Silencing TRPM2 enhanced erastin- and RSL3-induced ferroptosis in gastric cancer cells through destabilizing HIF-1α and Nrf2 proteins

Abstract

Ferroptosis is a regulated form of cell death driven by small molecules or conditions that induce lipid-based reactive oxygen species (ROS) accumulation. Cation channel transient receptor potential melastatin-2 (TRPM2) is crucial for cancer cell survival. Our bioinformatic analysis revealed that TRPM2 is associated with cellular responses to chemical stimulus and oxidative stress, implying the potential role of TRPM2 in ferroptosis. Gastric cancer cells were treated with the ferroptosis-inducer, Erastin and RSL3. siRNA transfection was used to silence TRPM2. The levels of GSH, Fe²⁺, ROS and lipid peroxidation, and the activity of GPx activity were evaluated by flow cytometry and spectrophotometer. The effect of TRPM2 on ubiquitination of HIF-1α and Nrf2 were evaluated by co-immunoprecipitation. Erastin and RSL3 induced the up-regulation of TRPM2 in gastric cancer cell lines, especially in SGC7901 and MGC803. These two cells also showed stronger resistance to Erastin and RSL3 than the other cell lines. TRPM2 knockdown reduced the concentration of GSH and GPx activity, but enhanced the concentration of Fe²⁺, ROS and lipid peroxidation, which are significant indicators of ferroptosis. Importantly, silencing TRPM2 enhanced the inhibitory effects of Erastin and RSL3 on gastric cancer cell viability, migration, and invasion. TRPM2 stabilized and finally elevated the abundance of HIF-1α and Nrf2 in SGC7901 and MGC803 cells upon Erastin and RSL3. Activation of HIF-1α impaired Erastin- and RSL3—induced ferroptosis after TRPM2 knockdown. Collectively, silencing TRPM2 enhanced Erastin- and RSL3-induced ferroptosis in gastric cancer cells through destabilizing HIF-1α and Nrf2 proteins.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10616-022-00545-z.

Introduction

Gastric cancer is the third leading cause of cancer mortality with an estimated 1.3 million cases and 819,000 deaths worldwide (Siegel et al. 2021). Remarkably, China has a high incidence of gastric cancer, and the number of deaths account for about 50% of the world’s total (Chen et al. 2016). Currently, the 5-year survival rate of gastric cancer patients is less than 20%, due to the recurrence and metastasis of gastric cancer (Katai et al. 2018). Although the treatment of gastric cancer has made great progress, its recurrence and metastasis often lead to treatment failure and death of the patients (Sexton et al. 2020). The combined use of chemotherapy and targeted therapy has evidently prolonged the overall survival and improved life quality of gastric cancer patients with advanced disease. The commonly used chemotherapeutic agents include Adriamycin (ADR), platinum drugs, 5-fluorouracil (5-FU), vincristine (VCR) and paclitaxel (PTX). However, the development of multi-drug resistance (MDR) of gastric cancer cells is a major hurdle in clinical oncology, which may result in a poor prognosis (Wei et al. 2020). Therefore, activating ferroptotic pathways may overcome drug-resistance and reduce the incidence and mortality of gastric cancer (Ozkan and Bakar-Ates 2021). This possibility offers a perspective for researchers regarding the potential use of this mechanism in developing novel therapeutic strategies.

Distinct from apoptosis, necrosis, and autophagy, ferroptosis is an oxidative, iron-dependent form of cell death (Dixon et al. 2012; Yang et al. 2014). Erastin and RSL3 are the commonly used inducers of ferroptosis (Yang and Stockwell 2008). Further studies have illustrated that Erastin and RSL3 can directly or indirectly impair the antioxidant glutathione (GSH) through different pathways, leading to the accumulation of toxic lipid ROS and, eventually, cell death (Wang et al. 2020). Specifically, erastin inhibits the glutamate (Glu)/cystine antiporter of system Xc⁻ and consequently, the import of cystine. A lack of cystine, an important precursor of GSH synthesis, results in the reduced level of GSH and ROS accumulation (Dixon et al. 2012). In addition, RSL3 directly binds and inhibits glutathione peroxidase 4 (GPX4), which is a critical antioxidant enzyme that can reduce lipid hydroperoxides within biological membranes (Yang et al. 2014; Brigelius-Flohe and Maiorino 2013). Without sufficient levels of GPX4, GSH cannot function as a reducing agent within the local peroxidase reaction cycle and thus causes an accumulation of lipid ROS and induction of ferroptosis. Both erastin and RSL3 share this common cell death mechanism, which causes loss of cellular antioxidant capacity that leads to ferroptosis (Dixon et al. 2012; Yang and Stockwell 2016). Ferroptosis not only stands as an excellent alternative to trigger cell death and reverse drug-resistance, but also provides selectivity in therapy (Zhao et al. 2020; Ghoochani et al. 2021). Erastin synergizes with cisplatin via ferroptosis to inhibit ovarian cancer growth (Cheng et al. 2021). Erastin reverses ABCB1-mediated docetaxel resistance in ovarian cancer (Zhou et al. 2019). RSL3 drives ferroptosis through GPX4 inactivation and ROS production in colorectal cancer (Sui et al. 2018).

