Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Sep 28.
Published in final edited form as: Methods Mol Biol. 2021;2323:249–265. doi: 10.1007/978-1-0716-1499-0_18

Expression and Purification of tRNA/pre-miRNA-Based Recombinant Noncoding RNAs

Mei-Juan Tu, Halley K Wright, Neelu Batra, Ai-Ming Yu
PMCID: PMC9516694  NIHMSID: NIHMS1836965  PMID: 34086286

Abstract

Research on RNA function and therapeutic potential is dominated by the use of chemoengineered RNA mimics. Recent efforts have led to the establishment of novel technologies for the production of recombinant or bioengineered RNA molecules, which should better recapitulate the structures, functions and safety profiles of natural RNAs because both are produced and folded in living cells. Herein, we describe a robust approach for reproducible fermentation production of bioengineered RNA agents (BERAs) carrying warhead miRNAs, siRNAs, aptamers, or other forms of small RNAs, based upon an optimal hybrid tRNA/pre-miRNA carrier. Target BERA/sRNAs are readily purified by fast protein liquid chromatography (FPLC) to a high degree of homogeneity (>97%). This approach offers a consistent high-level expression (>30% of total bacterial RNAs) and large-scale production of ready-to-use BERAs (multiple to tens milligrams from 1 L bacterial culture).

Keywords: Bioengineering, Noncoding RNA (ncRNA), microRNA (miR), Small interfering RNA (siRNA), tRNA, Pre-miRNA, Bacteria, Expression, Purification, Fast protein liquid chromatography (FPLC)

1. Introduction

Noncoding RNAs (ncRNAs) such as microRNAs (miRNAs or miRs) and long noncoding RNAs (lncRNAs) derived from the genome play vital roles in the control of essentially all cellular processes through the regulation of target gene expression, and many ncRNAs are involved in the initiation and progression of various types of diseases [1, 2]. On the other hand, small interfering RNAs (siRNAs), antisense RNAs (asRNAs) or antisense oligonucleotides (ASOs), aptamers, small guide RNAs (sgRNAs), and other forms of small RNAs (sRNAs) are important tools and have been widely used for functional studies. In addition, with a number of novel RNA drugs approved by the US Food and Drug Administration, there is growing interest in developing the next generation of RNA therapeutics [3–6] which hold great promise to expand the range of druggable targets. Nevertheless, current research and development is limited to the use of RNA molecules or mimics made by chemical synthesis or enzymatic reactions in vitro [7, 8], or viral and nonviral plasmid DNA-based materials [9].

Efforts have been made recently to develop new technologies to produce recombinant or bioengineered RNA molecules in living cells for RNA research and development [10–14], similar as protein research and drug development that has found ultimate success by using recombinant or bioengineered proteins made and folded in living cells. The transfer RNA (tRNA) scaffold was first utilized for large-scale fermentation production of recombinant RNAs carrying target RNAs around 20–300 nt in length [10, 11], while expression efficiency truly depends on the stability of chimeric RNA. Recognizing that only particular tRNA fused pre-miRNA (tRNA/pre-miRNA) molecules could be expressed in bacteria at meaningful levels for further processing [12, 15–17], we first demonstrated the robustness and versatility of using high-expressing hybrid tRNA/pre-miRNA molecule (e.g., accounting for 10–20% of total bacterial RNA) as a carrier for the expression of bioengineered RNA agents (BERAs) bearing various types of warhead sRNAs, including miRNAs, siRNAs, and aptamers [12]. The pre-miR-34a sequence within the tRNA/pre-miRNA carrier was further refined to achieve a consistently higher level of expression of more than 30 target BERAs (each >30% of total bacterial RNA) [13]. High-level expression also facilitated the purification of target BERAs, which were demonstrated to be biologically and pharmacologically active in the control of target gene expression, modulation of cellular processes, and management of specific diseases in preclinical models [12, 13, 18–21].

Herein, we describe a protocol for the expression and purification of recombinant or bioengineered RNAs using the optimal tRNA/pre-miR-34a carrier. In particular, the miR-34a duplexes may be substituted by target miRNAs, siRNAs (e.g., GFP-siRNA), or other forms of sRNAs along with respective complementary sequences (Fig. 1). Meanwhile, RNA aptamers (theophylline aptamer (TPA), EpCAM aptamer (EpCAMA), etc.) or other single-stranded RNAs can be directly inserted into the tRNA/pre-miRNA carrier to achieve overexpression (Fig. 1). Detailed instructions are provided in the following sections for reproducible production of high-purity BERA/sRNAs ready for basic and applied studies.

Fig. 1.

