Abstract
Probiotics are alive microbes that present beneficial to the human’s health. They influence immune responses through stimulating antibody production, activating T cells, and altering cytokine expression. The probiotic characteristics of Levilactobacillus brevis KU15159 were evaluated on the tolerance and adherence to gastrointestinal conditions. L. brevis KU15159 was safe in a view of producing various useful enzymes and antibiotic sensitivity. Heat-treated L. brevis KU15159 increased production of nitric oxide (NO) and phagocytic activity in RAW 264.7 cells. In addition, heat-treated L. brevis KU15159 upregulated the expression of inducible nitric oxide synthase (iNOS) and proinflammatory cytokines including tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6, at protein as well as mRNA levels. In addition, the mitogen-activated protein kinase (MAPK) pathway, which regulates the immune system, was activated by heat-treated L. brevis KU15159. Therefore, L. brevis KU15159 exhibited an immune-enhancing effect by the MAPK pathway in macrophage.
Keywords: Levilactobacillus brevis, Probiotics, Immune-enhancing, RAW 264.7 cell, MAPK signaling pathway
Introduction
The ongoing COVID-19 pandemic has increased interest in improving immunity. The immune system protects the host from the external antigens and reduces susceptibility to diseases [1]. Induction of immune cells (dendritic cells, macrophages, and lymphocytes) that comprise the immune system acts an important role in enhancing immunity [2]. The gut microbiota communicates closely with the immune system to maintain immune homeostasis in the gastrointestinal tract of the host [3].
Supplementation with probiotics, alive microbes that confer several health benefits to the hosts, could re-establish homeostasis and restore the microbiota [4]. Probiotics influence immune responses by stimulating antibody production, activating T cells, and altering cytokine expression. They activate macrophages to secrete proinflammatory cytokines as well as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6; they stimulate the expression of inducible nitric oxide synthase (iNOS) [5].
Cytokines are regulated through the mitogen-activated protein kinase (MAPK) and nuclear factor kappa-B (NF-κB) signaling pathways. MAPK regulates cell proliferation and cellular responses to cytokines [6]. The MAPK components include p38 MAPKs, extracellular signal-regulated kinases 1/2 (ERK 1/2), and c-Jun N-terminal kinase (JNK) [7]. NF-κB regulates genes related to both intrinsic and adaptive immune responses. Stimulated NF-κB is transported into the cell nucleus, and it regulates the mRNA expression of iNOS and TNF-α [8].
Lactobacillus strains are one of the most commonly used probiotics because they are commonly found in healthy intestines [9]. Lactobacillus strains were reclassified into 25 genera including Lactiplantibacillus, Levilactobacillus, and Lacticaseibacillus according to the new taxonomic conventions [10]. Lactobacillus strains exhibit anticancer [11], antioxidant [12], anti-inflammatory [13], and immune-enhancing [14] properties. To avoid sepsis that could be caused by live cells [11], it is necessary to consider the use of heat-killed Lactobacillus or its metabolites [15].
Levilactobacillus brevis KU15159 was obtained from homemade diced radish kimchi. The purpose of this investigation was to estimate the probiotic properties of L. brevis KU15159 and the immune-improving effect of heat-treated L. brevis KU15159 in macrophage.
Materials and Methods
Culture Media and Analytical Reagents
Lactobacilli MRS broth for bacterial cultures was acquired from BD Biosciences (Franklin Lakes, NJ, USA). For cell culture, phosphate-buffered saline (PBS), fetal bovine serum (FBS), penicillin/streptomycin (P/S), DMEM, and RPMI 1640 were acquired from HyClone (Logan, UT, USA). The API ZYM® kit was obtained from BioMérieux (Marcy-l’Étoile, France). RevertAid First Strand cDNA Synthesis Kit and RNeasy® Mini Kit were obtained from Thermo Fisher Scientific (Waltham, MA, USA) and QIAGEN (Hilden, Germany), respectively. SYBR Green PCR Master Mix for the semi-quantitative real-time RT-PCR was acquired from PikoReal 96 (Scientific Pierce, Waltham, MA, USA). The mouse iNOS ELISA kit was purchased from Abcam (Cambridge, USA). Mouse TNF-α, Mouse IL-1beta, and IL-6 ELISA kit were used from Invitrogen (Carlsbad, CA, USA). The DC protein assay kit and enhanced chemiluminescence detection kit were used from Bio-Rad Laboratories, Inc. (Hercules, CA, USA), and the antibodies were used from Santa Cruz Biotechnology (Dallas, TX, USA). Other materials were used from Sigma-Aldrich (St. Louis, MO, USA).
Probiotics and Sample Production
Lactiplantibacillus plantarum KU15149, Levilactobacillus brevis KU15159, and L. brevis KU15176 were used in this study [11]. Lacticaseibacillus rhamnosus GG utilized for a reference strain. For sample preparation, Lactobacillus strains were cultivated in lactobacilli MRS broth at 37 °C for 20 h, and the bacteria cells were obtained by centrifugation at 12,000 × g at 4 °C for 5 min. The bacterial cells were rinsed trice with PBS and treated at 80 °C for 30 min. And then, the samples were obtained by resuspension using cell growth media.