Transient receptor potential (TRP) channels are a superfamily of ion channels involved in lots of physiological functions (Nilius and Flockerzi 2014; Akopian 2016). The TRPM subfamily has many members which are involved in various signaling pathways, ultimately leading to cancer progression and growth (Nilius et al. 2007; Aarts et al. 2003). TRPM2, widely expressed in many cell types including brain, hematopoietic cells, and heart (Miller and Zhang 2011), is now considered as a potential therapeutic target in several types of cancer (Zhao et al. 2016; Lin et al. 2018). TRPM2 is naturally activated by ADPribose (ADPR) (Perraud et al. 2003a, b), a mitochondrial metabolite generated by oxidative stress (Perraud et al. 2005), whereas AMP (Lange et al. 2008; Kolisek et al. 2005) and acidic pH (Yang et al. 2010; Starkus et al. 2010) negatively regulate its function. Since its discovery, TRPM2 has been shown to play an important role in response to oxidative stress (Miller and Zhang 2011; Yazgan and Naziroglu 2017; Wang et al. 2017; Akpinar et al. 2016). Different mechanisms influencing cell death and intracellular localization of TRPM2 in different types of cancer have been reported and unifying themes are emerging. The expression of TRPM2 has been proposed as a biomarker for the early diagnosis of aggressive tumors (Park et al. 2016; Orfanelli et al. 2008). Moreover, in both triple negative and estrogen-receptor positive breast cancer, TRPM2 inhibition resulted in increased DNA damage and cytotoxicity, similar to that seen in neuroblastoma (Koh et al. 2015). Inhibition of TRPM2 in gastric cancer cell lines leads to suppressed cell proliferation and increased percentage of apoptotic cells (Almasi et al. 2018). Activation of TRPM2 by H₂O₂ led to increased migration of both HeLa cells and prostate cancer cells (Li et al. 2016). The cooperation of TRPM2 and TRPV2 with Rho GTPases increased cell invasiveness (Chinigo et al. 2020). Although inhibition of TRPM2 is advantageous in the treatment of various cancers, the underlying mechanism remains uncertain. Therefore, understanding the mechanism behind TRPM2-mediated cancer cell survival and migration is crucial for the development of TRPM2-targeted cancer therapy. The recent studies has demonstrated the involvement of TRPM2 in apoptosis, autophagy, and mitochondrial function (Zhao et al. 2016; Hopkins et al. 2015), but whether TRPM2 is associated with ferroptosis is still unclear.

There are several studies clearly indicated that there is a relationship between ferroptosis and HIF-1α. Hypoxia inhibits RANKL-induced ferritinophagy and protects osteoclasts from ferroptosis via activation of HIF-1α (Ni et al. 2021). Hypoxia protects H9c2 cells against ferroptosis through SENP1-mediated the regulation of HIF-1α deSUMOylation (Bai et al. 2021). Much of the literature on ferroptosis has emphasized the importance of Nrf2. Nrf2 protects against acute lung injury via inhibiting ferroptosis (Qiu et al. 2020), promotes resistance of neuron-like cells to ferroptosis (Liu et al. 2020a), inhibits the sensitivity of human NSCLC cells to ferroptosis (Liu et al. 2020b), and prevents ferroptosis in Friedreich’s Ataxia (Rosa et al. 2021). TRPM2 has been reported to stimulated HIF-1α and Nrf2 (Liu et al. 2007; Bao et al. 2019), therefore we speculate that TRPM2 is Involved in regulation of ferroptosis through HIF-1α and Nrf2 proteins.

Through bioinformatic analysis, we found that TRPM2 may be an important regulator of ferroptosis, because TRPM2 is involved in the response of cells to chemical stimulus and oxidative stress. To further decipher the role of TRPM2 in ferroptosis, we used the siRNA to knock down TRPM2 gene expression in two TRPM2 high-expressed gastric cancer cell lines (SGC7901 and MGC803) after treated with the ferroptosis inducers. The study revealed that silencing TRPM2 enhanced Erastin- and RSL3-induced ferroptosis through destabilizing HIF-1α and Nrf2 proteins. Overall, our findings underline the importance of TRPM2 in ferroptosis regulation and its potential as a new therapeutic target of gastric cancer.

Materials and methods

Clinical data analysis

The tumor gene expression profiles and associated clinical data downloaded from the Cancer Genome Atlas (TCGA) RNA-Seq gene expression profiles data and the NCBI Gene Expression Omnibus (GEO) database (GSE). Patients with gastric cancer were divided into the two groups depending on whether the expression of TRPM2 is higher or lower than the median level. For survival analysis, we compared overall survival time and disease-free survival time between gastric cancer patients with high and low TRPM2 expression using Kaplan–Meier analysis (http://kmplot.com/analysis/).

Cell culture and treatments

Gastric cancer cell lines AGS, BGC823, MKN45, SGC7901 and MGC803 were purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. AGS cells were cultured in the F12K medium supplemented with 10% FBS and 1% pen/strep and other cells were cultured in RPMI1640 medium supplemented with 10% FBS and 1% pen/strep. All cell lines were incubated at 37 °C with 5% CO₂ under humidifying conditions. Cells were tested for mycoplasma contamination every 2 months, and only mycoplasma-negative cells were used. Erastin, RSL3 and DMOG was purchased from Selleck Chemicals and dissolved in DMSO and was diluted with RPMI-1640 to its final concentration.