Fig. 1

Open in a new tab

Design of bioengineered noncoding RNA agents (BERAs) using a tRNA/pre-miRNA carrier and construction of target BERA/sRNA-expressing plasmid. (a) Target miRNA or siRNA (red) and complementary sequence (green) may be designed to replace miR-34a within the tRNA/pre-miR-34a carrier to achieve high-yield production of BERA/miRNA or siRNA. In addition, an aptamer or sRNA can be inserted between tRNA and pre-miRNA toward the expression of target BERA/sRNA. (b) Cloning primers are designed to span the 15-nt from restriction enzyme sites (blue), overlapping pre-miR-34a spanning toward the inserted sRNA on both ends. The tRNA sequence is highlighted in yellow, and pre-miRNA sequence is in black in which miRNA duplex sequences are substituted with target siRNA or miRNA (red) and complementary sequence (green). (c) Coding sequence of BERA/sRNA is cloned into the pBSTNAV vector consisting of a strong lipoprotein (lpp) gene promotor, a ribosomal RNA operon transcription terminator (rrnC). Positive plasmids could be selected through ampicillin resistance and verified by DNA sequencing

2. Materials

All solutions were made by using distilled and deionized (dd) water and biological grade reagents. Prepare and store all reagents at room temperature (unless stated otherwise). All procedures are carried out by following standard RNase-free practices (see Note 1).

2.1. Cloning, Bacterial Transformation and Culture

2.1.1. Laboratory Equipment

  1. Thermocycler.

  2. Water bath.

  3. Agarose Horizontal Electrophoresis System.

  4. Incubator.

  5. Shaking Incubator.

  6. Magnetic stirrer.

  7. Laboratory balances.

  8. NanoDrop.

  9. Gel Imaging System.

  10. Microcentrifuge.

2.1.2. Bacterial Culture and Transformation

  1. Diethyl pyrocarbonate (DEPC) water: Add 1 mL of DEPC (>97%) to 1 L dd water and stir at room temperature for 2 h (see Note 2). Autoclave at 121 °C for 30 min. Store at 4 °C.

  2. 10× TAE buffer: Dissolve 48.4 g of Tris base, 57.1 mL of glacial acetic acid (100%), and 9.4 g of EDTA in 800 mL autoclaved DEPC water. Adjust volume to 1 L with autoclaved DEPC water. Store at 4 °C.

  3. 3% Agarose gel: Add 1.50 g of agarose to 50 mL of 1× TAE buffer, and heat the mixture until agarose is dissolved. When the solution cools to ~55 °C, add 1 μL of ethidium bromide. Immediately pour the solution into the previously prepared gel mold.

  4. Ampicillin stock solution (100 mg/mL, 1000×): Dissolve 5 g of ampicillin powder in 50 mL of 70% ethanol. Store at −20 °C.

  5. LB or 2×YT medium: Add 20 g of LB Broth powder or 31 g of 2×YT medium broth to 1 L of dd water and sterilize by autoclaving at 121 °C for 15 min. If required, antibiotics (ampicillin was used in this study) can be added to a final concentration of 100 mg/L, after the autoclaved medium is cooled (~55 °C). The medium can be stored at 4 °C for up to 1 month.

  6. LB agar plate: Add 15 g of agar, 20 g of LB Broth powder to 1 L of dd water. Autoclave the mixture at 121 °C for 15 min. After ampicillin was added, pour a layer of solution into the Petri dishes to cover the plate (about 15 mL/plate). Leave the plates on the bench for at least 1 h to solidify. Store at 4 °C.

  7. Stellar™ Competent Cells (E. coli HST08 strain) (Takara Bio, Mountain View, CA).

  8. E. coli DH5α competent cells.

  9. Sequences of model BERAs and corresponding cloning primers are listed in Table 1.

  10. pBSTNAV plasmid containing tRNA/pre-miR-34a scaffold [13] may be utilized as a template for PCR cloning (see Note 3).

  11. PCR Premix: CloneAmp HiFi PCR Premix (Takara).

  12. Vector digestion enzymes and buffer: restriction enzyme EagI-HF® (20,000 units/mL, New England Biolabs, Ipswich, MA), SacII (20,000 units/mL, New England Biolabs), 10× CutSmart® Buffer (New England Biolabs).

  13. Infusion enzyme and buffer: 5× In-Fusion HD Enzyme Premix (Takara).

  14. Gel cleanup kit: NucleoSpin gel and PCR cleanup kit (Takara).

  15. Plasmid extraction: QlAprep Spin Miniprep Kit (QIAGEN, Germantown, MD).

Table 1.

Sequences of target BERAs and respective cloning primers. The pBSTNAV plasmid containing the optimum tRNA/pre-miR-34a carrier [13] was used as a template during PCR cloning, except for BERA/GFP-siRNA whose cloning primers were extended to have about 15 nt overlaps

BERA Length (nt) Sequence (5′→3′) Cloning primers (5′→3′)
BERA/miR-34a-5p 180 GGCUACGUAGCUCAGUUGG
 UUAGAGCAGCGGCCGGGCCAGCUGUGAGUGUUUC
 UUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAA
 UAGUAAGGAAGCAAUCAGCAAGUAUACUGCCC
 UAGAAGUGCUGCACGUUGUUGGCCCCCGCGGG
 UCACAGGUUCGAAUCCCGUCGUAGCCACCA		 F