Tolerance of Lactobacillus Strains in Artificial Gastric Conditions
The resistance of Lactobacillus strains in artificial gastric conditions was evaluated, as depicted previously [16]. Tolerance in artificial gastric juice was confirmed by incubating the Lactobacillus strains in lactobacilli MRS broth balanced pH 2.5 with 3 g/L pepsin, at 37 °C for 3 h. Tolerance in bile acids was evaluated through incubation in lactobacilli MRS broth including 3 g/L oxgall, at 37 °C for 24 h. Tolerance (%) was computed based on the survived cells on lactobacilli MRS agar plates in comparison with the initial cells, as follows:
where A and B are the survived cells following treatment with artificial gastric conditions and the initial cells before treatment, respectively.
Intestinal Adhesion of Lactobacillus Strains
The adhesion capacity of L. brevis KU15159 to HT-29 cells was evaluated as the bacterial counts of bacteria attached to the cells. HT-29 cells (1 × 105 cells/mL) were inoculated in 24-well plates and cultured at 37 °C for 24 h. Lactobacillus strains were performed centrifugation at 12,000 × g at 4 °C for 10 min and rinsed trice with PBS; they were diluted with antibiotic-free RPMI medium. HT-29 cells were handled with Lactobacillus strains and cultured at 37 °C for 2 h; the cutlured cells were rinsed trice with PBS, treated with 1 mL of 1% (v/v) Triton X-100, and incubated at 37 °C for 10 min. The separated Lactobacillus strains were diluted in PBS and spread on lactobacilli MRS agar plates. After 24 h of incubation at 37 °C, the bacteria were counted.
Enzyme Production of Lactobacillus Strains
To estimate the enzymes produced by the Lactobacillus strains, the API ZYM® kit was utilized. The Lactobacillus strains were incubated in lactobacilli MRS broth at 37 °C for 20 h. The bacterial cultures were performed centrifugation at 12,000 × g at 4 °C for 5 min and washed twice with PBS. The cell pellet was suspended using PBS to 107 CFU/mL. Suspensions were put to each slot cultured at 37 °C for 4 h. Two microliters of separately Zym A and Zym B reagent was added. Enzyme production was determined on a scale of 0 to ≥ 40 nM as the color change.
Antibiotics Sensitivity of Lactobacillus Strains
The antibiotics sensitivity of the Lactobacillus strains was determined, in accordance with the guidelines of the Clinical and Laboratory Standards Institute (CLSI). The disc diffusion method was used to measure the sensitivity to ampicillin (10 mg), chloramphenicol (30 mg), tetracycline (30 mg), doxycycline (30 mg), streptomycin (10 mg), kanamycin (30 mg), and gentamicin (10 mg). Each Lactobacillus strain at 105 CFU/mL was placed on lactobacilli MRS agar plates. Paper discs were placed on the plates and added 50 μL of antibiotics. The plates were cultured at 37 °C for 24 h, and the inhibition zones were evaluated.
RAW 264.7 Cells and Culture Condition
RAW 264.7 cells were acquired from the Korean Cell Line Bank (KCLB, Seoul, Korea) and incubated in DMEM with 10% (v/v) FBS and 1% (v/v) P/S at 37 °C with 5% CO2 incubator.
NO Production and Viability in RAW 264.7 Cells
Nitric oxide (NO) assays were performed to evaluate the immune-enhancing potential, as described earlier [17]. RAW 264.7 cells (2 × 105 cells/well) were seeded in a microwell plate and incubated for 4 h; 100 µL of diluted samples or 1 ng/mL LPS (positive control) was added. Later 24 h of incubation, 100 μL of the cell supernatant was blended with 100 μL of Griess reagent. The optical density was determined at 540 nm, and the NO production was determined using standard curve of sodium nitrite.
Cell viability was investigated applying an MTT assay. RAW 264.7 cells were inoculated in microplate at 100 µL of 2 × 105 cells/well and cultured for 4 h; 100 µL of diluted samples or 1 ng/mL LPS (positive control) was added and cultured for 24 h. The cells were rinsed two times with PBS, handled with 100 μL of 0.5 mg/mL MTT solution. After 30 min incubation, the MTT mixture was eliminated, and 200 μL of dimethyl sulfoxide (DMSO) was mixed. Optical density was measured at 570 nm, and viability was determined as follows:
where Asample and Acontrol are the optical density of the treated sample and the untreated sample, respectively.
Phagocytic Activity of RAW 264.7 Cells
The neutral red uptake method was utilized to measure the effect of heat-treated L. brevis KU15159 on the phagocytic activity of macrophages [18]. RAW 264.7 cells were cultured at 2 × 105 cells/well in a 24-well plate and cultured for 4 h. Cultured RAW 264.7 cells were added 7 log CFU/mL of heat-treated Lactobacillus strains and incubated for 24 h. The supernatant was removed; 0.075% neutral red solution was put in the cells and stained for 1 h. Cells were washed thrice with PBS and lysed with lysis reagent (acetate and ethanol; 1:1). The optical density was measured at 540 nm.