Cell transfection

shRNA against TRPM2 and scrambled shRNA (control shRNA) were purchased from Sangon Biotech. siRNAs were transfected into gastric cancer cells in six-well plates using Lipofectamine 2000 (Invitrogen). The detail information of TRPM2-shRNAs are shown in Table 1.

Table 1.

The detail information of shRNA

shRNAs	Clone ID	Target Seq	Vector
TRPM2-shRNA1	TRCN0000044151	GAAGAAAGAATGCGTGTATTT	pLKO.1
TRPM2-shRNA2	TRCN0000044149	GCAGAAACTGAGCGTGTTCTT	pLKO.1
TRPM2-shRNA3	TRCN0000157541	GACCTTCTCATTTGGGCCATT	pLKO.1

Cell viability assay

Gastric cancer cells (3 × 10³) were cultured in the RPMI-1640 medium with 10% FBS for 12 h. Cells were washed twice with PBS, fed with the RPMI-1640 medium containing 10% FBS and indicated inhibitors or agonists, and cultured for additional 48 h. The growth rates were detected by the CCK-8 assay according to the manufacturer’s protocol. Each experiment was performed in triplicate.

RT-qPCR assay

The total RNA was isolated and reversely transcribed using the RNeasy kit (Qiagen, #74104) and the PrimeScript RT reagent kit (TaKaRa, #RR037A), respectively, according to the manufacturer’s instructions. qPCR was performed using the SYBR Green PCR Master Mix (Thermo Fisher, #4368706), and relative mRNA expression was normalized to GAPDH.

Western blot

Cells were lysed with RIPA buffer and centrifuged at 13,000×g for 20 min. Protein lysates were separated by SDS/PAGE, blotted onto a PVDF membrane, and probed overnight at 4 °C with antibodies against mouse anti-β-Actin (1:3000; Santa Cruz, sc-47778), mouse anti-TRPM2 (1:1000, Sigma, 05-354), rabbit anti-xCT (1:1000, Abcam, ab37185), rabbit anti-GPX4 (1:1000, Abcam, ab125066), rabbit anti-Nrf2 (1:1000, Abcam, ab31163), mouse anti-HIF-1α (1:1000, Novus Biologicals, NB100-105) antibodies. Stripped membranes were probed with a secondary antibody of goat anti-mouse or anti-rabbit IgG (1:5000, Thermo Fisher) and then visualized with enhanced chemiluminescence.

Invasion assay

Gastric cancer cells (5 × 10⁴) were placed in the RPMI1640 culture medium without FBS in the upper chambers of transwell inserts with an 8-μm pore size that were precoated with diluted Matrigel (1:7; BD Biosciences, #356234). RPMI-1640 medium containing 10% FBS and indicated inhibitors or agonists were added to lower chamber (600 μl/well). Cells were allowed to invade into the bottom chamber for 24 h. Non-invading cells in the upper surface were removed and invaded cells on the lower surface were fixed, stained with crystal violet and counted.

Wound-healing assay

Gastric cancer cells were seeded in a six-well plate and allowed to grow to 80% confluence. The cell monolayer was subsequently scratched with a 200 μl pipette tip to create a narrow wound-like gap. Cells were washed twice with PBS and fed with conditioned medium without FBS. The plates were photographed at 0 and 48 h, and the wound distances were measured.

Coimmunoprecipitation (Co-IP) assay

Briefly, 48 h after transfection, cells were harvested, washed and resuspended in lysis buffer [50 mM Tris–HCl (pH 8.0); 120 mM NaCl; 5 mM EDTA; 1% NP-40; 10% glycerol; protease inhibitor cocktail (Sigma-Aldrich)] and kept on ice for 20 min. The cell extracts were clarified by centrifugation, and proteins immobilized by binding to anti-HIF-1α or anti-Nrf2 antibodies overnight at 4 °C. Beads were washed and proteins recovered directly in SDS-PAGE sample buffer. Mouse anti-Ubiquitin antibody was used for Western blot analysis.

Colony formation assay

Cells were seeded into a 96-well plate at a density of 2 × 10³ cells/well. After being seeded for a period of 16 h, the culture medium was replaced by a fresh culture medium containing indicated inhibitors or agonists, with five replicated wells. Following a 48-h period of treatment, the cells were detached by 0.25% trypsin and resuspended in RPMI-1640 medium, which contained 10% FBS. A bottom layer of 1% agar with complete medium is solidified first, followed by an upper layer containing 1000 cells suspended in 0.4% medium-agar mixture in 6-well plates. After 2–3 weeks of incubation, cells were stained with 0.005% crystal violet and the number of colonies were counted. All experiments were performed in triplicates.

Measurement of lipid peroxidation

Cells were seeded on 12-well plates and incubated overnight. The next day, cells were treated with compounds for the indicated times, harvested by trypsinization and resuspended in 200 μl PBS containing 5 μM C11-BODIPY 581/591 (Invitrogen, D3861). Cells were incubated for 30 min at 37 °C in a water bath. The amount of lipid peroxidation was measured by the spectrophotometric absorbance of the supernatant at 484/510 nm using a spectrophotometer.