R		 GTTAGAGCAGCGGCCGGGCCAGCTGTGAGTGTTTC
 TTTG
TCGAACCTGTGACCCGCGGGGGCCAACAACG
 TGCAGC
BERA/GFP-siRNA 180 GGCUACGUAGCUCAGUUGG
 UUAGAGCAGCGGCCGGGCCAGCUGUGAGUGUUUC
 UUAGUUGUACUCCAGCUUGUGCCCUGUGAGCAA
 UAGUAAGGAAGGGCACAAGUGGUAGUACAACC
 UAGAAGUGCUGCACGUUGUUGGCCCCCGCGGG
 UCACAGGUUCGAAUCCCGUCGUAGCCACCA		 F


R		 TCGAACCTGTGACCCGCGGGGGCCAACAACG
 TGCAGCACTTCTAGGTTGTACTACCACTTGTGCCC
 TTCCTTACTATTGC
GTTAGAGCAGCGGCCGGGCCAGCTGTGAGTGTTTC
 TTAGTTGTACTCCAGCTTGTGCCCTGTGAGCAATAG
 TAA
BERA/TPA3′ + 5′ 246 GGCUACGUAGCUCAGUUGG
 UUAGAGCAGCGGCCGGGCGA
 UACCAGCCGAAAGGCCCUUGGCAGCGUCGGCCAGC
 UGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGG
 UUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAG
 UAUACUGCCCUAGAAGUGCUGCACGUUG
 UUGGCCCGGCGAUACCAGCCGAAAGGCCC
 UUGGCAGCGUCCCGCGGGUCACAGGUUCGAA
 UCCCGUCGUAGCCACCA		 F


R		 GTTAGAGCAGCGGCCGGGCGA
 TACCAGCCGAAAGGCCCTTGGCAGCGTCGGCCAGC
 TGTGAGTGTTT
TCGAACCTGTGACCCGCGGGACGCTGCCAAGGGCC
 TTTCGGCTGGTATCGCCGGGCCAACAACGTGCAGC
BERA/EpCAMA3′ 199 GGCUACGUAGCUCAGUUGG
 UUAGAGCAGCGGCCGGGCCAGCUGUGAGUGUUUC
 UUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAA
 UAGUAAGGAAGCAAUCAGCAAGUAUACUGCCC
 UAGAAGUGCUGCACGUUGUUGGCCCGCGACUGG
 UUACCCGGUCGCCGCGGGUCACAGGUUCGAA
 UCCCGUCGUAGCCACCA		 F
R		 GTTAGAGCAGCGGCCGGGCCAGCTGTGAGTGTTTCT
TCGAACCTGTGACCCGCGGCGACCGGGTAACCAG
 TCGCGGGCCAACAACGTGCAGCAC
Open in a new tab

2.2. RNA Extraction and Denaturing Urea Polyacrylamide Gel Electrophoresis (PAGE)

2.2.1. Laboratory Equipment

  1. Vertical Electrophoresis Cell.

  2. Mini-PROTEAN® Tetra Cell Casting Module and comb, 15-well, 1.0 mm, 26 μL.

  3. Platform Rocker.

2.2.2. RNA Extraction and Denaturing Urea PAGE

  1. 10 mM magnesium acetate–Tris-hydrochloride (HCl) solution: Add 214.45 mg of magnesium acetate and 121.14 mg of Tris–HCl to 90 mL of autoclaved DEPC water. Adjust pH to 7.4 and adjust volume to 100 mL. Store at 4 °C.

  2. 5 M sodium chloride (NaCl): Add 29.22 g of NaCl to 90 mL of autoclaved DEPC water. Mix and adjust volume to 100 mL. Store at 4 °C.

  3. 10% Ammonium persulphate solution (APS): Dissolve 1 g of APS in 10 mL of autoclaved DEPC water. Store aliquots (1 mL of each) at −20 °C.

  4. Denaturing urea (8 M) polyacrylamide (8%) gel solution (one gel): Add 0.6 mL of 10 × TAE, 1.2 mL of 40% acrylamide–bis (19:1, 1610144, Bio-Rad), and 3.0 g urea to a 50 mL conical tube. Adjust volume to 6 mL with autoclaved DEPC water. Dissolve the urea by vortex and shaking. Mix the solution with 30 μL of 10% APS, 6 μL TEMED, and cast gel with a Cell Casting Module (see Note 4).

2.3. RNA Purification

2.3.1. Laboratory Equipment

  1. NGC Quest™ 10 FPLC System.

  2. BioFrac™ Fraction Collector.

  3. Enrich™ Q 10 × 100 column.

  4. Centrifuge.

  5. Amicon® Ultra-2 centrifugal filter concentrator (2 mL, 30K, MilliporeSigma, St. Louis, MO).

2.3.2. Solutions

  1. Buffer A: 10 mM NaH2PO4. Dissolve 1.38 g of NaH2PO4 in 900 mL of DEPC water. Adjust pH to 7.0 and volume to 1000 mL. Store at 4 °C.