RNA Extraction and Semi-Quantitative Real-Time RT-PCR
Total RNA was obtained from the RAW 264.7 cells, and cDNA was synthesized. The proinflammatory factor (iNOS) and proinflammatory cytokines (TNF-α, IL-1β, and IL-6) were confirmed by using SYBR Green PCR Master mix in a semi-quantitative real-time RT-PCR. β-Actin was used as the control. The used primers are represented in Table 1 [19]. The thermal cycling conditions were followed: 95 °C for 2 min, 40 cycles of 95 °C for 5 s, and 60 °C for 15 s. The amplification results were evaluated using the delta–delta Cq (ΔΔCq) method, and the purity of the PCR products was estimated based on the melting curve.
Table 1.
Sequence of primers used for semi-quantitative RT-PCR
| Primer | Sequence (5′ to 3′) | |
|---|---|---|
| β-Actin | (Forward) | GTGGGCCGCCCTAGGCACCAG |
| (Reverse) | GGAGGAAGAGGATGCGGCAGT | |
| iNOS | (Forward) | CCCTTCCGAAGTTTCTGGCAGC |
| (Reverse) | GGCTGTCAGAGCCTCGTGGCTTTGG | |
| TNF-α | (Forward) | TTGACCTCAGCGCTGAGTTG |
| (Reverse) | CCTGTAGCCCACGTCGTAGC | |
| IL-1β | (Forward) | CAGGATGAGGACATGAGCACC |
| (Reverse) | CTCTGCAGACTCAAACTCCAC | |
| IL-6 | (Forward) | GTACTCCAGAAGACCAGAGG |
| (Reverse) | TGCTGGTGACAACCACGGCC | |
iNOS inducible nitric oxide synthase, TNF-α tumor necrosis factor-α, IL interleukin
ELISA
RAW 264.7 cells were incubated with 1 × 106 cells/well seeding in a 6-well plate for 24 h. The cells were treated with 7 log CFU/mL of heat-treated Lactobacillus strains and incubated for 24 h. The levels of iNOS and cytokines were measured using the respective ELISA kit, as stated by the manufacturer’s directions.
Western Blotting
The cells were washed along with chilly PBS and extracted with Pro-prep lysis buffer with protease inhibitor. The supernatant was obtained by centrifugation at 4 °C at 15,000 × g for 30 min. Thirty micrograms of proteins was split on a 10% SDS-PAGE gel and subsequently transported to a polyvinyl difluoride membrane. Transferred membranes were blocked into 5% skim milk for 1 h and reacted with primary antibodies (p-p38, p38, p-ERK 1/2, ERK 1/2, p-JNK, and JNK antibodies) at 4 °C overnight. The membranes were cross-reacted by secondary antibodies at 25 °C for 2 h. The protein bands were identified and were quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Statistical Analysis
All data are displayed as the mean ± standard deviation of 3 independent experiments. One-way analysis of variance (ANOVA) was used to confirm significant differences. The mean values were used in Duncan’s multiple range test for post hoc verification (p < 0.05).
Results
Tolerance in Artificial Gastric Conditions and Adhesion to HT-29 Cells of Lactobacillus Strains
Tolerance in artificial gastric conditions is a basic trait of probiotics; it was evaluated to determine whether L. brevis KU15159 could reach the intestines live, following ingestion. L. brevis KU15159 revealed a survival rate of 98.90% in artificial gastric juice and more than 100% in artificial bile condition (Table 2). This was similar to that observed for L. rhamnosus GG. Therefore, survival of L. brevis KU15159 is affected by gastric conditions but is not significantly affected by the bile salt concentration found in the human intestine.
Table 2.
Probiotic properties of Lactobacillus strains
| Probiotic properties | L. rhamnosus GG | L. brevis KU15159 |
|---|---|---|
| Tolerance in pH 2.5 with 3 g/L pepsin, for 3 h | 99.28 ± 1.97a | 98.90 ± 0.22a |
| Tolerance in 3 g/L oxgall, for 24 h | 102.89 ± 2.01a | 109.39 ± 0.93a |
| Adhesion to HT-29 cells (%) | 6.37 ± 0.35a | 7.66 ± 0.37a |
|
Enzyme production β-Galactosidase β-Glucosidase Leucine arylamidase Naphthol-AS-BI-phosphohydrolase Valine arylamidase |
5 nM 5 nM 20 nM 10 nM 20 nM |
5 nM 20 nM 10 nM 5 nM 5 nM |
aThe data are the mean ± SD from three independent experiments
To assess the adhesion rate of L. brevis KU15159, its survival rate under gastrointestinal tract conditions was evaluated. L. brevis KU15159 exhibited an adhesion rate of 7.66% to HT-29 cells, which was higher than the 6.37% exhibited by L. rhamnosus GG (Table 2). The adhesion rate of Lactobacillus strains typically ranges from 2 to 10% [20]. Therefore, L. brevis KU15159 can colonize the gastrointestinal tract.
Enzyme Production of Lactobacillus Strains
The API ZYM kit was used to identify enzymes produced by L. brevis KU15159. L. brevis KU15159 was positive for β-galactosidase, β-glucosidase, leucine arylamidase, acid phosphatase, naphthol-AS-BI-phosphohydrolase, and valine arylamidase (Table 2). L. brevis KU15159 produced a large amount of β-glucosidase compared to L. rhamnosus GG, the reference strain. In contrast, L. brevis KU15159 did not show β-glucuronidase production, which can aid the production of cancer-causing agent [21]. Therefore, L. brevis KU15159 produced useful enzymes without being harmful.
Antibiotic Sensitivity of Lactobacillus Strains
Antibiotic sensitivity of a probiotic should be evaluated because antibiotic-resistant strains could become persistent and difficult to eradicate when necessary; in addition, antibiotic resistance could be transferred to pathogenic bacteria [23]. Table 3 shows the antibiotic sensitivities of L. brevis KU15159. L. brevis KU15159 showed similar results as L. rhamnosus GG, except for gentamycin (10 mg). Therefore, L. brevis KU15159 was consistent with the CLSI guidelines.
Table 3.
Antibiotic sensitivities of LAB strains
| Antibiotics | L. rhamnosus GG | L. brevis KU15159 |
|---|---|---|
| Ampicillin (10 μg) | S | S |
| Chloramphenicol (30 μg) | S | S |
| Tetracycline (30 μg) | S | S |
| Doxycycline (30 μg) | S | S |
| Streptomycin (10 μg) | R | R |
| Kanamycin (30 μg) | R | R |
| Gentamycin (10 μg) | R | I |
Resistance was evaluated according to the CLSI breakpoints for Enterobacterales [22]
S susceptible, I intermediate, R resistant
NO Production and Viability in RAW 264.7 Cells
The immune-enhancing effect of heat-treated Lactobacillus strains was assessed using an NO assay. If Lactobacillus strains influence the viability of RAW 264.7, they can alter the amount of NO production; therefore, the viability was evaluated using MTT analysis. LPS (1 ng/mL) was employed as the positive control to stimulate RAW 264.7 cells.
The NO production after LPS treatment was higher than the control group. Similarly, treatment with heat-treated Lactobacillus increased NO production (Fig. 1). Despite the higher amount of NO production at the concentration of 8 log CFU/mL, the viability of L. brevis KU15159 was less than 100%; therefore, 7 log CFU/mL was adopted in the subsequent experiments. At 7 log CFU/mL, L. plantarum KU15149 and L. brevis KU15159 increased NO production to a greater extent than L. rhamnosus GG. In contrast, L. brevis KU15176 exhibited lower values.
Fig. 1.
Cytotoxicity of heat-treated L. brevis KU15159 (7 log CFU/mL) in RAW 264.7 cells. The cells were incubated with LPS (1 ng/mL) or heat-treated bacterial sample for 24 h. a Nitric oxide (NO) production evaluated using NO assay. b Cell viability assessed using MTT assay. LGG, L. rhamnosus GG; 149, L. plantarum KU15149; 159, L. brevis KU15159; 176, L. brevis KU15176. Different letters indicate significant differences for each characteristic (p < 0.05)
Changes in the Phagocytic Activity of Macrophages
Neutral red uptake assay was accomplished to assess the influence of L. brevis KU15159 on the phagocytic activity of RAW 267.4 cells (Fig. 2). LPS increased the phagocyte activity compared to that in the control group, which is supported by the increase in NO production in the LPS-treated RAW 267.4 cells. All Lactobacillus strains increased phagocytic activity, compared to that in the LPS treatment. However, L. plantarum KU15149 showed a slightly lower value, while the other strains showed a similar increase in phagocytic activity.
Fig. 2.
Phagocytic activity of heat-treated L. brevis KU15159 in RAW 264.7 cells using neutral red uptake method. The cells were incubated with the LPS (1 ng/mL) or heat-treated bacterial sample (7 log CFU/mL) for 24 h. LGG, L. rhamnosus GG; 149, L. plantarum KU15149; 159, L. brevis KU15159; 176, L. brevis KU15176. Different letters indicate significant differences for each characteristic (p < 0.05)
Expression of iNOS, TNF-α, IL-1β, and IL-6
The RT-PCR results indicated that heat-treated Lactobacillus strains regulated the expression of some immune-correlated genes (Fig. 3). The treatment with LPS (positive control) increased the expression of all genes compared to the control. The iNOS expression in the L. rhamnosus GG and L. brevis KU15176 groups was similar to that in the LPS group. L. plantarum KU15149 and L. brevis KU15159 increased the expression 48.19 and 45.13 times, compared to that in the control, respectively. This corroborates the results of the NO assay, because iNOS produces NO. In TNF-α, IL-1β, and IL-6, the L. plantarum KU15149 and L. brevis KU15159-treated groups showed higher expression levels, compared to the L. rhamnosus GG-treated group. In contrast, L. brevis KU15176 induced only a small increase in the overall expression.
Fig. 3.
The expression of immune-associated genes induced by heat-treated L. brevis KU15159 in RAW 264.7 cells. The cells were incubated with LPS (1 ng/mL) or heat-treated bacterial sample (7 log CFU/mL) for 24 h. A iNOS, B TNF-α, C IL-1β, and D IL-6 expression levels were measured using RT-PCR. LGG, L. rhamnosus GG; 149, L. plantarum KU15149; 159, L. brevis KU15159; 176, L. brevis KU15176. Different letters indicate significant differences for each characteristic (p < 0.05)
The amount of protein present in the supernatant was measured using ELISA to confirm whether an increase in the expression of mRNA, as identified using RT-PCR, leads to a corresponding increase in the protein levels. All four factors increased the protein levels compared to that in treatment with LPS (positive control). The amounts of iNOS induced by L. rhamnosus GG, L. plantarum KU15149, and L. brevis KU15159, but not by L. brevis KU15176, were similar (Fig. 4). However, TNF-α and IL-1β production was higher in the L. brevis KU15159 treatment, compared to that in the other treatments.
Fig. 4.
The expression of immune-associated protein induced by heat-treated L. brevis KU15159 in RAW 264.7 cells. The cells were incubated with the LPS (1 ng/mL) or heat-treated bacterial sample (7 log CFU/mL) for 24 h. A iNOS, B TNF-α, C IL-1β, and D IL-6 expression levels evaluated using ELISA. LGG, L. rhamnosus GG; 149, L. plantarum KU15149; 159, L. brevis KU15159; 176, L. brevis KU15176. Different letters indicate significant differences for each characteristic (p < 0.05)
Protein Expression of MAPK Pathway Components
The activation of factors associated with the MAPK signaling pathway (p38, JNK, and ERK1/2) was evaluated applying western blotting, to confirm the mechanism by which L. brevis KU15159 increased NO production and upregulated cytokines. LPS treatment increased the phosphorylation of p38, JNK, and ERK 1/2, compared to that in the control (Fig. 5). Similarly, L. brevis KU15159 activated all the proteins; this was more effective than LPS and LGG. L. brevis KU15159 increased the activation of p-p38/p38, p-JNK/JNK, and p-ERK 1/2/ERK 1/2 by 169.57-, 52.63-, and 88.22-fold, respectively. Therefore, the immune-enhancing effect of heat-treated L. brevis KU15159 occurs via the MAPK pathway.
Fig. 5.
The expression level of phosphorylated MAPKs induced by heat-treated L. brevis KU15159 in RAW 264.7 cells. The cells were incubated with LPS (1 ng/mL) or heat-treated bacterial sample (7 log CFU/mL) for 5 min. a Expression of proteins in the MAPK signaling pathway was investigated through western blotting. b–d Relative quantification of protein bands using ImageJ. LGG, L. rhamnosus GG; 159, L. brevis KU15159. Statistical differences are indicated using different letters (p < 0.05)
Discussion
Probiotics must be safe for human consumption, have the ability to endure the gastrointestinal environment, adhere to intestinal epithelial cells, and perform various biological functions in the hosts [24]. Through a series of probiotic experiments, it was identified that L. brevis KU15159 can survive in the gastrointestinal environment and attach to intestinal cells. Additionally, L. brevis KU15159 can produce useful enzymes without the risk of transferring antibiotic resistance to harmful bacteria or producing harmful enzymes. Leucine arylamidase and valine arylamidase produced by Lactobacillus influence the decomposition of proteins and peptides, contributing to the flavor of the final product [25]. β-Galactosidase helps alleviate lactose intolerance in the gut and is important for probiotics [26, 27]. In addition, β-glucosidase contributes to taste by hydrolyzing bitter compounds and converting flavorless glucosides into aromatic compounds [28]. L. brevis KU15159 showed a higher production of β-glucosidase than L. rhamnosus GG.
The immune-improving effect of heat-treated L. brevis KU15159 was confirmed using NO and phagocytosis assays. Treatment of RAW 264.7 cells with 7 log CFU/mL of heat-treated L. brevis KU15159 increased NO production more effectively than the L. rhamnosus GG treatment. When macrophages are activated, they secrete NO to counteract free radicals; NO production is the important molecules in immune response. In addition, it is fatal to intracellular parasites and bacteria [29]. The induction of phagocytic activity by heat-treated L. brevis KU15159 was similar to that by L. rhamnosus GG. The phagocytic activity of macrophages is important to defend their host against pathogens, which is crucial for immunity [30].
The increased expression of iNOS in RAW 264.7 cells treated with heat-treated L. brevis KU15159, compared to that in the LPS or L. rhamnosus GG treatment, further implicates the immune-enhancing effect of L. brevis KU15159. iNOS adjusts the function and differentiation of immune cells through nitration of principal molecules related to signaling or transcriptional pathways [31, 32]. In addition, heat-treated L. brevis KU15159 upregulated the expression of TNF-α, IL-6, and IL-1β. The upregulation of TNF-α by L. brevis KU15159 was higher than that in the other treatments. Macrophages secrete cytokines, as well as TNF-α, IL-6, and IL-1β, and have considerable effects on immune responses [33]. They can bind to particular receptors of other cells and activate them immunologically [24]. TNF-α protects the host against infectious pathogens [3], initiates the expression of adhesion molecules in endothelial cells and neutrophils, and activates leukocytes [34]. The amounts of iNOS, TNF-α, IL-6, and IL-1β in the heat-treated L. brevis KU15159 treatment were similar to or higher than that in the L. rhamnosus GG treatment.
Western blot analysis showed that heat-treated L. brevis KU15159 activated the MAPK pathway (Fig. 5). The MAPK signaling pathway is related to regulating mRNA expression associated with the expression and release of inflammatory cytokines for modulating immune responses [35]. MAPKs are regulators of immune responses; their activity is regulated by reversible phosphorylation of threonine and tyrosine residues [36]. There are trinity-specific MAPK pathways, the p38, ERK, and JNK pathways [36]. Heat-treated L. brevis KU15159 phosphorylated p38, JNK, and ERK 1/2 more than LGG did. Therefore, elevated cytokine production in macrophage handled with heat-treated L. brevis KU15159 was associated with the activity of MAPK pathway.
L. plantarum KU15149 exhibited immune-enhancing potential. In the RT-PCR and ELISA data, L. plantarum KU15149 treatment had similar or slightly lower values than L. brevis KU15159. Unlike L. brevis KU15159, which affected cell viability at 8 log CFU/mL in the MTT assay, L. plantarum KU15149 did not affect viability. Therefore, it is necessary to evaluate the use of higher concentrations and longer treatment times. In addition, it is important to assess inflammatory reactions that could occur with increased bacterial concentrations. This applies to the immune-enhancing potential of L. brevis KU15159 as well, and in vivo tests are necessary to evaluate the effectiveness and the possibility of an inflammatory reaction.
In summary, L. brevis KU15159 was characterized for its probiotic properties, and heat-treated L. brevis KU15159 was investigated to detect its immune-enhancing effects in macrophage. Heat-treated L. brevis KU15159 augmented the phagocytic activity and the NO production in macrophage by regulating iNOS. The TNF-α, IL-1β, and IL-6 expression was upregulated. At the protein level, L. brevis KU15159 showed an effect similar to that of LGG. Therefore, L. brevis KU15159 has immune-enhancing potential in vitro, but in vivo experiments are needed to clarify its effect.
Author Contribution
C.-H. Hwang, K.-T. Kim, N.-K. Lee, and H.-D. Paik conceptualized this study. C.-H. Hwang conducted all the experiments, and C.-H. Hwang and N.-K. Lee drafted first version of the manuscript. K.-T. Kim, N.-K. Lee, and H.-D. Paik reviewed the draft manuscript, and all the authors revised the final version of the manuscript.
Declarations
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Azike CG, Charpentier PA, Lui EM. Stimulation and suppression of innate immune function by American ginseng polysaccharides: biological relevance and identification of bioactives. Pharm Res. 2015;32:876–897. doi: 10.1007/s11095-014-1503-3. [DOI] [PubMed] [Google Scholar]
- 2.Xie Y, Wang L, Sun H, Wang Y, Yang Z, Zhang G, Jiang S, Yang W. Polysaccharide from alfalfa activates RAW 264.7 macrophages through MAPK and NF-κB signaling pathways. Int J Biol Macromol. 2019;126:960–968. doi: 10.1016/j.ijbiomac.2018.12.227. [DOI] [PubMed] [Google Scholar]
- 3.Han NR, Kim HJ, Lee JS, Kim HY, Moon PD, Kim HM, Jeong HJ. The immune-enhancing effect of anthocyanin-fucoidan nanocomplex in RAW264.7 macrophages and cyclophosphamide-induced immunosuppressed mice. J Food Biochem. 2021;45:e13631. doi: 10.1111/jfbc.13631. [DOI] [PubMed] [Google Scholar]
- 4.Wierzbicka A, Mańkowska-Wierzbicka D, Mardas M, Stelmach-Mardas M. Role of probiotics in modulating human gut microbiota populations and activities in patients with colorectal cancer—a systematic review of clinical trials. Nutrients. 2021;13:1160. doi: 10.3390/nu13041160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Lee J, Jung I, Choi JW, Lee CW, Cho S, Choi TG, Sohn M, Park YI. Micronized and heat-treated Lactobacillus plantarum LM1004 stimulates host immune responses via the TLR-2/MAPK/NF-κB signalling pathway in vitro and in vivo. J Microbiol Biotechnol. 2019;29:704–712. doi: 10.4014/jmb.1812.12059. [DOI] [PubMed] [Google Scholar]
- 6.Chen Q, Qi C, Peng G, Liu Y, Zhang X, Meng Z. Immune-enhancing effects of a polysaccharide PRG1-1 from Russula griseocarnosa on RAW264. 7 macrophage cells via the MAPK and NF-κB signalling pathways. Food Agr Immunol. 2018;29:833–844. doi: 10.1080/09540105.2018.1461198. [DOI] [Google Scholar]
- 7.Jeong M, Kim JH, Yang H, Kang SD, Song S, Lee D, Lee JS, Park JHY, Byun S, Lee KW. Heat-killed Lactobacillus plantarum KCTC 13314BP enhances phagocytic activity and immunomodulatory effects via activation of MAPK and STAT3 pathways. J Microbiol Biotechnol. 2019;29:1248–1254. doi: 10.4014/jmb.1905.05066. [DOI] [PubMed] [Google Scholar]
- 8.Lee JH, Moon SH, Kim HS, Park E, Ahn DU, Paik HD. Immune-enhancing activity of phosvitin by stimulating the production of pro-inflammatory mediator. Poult Sci. 2017;96:3872–3878. doi: 10.3382/ps/pex205. [DOI] [PubMed] [Google Scholar]
- 9.Azad MDAK, Sarker M, Wan D. Immunomodulatory effects of probiotic on cytokine profiles. Biomed Res Int. 2018;2018:8063647. doi: 10.1155/2018/8063647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Oberg TS, McMAhon DJ, Culumber MD, McAuliffe M, Oberg CJ. Review of taxonomic changes in dairy-related lactobacilli. J Dairy Sci. 2022;105:2750–2770. doi: 10.3168/jds.2021-21138. [DOI] [PubMed] [Google Scholar]
- 11.Hwang CH, Lee NK, Paik HD. The anti-cancer potential of heat-killed Lactobacillus brevis KU15176 upon AGS cell lines through intrinsic apoptosis pathway. Int J Mol Sci. 2022;23:4073. doi: 10.3390/ijms23084073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hashemi SMB, Jafarpour D, Jouki M. Improving bioactive properties of peach juice using Lactobacillus strains fermentation: antagonistic and anti-adhesion effects, anti-inflammatory and antioxidant properties, and Maillard reaction inhibition. Food Chem. 2021;365:130501. doi: 10.1016/j.foodchem.2021.130501. [DOI] [PubMed] [Google Scholar]
- 13.Yamazaki T, Yamada S, Ohshio K, Sugamata M, Morita Y. Lactobacillus paracasei KW3110 prevents inflammatory-stress-induced mitochondrial dysfunction in mouse macrophages. Int J Mol Sci. 2022;23:1443. doi: 10.3390/ijms23031443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kumar A, Joishy T, Das S, Kalita MC, Mukherjee AK, Khan MR. A potential probiotic Lactobacillus plantarum JBC5 improves longevity and healthy aging by modulating antioxidative, innate immunity and serotonin-signaling pathways in Caenorhabditis elegans. Antioxidants. 2022;11:268. doi: 10.3390/antiox11020268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Scarpellini E, Rinninella E, Basilico M, Colomier E, Rasetti C, Larussa T, Santori P, Abenavoli L. From pre-and probiotics to post-biotics: a narrative review. Int J Environ Res Public Health. 2021;19:37. doi: 10.3390/ijerph19010037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lim SM, Lee NK, Kim KT, Paik HD. Probiotic Lactobacillus fermentum KU200060 isolated from watery kimchi and its application in probiotic yogurt for oral health. Microb Pathog. 2020;147:104430. doi: 10.1016/j.micpath.2020.104430. [DOI] [PubMed] [Google Scholar]
- 17.Maleki EH, Bahrami AR, Sadeghian H, Matin MM. Discovering the structure–activity relationships of different O-prenylated coumarin derivatives as effective anticancer agents in human cervical cancer cells. Toxicol Vitr. 2020;63:104745. doi: 10.1016/j.tiv.2019.104745. [DOI] [PubMed] [Google Scholar]
- 18.Lee JE, Lee NK, Paik HD. Antimicrobial and anti-biofilm effects of probiotic Lactobacillus plantarum KU200656 isolated from kimchi. Food Sci Biotechnol. 2021;30:97–106. doi: 10.1007/s10068-020-00837-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Yang SJ, Lee JE, Lim SM, Kim YJ, Lee NK, Paik HD. Antioxidant and immune-enhancing effects of probiotic Lactobacillus plantarum 200655 isolated from kimchi. Food Sci Biotechnol. 2019;28:491–499. doi: 10.1007/s10068-018-0473-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Jeon EB, Son SH, Jeewanthi RKC, Lee NK, Paik HD. Characterization of Lactobacillus plantarum Lb41, an isolate from kimchi and its application as a probiotic in cottage cheese. Food Sci Biotechnol. 2016;25:1129–1133. doi: 10.1007/s10068-016-0181-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Eslami M, Yousefi B, Kokhaei P, Hemati M, Nejad ZR, Arabkari V, Namdar A. Importance of probiotics in the prevention and treatment of colorectal cancer. J Cell Physiol. 2019;234:17127–17143. doi: 10.1002/jcp.28473. [DOI] [PubMed] [Google Scholar]
- 22.CLSI (2022) Performance standards for antimicrobial susceptibility testing, 32nd edition
- 23.Han KJ, Lee JE, Lee NK, Paik HD. Antioxidant and anti-inflammatory effect of probiotic Lactobacillus plantarum KU15149 derived from Korean homemade diced-radish kimchi. J Microbiol Biotechnol. 2020;30:591–598. doi: 10.4014/jmb.2002.02052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kim KT, Yang SJ, Paik HD. Probiotic properties of novel probiotic Levilactobacillus brevis KU15147 isolated from radish kimchi and its antioxidant and immune-enhancing activities. Food Sci Biotechnol. 2021;30:257–265. doi: 10.1007/s10068-020-00853-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Todorov SD, Stojanovski S, Iliev I, Moncheva P, Nero LA, Ivanova IV. Technology and safety assessment for lactic acid bacteria isolated from traditional Bulgarian fermented meat product “lukanka”. Braz J Microbiol. 2017;48:576–586. doi: 10.1016/j.bjm.2017.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Colombo M, Castilho N, Todorov SD, Nero LA. Beneficial properties of lactic acid bacteria naturally present in dairy production. BMC Microbiol. 2018;18:1–12. doi: 10.1186/s12866-018-1356-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lee KW, Shim JM, Park SK, Heo HJ, Kim HJ, Ham KS, Kim JH. Isolation of lactic acid bacteria with probiotic potentials from kimchi, traditional Korean fermented vegetable. LWT-Food Sci Technol. 2016;71:130–137. doi: 10.1016/j.lwt.2016.03.029. [DOI] [Google Scholar]
- 28.Son SH, Jeon HL, Yang SJ, Sim MH, Kim YJ, Lee NK, Paik HD. Probiotic lactic acid bacteria isolated from traditional Korean fermented foods based on β-glucosidase activity. Food Sci Biotechnol. 2018;27:123–129. doi: 10.1007/s10068-017-0212-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Radi R. Oxygen radicals, nitric oxide, and peroxynitrite: redox pathways in molecular medicine. Proc Natl Acad Sci USA. 2018;115:5839–5848. doi: 10.1073/pnas.1804932115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Sueiro-Benavides RA, Leiro-Vidal JM, Salas-Sánchez AÁ, Rodríguez-González JA, Ares-Pena FJ, López-Martín ME. Radiofrequency at 2.45 GHz increases toxicity, pro-inflammatory and pre-apoptotic activity caused by black carbon in the RAW 264.7 macrophage cell line. Sci Total Environ. 2021;765:142681. doi: 10.1016/j.scitotenv.2020.142681. [DOI] [PubMed] [Google Scholar]
- 31.Xu J, Zhao Y, Aisa HA. Anti-inflammatory effect of pomegranate flower in lipopolysaccharide (LPS)-stimulated RAW264. 7 macrophages. Pharm Biol. 2017;55:2095–2101. doi: 10.1080/13880209.2017.1357737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Xue Q, Yan Y, Zhang R, Xiong H. Regulation of iNOS on immune cells and its role in diseases. Int J Mol Sci. 2018;19:3805. doi: 10.3390/ijms19123805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Arango Duque G, Descoteaux A. Macrophage cytokines: involvement in immunity and infectious diseases. Front Immunol. 2014;5:491. doi: 10.3389/fimmu.2014.00491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ahmad W, Jantan I, Kumolosasi E, Haque MA, Bukhari SNA. Immunomodulatory effects of Tinospora crispa extract and its major compounds on the immune functions of RAW 264.7 macrophages. Int Immunopharmacol. 2018;60:141–151. doi: 10.1016/j.intimp.2018.04.046. [DOI] [PubMed] [Google Scholar]
- 35.Li Q, Chen G, Chen H, Zhang W, Ding Y, Yu P, Zhao T, Mao G, Feng W, Yang L, Ye X. Se-enriched G. frondosa polysaccharide protects against immunosuppression in cyclophosphamide-induced mice via MAPKs signal transduction pathway. Carbohydr Polym. 2018;196:445–456. doi: 10.1016/j.carbpol.2018.05.046. [DOI] [PubMed] [Google Scholar]
- 36.Zhao M, Hou J, Zheng S, Ma X, Fu X, Hu S, Zhao K, Xu W. Peucedanum praeruptorum Dunn polysaccharides regulate macrophage inflammatory response through TLR2/TLR4-mediated MAPK and NF-κB pathways. Biomed Pharmacother. 2022;152:113258. doi: 10.1016/j.biopha.2022.113258. [DOI] [PubMed] [Google Scholar]