Measurement of ROS levels

Cells were seeded on 12-well plates and incubated overnight. The next day, cells were treated with compounds for the indicated times, then fresh medium containing 4 μM CM-H₂DCFDA (Thermo Fisher, C6827) for ROS measurements was added to each well. After incubation for 30 min in a humidified incubator (at 37 °C, 5% CO₂), the cells were washed with PBS and trypsinized to obtain a cell suspension. ROS levels were analyzed by flow cytometry using an Accuri 6 cytometer (BD Bioscience).

Measurement of glutathione peroxidase (GPx) activity

For measuring glutathione peroxidase (GPx) activity, we followed the manufacturer’s instructions (Calbiochem, La Jolla, Calif., USA). Cells were collected, homogenized (50 mM Tris–HCl, pH 7.5, 5 mM EDTA and 1 mM DDT) and centrifuged (10,000×g for 15 min at 4 °C). Following mixing of cumene hydroperoxide with supernatant, absorbance at 340 nm was measured immediately and read every minute over 7 min. The decrease in absorbance at 340 nm, which is caused by the oxidation of NADPH into NADP⁺, is directly proportional to the GPx activity. One unit of activity is defined as the amount of enzyme that catalyzes the oxidation of 1 nmol NADPH/min.

Measurement of Fe²⁺

The levels of intracellular Fe²⁺ were detected using the iron assay kit. Following treatment, cells were homogenized in an appropriate amount of iron assay buffer. The samples and kits were used in strict accordance with the manufacturer’s instructions, and the absorbance was measured at 593 nm using a microplate reader.

Measurement of glutathione activity

Cells were treated as indicated, and cellular GSH level was assessed using the Quantichrom Glutathione Assay Kit (DIGT-250, BioAssay Systems, Hayward, CA, USA) according to the manufacturer’s instructions.

Statistics

Samples were randomly allocated among groups. All statistical analyzes were performed using GraphPad Prism 8 (Graphpad Software, Inc.). For one variance, two-tailed Student’s t test (two-sided test) was used between two groups, and one-way analysis of variance (ANOVA) was used to compare more than two groups followed by Tukey’s test. Statistical tests performed are included in the figure legends. The data were presented as mean ± S.D. Statistical analysis was carried out as described in each corresponding figure legend, and sample sizes are shown in each corresponding figure legend. p < 0.05 is considered significant.

Results

TRPM2 functions as an oncogene in pan-cancers

We firstly analyzed the expression of TRPM2 in multiple cancer types from TCGA database (https://tcga-data.nci.nih.gov/tcga/). The public available data indicated that TRPM2 is highly overexpressed in cancers, i.e. gastric cancer (Abbreviation: STAD) compared with normal tissues (Fig. 1A). The results further revealed that high TRPM2 expression were significantly associated with advanced TNM stage, patients’ age, and nodal metastases status of gastric cancer (Fig. 1B). In terms of survival rate, patients with high TRPM2 expression significantly correlated with poorer overall survival and disease-free survival than patients with low TRPM2 expression (Fig. 1C, D). The above results suggested that TRPM2 is an oncogene for cancer progression.

Fig. 1.

Expression level of TRPM2 is negatively correlated with the overall survival rate of gastric cancer patients. A The expression levels of TRPM2 based on TCGA data (log₂(TPM + 1) Scale) compared with tumor and normal tissues in pan-cancer. B Differential TRPM2 expression based on individual cancer stages, tumor grade, patients’ gender, patients’ age, histological subtypes and metastases status in TCGA-STAD dataset. Kaplan–Meier analysis for overall survival (C) and diseased-free survival (D) between TRPM2 high expression group and TRPM2 low expression group (http://kmplot.com/analysis/). Ca The percent of survival patients within 150 month. Cb Significance vs. cutoff values between lower and upper quartiles of expression

TRPM2 is involved in regulating ferroptosis progression

To identify the functions of TRPM2, GO analysis was performed using Uniprot (www.uniprot.org). The GO terms were enriched in second-messenger-mediated signaling, response to oxidative stress and response to oxygen-containing compound (Fig. 2). Functions associated with second-messenger-mediated signaling are involved in intracellular signal transduction, cell communication, cellular response to stimulus, regulation of cellular process and response to stress. Functions associated with response to oxygen-containing compound are involved in cellular response to chemical stimulus. Therefore, we conjectured that TRPM2 may participate in the regulation of ferroptosis, because it is closely associated with cellular response to stimulus and response to oxidative stress.

Fig. 2.

GO analysis of molecular function and biological process of TRPM2. The corresponding information of TRPM2 is analyzed via UniProt (https://www.uniprot.org/)

We next examined whether TRPM2 is associated with ferroptosis. First, we assessed the sensitivity of various gastric cancer cell lines to the ferroptosis inducers, erastin (5 μg/ml) and RSL3 (10 ng/ml). Erastin and RSL3 are two classical small-molecule inducers of ferroptosis (Dixon et al. 2012). Five gastric cancer cell lines were treated with erastin and RSL3 for 48 h. Results of CCK-8 assay showed that SGC7901 and MGC803 cells are less sensitive to the ferroptosis inducers compared to AGS, BGC823 and MKN45 cells (p < 0.05) (Fig. 3A). We also measured TRPM2 level in five gastric cancer cell lines after treated with the ferroptosis inducers and observed that both mRNA and protein levels of TRPM2 were significantly higher in SGC7901 and MGC803 cells than in AGS, BGC823 and MKN45 cells (p < 0.001) (Fig. 3B, C). Taken together, these results indicate that TRPM2 may be a negative regulator of the sensitivity of gastric cancer cells to ferroptosis. Given that TRPM2 level is the highest in SGC7901 and MGC803 cells after treated with the ferroptosis inducers, we used these two cell lines for subsequent experiments.

Fig. 3.

TRPM2 is negatively associated with the sensitivity of cells to ferroptosis. A Cells were treated with Erastin (4.6 μM) and RSL3 (0.1 μM) for 48 h. The cell viability was analyzed by CCK8 assay. Cell viability is represented as a percentage relative to untreated cells. B RT-PCR analysis of TRPM2 and β-actin in cells treated with Erastin and RSL3 for 48 h. C Western blot analysis of TRPM2 and β-actin in cells treated with Erastin and RSL3 for 48 h. Data are presented as mean ± S.D. *p < 0.05; **p < 0.01; ***p < 0.001, compared with control group (n = 3)

Silencing TRPM2 enhanced the ferroptosis of gastric cancer triggered by erastin and RSL3

To further confirm the role of uniprot in ferroptosis, we knocked down TRPM2 by transfecting cells with siRNA. The results showed that siRNA-1, siRNA-2 and siRNA-3 interferences lowered TRPM2 expression significantly compared to control. siRNA-1 had the strongest inhibitory effect (p < 0.001), thus it was used to perform the following functional experiments (Fig. 4A). Erastin and RSL3 promoted the expression of TRPM2 in TRPM2-KD cells (Fig. 4B).

Fig. 4.

TRPM2 KD enhance the sensitivity of cells to ferroptosis. A RT-PCR analysis of TRPM2 and β-actin in cells transfected with siRNA-NC, siRNA1, siRNA2 and siRNA3. B RT-PCR analysis of TRPM2 and β-actin in cells transfected with siRNA1 and treated with Erastin and RSL3 for 48 h. GSH concentration (C), GPx activity (D) in cells transfected with siRNA1 and treated with Erastin and RSL3 for 48 h. E ROS level in cells transfected with siRNA1 and treated with Erastin and RSL3 for 48 h. Intracellular ROS level was examined by DCF staining. Lipid peroxidation concentration (F) and Fe²⁺ concentration (G) in cells transfected with siRNA1 and treated with Erastin and RSL3 for 48 h. Data are presented as mean ± S.D. *p < 0.05; **p < 0.01; ***p < 0.001, compared with control group. ^#p < 0.05; ^##p < 0.01; ^###p < 0.001, compared with Erastin-treated group. ^&p < 0.05; ^&&p < 0.01; ^&&&p < 0.001, compared with RSL3-treated group (n = 3). KD knockdown

To explore the molecular mechanism of TRPM2 in ferroptosis, we analyzed GSH concentration, GPx activity, lipid peroxidation and iron ion accumulation, which are important indexes for the evaluation of ferroptosis. By using GSH as the substrate, GPx prevents ferroptosis through clearance of lipid peroxides. Excessive lipid peroxidation (LPO) is indispensable for ferroptosis (Yang et al. 2014). Reducing the expression of TRPM2 further exacerbated the erastin-induced reduction in GSH concentration (p < 0.05) (Fig. 4C). Suppression of TRPM2 expression increased erastin- and RSL3-induced reduction in GPx activity in both SGC7901 and MGC803 cells (p < 0.01) (Fig. 4D). The elevated levels of ROS induced by erastin and RSL3 were further promoted by the knockdown of TRPM2 (p < 0.001) (Fig. 4E). Similarly, the LPO concentration were induced by inhibition of TRPM2 in erastin- and RSL3-treated cells (p < 0.01) (Fig. 4F). Ferrous iron (Fe²⁺) overload is also necessary for the occurence of ferroptosis, as Fe²⁺ robustly induces lipid peroxidation (Chen et al. 2021). Therefore, we further investigated the effect of TRPM2 on the changes of Fe²⁺ levels. The levels of intracellular Fe²⁺ were increased in SGC7901 and MGC803 cells following erastin and RSL3 treatment. Knockdown of TRPM2 increased the levels of intracellular Fe²⁺ (p < 0.01) (Fig. 4G). These findings indicate that TRPM2 promoted the ferroptosis of gastric cancer triggered by erastin and RSL3.