  2. Buffer B: 10 mM NaH2PO4, 1 M NaCl. Dissolve 1.38 g of NaH2PO4 and 58.44 g NaCl in 900 mL of DEPC water. Adjust pH to 7.0 and volume to 1000 mL. Store at 4 °C.

2.4. RNA Purity Analyses

2.4.1. Laboratory Equipment

  1. Shimadzu LC-20 AD Prominence Ultra-Fast Liquid Chromatography system equipped with binary pumps, an on-line degassing unit, an autosampler a UV photodiode array detector, and a column oven (Shimadzu, Kyoto, Japan).

  2. XBridge OST C18 column (2.1 × 50 mm, 2.5 μm particle size; Waters, Milford, MA).

  3. Microplate reader.

2.4.2. Solutions and Reagents

  1. Hexafluoro-2-propanol (HFIP).

  2. Buffer C: Add 0.6 mL of TAE (8.6 mM) and 5.3 mL of HFIP (100 mM) to 450 mL of HPLC grade water. Adjust volume to 500 mL with water.

  3. Buffer D: Add 0.6 mL of TAE (8.6 mM) and 5.3 mL of HFIP (100 mM) to 450 mL of methanol. Adjust volume to 500 mL with methanol.

  4. Endotoxin determination kit: Pyrogent-5000 kinetic LAL assay (Lonza, Walkersville, MD).

3. Methods

3.1. Design and Construction of BERA/sRNA-Expressing Plasmid

3.1.1. Design of Target BERA/sRNA and Corresponding Cloning Primers

  1. Define target miRNA, siRNA, or sRNA sequences (see Fig. 1 and Table 1).

  2. Add two restriction sites, EagI and SacII, to the 5′ and 3′ end of the target BERA coding sequence, respectively, to infuse the target BERA to the expression plasmid, pBSTNAV.

  3. Design the forward and reverse cloning primers by spanning upstream and downstream 15 nt from restriction site (see Note 5).

  4. Extend the primers to overlap pre-miR-34a spanning toward the target ncRNA on both ends (see Fig. 1, Note 6, and Table 1).

  5. The mature miR-34a-5p and complementary sequences within the tRNA/pre-miR-34a carrier are replaced by target miRNA, siRNA or sRNA sequences (see Fig. 1, Note 7). In this chapter, GFP-siRNA is used as a model to illustrate the expression and purification of target BERA/sRNA (Table 1).

  6. An RNA aptamer or sRNA can be inserted to the 3′ or 5′ of the pre-miR-34a (see Fig. 1a). For example, theophylline aptamer (TPA) is inserted to both the 3′ and 5′ of pre-miR-34a to construct BERA/TPA3′ + 5′, and EpCAM aptamer (EpCAMA) is inserted to the 3′ of pre-miR-34a to construct BERA/EpCAMA3′ (Table 1).

3.1.2. PCR Amplification of Target Insert

  1. Add 2 μL of forward primer (10 μM) and reverse primer (10 μM), 25 μL of PCR Premix to 21 μL dd water to make a 50-μL PCR reaction system.

  2. Run PCR under the following condition:
    1. 95.0 °C for 30 s.
    2. 95.0 °C for 10 s.
    3. 68.0 °C for 30 s (see Note 8).
    4. 72.0 °C for 30 s.
    5. Repeat steps (b)–(d) for 30 cycles.
    6. 72.0 °C for 10 min.
    7. 4 °C forever.

3.1.3. Vector Preparation, DNA Product Isolation, and Ligation

  1. Add 1 μg of pBSTNAV-tRNA/pre-miR-34a plasmid [13], 1 μL of restriction enzyme EagI, 1 μL of restriction enzyme SacII, and 5 μL of 10× CutSmart Buffer to dd water to a 50-μL reaction mixture.

  2. Incubate at 37 °C for 2 h.

  3. Load the PCR products or digested vector products into an agarose gel (50 μL/well).

  4. Separate the target band from others by running gel electrophoresis (100 V for about 20 min).

  5. Cut and collect the band containing target fragment in an open UV detector box.

  6. Isolate target DNA from the collected gel using a gel cleanup kit.

  7. Elute the sample with 25 μL (PCR product) or 50 μL dd water (digestion product).

  8. Mix 7 μL of PCR cleanup product and 1 μL of vector isolated above with 2 μL of 5 × In-Fusion HD Enzyme Premix.

  9. Incubate at 50 °C for 15 min.

3.1.4. Transformation

  1. Add 5 μL of ligation product to 20 μL of Stellar™ Competent Cells, and mix gently with pipette tips. Incubate on ice for 30 min.

  2. Incubate the mixture in water bath at 42 °C for 45 s (do not shake the tubes).

  3. Put tubes back on ice for 2 min.

  4. Add 800 μL of LB medium (without antibiotics) and mix with pipette gently.

  5. Shake the cultures at 225 rpm at 37 °C for 60 min.

  6. Plate the transformation on a LB-ampicillin agar plate and incubate overnight at 37 °C.

3.1.5. Plasmid Amplification, Mini Preparation, and Sequence Verification

  1. Pick up 3–5 colonies from the LB-agar plate and transfer each into a 50-mL conical tube containing 15 mL LB-ampicillin medium.

  2. Shake overnight at 225 rpm at 37 °C.

  3. Extract plasmids from the overnight culture (see Note 9).

  4. Send out the plasmids for sequencing. The plasmids with correct sequences are thus used for RNA expression.

3.2. Fermentation Production of Target BERA/sRNA

3.2.1. Small-Scale Expression of BERA/sRNAs

  1. Mix 50–100 ng of sequence-confirmed plasmids with 20 μL of Stellar™ Competent Cells and incubate on ice for 30 min (see Note 10).

  2. Follow the rest steps described in Subheading 3.1.4.

  3. Add the transformation product to 15 mL of ampicillin-containing 2 × YT medium in a 50 mL conical tube (see Note 11).

  4. Shake overnight at 225 rpm and 37 °C.

3.2.2. Large-Scale Expression of BERA/sRNAs

  1. Mix 100–200 ng of sequence-confirmed plasmids with 30 μL Stellar™ Competent Cells and incubate on ice for 30 min (see Note 10).

  2. Follow the rest steps described in Subheading 3.1.4.

  3. Add the transformation product to 600 mL ampicillin-containing 2 × YT medium in a 2-L flask.

  4. Shake overnight at 225 rpm at 37 °C.

3.2.3. Isolation of Total Bacterial RNA

  1. Transfer the broth to multiple 250-mL round bottom bottles, centrifuge at 9000 × g and 4 °C for 6 min (for small-scale RNA expression, centrifuge the tube directly, see Note 11), and then remove the supernatant.

  2. Add 4 mL (400 μL for small-scale expression) of 10 mM magnesium acetate—Tris–HCl solution to resuspend the pellet.

  3. Combine and transfer the resuspension to a 50-mL tube (about 20 mL in each tube; about 500 μL in a 2-mL tube for small-scale), and then add equal volume of phenol (about 20 mL; around 500 μL for small-scale).

  4. Shake the tubes gently on a rocker for 20–60 min.

  5. Centrifuge at 10,000 × g at 4 °C for 10 min. Transfer the aqueous phase (about 16 mL; ~400 μL for small-scale) to fresh tube(s).

  6. Add 10% volume (about 1.6 mL; ~40 μL for small-scale) of 5 M NaCl, and centrifuge at 10,000 × g and 4 °C for 10 min.

  7. Carefully transfer the supernatant to new 50-mL conical tube (s) (2-mL tube(s) for small-scale).

  8. Add 2 volumes (about 30 mL; ~800 μL for small-scale) of pure ethanol (<99%), keep the tube in a −80 °C freezer for 1 h and centrifuge at 10,000 × g and 4 °C for 10 min.

  9. Dissolve the pellet in 1–2 mL (200 μL for small-scale) of autoclaved DEPC water (see Note 11).

  10. Centrifuge the RNA solution at 16,000 × g and 4 °C for 15 min.

  11. Collect the supernatant and filter the sample through a 0.22 μm sterile syringe filter.

  12. Determine the RNA quality and concentration by using Nano-Drop 2000 with a UV-Vis Spectrophotometer.

3.2.4. Verification of Target BERA/sRNA Expression

  1. Pour the acrylamide-urea gel solution between the gel plates and insert the comb.

  2. Allow the gel to polymerize for 20–30 min.

  3. Once polymerization is completed, remove the comb, wash the gel plates and clamp them to the gel rack (see Note 12).

  4. Fill the upper reservoir of the gel electrophoresis tank with 0.5× TAE buffer to cover the wells of the gels and fill the tank with 0.5× TAE buffer to the indicated level.

  5. Prepare the samples on the ice by mixing 100–300 ng of test RNA or an RNA marker with 10 × RNA loading buffer. Add water to make a 10-μL volume for each sample.

  6. Wash the wells with 0.5×TAE buffer to remove urea and gel pieces, and then load the samples.

  7. Run the gel at 100 V for 80–100 min.

  8. Stain the gel in a 0.5 μg/mL ethidium bromide solution for about 5 min.

  9. Image the gel under UV detector of a gel imaging system. As shown in Fig. 2, the appearance of strong new band at expected size, compared to total RNA isolated from wild type E. coli, demonstrated a successful high-level expression of target BERA.

Fig. 2.

Fig. 2

Open in a new tab

Expression of BEAR/sRNA in E. coli. (a) Verified BERA/sRNA-expressing plasmid was transformed into HST08 E. coli. After overnight fermentation, bacteria are harvested for total RNA isolation. (b) Overexpression of target BERA/sRNA was validated by urea-PAGE analysis. The appearance of a strong new band at expected size, as compared to total RNA from wild type bacteria, indicates the successful high-level expression of recombinant RNAs

3.3. Purification of Target BERA/sRNA

3.3.1. Anion Exchange FPLC Purification

  1. Filter the mobile phases through a 0.22 μm PVDF Durapore Membrane, and sonicate for 15 min (see Note 13).

  2. Turn on FPLC system, and wash the RNA separation column (Enrich-Q 10 × 100 column was mainly used in this study, see Note 14) with 5 column volumes of autoclaved DEPC water at a flow rate of 2.5 mL/min.

  3. Equilibrate the column with 5 column volumes of Buffer A (10 mM sodium phosphate, pH 7.0) and monitor the FPLC trace at 260/280 nm using a UV/Vis detector.

  4. Inject 1–2 mL of total RNA solution (5–10 mg of total RNA) into the sample loop.

  5. Separate the RNAs with a gradient elution at a constant flow rate of 2.5 mL/min: 100% Buffer A for 2 min; 55% Buffer B for 4.8 min; 55–75% Buffer B for 20.4 min, followed by washing with 100% Buffer B for 9.6 min, and re-equilibrating with 100% Buffer A for 10 min before next injection.

  6. During the separation, collect the FPLC factions when the desired UV peak of target RNA shows up (Fig. 3a, see Note 15).

  7. Verify the purity of collected fractions by performing semi-quantitative urea-PAGE analysis (Fig. 3b), as described in Subheading 3.2.4.

Fig. 3.

Fig. 3

Open in a new tab

Purification of target BERA/sRNA by anion exchange FPLC. (a) Separation of target BERA/sRNA from other bacterial RNAs is monitored by UV detection. (b) After verified by urea-PAGE analysis, FPLC fractions showing high homogeneity are pooled for further desalting and concentration. (c) Purity of desalted BERA is further confirmed by urea-PAGE analysis

3.3.2. Desalting and Concentration

  1. Combine the FPLC fractions containing pure BERAs into a 50-mL conical tube (about 15 mL/tube).

  2. Add two volumes of pure ethanol to precipitate the RNA and salt.

  3. Place the tube in a −80 °C freezer for 1 h.

  4. Centrifuge the samples at 10,000 × g and 4 °C for 10 min, and carefully aspirate the supernatant.

  5. Resuspend the pellet with 1 mL sterile DEPC-water. If it cannot be dissolved, scale up the volume slowly to completely dissolve the sample (usually less than 2 mL).

  6. Load up to 2 mL RNA solution onto an Amicon® Ultra-2-centrifugal filter concentrator, and centrifuge at 7500 × g and 4 ° C for 10 min. Repeat this step until all samples are processed.

  7. Add 1.8 mL of water to the filter and spin it down under the same condition to wash (desalt) the column. Repeat this step for three times (see Note 16).

  8. Remove the filtrate and invert the whole centrifugal filter device.

  9. Centrifuge at 1000 × g and 4 °C for 2 min.

  10. Recover target RNA solution from the concentrate collection tube.

  11. Determine RNA concentration (usually the samples should be diluted by 1:10 to 1:50) using NanoDrop. Store the pure RNA at −80 °C (see Note 17).

This approach provides high-yield production of pure BERAs on large scale (i.e., accounting for 40–80% of total RNAs, and offering 4–20 mg from 1 L bacterial fermentation) [13].

3.4. Analysis of RNA Purity

3.4.1. Semiquantitative Analysis by Urea-PAGE Analysis

  1. Load and separate 50–300 ng purified RNA by urea-PAGE, as described in Subheading 3.2.4.

  2. Stain and visualize the isolated RNA (Fig. 3c).

  3. Estimate the purity of target BERA according to RNA band intensity.

3.4.2. Quantitative Analysis by HPLC

  1. Prepare mobile phases, Buffer C and Buffer D, and degas through sonication, similar as that described in Subheading 3.3.1.

  2. Turn on the HPLC system, and equilibrate the XBridge OST C18 column with 84% Buffer C plus 16% Buffer D (the initial mobile phase) at a constant flow rate of 0.2 mL/min, while column temperature is maintained at 60 °C.

  3. Monitor the HPLC trace using a UV photodiode array detector at 260 nm.

  4. Dilute the RNA sample with the initial mobile phase solution (i.e., 84% Buffer C and 16% Buffer D) to a desired concentration, and inject 2–5 μL sample containing 50–100 ng RNA for HPLC analysis.

  5. Elute with 16% Buffer D at 0–1 min, 16–22% Buffer D at 1–21 min, and 22% Buffer D at 21–22 min, followed by re-equilibration with 16% Buffer D for 5 min.

  6. Determine RNA purity (Fig. 4) by dividing the HPLC peak area of target BERA by all peaks.

Fig. 4.

Fig. 4

Open in a new tab

HPLC analysis of the purity of bioengineered ncRNAs isolated from bacteria. Representative HPLC-UV trace of the model BERA/GFP-siRNA, which is over 99.0% pure

3.4.3. Determination of Endotoxin Level

  1. Allow reagents of the Pyrogent-5000 kinetic LAL assay to equilibrate to room temperature prior to use.

  2. Following the manufacturer’s protocol to prepare the standards and test samples, and conduct the measurement.

  3. Calculate the endotoxin levels of individual samples according to the standard curve.

Acknowledgments

This study was supported by National Cancer Institute (grant No. R01CA225958) and National Institute of General Medical Sciences (R01GM113888), National Institutes of Health.

4 Notes

1.

All lab supplies and reagents used in our protocols are DNase and RNase free. Researchers should wear gloves and protective face masks and follow standard RNase-free practices. DEPC, ethidium bromide, phenol and TEMED are toxic, corrosive, and volatile chemicals, so researchers should handle them in a fume hood.

2.

The mixture of DEPC and water should be stirred at room temperature for at least 2 h before being autoclaved to completely deactivate the RNase in water. Do not use without autoclaving to degrade toxic and carcinogenic DEPC.

3.

The pBSTNAV plasmid, driven by a strong lipoprotein gene promotor (lpp), terminated with a ribosomal RNA operon transcription terminator (rrnC), and selected with ampicillin resistance gene (AmpR) [10], was used as expression vector to produce BERAs in E. coli (see Fig. 1). The pBSTNAV plasmid containing the optimum tRNA/pre-miR-34a carrier [13] constructed in our lab was used as a cloning template in this study.

4.

Dissolution of urea usually takes 20–30 min by gently shaking the mixture, and vortex could accelerate this step. Add 10% APS and TEMED after urea is completely dissolved in the solution. Polymerization begins as soon as APS is added, and the process will be very fast once TEMED is added. Thus, all succeeding actions must be performed promptly.

5.

The CCA sequence should be added at the end of the tRNA scaffold as the BERAs could not be expressed/processed in E. coli without the sequence.

6.

PCR efficiency and success rate were high when the forward and reverse primers were extended to have about 15 nt overlaps (Fig. 1b). Under this condition, no additional template is needed for PCR production of a target insert.

7.

When designing a target BERA/sRNA, we tried different ways. One way is to use 100% matched complementary sequence for a target siRNA or miRNA, or natural miRNA duplexes. Another way is to follow the intrinsic miR-34a duplexes pattern, which means a slight alteration of complementary sequence to provide “miR-34a-type” mismatches (bulbs) at particular sites. Our results showed that the latter design always offers higher level of expression and greater success rate. Furthermore, if the length of target miRNA/siRNA/sRNA is different from miR-34a-5p (22 nt), we either remove the extra 1–3 nt at the 3′ end or insert 1–2 nt. Those in the same length (22 nt) as miR-34a-5p usually show relatively higher levels of expression. Therefore, mimicking miR-34a pattern may provide optimal outcome when using tRNA/pre-miR-34a carrier.

8.

Annealing temperature may be optimized according to the sequence of the target BERA and cloning primers (usually Tm—5 °C), and we usually use 68–72 °C in our studies.

9.

To identify positive colonies, another step of PCR screening may be added before plasmid extraction and sequencing. Harvest the transformed E. coli overnight broth culture, dilute to 2–4 folds, incubate the solution at 90 °C for 10 min, and then use it as PCR template. The colonies from which the target fragments could be amplified are likely positive ones and can be sent out for sequencing. M13 primers (forward 5′-GTAAAACGACGGCCAGT-3, reverse 5′-CAGGAAACAGCTATGAC-3′) are used as PCR screening and sequencing primers.

10.

Stellar™ Competent Cell is an E. coli HST08 strain that comes with the CloneAmp HiFi PCR Premix kit and offers high transformation efficiency and high-level recombinant RNA expression. Therefore, this strain is used for the expression of target BERAs. By contrast, DH5α competent cells, a strain commonly used for general cloning and subcloning, are used in the storage and propagation of sequence-confirmed plasmids.

11.

Once a target BERA expression plasmid is successfully constructed (correct sequence is confirmed), we usually perform a small-scale (~15 mL) culture to evaluate target BERA expression. When target BERA is highly expressed, a large-scale RNA expression is thus conducted. The RNA extraction procedures described in the Subheading 3.2.3 (steps 1–9) are applicable to small-scale RNA isolation by scaling down the reagents accordingly, while steps 10 and 11 are not necessary for small-scale RNA extraction as the isolated RNA is used to examine BERA expression and will not be proceeded for FPLC purification.

12.

For a better separation, the freshly made urea gel could be inverted in water or 0.5× TAE buffer for 30 min to remove the supersaturated urea in the well and gel. This step makes it easier to wash away the urea from each well before gel electrophoresis. The gel could be wrapped with water-containing preservative film and stored at 4 °C for 2–3 days.

13.

FPLC mobile phases should be filtered and degassed before using, and keeping the right pH is important to achieve a consistent separation among different injections/batches. Therefore, we recommend using freshly made solutions, and the extra mobile phases could be stored at 4 °C for at most 3 days.

14.

Most BERAs can be purified to a high degree of homogeneity (e.g., >97%) by a single run on Enrich-Q 10 × 100 column. If sample does not reach to desired purity, repurification may be conducted using the same or different columns [14].

15.

To identify the elution time of target BERA peak, total RNA of wild type HST08 bacteria may be separated by the same FPLC method ahead of time.

16.

To remove a large amount of salt within the FPLC fractions, it is necessary to wash three times. Make sure that the filter is not overloaded with RNA.

17.

We usually store the purified RNA at a high concentration (e.g., >5 mg/mL) at −80 °C. Dilute it to a proper working solution and aliquot it for regular use. Even though we have found that BERAs are stable over 50 freeze–thaw cycles, it is still recommended to minimize freeze–thaw cycles for long term storage and avoiding possible contamination.

References

  • 1.Ambros V (2004) The functions of animal microRNAs. Nature 431:350–355 [DOI] [PubMed] [Google Scholar]
  • 2.Cech TR, Steitz JA (2014) The noncoding RNA revolution-trashing old rules to forge new ones. Cell 157:77–94 [DOI] [PubMed] [Google Scholar]
  • 3.Setten RL, Rossi JJ, Han SP (2019) The current state and future directions of RNAi-based therapeutics. Nat Rev Drug Discov 18:421–446 [DOI] [PubMed] [Google Scholar]
  • 4.Yu AM, Jian C, Yu AH et al. (2019) RNA therapy: are we using the right molecules? Pharmacol Ther 196:91–104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bennett CF (2019) Therapeutic antisense oligonucleotides are coming of age. Annu Rev Med 70:307–321 [DOI] [PubMed] [Google Scholar]
  • 6.Levin AA (2019) Treating disease at the RNA level with oligonucleotides. N Engl J Med 380:57–70 [DOI] [PubMed] [Google Scholar]
  • 7.Bramsen JB, Kjems J (2012) Development of therapeutic-grade small interfering RNAs by chemical engineering. Front Genet 3:154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Khvorova A, Watts JK (2017) The chemical evolution of oligonucleotide therapies of clinical utility. Nat Biotechnol 35:238–248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Liu YP, Berkhout B (2011) miRNA cassettes in viral vectors: problems and solutions. Biochim Biophys Acta 1809:732–745 [DOI] [PubMed] [Google Scholar]
  • 10.Ponchon L, Beauvais G, Nonin-Lecomte S et al. (2009) A generic protocol for the expression and purification of recombinant RNA in Escherichia coli using a tRNA scaffold. Nat Protoc 4:947–959 [DOI] [PubMed] [Google Scholar]
  • 11.Ponchon L, Dardel F (2007) Recombinant RNA technology: the tRNA scaffold. Nat Methods 4:571–576 [DOI] [PubMed] [Google Scholar]
  • 12.Chen Q-X, Wang W-P, Zeng S et al. (2015) A general approach to high-yield biosynthesis of chimeric RNAs bearing various types of functional small RNAs for broad applications. Nucleic Acids Res 43:3857–3869 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ho PY, Duan Z, Batra N et al. (2018) Bioengineered noncoding RNAs selectively change cellular miRNome profiles for cancer therapy. J Pharmacol Exp Ther 365:494–506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Petrek H, Batra N, Ho PY et al. (2019) Bioengineering of a single long noncoding RNA molecule that carries multiple small RNAs. Appl Microbiol Biotechnol 103:6107–6117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li M-M, Addepalli B, Tu M-J et al. (2015) Chimeric microRNA-1291 biosynthesized efficiently in Escherichia coli is effective to reduce target gene expression in human carcinoma cells and improve chemosensitivity. Drug Metab Dispos 43:1129–1136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Li M-M, Wang W-P, Wu W-J et al. (2014) Rapid production of novel pre-microRNA agent hsa-mir-27b in Escherichia coli using recombinant RNA technology for functional studies in mammalian. Cell 42:1791–1795 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wang W-P, Ho PY, Chen Q-X et al. (2015) Bioengineering novel chimeric microRNA-34a for prodrug cancer therapy: high-yield expression and purification, and structural and functional characterization. J Pharmacol Exp Ther 354:131–141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jilek JL, Zhang QY, Tu MJ et al. (2019) Bioengineered let-7c inhibits Orthotopic hepatocellular carcinoma and improves overall survival with minimal immunogenicity. Mol Ther Nucleic Acids 14:498–508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Li PC, Tu MJ, Ho PY et al. (2018) Bioengineered NRF2-siRNA is effective to interfere with NRF2 pathways and improve chemosensitivity of human cancer cells. Drug Metab Dispos 46:2–10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tu MJ, Ho PY, Zhang QY et al. (2019) Bioengineered miRNA-1291 prodrug therapy in pancreatic cancer cells and patient-derived xenograft mouse models. Cancer Lett 442:82–90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yi WR, Tu MJ, Liu Z et al. (2020) Bioengineered miR-328-3p modulates GLUT1-mediated glucose uptake and metabolism to exert synergistic antiproliferative effects with chemotherapeutics. Acta Pharm Sin B 10:159–170 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES