11010070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang K, Ren B, Zhou X, Xu HH, Chen Y, Han Q, et al. Effect of antimicrobial denture base resin on multi-species biofilm formation. Int J Mol Sci. 2016;17(7):1033. doi: 10.3390/ijms17071033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Feldman M, Ginsburg I, Al-Quntar A, Steinberg D. Thiazolidinedione-8 alters symbiotic relationship in C. albicans-S. mutans dual species biofilm. Front Microbiol. 2016;7:140. doi: 10.3389/fmicb.2016.00140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Srivastava N, Ellepola K, Venkiteswaran N, Chai LYA, Ohshima T, Seneviratne CJ. Lactobacillus Plantarum 108 inhibits Streptococcus mutans and Candida albicans mixed-species biofilm formation. Antibiotics (Basel) 2020;9(8):478. doi: 10.3390/antibiotics9080478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lobo CIV, Rinaldi TB, Christiano CMS, De Sales LL, Barbugli PA, Klein MI. Dual-species biofilms of Streptococcus mutans and Candida albicans exhibit more biomass and are mutually beneficial compared with single-species biofilms. J Oral Microbiol. 2019;11(1):1581520. doi: 10.1080/20002297.2019.1581520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhang K, Xiang Y, Peng Y, Tang F, Cao Y, Xing Z, et al. Influence of fluoride-resistant Streptococcus mutans within antagonistic dual-species biofilms under fluoride in vitro. Front Cell Infect Microbiol. 2022;12:801569. doi: 10.3389/fcimb.2022.801569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Khan MS, Ahmad I. Antibiofilm activity of certain phytocompounds and their synergy with fluconazole against Candida albicans biofilms. J Antimicrob Chemother. 2012;67(3):618–621. doi: 10.1093/jac/dkr512. [DOI] [PubMed] [Google Scholar]
  • 26.Uppuluri P, Srinivasan A, Ramasubramanian A, Lopez-Ribot JL. Effects of fluconazole, amphotericin B, and caspofungin on Candida albicans biofilms under conditions of flow and on biofilm dispersion. Antimicrob Agents Chemother. 2011;55(7):3591–3593. doi: 10.1128/AAC.01701-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Heredia M, Andes D. Contributions of extracellular vesicles to fungal biofilm pathogenesis. Curr Top Microbiol Immunol. 2021;432:67–79. doi: 10.1007/978-3-030-83391-6_7. [DOI] [PubMed] [Google Scholar]
  • 28.Mayer FL, Wilson D, Hube B. Candida albicans pathogenicity mechanisms. Virulence. 2013;4(2):119–128. doi: 10.4161/viru.22913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wan SX, Tian J, Liu Y, Dhall A, Koo H, Hwang G. Cross-kingdom cell-to-cell interactions in cariogenic biofilm initiation. J Dent Res. 2021;100(1):74–81. doi: 10.1177/0022034520950286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Gulati M, Nobile CJ. Candida albicans biofilms: development, regulation, and molecular mechanisms. Microbes Infect. 2016;18(5):310–321. doi: 10.1016/j.micinf.2016.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hwang G, Liu Y, Kim D, Li Y, Krysan DJ, Koo H. Candida albicans mannans mediate Streptococcus mutans exoenzyme GtfB binding to modulate cross-kingdom biofilm development in vivo. PLoS Pathog. 2017;13(6):e1006407. doi: 10.1371/journal.ppat.1006407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lee KW, Periasamy S, Mukherjee M, Xie C, Kjelleberg S, Rice SA. Biofilm development and enhanced stress resistance of a model, mixed-species community biofilm. ISME J. 2014;8(4):894–907. doi: 10.1038/ismej.2013.194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cavalcanti YW, Morse DJ, da Silva WJ, Del-Bel-Cury AA, Wei X, Wilson M, et al. Virulence and pathogenicity of Candida albicans is enhanced in biofilms containing oral bacteria. Biofouling. 2015;31(1):27–38. doi: 10.1080/08927014.2014.996143. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are available from the corresponding author on reasonable request.


Articles from BMC Oral Health are provided here courtesy of BMC

RESOURCES