Silencing TRPM2 enhances the inhibition of erastin and RSL3 on cell migration, invasion and clonogenicity

To investigate whether TRPM2 affects ferroptosis-inhibited cell migration, wound-healing assays were performed. The results showed that treatment with erastin and RSL3 significantly reduced migration compared with that in controls, this process was enhanced by knockdown (KD) of TRPM2 (p < 0.01) (Fig. 5A). Next, a Transwell assay was performed to further confirm the effect of TRPM2 on cell invasion. As shown in Fig. 5B, TRPM2 significantly suppressed gastric cancer cell migration after exposure to erastin and RSL3 for 48 h (p < 0.05). In addition, colony formation assays revealed that TRPM2 silencing suppressed colony formation after treatment with erastin and RSL3 (p < 0.01) (Fig. 5C). Altogether, these data demonstrate that TRPM2 depletion enhanced the effects of erastin and RSL3 on the suppression of gastric cancer cell migration, invasion and clonogenicity.

Fig. 5.

TRPM2 KD suppressed cell proliferation, migration and invasion of gastric cancer. A Brightfield images and quantification analysis of cells during wound healing assays of cells at 0 and 48 h. Wound closures were imaged immediately after scratching (0 h) and 48 h later. B Brightfield images and quantification analysis of crystal violet staining of migrating cells in the migration assay. C Colony formation ability was assessed using colony formation assay; representative images and quantification analysis are shown. Data are presented as mean ± S.D. *p < 0.05; **p < 0.01; ***p < 0.001, compared with control group. ^#p < 0.05; ^##p < 0.01; ^###p < 0.001, compared with Erastin-treated group. ^&p < 0.05; ^&&p < 0.01; ^&&&p < 0.001, compared with RSL3-treated group (n = 3). KD knockdown. (Color figure online)

TRPM2 regulates HIF-1α and Nrf2 protein levels in gastric cancer cell upon erastin and RSL3 stimulation

Recent studies have demonstrated that HIF-1α protects osteoclasts from ferroptosis (Ni et al. 2021). The Nrf2 gene and its targets are involved in the oxidative stress response and play a regulatory role in ferroptosis (Song et al. 2021; Abdalkader et al. 2018). Our observation is in accordance with studies reported previously. As shown in Fig. 6, erastin and RSL3 downregulated the protein levels of Xc-, GPX4 and Nrf2 (p < 0.05), and upregulated the expression of HIF-1α (p < 0.001). Knockdown of TRPM2 blocked the up-regulation of HIF-1α caused by erastin and RSL3, and further downregulated the expression of Xc-, GPX4 and Nrf2 (p < 0.01). We also investigated the protein levels after knockdown of TRPM2 alone. Without the erastin and RSL3, knockdown of TRPM2 also decreased the protein levels of Xc-, GPX4 and Nrf2 (p < 0.01 or p < 0.001, supplementary figure). But, it was almost undetectable of HIF-1α without the addition of erastin and RSL3. Therefore, it is difficult to evaluate the effect of TRPM2 on HIF-1α without the addition of erastin and RSL3.

Fig. 6.

TRPM2 KD inhibited the expression of HIF-1α. Western blot analysis of Xc⁻, GPX4, Nrf2, HIF-1α and β-actin in cells transfected with siRNA1 and treated with Erastin and RSL3 for 48 h. Data are presented as mean ± S.D. *p < 0.05; **p < 0.01; ***p < 0.001, compared with control group (n = 3). KD knockdown

To detect whether TRPM2 affects ferroptosis through regulating HIF-1α, we silenced TRPM2 in SGC7901 and MGC803 cells treated with erastin, RSL3 and HIF-1α activator DMOG. As shown in Fig. 7A, activation of HIF-1α significantly suppressed the sensitivity of TRPM2-knockdown SGC7901 and MGC803 cells to erastin and RSL3 (p < 0.05). Further investigation revealed that overexpression of HIF-1α reversed TRPM2-regulated downregulation of GSH concentration, GPx activity and upregulation of Fe²⁺ concentration, ROS level and LPO concentration (p < 0.05) (Fig. 7B–F). Application of DMOG to TRPM2-knockdown cells abrogated erastin- and RSL3-inhibited cell migration, invasion and clonogenicity (p < 0.05) (Fig. 8A–C). These results show that silencing TRPM2 promoted ferroptosis by reducing HIF-1α.

Fig. 7.

HIF-1α activation reversed TRPM2 KD-enhanced ferroptosis. A Cells transfected with siRNA1 were treated with Erastin, RSL3 and DMOG for 48 h. The cell viability was analyzed by CCK8 assay. Cell viability is represented as a percentage relative to untreated cells. GSH concentration (B), GPx activity (C) in cells transfected with siRNA1 and treated with Erastin, RSL3 and DMOG for 48 h. D Fe²⁺ concentration in cells transfected with siRNA1 and treated with Erastin, RSL3 and DMOG for 48 h. E ROS level in cells transfected with siRNA1 and treated with Erastin, RSL3 and DMOG for 48 h. Intracellular ROS level was examined by DCF staining. F Lipid peroxidation concentration in cells transfected with siRNA1 and treated with Erastin, RSL3 and DMOG for 48 h. Data are presented as mean ± S.D. *p < 0.05; **p < 0.01; ***p < 0.001, compared with control group. ^#p < 0.05; ^##p < 0.01; ^###p < 0.001, compared with Erastin-treated group. ^&p < 0.05; ^&&p < 0.01; ^&&&p < 0.001, compared with RSL3-treated group (n = 3). KD knockdown; Act activator

Fig. 8.

HIF-1α activation reversed TRPM2 KD-suppressed cell proliferation, migration and invasion. A Brightfield images and quantification analysis of cells during wound healing assays of cells transfected with siRNA1 and treated with Erastin, RSL3 and DMOG at 0 and 48 h. Wound closures were imaged immediately after scratching (0 h) and 48 h later. B Brightfield images and quantification analysis of crystal violet staining of migrating cells transfected with siRNA1 and treated with Erastin, RSL3 and DMOG in the migration assay. C Colony formation ability was assessed using colony formation assay; representative images and quantification analysis are shown. Data are presented as mean ± S.D. *p < 0.05; **p < 0.01; ***p < 0.001, compared with control group. ^#p < 0.05; ^##p < 0.01; ^###p < 0.001, compared with Erastin-treated group. ^&p < 0.05; ^&&p < 0.01; ^&&&p < 0.001, compared with RSL3-treated group (n = 3). KD knockdown; Act activator. (Color figure online)

TRPM2 regulates the ubiquitination of HIF-1α and Nrf2

The String website (https://string-db.org/) was used to search the relationship between TRPM2 and HIF-1α and Nrf2, as shown in the protein network map (Fig. 9A). The minimum required interaction score was set as the medium confidence (0.400). It has been reported that TRPM2 can regulate the stability of HIF-1α and Nrf2 through RACK1 and IQGAP1 (Liu et al. 2007; Bao et al. 2019). Moreover, through analysis using String website, we found that TRPM2 can also regulate HIF-1α through HO-1. Interestingly, HIF-1α, acting as a transcription factor, is able to regulated HO-1 expression (Ockaili et al. 2005), suggesting a potential positive feedback between HO-1 and HIF-1α. It is worthy to mention that HO-1 is also positively regulated by Nrf2 (Loboda et al. 2016). Therefore, TRPM2 probably regulates HIF-1α and Nrf2 stability in multiple ways (Fig. 9B). It is well established that ubiquitination of HIF-1α and Nrf2 is a crucial step for their degradation (Digaleh et al. 2013; Albanese et al. 2020). CoIP experiments showed that cells treated with erastin and RSL3 significantly suppressed ubiquitination of HIF-1α in SGC7901 and MGC803 cells, but this inhibitory effect was rescued by transfected with TRPM2 siRNA. Similarly, knockdown of TRPM2 enhanced ubiquitination of Nrf2 (Fig. 9C). Taken together, these results suggest that TRPM2 inhibits ubiquitination of HIF-1α and Nrf2, thereby suppressing degradation of HIF-1α and Nrf2.

Fig. 9.

TRPM2 KD promoted the ubiquitination of HIF-1α and Nrf2. A Image generated by STRING (https://string-db.org/). B Potential mechanistic pathway by which TRPM2 promotes the stability of HIF-1α and Nrf2. C Cells were harvested and lysed, followed by IP with anti-HIF-1α and anti-Nrf2 antibody. Immunoblotting was employed for Ubiquitin, HIF-1α and Nrf2. KD knockdown

Discussion

TRPM2 is a non-selective calcium-permeable cation channel (Hara et al. 2002). TRPM2 activity was so far connected with such events as a cellular response to ischemia–reperfusion injury, regulation of endothelial permeability, inflammation, development of cancer and degenerative diseases, or induction of cell death, including apoptosis and autophagy (Zhang et al. 2021; Zeng et al. 2010; Sun et al. 2012; Rakita et al. 2020; Miyanohara et al. 2018; Hecquet et al. 2008). In the present study, we first report TRPM2 as a regulator in erastin- and RSL3-induced ferroptosis. TRPM2 knockdown increased the sensitivity of gastric cancer cells to erastin- and RSL3-induced ferroptosis. TRPM2 knockdown reduced the concentration of GSH and GPx activity, but enhanced the concentration of Fe²⁺, ROS and lipid peroxidation, which are significant indicators of ferroptosis.

There are some differences in the effects of Erastin and RSL3 on inducing the ferroptosis in gastric cancer. Both Erastin and RSL3 are inducers of ferroptosis, but the mechanism by which they induce ferroptosis isn’t exactly the same. Erastin inhibits the glutamate/cystine antiporter of system Xc- and consequently suppressed the GSH synthesis. RSL3 directly binds and inhibits GPX4 activity. Therefore, treatment with Erastin reduced GSH in gastric cancer cells. The storage of GSH further suppressed the activity of GPX4. In our study, both GSH and GPX4 activity were reduced after treatment with Erastin. RSL3 inhibiting GPX4 activity reduced the consumption of GSH by GPX4, which may be a reason for GSH increase after RSL3 treatment.

Each year, 1 million new patients are diagnosed with gastric cancer, 700,000 of whom will lose the battle with this devastating disease, making gastric cancer one of the deadliest cancers in the world (Smyth et al. 2020). Additionally, patients are usually diagnosed with GC after metastasis has occurred or in an advanced stage due to limitations in early noninvasive detection techniques (Ferlay et al. 2015). Gastric cancer remains a major burden to individuals worldwide, highlighting the importance of finding new treatments in the hopes of improving patient survival. Considering the poor efficacy of current anti-cancer agents, the increasing resistance to chemotherapy drugs and the lack of treatment options for late-stage patients, the development of novel and effective therapeutic approaches is of critical importance. In this study, we characterized the function of TRPM2 in gastric cancer cells to provide an overview of its potential role in cancer cell survival and metastasis. The results showed that TRPM2 knockdown significantly decreases gastric cancer cell invasion, migration and proliferation mainly through improving the effectiveness of the ferroptosis-inducing compounds, erastin and RSL3. More importantly, TRPM2 is significantly upregulated in many types of cancer compared with adjacent normal tissues. The expression of TRPM2 is tightly associated with clinical characteristics, such as TNM stage, nodal metastasis and overall survival. Our findings illustrated the importance of TRPM2 in the proliferation and invasion of gastric cancer cells. Hence, finding a specific inhibitor for TRPM2 holds significant clinical potential and may serve as a new anti-cancer agent.

HIF-1α, a central regulator for detecting and adapting to cellular oxygen levels, transcriptionally activates genes modulating oxygen homeostasis and metabolic activation (Schito and Semenza 2016). In cancer progression, HIF-1α indirectly promotes EMT by modulating NOTCH and integrin-linked kinase signaling (Rankin and Giaccia 2016). HIF-1α induced cisplatin-resistance in non-small lung cancer (Liu et al. 2020c). In addition to regulation by O₂ levels, HIF-1α activity is also modulated by somatic mutations in oncogenes and tumor suppressor genes, tumor virus infection, cytokines, and other signaling molecules in the tumor microenvironment (Semenza 2010). Recent studies have demonstrated that HIF-1α participated in ferroptosis and protects cells against ferroptosis (Ni et al. 2021; Bai et al. 2021). In accordance with the present results, our findings revealed that erastin and RSL3 increased the expression of HIF-1α in normoxic conditions. The precise mechanisms are not known. One mechanism may be that mitochondrial ROS production induces HIF-1α stabilization (Castelli et al. 2021). TRPM2 regulates HIF-1α and Nrf2 protein levels in gastric cancer cell upon erastin and RSL3 stimulation. HIF-1α activator significantly suppressed the sensitivity of TRPM2-knockdown cells to erastin and RSL3. Nrf2 prevents damage caused by oxidative stress. Activated Nrf2 promotes cancer development and progression (Li et al. 2019). Increasing evidence suggests that ferroptosis is regulated by the Nrf2 pathway. Stimulation of the Nrf2 pathway protected against ferroptosis in hepatocellular carcinoma (Sun et al. 2016). Nrf2 knockdown sensitized GPX4 inhibitor-induced ferroptosis in head and neck cancer (Shin et al. 2018). In our study, we found that TRPM2 inhibits ubiquitination of HIF-1α and Nrf2, thereby suppressing degradation of HIF-1α and Nrf2. Therefore, we speculate that TRPM2 may serve as a regulator of stabilization of HIF-1α and Nrf2 and it is important for future research to focus on the interaction between TRPM2-HIF-1α/Nrf2 and their regulation on ferroptosis.

Under normoxic conditions, α-ketoglutarate-dependent prolyl hydroxylases (PHDs) catalyze the hydroxylation of proline residues in the oxygen-dependent degradation domains of HIF-1α, which are recognized by the VHL E3 ubiquitin ligase complex, leading to HIF-1α ubiquitination and subsequent degradation (LaGory and Giaccia 2016). Suppressed ubiquitination of Nrf2 contributes to Nrf2 activation (Ha Kim et al. 2017). Under homeostatic conditions, its cellular level is kept low by Keap1-mediated Cul3/Rbx1-dependent ubiquitination, which targets it for proteasome-mediated degradation in the cytoplasm (Zhang et al. 2004). In this study, we found that the ubiquitination of HIF-1α and Nrf2 are associated with TRPM2. Our results revealed that TRPM2 inhibits ubiquitination of HIF-1α and Nrf2 and stabilized HIF-1α and Nrf2, which in turn promotes survival and metastasis of cancer cells. We propose that silencing TRPM2 makes HIF-1α and Nrf2 more amenable for interaction with ubiquitin ligase thus inducing its degradation. However, the precise mechanism by which TRPM2 inhibited ubiquitination of HIF-1α and Nrf2 presently remains unclear. Our results reveal an important mechanism underlying the role of TRPM2 in cancer progression.

Taken together, our studies demonstrated that TRPM2 knockdown significantly enhances gastric cancer cell sensitivity to the ferroptosis-induced compounds, which reveals the therapeutic potential as an anti-cancer target. Given the negative correlation between the TRPM2 expression level and patient survival, we suggest that combination of chemotherapeutics and TRPM2-targeted drugs may lead to an increase in treatment effectiveness and improve patient outcome.

Supplementary Information

Below is the link to the electronic supplementary material.

Funding

This study was supported by the Shaoguan Science and Technology Project (Grant No. 200812114531705); Shaoguan Health Research Project (Grant No.Y20204).

Data availability

The data used to support the findings of this study are available from the corresponding author upon request.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest.