Combining CRISPR-Cas9 and brain imaging to study the link from genes to molecules to networks

Sabina Marciano; Tudor M Ionescu; Ran Sing Saw; Rachel Y Cheong; Deniz Kirik; Andreas Maurer; Bernd J Pichler; Kristina Herfert

doi:10.1073/pnas.2122552119

. 2022 Sep 26;119(40):e2122552119. doi: 10.1073/pnas.2122552119

Combining CRISPR-Cas9 and brain imaging to study the link from genes to molecules to networks

Sabina Marciano ^a,¹, Tudor M Ionescu ^a, Ran Sing Saw ^a, Rachel Y Cheong ^b, Deniz Kirik ^b, Andreas Maurer ^a, Bernd J Pichler ^a, Kristina Herfert ^a,²

PMCID: PMC9546570 PMID: 36161926

Significance

The involvement of receptors, transporters, and ion channels in neurological diseases has been demonstrated, but genetic screenings are constantly discovering new targets whose mechanistic role in the pathogenesis of these diseases is not yet well understood. We combined in vivo CRISPR-Cas9 gene editing with molecular and functional brain imaging in the adult rat brain to study the impact of target molecules on brain function at the whole-brain level. We show that our combinatorial approach can be used to identify pathological features characteristic of mild or severe disease phenotypes, as it allows the detection of stage-specific molecular and functional brain adaptations. Ultimately, our multimodal design has the potential to support the development of targeted therapies to restore normal brain function.

Keywords: CRISPR-Cas9, resting-state functional MRI, PET, VMAT2, dopamine

Abstract

Receptors, transporters, and ion channels are important targets for therapy development in neurological diseases, but their mechanistic role in pathogenesis is often poorly understood. Gene editing and in vivo imaging approaches will help to identify the molecular and functional role of these targets and the consequence of their regional dysfunction on the whole-brain level. We combine CRISPR-Cas9 gene editing with in vivo positron emission tomography (PET) and functional MRI (fMRI) to investigate the direct link between genes, molecules, and the brain connectome. The extensive knowledge of the Slc18a2 gene encoding the vesicular monoamine transporter (VMAT2), involved in the storage and release of dopamine, makes it an excellent target for studying the gene network relationships while structurally preserving neuronal integrity and function. We edited the Slc18a2 in the substantia nigra pars compacta of adult rats and used in vivo molecular imaging besides behavioral, histological, and biochemical assessments to characterize the CRISPR-Cas9–mediated VMAT2 knockdown. Simultaneous PET/fMRI was performed to investigate molecular and functional brain alterations. We found that stage-specific adaptations of brain functional connectivity follow the selective impairment of presynaptic dopamine storage and release. Our study reveals that recruiting different brain networks is an early response to the dopaminergic dysfunction preceding neuronal cell loss. Our combinatorial approach is a tool to investigate the impact of specific genes on brain molecular and functional dynamics, which will help to develop tailored therapies for normalizing brain function.

The brain is a network of spatially distributed but functionally and structurally interconnected regions that exhibit correlated activity over time. They communicate with each other via highly specialized neuronal connections and are organized in neuronal circuits and networks. Understanding how functional connections between regions are arranged in the healthy and diseased brain is therefore of great interest.

Resting-state functional MRI (rs-fMRI) has enabled neuroscientists to delineate the level of functional communication between anatomically separated regions (1). rs-fMRI measures the resting-state functional connectivity (rs-FC) at high spatial and temporal resolutions based on spontaneous fluctuations of the blood oxygen level–dependent (BOLD) signal at rest, which indirectly detects neuronal activity via hemodynamic coupling (2). Using rs-fMRI, several brain resting-state networks in humans and rodents have been identified, such as the default mode network (DMN) and sensorimotor network (SMN) (3–9). Alterations of these networks are linked to neurological diseases (10, 11) and may serve as early therapeutic and diagnostic biomarkers. However, the molecular signatures related to the functional alterations in disease remain largely unknown.

Positron emission tomography (PET) provides a noninvasive tool to indirectly measure molecular changes in the brain with high specificity and sensitivity. One well-characterized example is the radioligand [¹¹C]raclopride, a widely used D2/D3 receptor antagonist enabling the noninvasive determination of dopamine release and availability (12–14).

PET, in combination with BOLD-fMRI, has the great potential to investigate the molecular substrate of brain FC, enabling the direct spatial and temporal correlation of both measurements (15–21). In this context, we have recently shown that rs-FC is modulated by intrinsic serotonin transporter and D2/3 receptor occupancy in rats (22).

Insights into functional brain circuits and their relationships to individual phenotypes can be gained by genetic manipulations of neuronal subtypes (23). Genome-engineering methodologies based on CRISPR-Cas9 represent a promising approach to unveil the influence of genes on brain circuits. CRISPR-Cas9 has enabled researchers to interrogate the mammalian DNA in a precise yet simple manner (24, 25) in several species (26–31) by editing single or multiple genomic loci in vitro and in vivo (25, 32, 33). However, one great hurdle is brain delivery, which must comply with adequate nuclear access while minimizing immunogenic reactions and off-target editing (34). Despite these limitations, the potential of CRISPR-Cas9 is continuously expanding, with novel nuclease variants being exploited (35–37). Derived from Staphylococcus aureus, SaCas9 overcomes the packaging constraints of adeno-associated viral vectors (AAVs), allowing efficient CRISPR-Cas9 brain transfer (38–42). In several neurological disorders, including epilepsy, major depression, Parkinson’s disease, and Alzheimer’s disease, next-generation sequencing approaches have identified novel receptors, transporters, and ion channels involved in disease initiation and progression. However, their role in pathogenesis is poorly understood (43). Gene editing combined with in vivo imaging modalities, as developed in the present study, will help to identify the molecular and functional role of these targets and the adaptations following their regional dysfunction on the whole-brain level. This will be crucial to identify novel diagnostic and therapeutic strategies and advance research in the field.

In this study, we use an AAV-based CRISPR-SaCas9 gene-editing approach to knock down the Slc18a2 gene encoding the vesicular monoamine transporter 2 (VMAT2), a key protein involved in the storage and release of dopamine in the brain (44). The extensive knowledge of the Slc18a2 makes it an excellent basis for studying the gene networks relationships. We characterize the VMAT2-mediated dopamine signaling using in vivo molecular imaging, behavioral, histological, and biochemical assessments.

Results

In Vitro Validation of CRISPR-SaCas9–Induced VMAT2 Knockdown in Rat Primary Cortical Neurons.

To evaluate the efficiency of the AAV-based CRISPR-SaCas9 VMAT2 knockdown in rat primary neurons, we designed AAV-SaCas9 and AAV-single-guide RNA (sgRNA) targeting the first exon of the bacterial lacZ gene (control) or the second exon of the Slc18a2 gene (Fig. 1A) (sgRNAs sequences are reported in Table 1). Seven days posttransduction, the protein expression level and mutation rate of the harvested genomic DNA were inspected by immunofluorescence and surveyor assay (Fig. 1B). Immunofluorescence indicated a clear reduction of VMAT2 protein expression in neurons transduced with AAV-SaCas9 and AAV-sgRNA-Slc18a2 (Fig. 1C). We observed 20% editing for the digested DNA from neurons transduced with vectors for SaCas9 and sgRNA-Slc18a2 (SI Appendix, Fig. S1).

Fig. 1. — In vitro validation of CRISPR-SaCas9–induced VMAT2 knockdown in rat primary cortical neurons. (A) AAV-SaCas9 and AAV-sgRNA expression vectors. (B) Experimental design for primary neurons isolation and transduction. (C) VMAT2 immunostaining (red) and nuclei labeled with DAPI (blue). GFP (green) and HA-tag (white) indicate the expression of the sgRNA and SaCas9 vectors, respectively. VMAT2 KD (arrows) is shown in neurons transduced with AAVs carrying SaCas9 and sgRNA-*Slc18a2.* KD, knockdown; ITR, inverted terminal repeat; CMV, cytomegalovirus promoter; GFP, green fluorescent protein; CAG, CMV enhancer/chicken β-actin promoter; NLS, nuclear localization signal; HA-tag, hemagglutinin tag; polyA, polyadenylation signal; polyT, polytermination signal; IF, immunofluorescence.

Table 1.

sgRNA sequences

sgRNAs	DNA target sequences 5′–3′	PAM (NNGRRT) 5′–3′
Slc18a2	CGATGAACAGGATCAGTTTGC	GCGAGT
lacZ	CCTTCCCAACAGTTGCGCAGC	CTGAAT

Open in a new tab

CRISPR-SaCas9–Induced VMAT2 Knockdown Elicits Postsynaptic Changes but No Nerve Terminal Loss or Neuroinflammation in the Adult Rat Brain.

To test the in vivo efficiency of the CRISPR-SaCas9 gene editing, we expressed SaCas9 and sgRNA targeting Slc18a2 to knock down the VMAT2, or targeting lacZ as control, by AAV-mediated gene transfer into the right substantia nigra pars compacta (SNc). A sham injection was performed in the left SNc. [¹¹C]dihydrotetrabenazine (DTBZ) PET imaging was performed 8–10 wk postinjection to quantify VMAT2 expression in the striatum (Fig. 2A).

Fig. 2. — CRISPR-SaCas9–induced VMAT2 knockdown elicits postsynaptic changes but no nerve terminal loss in the adult rat brain. (A) Schematic illustration of the experimental design. (B) Mean BP_ND maps of control and VMAT2 KD rats coregistered to a rat brain atlas. (C) BP_ND values of individual control and VMAT2 KD rats in the left and right striatum. (D) A strong correlation between Δ [¹¹C]RAC and Δ [¹¹C]DTBZ BP_ND is shown. (E) The ratio of striatal [¹¹C]RAC and [¹¹C]DTBZ BP_ND shows prominent [¹¹C]RAC changes when a threshold of ∼20% Δ [¹¹C]DTBZ BP_ND is reached. This threshold was set to separate the VMAT2 KD rats into mild and moderate. (F) Mild and moderate rats could be differentiated based on the postsynaptic changes. *P < 0.01, **P < 0.001, Bonferroni–Sidak corrected. Data are shown as a boxplot with the median value (central mark), the mean value (plus sign), interquartile range (boxes edges), and the extreme points of the distribution (whiskers). Control rats n = 8; VMAT2 KD rats n = 12. Mild: Δ [¹¹C]DTBZ BP_ND < 20%; moderate: Δ [¹¹C]DTBZ BP_ND ≥ 20%. [¹¹C]MP, [¹¹C]methylphenidate; [¹¹C]RAC, [¹¹C]raclopride; LSTR, left striatum; RSTR, right striatum; CER, cerebellum; DAT, dopamine transporter; TSPO, translocator protein; DPBS, Dulbecco’s phosphate buffered saline; ns, not significant.

The [¹¹C]DTBZ nondisplaceable binding potential (BP_ND) was decreased by 30% (0–62%) in the right striatum of rats where the VMAT2 was knocked down, in comparison to the contralateral striatum. No changes of the [¹¹C]DTBZ BP_ND were observed in the contralateral striatum, as [¹¹C]DTBZ BP_ND did not differ between the left striatum of rats injected with sgRNA targeting lacZ and rats injected with sgRNA targeting Slc18a2 (Fig. 2 B and C).

We further evaluated changes of dopamine availability in the striatum using [¹¹C]raclopride, which competes with dopamine for the same binding site at the D2 receptor (D2R) (13). After 12–14 wk following CRISPR-SaCas9–induced VMAT2 knockdown in nigrostriatal neurons, we observed a 17% increased BP_ND of [¹¹C]raclopride in the right striatum of VMAT2 knockdown rats and no changes in control rats (Fig. 2 B and C), indicating a reduction of synaptic dopamine levels and/or compensatory changes of D2R expression at postsynaptic medium spiny neurons. A larger VMAT2 knockdown led to lower dopamine levels in the striatum and thus to higher D2R binding changes (Fig. 2D). To explore the threshold at which the observed postsynaptic changes occur, we calculated the [¹¹C]raclopride/[¹¹C]DTBZ BP_ND ratio for the right and left striatum. The ratio remained close to 1 in the sham-injected striatum (SI Appendix, Fig. S2) and control rats, indicating no substantial difference between the two hemispheres. In contrast, VMAT2 knockdown rats displayed large [¹¹C]raclopride BP_ND changes when the level of VMAT2 knockdown was ≥20%. From this point, a prominent increase in D2R binding was observed in the right striatum (Fig. 2E). Therefore, this threshold was set to split the rats into mild (<20%) and moderate (≥20%). Notably, [¹¹C]raclopride PET imaging was able to discriminate between different degrees of synaptic dysfunction, classified from [¹¹C]DTBZ BP_ND changes (Fig. 2F).

We inspected the integrity of dopaminergic nerve terminals and the occurrence of neuroinflammation in the striatum after the CRISPR-SaCas9–induced VMAT2 knockdown. [¹¹C]methylphenidate PET imaging of the dopamine transporter and [¹⁸F]GE-180 PET imaging of the translocator protein, which is overexpressed on activated microglia, were performed. CRISPR-SaCas9–induced VMAT2 knockdown did neither alter the [¹¹C]methylphenidate BP_ND (Fig. 2 B and C) nor [¹⁸F]GE-180 uptake (SI Appendix, Fig. S3).

CRISPR-SaCas9–Induced VMAT2 Knockdown Impairs Motor Function.

To explore the motor consequences of the CRISPR-SaCas9–induced VMAT2 knockdown, we performed several behavioral tests (Fig. 3A).

We observed a reduction in the locomotor activity of VMAT2 knockdown rats in the open field test (Fig. 3A) but no correlation to VMAT2 expression changes (Δ [¹¹C]DTBZ BP_ND) or dopamine availability changes (Δ [¹¹C]raclopride BP_ND) (SI Appendix, Fig. S4 A and B).

Next, we evaluated the forelimb akinesia using the cylinder test. VMAT2 knockdown rats displayed a preference for the right forepaw, while control rats equivalently used their right and left forepaw (Fig. 3C). Paw-use alterations correlated highly with VMAT2 knockdown (Δ [¹¹C]DTBZ BP_ND) and changes in dopamine availability (Δ [¹¹C]raclopride BP_ND) (Fig. 3 D and E).

To further examine differences in motor function, coordination, and balance, rats underwent the beam walk test. VMAT2 knockdown rats stumbled with higher frequency to the left side, while control rats displayed equal chances to slip in each direction (Fig. 3F). However, no correlations between gait alterations and VMAT2 knockdown (Δ [¹¹C]DTBZ BP_ND) or dopamine availability changes (Δ [¹¹C]raclopride BP_ND) were found (SI Appendix, Fig. S4 C and D).

As previous studies suggest that body-weight changes reflect striatal dopamine depletion (45), we inspected the impact of the VMAT2 knockdown on body weight gain. VMAT2 knockdown rats exhibited a 30% reduction in their gained weight over a period of 14 wk compared with controls (Fig. 3G). Body weight gain correlated with changes in VMAT2 expression (Δ [¹¹C]DTBZ BP_ND) and dopamine availability (Δ [¹¹C]raclopride BP_ND) (Fig. 3 H and I).

To assess the rotational behavior, we performed the rotameter test with and without apomorphine administration. In the spontaneous rotation test, VMAT2 knockdown rats displayed a higher No. of ipsilateral net turns compared with control rats (Fig. 3J). The No. of turns did not correlate with VMAT2 expression changes (Δ [¹¹C]DTBZ BP_ND) and changes in dopamine availability (Δ [¹¹C]raclopride BP_ND) (SI Appendix, Fig. S4 E and F). Apomorphine-induced rotations to the contralateral side were higher in VMAT2 knockdown rats compared with control rats (Fig. 3K) and correlated with changes in VMAT2 expression (Δ [¹¹C]DTBZ BP_ND) and dopamine availability (Δ [¹¹C]raclopride BP_ND) (Fig. 3 L and M).

Ex Vivo Validation of the CRISPR-SaCas9-Induced VMAT2 Knockdown.

Nineteen weeks postinjection, nigral and striatal sections of VMAT2 knockdown and control rats were collected to perform high-performance liquid chromatography (HPLC) and immunohistochemistry (Fig. 4A). Using immunofluorescence, we confirmed the concomitant expression of SaCas9- and Slc18a2-targeting sgRNA 19 wk posttransduction and a corresponding decrease of VMAT2 expression in the SNc of the VMAT2 knockdown group (Fig. 4B).

Immunohistochemistry revealed no changes in tyrosine hydroxylase expression levels in the striatum and SNc in both groups (Fig. 4 C and D) and confirmed the reduction of VMAT2 expression in the right striatum and SNc in the knockdown group (Fig. 4E).

Biochemical analysis showed a large reduction of dopamine, paralleled by an increased ratio of metabolites (3,4-dihydroxyphenylacetic acid and homovanillic acid) to dopamine, in the right striatum of VMAT2 knockdown rats (Fig. 4 F and G). The reduced dopamine content correlated with the in vivo VMAT2 expression (Δ [¹¹C]DTBZ BP_ND) and postsynaptic changes (Δ [¹¹C]RAC BP_ND) (Fig. 4 H and I). Additionally, serotonin was unchanged in the striata of VMAT2 knockdown and control rats, suggesting dopamine nigrostriatal pathway specificity (Fig. 4J) (striatal levels of metabolites and neurotransmitters are reported in Table 2). Iba1 and ED1 immunostaining in the SNc and striatum revealed no microglia activation or change in cell morphology, indicative of lack of neuroinflammation, other than along the needle track (Fig. 4 K and L).

Table 2.

Dopamine, 3,4-dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), and serotonin (5-HT) striatal content determined by HPLC

Neurotransmitter or metabolite	nmol/mg (mean ± SD)
DA	Control	VMAT2 KD
STR-L	244 ± 109	351 ± 168
STR-R	308 ± 166	100 ± 97
DOPAC	Control	VMAT2 KD
STR-L	34 ± 7	34 ± 11
STR-R	38 ± 4	27 ± 5
HVA	Control	VMAT2 KD
STR-L	24 ± 5	25 ± 5
STR-R	26 ± 6	19 ± 4
5-HT	Control	VMAT2 KD
STR-L	17 ± 2	19 ± 8
STR-R	19 ± 6	23 ± 9

Open in a new tab

Table 3.

Brain regions included in the Paxinos rat brain atlas, including their respective volumes and abbreviations

Brain region (ROI)	ROI volume [mm³]	Abbreviation
Striatum	43.55	STR
Cingulate cortex	14.48	CgC
Medial prefrontal cortex	6.3	mPFC
Motor cortex	32.61	MC
Orbitofrontal cortex	18.94	OFC
Parietal cortex	7.63	PaC
Retrosplenial cortex	18.92	RSC
Somatosensory cortex	71.6	SC
Hippocampus	25.06	Hipp
Thalamus	30.71	Th

Open in a new tab

Increased rs-FC after CRISPR-SaCas9–Induced VMAT2 Knockdown.

As multiple lines of evidence suggest a broader role of dopamine in the dynamic reconfiguration of brain networks (17, 46, 47), we next investigated the impact of unilateral dopamine depletion on brain rs-FC. A second cohort of rats underwent longitudinal simultaneous [¹¹C]raclopride-PET/BOLD-fMRI scans at baseline and 8–14 wk after CRISPR-SaCas9–induced VMAT2 knockdown (Fig. 5A). PET scans and behavioral analysis confirmed previous findings in the study cohort 1 (SI Appendix, Fig. S5).

Fig. 5. — Increased resting-state functional connectivity after CRISPR-SaCas9–induced VMAT2 knockdown. (A) Schematic illustration of the experimental design. (B and C) Group level correlation matrices of the DMN (B) and SMN (C) at baseline and after CRISPR-SaCas9 targeting for rats with a mild (*Left*) and moderate (*Right*) VMAT2 KD. In the moderate KD group, rs-FC was increased between the right mPFC and right and left Hipp in the DMN (B) and between the contralateral SC and right and left Th, as well as between the left STR and right and left Th in the SMN (C). (D) Internetwork rs-FC changes in the mild KD group indicated increased rs-FC between anterior regions of the DMN and the SMN (between the left OFC and STR and between the right OFC and the left SC, and the right and left STR). Conversely, rs-FC was decreased between regions of the posterior DMN and the SMN (between the left RSC and right SC). In the moderate KD group, DMN–SMN rs-FC was increased. Brain graphs, right to the matrices, illustrate the nodes and edges (raw values) that demonstrated rs-FC changes to baseline (%). *P < 0.01. Mild: Δ [¹¹C]DTBZ BP_ND < 20%, n = 13; moderate: Δ [¹¹C]DTBZ BP_ND ≥ 20%, n = 10. DMN, default-mode network; SMN, sensorimotor network; mPFC, medial prefrontal cortex; Hipp, hippocampus; SC, somatosensory cortex; Th, thalamus; OFC, orbitofrontal cortex; RSC, retrosplenial cortex. Abbreviations of brain regions considered for the analysis of the fMRI data, including their respective volumes, are reported in Table 3.

We next assessed the occurrence of rs-FC changes in DMN and SMN. Our analysis focused on identifying early biomarkers of mild dysfunction and patterns of spreading of synaptic dysfunction. Fig. 5 B and C illustrates intraregional rs-FC group-level correlation matrices at baseline and after VMAT2 knockdown in mild and moderate rats for the DMN and SMN, respectively. We observed within-network rs-FC changes in rats with moderate VMAT2 knockdown in both DMN and SMN.

Rats of the mild knockdown group revealed rs-FC changes up to 20% in prefrontal cortical regions of the DMN and between the left thalamus (Th) and somatosensory cortex (SC) in the SMN. However, these data need to be carefully interpreted, as they did not survive a more-stringent P value selection (*P < 0.01) (SI Appendix, Fig. S6 A and B) (P values are reported in SI Appendix, Tables S1 and S3).

Rats with moderate VMAT2 knockdown exhibited a 60% increase in rs-FC within the right medial prefrontal cortex (mPFC) and the right and left hippocampus (Hipp) (Fig. 5B) (P values are reported in SI Appendix, Table S2).

FC increase between the left Th and SC in the SMN doubled to 34% in rats with moderate VMAT2 knockdown and extended throughout the left and right Th and striatum (STR), respectively (Fig. 5C) (P values are reported in SI Appendix, Table S4).

Moreover, we inspected rs-FC changes between the DMN and SMN at baseline and after the CRISPR-SaCas9–induced VMAT2 knockdown.

Fig. 5D illustrates internetwork rs-FC correlation matrices in rats with mild (left panel) and moderate (right panel) VMAT2 knockdown. Brain graphs display the nodes and edges (raw values) that demonstrated internetwork rs-FC changes to baseline (%). Strikingly, considerable alterations between DMN and SMN were already observable in the mild VMAT2 knockdown group. Rats presented opposite rs-FC changes between regions of the anterior/posterior DMN and the SMN compared with baseline. A 30–60% increase in rs-FC was observed between regions of the anterior DMN and the SMN. Specifically, rs-FC increased between the right orbitofrontal cortex (OFC) and STR bilaterally and the contralateral SC and between the contralateral OFC and STR. Instead, a 20% decrease in rs-FC was found between regions of the posterior DMN and the SMN. Specifically, rs-FC decreased between the left retrosplenial cortex (RSC) and right SC (Fig. 5 D, Left) (P values are reported in SI Appendix, Table S5).

Rats with a moderate VMAT2 knockdown presented increased rs-FC between regions of the anterior/posterior DMN and the SMN compared with baseline. Of particular note, internetwork rs-FC changes were not found between the regions of the posterior DMN and the SMN that showed decreased rs-FC in rats with mild VMAT2 knockdown. Moreover, between-network rs-FC increase extended to other regions. A 60–80% increase in rs-FC was found between the mPFC and the right STR and the motor cortex (MC) and SC bilaterally. FC increased by more than 20% between the Hipps and contralateral SC. (Fig. 5 D, Right) (P values are reported in SI Appendix, Table S6). Notably, between-network rs-FC changes did not involve the Th, which connectivity was, however, altered within the SMN.

Further, we examined how the rs-FC changes to baseline correlated between the mild and moderate groups (SI Appendix, Fig. S7A). Group-level intraregional and internetwork rs-FC changes from baseline (%) correlated linearly between the two groups (SI Appendix, Fig. S7 B–D). Node-correlation analysis indicated a linear increase in the magnitude of the rs-FC changes to baseline in the Hipps (SI Appendix, Fig. S7E), cingulate cortices (SI Appendix, Fig. S7F), and contralateral, but not ipsilateral, Th (SI Appendix, Fig. S7G). Our data suggest a similarity in the pattern of the intraregional and internetwork rs-FC changes between mild and moderate VMAT2 knockdown rats and a linear relationship between the magnitude of the rs-FC changes.

To complement the results of the intraregional and internetwork rs-FC, we evaluated changes in regional mean connection distances. Network-wise graph theoretical analysis on node level was paralleled by whole-brain connection-wise analysis to identify the nodes that were significantly altered in rats with mild and moderate VMAT2 knockdown, compared with baseline, for the DMN (SI Appendix, Fig. S8 A and B) and SMN (SI Appendix, Fig. S8 C and D). Briefly, the network organization did not change in rats with mild VMAT2 knockdown compared with baseline, as changes in the global mean connection distance were not found in the DMN (SI Appendix, Fig. S8A) or SMN (SI Appendix, Fig. S8C). Interestingly, in rats with moderate VMAT2 knockdown, network organization changes did not influence regions of the DMN (SI Appendix, Fig. S8B) but occurred in the contralateral STR and Th (SI Appendix, Fig. S8D) (P values are reported in SI Appendix, Table S7).

Collectively, rs-FC results highlight lateralized effects in the SMN, as opposed to the symmetric recruitment of DMN regions.

CRISPR-SaCas9–Induced VMAT2 Knockdown Alters GABA Signaling.

Besides dopamine, dopaminergic neurons corelease γ-aminobutyric acid (GABA) via the VMAT2 (48, 49). To investigate whether GABA neurotransmission is altered following the VMAT2 knockdown, we performed additional [¹¹C]flumazenil PET scans 10–12 wk after the CRISPR-Cas9 editing and quantified the GABA-A BP_ND in regions of the DMN and SMN (Fig. 6). While no changes were observed in the STR, we observed a decrease of [¹¹C]flumazenil BP_ND in the ipsilateral parietal cortex (PaC) (14%), Hipp (4%), and SC (9%) in mild VMAT2 knockdown rats (Fig. 6 A and B). In moderate VMAT2 knockdown rats, we observed a decrease of [¹¹C]flumazenil BP_ND in the ipsilateral PaC (11%) and SC (6%) (Fig. 6 A and C). [¹¹C]flumazenil BP_ND in the ipsilateral Hipp decreased by 4% as in VMAT2 knockdown mild rats. However, due to the smaller size of the moderate rat cohort, the percent change did not reach statistical significance after the Bonferroni–Sidak correction (Fig. 6 A and C). This indicates that the [¹¹C]flumazenil BP_ND was altered regardless of the VMAT2 knockdown extent. This was further evidenced by the lack of correlation between [¹¹C]DTBZ and [¹¹C]flumazenil BP_ND changes in the target regions.

Fig. 6. — CRISPR-SaCas9–induced VMAT2 knockdown alters GABA signaling. (A) [¹¹C]FMZ mean BP_ND maps of mild and moderate VMAT2 KD rats coregistered to a rat brain atlas. Arrows and regions of interest in coronal sections indicate brain regions of the DMN and SMN with altered [¹¹C]FMZ BP_ND. (B and C) [¹¹C]FMZ BP_ND potentials from volume of interest–based analysis in DMN and SMN regions of rats with mild (B) and moderate (C) VMAT2 KD. [¹¹C]FMZ BP_ND was decreased in the right PaC, SC, and Hipp of mild KD rats (B) and right PaC and SC of moderate KD rats (C). ⁺P < 0.05, *P < 0.01, **P < 0.001, Bonferroni–Sidak corrected. Data are shown as mean ± SD. Mild: Δ [¹¹C]DTBZ BP_ND < 20%, n = 13; moderate: Δ [¹¹C]DTBZ BP_ND ≥ 20%, n = 10. [¹¹C]FMZ, [¹¹C]flumazenil; PaC, parietal cortex. Abbreviations of brain regions, including their respective volumes, are reported in Table 3.

Discussion

Here, we show the potential of combining CRISPR-Cas9 gene editing with molecular and functional brain imaging to identify early adaptations of brain circuits in response to targeted gene and protein modulations. Using CRISPR-SaCas9, we knocked down the Slc18a2 gene, encoding the VMAT2, which plays a key role in the storage and release of dopamine in response to neuronal activity (44). The CRISPR-Cas9–mediated knockdown allowed us to investigate the VMAT2-dependent dopamine signaling in the STR while structurally preserving neuronal integrity. [¹⁸F]GE-180 results, together with in vitro stainings for reactive microglia, suggest that glial activation is not the source of dopaminergic synaptic dysfunction and exclude the occurrence of inflammatory responses arising from the surgical procedure and the chosen AAV serotype, which could influence our readout, in line with recent reports (50). However, the PET data must be interpreted with caution because [¹⁸F]GE-180 shows high nonspecific binding in different regions, which could superimpose the specific binding, hampering the detection of translocator protein binding changes. In addition to that, the choice of the left STR as a reference region may mask potential binding changes on the contralateral side.

Our data reveal that the targeted gene knockdown in the SNc leads to an expected reduction of dopamine release in the STR, paralleled by [¹¹C]raclopride BP_ND changes. It is conceivable that the observed [¹¹C]raclopride BP_ND increase is due to the combination of reduced dopamine striatal content and D2R compensatory upregulation. At the same time, supersensitivity to apomorphine in rats with nigrostriatal lesions or VMAT2 knockout is accompanied by an increase in striatal D2R-binding sites but no change in affinity (51–56). Nevertheless, clear evidence should be provided by in vivo microdialysis.

Further, the observed striatal increase in the [¹¹C]raclopride BP_ND is independent of presynaptic nerve terminal loss and occurs in response to an ∼20% decrease of the [¹¹C]DTBZ BP_ND. This confirms, in line with our [¹¹C]methylphenidate results, that [¹¹C]raclopride can be used to delineate postsynaptic changes in the absence of dopamine transporter–mediated compensation triggered by neuronal loss. Accordingly, the increased [¹¹C]raclopride BP_ND is observed in the early, but not later, stages of Parkinson’s disease (57), characterized by severe neuronal cell loss and dopamine transporter changes (>50%) (58). Consistently, rats with severe denervation (>75%) present earlier mitigation by the dopamine transporter, followed by D2R binding changes (59). Hence, with our method, it is feasible to study the consequences of synaptic dopamine dysfunction without compensations triggered by neuronal cell loss. Moreover, the observed [¹¹C]raclopride and [¹¹C]DTBZ correlations to the motor behavior highlight that the [¹¹C]raclopride BP_ND remains at control levels as long as synaptic dopamine levels are sufficient to maintain adequate motor function. Motor disturbances strongly correlate to pre- and postsynaptic changes if movements of the forelimbs, but not whole body, are considered, in agreement with earlier observations in dopamine-depleted rats (45). Depletion of VMAT2 resulted in reduced dopamine tissue levels in the ipsilateral STR, which agrees with the in vivo data. However, changes in dopamine levels did not show a high correlation to Δ [¹¹C]DTBZ BP_ND (R² = 0.28) or Δ [¹¹C]raclopride BP_ND (R² = 0.28). This may be related to the fact that only part of the STR was used for the HPLC analysis, while the whole STR was used in the PET data analysis. In addition to that, the correlation may not necessarily be linear.

Moreover, metabolite analysis suggested that, due to the lack of VMAT2-mediated storage in presynaptic vesicles, dopamine is quickly converted. The increased metabolism might as well be a possible compensatory mechanism consequent to the VMAT2 knockdown, reflecting actions that residual nigrostriatal neurons undertake to maintain dopamine homeostasis, as already speculated by others (52, 60).

To elucidate the role of VMAT2 in locomotion, reward, and Parkinson’s disease, several investigators have deleted its coding gene in mice (61–64). Besides the costly and time-consuming breeding, the gene knockout was not selective for dopaminergic neurons, resulting in the appearance of anxiety and depressive behavior phenotypes (65). CRISPR-Cas9 editing overcomes these limitations, allowing gene editing in adult and aged animals and avoiding compensatory changes occurring at early developmental stages. Since its discovery, only two studies have successfully applied CRISPR-Cas9 in the rat brain (40, 66), where gene editing has been difficult to adapt due to challenges in brain delivery. Future studies will profit from reporter genes to quantitatively assess and monitor the Cas9 and sgRNA expression in the brain over time (67, 68). Rats are particularly advantageous for imaging studies due to the larger brain size and limited spatial resolution and sensitivity of preclinical scanners (69). Here, by inducing a mild to moderate gene knockdown, we could investigate early to late resting-state brain network adaptations prompted by presynaptic dysfunction. We show that the selective impairment of presynaptic dopamine storage and release is followed by rs-FC alterations within and between the DMN and SMN. Our results confirm previous findings that the DMN, associated with ideation and mind wandering (70), and the SMN, involved in sensory processing and motor function (71), do not function in isolation from each other but rather synchronize (72). The observed internetwork synchronization may reflect compensatory brain reorganization, as already speculated by others (73, 74). We also identified enhanced intranetwork rs-FC in the DMN and SMN. rs-FC changes were observed in prefrontal cortical regions, Hipp, Th, and STR. Our data parallel previous findings of cortico-striato-thalamic hyperconnectivity in decreased dopamine transmission states (75–78). In line, increased synchronous neural oscillatory activity and functional coupling in the basal ganglia and its associated networks have been observed in Parkinson’s disease (79–84). The increase of cortico-striatal FC could, in part, be due to dysfunctions of multiple tonic inhibitory gate actions of D2R (85). Increased FC across the Th and prefrontal cortex has been reported in drug-treated Parkinson’s disease patients (86, 87), potentially indicating functional compensation as the brain recruits additional anatomical areas to aid in restoring cognitive processes. This might as well explain the engagement of the Hipp, which is functionally connected with DMN cortical regions (88, 89). In this regard, research has shown that the hyperconnectivity of brain circuits is a common response to neurological dysfunction and may reflect a protective mechanism to maintain normal brain functioning (90). Such a mechanism has been proposed for Parkinson’s disease, mild cognitive impairment, and Alzheimer’s disease (91–94). Collectively, our findings support this model and indicate a reorganization of brain networks that adapt to the synaptic dysfunction through enhanced interregional synchrony. Recruiting alternative brain regions may be an early response to the dysfunction preceding neuronal cell loss and motor impairment. Interestingly, brain connectome adaptations occurred symmetrically in the DMN but were more weighted toward the contralateral hemisphere in the SMN.

Besides dopamine, dopaminergic neurons corelease GABA via the VMAT2. This hints toward reduced GABA following the VMAT2 knockdown and consequent imbalance in downstream striatal projection neurons of the direct and indirect pathway (48, 49, 95). GABA regulates the inhibitory neurotransmission in various brain areas through GABA-A receptors (96). We hypothesize that decreased binding to the GABA-A receptors may be consistent with loss of inhibitory tone in multiple cortical areas, reflected by our [¹¹C]flumazenil PET data, resulting in increased localized brain connectivity, reflected in the fMRI signal. The suppression of the GABAergic feedback circuit, mediated by D2R and external globus pallidus neurons (85), complements the observed elevation in neuronal synchronicity. Our postulation is in line with earlier findings of an inverse correlation of GABA with rs-FC in DMN (97) and with a putative role of loss of inhibitory tone in hyperconnectivity (98). Interestingly, our [¹¹C]flumazenil PET data did not reveal changes in GABA-A expression in the STR. Instead, we observed a significant decrease in the ipsilateral hemisphere of several cortical regions in both mild and moderate rats, supporting previous findings of GABA modulation of the internetwork FC (99). Studies report downregulated inhibitory neurotransmission in Parkinson’s disease, where gene expression of GABAergic markers is low in the frontal cortex (100, 101). Further, inverse correlations between [¹¹C]flumazenil binding and gait disturbances (102) and between GABA concentration in the MC and disease severity have been reported (103). Moreover, our [¹¹C]flumazenil PET results suggest that GABA neurotransmission is disturbed already at the mild stage, indicating its potential role as an early biomarker of dopaminergic presynaptic dysfunction. Of note, the observed changes in GABA-A binding might indicate only an apparent decrease in the BP_ND due to the reduced GABA availability or reflect compensatory adaptation on the contralateral hemisphere. Future research should elucidate these aspects and also perform further investigations on glutamate, due to the crucial role of the excitatory/inhibitory imbalance in several psychiatric disorders (104).

Limitations and General Remarks.

We knocked down VMAT2 in dopaminergic projection neurons from the SNc to the dorsal STR. To achieve selective targeting of this neuronal subtype, rat Cre driver lines have been developed (66, 105). Although all monoamine-releasing neurons express VMAT2, in contrast to other brain regions, SNc neurons are predominantly dopaminergic (106). Thus, even though we used wild-type rats, we can largely dismiss effects on other monoaminergic neurons, as also indicated by biochemical analysis of striatal serotonin levels.

Despite its limited off-target editing (38), undesired targeting of SaCas9 on other genes cannot be entirely excluded. Nevertheless, off-target candidates with up to four mismatches were screened in the whole genome of Rattus norvegicus (http://www.rgenome.net/cas-offinder/), consistently with past reports (40). To the best of our knowledge, the off-target matches (Ndrg1, RGD1305938, Btn2a2, and AABR07042293.2) have no effects on VMAT2 function, being involved in cell differentiation, T-cell regulation, and mRNA processing, respectively (https://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/index.html).

In our study, the different PET tracer experiments were performed at different time points after the knockdown. Therefore, it cannot be excluded that molecular changes, which may have occurred or subsided over time, are not detected.

Another limitation of the study is the relatively small sample size, related to the complex and high-cost procedures involved in the in vivo imaging measurements. In addition, the intrinsically high intersubject variability in rs-fMRI and differences in knockdown efficiency contributed to significant variance in our cohorts (SI Appendix, Fig. S9). Nevertheless, the variability of gene editing efficiency was in line with previous in vivo brain studies (40, 41).

Conclusions.

This work encourages the combinatorial use of CRISPR-Cas9 and molecular and functional in vivo brain imaging to achieve selective modulation of genes and understand the related functional adaptations in brain networks beyond the targeted circuitry.

We anticipate our approach to be a starting point to shed light on the function of specific genes and their encoded proteins on whole-brain connectivity, useful to understand the cellular basis of functional changes, identify early neurobiological markers, and promising therapeutic interventions.

Materials and Methods

Animals.

Female wild-type Long Evans rats (224 ± 30 g, n = 57) (Charles River Laboratories, Sulzfeld, Germany) were kept on a 12-h day–night cycle at a room temperature of 22 °C and 40–60% humidity. Animals received a standard diet and tap water ad libitum before and during the experimental period. All animal experiments were performed according to the German Animal Welfare Act and were approved by the local ethical authorities, permit Nos. R15/19M and R4/20G.

Viral Vectors.

sgRNAs targeting the second exon of the Slc18a2 gene and the first exon of the lacZ gene were designed based on the protospacer adjacent motif sequence of SaCas9 (NNGRRT) (Table 1). sgRNAs were cloned into an AAV-PHP.EB expression vector containing a GFP reporter sequence, driven by the cytomegalovirus promoter, for the identification of transduced neurons. A second AAV-PHP.EB construct was produced to express SaCas9, flanked by two nuclear localization sequences to allow its translocation into the nuclei. The vector expresses the nuclease via the CAG promoter and contains three hemagglutinin tags to visualize the targeted neurons (Fig. 1A). Cloning of the sgRNAs, plasmid construction, as well as the production of concentrated and purified AAV-PHP.EB vectors, delivered at a 10¹³ gc/mL concentration, were carried by SignaGen Laboratories (Johns Hopkins University, USA).

The genomic mutation rate was assessed using a different set of AAVs with an AAV2/1 serotype, for a conditional design, kindly provided by Matthias Heidenreich (previously at Zhang laboratory, Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, MA).

Study Design of the In Vivo Experiments.

In the first cohort, AAVs-CRISPR-SaCas9 were stereotactically delivered into the right SNc of wild-type rats. Afterward, in vivo PET scans with imaging markers of VMAT2 expression, dopamine availability, nerve terminal integrity, and inflammatory responses were performed in VMAT2 knockdown and control rats using [¹¹C]DTBZ, [¹¹C]raclopride, [¹¹C]methylphenidate, and [¹⁸F]GE-180, respectively. Motor consequences of the CRISPR-SaCas9–induced VMAT2 knockdown were explored in a broad spectrum of behavioral tasks. Finally, biochemical and histological analyses were performed to corroborate the in vivo data (Figs. 2–4A).

In a second cohort, cylinder test and [¹¹C]raclopride-PET/BOLD-fMRI scans were performed at baseline and after CRISPR-SaCas9–induced VMAT2 knockdown. These measurements were paralleled by in vivo PET scans with imaging markers of VMAT2 and GABA-A expression to inspect the extent of the induced VMAT2 knockdown and its impact on GABA signaling, using [¹¹C]DTBZ and [¹¹C]flumazenil, respectively (Fig. 5A). A detailed description of the methods is provided in SI Appendix.

Statistics.

Statistical analysis was performed with GraphPad Prism 9.0 (GraphPad Software), if not otherwise stated. Results were analyzed using paired t tests for the within-subjects comparisons and unpaired t tests for the between-groups comparisons. Correlations were performed using linear regression analyses. Synaptic dysfunction discrimination was tested with multiple-comparison ANOVA.

Supplementary Material

Supplementary File

pnas.2122552119.sapp.pdf^{(1.5MB, pdf)}

Acknowledgments

We are very grateful to Feng Zhang and all members of the laboratory, Broad Institute of Massachusetts Institute of Technology and Harvard, for the help and support with establishing the CRISPR gene knockdown experiments. We thank the technical assistants Sandro Aidone, Daniel Bukala, Linda Schramm, Maren Harant, Ramona Stremme, Elena Kimmerle, and Johannes Kinzler. We also thank Ulla Samuelsson, Ulrika Sparrhult-Björk, Dr. Ulrika Schagerlöf, Anneli Josefsson, and Anna Hansen at Lund University, Sweden for their technical support. Additionally, we acknowledge Dr. Julia Mannheim, Dr. Andreas Schmid, Dr. Rebecca Rock, Ines Herbon, Dr. Neele Hübner, Dr. Andreas Dieterich, Hans Jörg Rahm, Dr. Carsten Calaminus, Funda Cay, Kristin Patzwaldt, Laura Kübler, Marilena Poxleitner, Sabrina Buss, and Dominik Seyfried for their administrative, technical, and experimental support at the Department of Preclinical Imaging and Radiopharmacy, Werner Siemens Imaging Center, Eberhard Karls University, Tübingen. This study is also part of the PhD thesis of Sabina Marciano. This study was supported by the German Research Foundation to K.H., the Carl-Zeiss Foundation to K.H., the Werner Siemens Foundation to B.J.P., and the Deutscher Akademischer Austauschdienst to S.M. and K.H.

Footnotes

The authors declare no competing interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at https://www.pnas.org/lookup/suppl/doi:10.1073/pnas.2122552119/-/DCSupplemental.

Data, Materials, and Software Availability

Data associated with the reported findings are available in the manuscript or SI Appendix. All original PET and fMRI data and codes for the data analysis have been deposited at DRYAD repository: doi:10.5061/dryad.zw3r228bb, and is publicly available as of the date of publication (107).

References

1.Biswal B., Yetkin F. Z., Haughton V. M., Hyde J. S., Functional connectivity in the motor cortex of resting human brain using echo-planar MRI. Magn. Reson. Med. 34, 537–541 (1995). [DOI] [PubMed] [Google Scholar]
2.Ogawa S., Lee T. M., Kay A. R., Tank D. W., Brain magnetic resonance imaging with contrast dependent on blood oxygenation. Proc. Natl. Acad. Sci. U.S.A. 87, 9868–9872 (1990). [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Lu H., et al. , Rat brains also have a default mode network. Proc. Natl. Acad. Sci. U.S.A. 109, 3979–3984 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Becerra L., Pendse G., Chang P. C., Bishop J., Borsook D., Robust reproducible resting state networks in the awake rodent brain. PLoS One 6, e25701 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Fox M. D., et al. , The human brain is intrinsically organized into dynamic, anticorrelated functional networks. Proc. Natl. Acad. Sci. U.S.A. 102, 9673–9678 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Jonckers E., Van Audekerke J., De Visscher G., Van der Linden A., Verhoye M., Functional connectivity fMRI of the rodent brain: Comparison of functional connectivity networks in rat and mouse. PLoS One 6, e18876 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Wehrl H. F., et al. , Simultaneous PET-MRI reveals brain function in activated and resting state on metabolic, hemodynamic and multiple temporal scales. Nat. Med. 19, 1184–1189 (2013). [DOI] [PubMed] [Google Scholar]
8.Amend M., et al. , Functional resting-state brain connectivity is accompanied by dynamic correlations of application-dependent [¹⁸F]FDG PET-tracer fluctuations. Neuroimage 196, 161–172 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Ionescu T. M., et al. , Elucidating the complementarity of resting-state networks derived from dynamic [¹⁸F]FDG and hemodynamic fluctuations using simultaneous small-animal PET/MRI. Neuroimage 236, 118045 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Badhwar A., et al. , Resting-state network dysfunction in Alzheimer’s disease: A systematic review and meta-analysis. Alzheimers Dement. (Amst.) 8, 73–85 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Bluhm R. L., et al. , Spontaneous low-frequency fluctuations in the BOLD signal in schizophrenic patients: Anomalies in the default network. Schizophr. Bull. 33, 1004–1012 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Volkow N. D., et al. , Imaging endogenous dopamine competition with [11C]raclopride in the human brain. Synapse 16, 255–262 (1994). [DOI] [PubMed] [Google Scholar]
13.Laruelle M., Imaging synaptic neurotransmission with in vivo binding competition techniques: A critical review. J. Cereb. Blood Flow Metab. 20, 423–451 (2000). [DOI] [PubMed] [Google Scholar]
14.Patel V. D., Lee D. E., Alexoff D. L., Dewey S. L., Schiffer W. K., Imaging dopamine release with Positron Emission Tomography (PET) and (11)C-raclopride in freely moving animals. Neuroimage 41, 1051–1066 (2008). [DOI] [PubMed] [Google Scholar]
15.Roffman J. L., et al. , Dopamine D1 signaling organizes network dynamics underlying working memory. Sci. Adv. 2, e1501672 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
16.McCutcheon R. A., et al. , Mesolimbic dopamine function is related to salience network connectivity: An integrative positron emission tomography and magnetic resonance study. Biol. Psychiatry 85, 368–378 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Nagano-Saito A., et al. , Posterior dopamine D2/3 receptors and brain network functional connectivity. Synapse 71, e21993 (2017). [DOI] [PubMed] [Google Scholar]
18.Hahn A., et al. , Differential modulation of the default mode network via serotonin-1A receptors. Proc. Natl. Acad. Sci. U.S.A. 109, 2619–2624 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Vidal B., et al. , In vivo biased agonism at 5-HT(1A) receptors: Characterisation by simultaneous PET/MR imaging. Neuropsychopharmacology 43, 2310–2319 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Shiyam Sundar L. K., et al. , Fully integrated PET/MR imaging for the assessment of the relationship between functional connectivity and glucose metabolic rate. Front. Neurosci. 14, 252 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Sander C. Y., Hooker J. M., Catana C., Rosen B. R., Mandeville J. B., Imaging agonist-induced D2/D3 receptor desensitization and internalization in vivo with PET/fMRI. Neuropsychopharmacology 41, 1427–1436 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Ionescu T. M., et al. , Striatal and prefrontal D2R and SERT distributions contrastingly correlate with default-mode connectivity. Neuroimage 243, 118501 (2021). [DOI] [PubMed] [Google Scholar]
23.Betley J. N., Sternson S. M., Adeno-associated viral vectors for mapping, monitoring, and manipulating neural circuits. Hum. Gene Ther. 22, 669–677 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Jinek M., et al. , RNA-programmed genome editing in human cells. eLife 2, e00471 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Cong L., et al. , Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Whitworth K. M., et al. , Use of the CRISPR/Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biol. Reprod. 91, 78 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Chen Y., et al. , Functional disruption of the dystrophin gene in rhesus monkey using CRISPR/Cas9. Hum. Mol. Genet. 24, 3764–3774 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Chang N., et al. , Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23, 465–472 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Platt R. J., et al. , CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell 159, 440–455 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Yu Z., et al. , Highly efficient genome modifications mediated by CRISPR/Cas9 in Drosophila. Genetics 195, 289–291 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Musunuru K., et al. , In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature 593, 429–434 (2021). [DOI] [PubMed] [Google Scholar]
32.Ousterout D. G., et al. , Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy. Nat. Commun. 6, 6244 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Swiech L., et al. , In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat. Biotechnol. 33, 102–106 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Wilbie D., Walther J., Mastrobattista E., Delivery aspects of CRISPR/Cas for in vivo genome editing. Acc. Chem. Res. 52, 1555–1564 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Wu W. Y., Lebbink J. H. G., Kanaar R., Geijsen N., van der Oost J., Genome editing by natural and engineered CRISPR-associated nucleases. Nat. Chem. Biol. 14, 642–651 (2018). [DOI] [PubMed] [Google Scholar]
36.Zetsche B., et al. , Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759–771 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Kleinstiver B. P., et al. , Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 523, 481–485 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Ran F. A., et al. , In vivo genome editing using Staphylococcus aureus Cas9. Nature 520, 186–191 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Nishimasu H., et al. , Crystal structure of Staphylococcus aureus Cas9. Cell 162, 1113–1126 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Sun H., et al. , Development of a CRISPR-SaCas9 system for projection- and function-specific gene editing in the rat brain. Sci. Adv. 6, eaay6687 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Kumar N., et al. , The development of an AAV-based CRISPR SaCas9 genome editing system that can be delivered to neurons in vivo and regulated via doxycycline and cre-recombinase. Front. Mol. Neurosci. 11, 413 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Hunker A. C., et al. , Conditional single vector CRISPR/SaCas9 viruses for efficient mutagenesis in the adult mouse nervous system. Cell Rep. 30, 4303–4316.e6 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Marciano S., et al. , Combining CRISPR/Cas9 and brain imaging: From genes to molecules to networks. BioRxiv [Preprint] (2021). [DOI] [PMC free article] [PubMed]
44.Liu Y., Edwards R. H., The role of vesicular transport proteins in synaptic transmission and neural degeneration. Annu. Rev. Neurosci. 20, 125–156 (1997). [DOI] [PubMed] [Google Scholar]
45.Miyanishi K., et al. , Behavioral tests predicting striatal dopamine level in a rat hemi-Parkinson’s disease model. Neurochem. Int. 122, 38–46 (2019). [DOI] [PubMed] [Google Scholar]
46.Tomasi D., et al. , Dopamine transporters in striatum correlate with deactivation in the default mode network during visuospatial attention. PLoS One 4, e6102 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Sambataro F., et al. , DRD2 genotype-based variation of default mode network activity and of its relationship with striatal DAT binding. Schizophr. Bull. 39, 206–216 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Tritsch N. X., Ding J. B., Sabatini B. L., Dopaminergic neurons inhibit striatal output through non-canonical release of GABA. Nature 490, 262–266 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Tritsch N. X., Oh W. J., Gu C., Sabatini B. L., Midbrain dopamine neurons sustain inhibitory transmission using plasma membrane uptake of GABA, not synthesis. eLife 3, e01936 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Chatterjee D., et al. , Enhanced CNS transduction from AAV.PHP.eB infusion into the cisterna magna of older adult rats compared to AAV9. Gene Ther. 29, 390–397 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Creese I., Burt D. R., Snyder S. H., Dopamine receptor binding enhancement accompanies lesion-induced behavioral supersensitivity. Science 197, 596–598 (1977). [DOI] [PubMed] [Google Scholar]
52.Konieczny J., Czarnecka A., Lenda T., Kamińska K., Antkiewicz-Michaluk L., The significance of rotational behavior and sensitivity of striatal dopamine receptors in hemiparkinsonian rats: A comparative study of lactacystin and 6-OHDA. Neuroscience 340, 308–318 (2017). [DOI] [PubMed] [Google Scholar]
53.Wang Y. M., et al. , Knockout of the vesicular monoamine transporter 2 gene results in neonatal death and supersensitivity to cocaine and amphetamine. Neuron 19, 1285–1296 (1997). [DOI] [PubMed] [Google Scholar]
54.Seeman P., et al. , Dopamine receptors in the central nervous system. Fed. Proc. 37, 131–136 (1978). [PubMed] [Google Scholar]
55.Gnanalingham K. K., Robertson R. G., The effects of chronic continuous versus intermittent levodopa treatments on striatal and extrastriatal D1 and D2 dopamine receptors and dopamine uptake sites in the 6-hydroxydopamine lesioned rat–an autoradiographic study. Brain Res. 640, 185–194 (1994). [DOI] [PubMed] [Google Scholar]
56.Graham W. C., Crossman A. R., Woodruff G. N., Autoradiographic studies in animal models of hemi-parkinsonism reveal dopamine D2 but not D1 receptor supersensitivity. I. 6-OHDA lesions of ascending mesencephalic dopaminergic pathways in the rat. Brain Res. 514, 93–102 (1990). [DOI] [PubMed] [Google Scholar]
57.Antonini A., Schwarz J., Oertel W. H., Pogarell O., Leenders K. L., Long-term changes of striatal dopamine D2 receptors in patients with Parkinson’s disease: A study with positron emission tomography and [11C]raclopride. Mov. Disord. 12, 33–38 (1997). [DOI] [PubMed] [Google Scholar]
58.Kraemmer J., et al. , Correlation of striatal dopamine transporter imaging with post mortem substantia nigra cell counts. Mov. Disord. 29, 1767–1773 (2014). [DOI] [PubMed] [Google Scholar]
59.Sossi V., et al. , Dopamine transporter relation to levodopa-derived synaptic dopamine in a rat model of Parkinson’s: An in vivo imaging study. J. Neurochem. 109, 85–92 (2009). [DOI] [PubMed] [Google Scholar]
60.Zigmond M. J., Hastings T. G., Perez R. G., Increased dopamine turnover after partial loss of dopaminergic neurons: Compensation or toxicity? Parkinsonism Relat. Disord. 8, 389–393 (2002). [DOI] [PubMed] [Google Scholar]
61.Takahashi N., et al. , VMAT2 knockout mice: Heterozygotes display reduced amphetamine-conditioned reward, enhanced amphetamine locomotion, and enhanced MPTP toxicity. Proc. Natl. Acad. Sci. U.S.A. 94, 9938–9943 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Fon E. A., et al. , Vesicular transport regulates monoamine storage and release but is not essential for amphetamine action. Neuron 19, 1271–1283 (1997). [DOI] [PubMed] [Google Scholar]
63.Mooslehner K. A., et al. , Mice with very low expression of the vesicular monoamine transporter 2 gene survive into adulthood: Potential mouse model for parkinsonism. Mol. Cell. Biol. 21, 5321–5331 (2001). [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Caudle W. M., et al. , Reduced vesicular storage of dopamine causes progressive nigrostriatal neurodegeneration. J. Neurosci. 27, 8138–8148 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Taylor T. N., et al. , Nonmotor symptoms of Parkinson’s disease revealed in an animal model with reduced monoamine storage capacity. J. Neurosci. 29, 8103–8113 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Back S., et al. , Neuron-specific genome modification in the adult rat brain using CRISPR-Cas9 transgenic rats. Neuron 102, 105–119 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Gambhir S. S., et al. , Imaging adenoviral-directed reporter gene expression in living animals with positron emission tomography. Proc. Natl. Acad. Sci. U.S.A. 96, 2333–2338 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Haywood T., et al. , Positron emission tomography reporter gene strategy for use in the central nervous system. Proc. Natl. Acad. Sci. U.S.A. 116, 11402–11407 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Zimmer E. R., Parent M. J., Cuello A. C., Gauthier S., Rosa-Neto P., MicroPET imaging and transgenic models: A blueprint for Alzheimer’s disease clinical research. Trends Neurosci. 37, 629–641 (2014). [DOI] [PubMed] [Google Scholar]
70.Andrews-Hanna J. R., The brain’s default network and its adaptive role in internal mentation. Neuroscientist 18, 251–270 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Göttlich M., et al. , Altered resting state brain networks in Parkinson’s disease. PLoS One 8, e77336 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Huang S., et al. , Multisensory competition is modulated by sensory pathway interactions with fronto-sensorimotor and default-mode network regions. J. Neurosci. 35, 9064–9077 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Wu C. W., et al. , Synchrony between default-mode and sensorimotor networks facilitates motor function in stroke rehabilitation: A pilot fMRI study. Front. Neurosci. 14, 548 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
74.Wang J., et al. , Functional reorganization of intra- and internetwork connectivity in major depressive disorder after electroconvulsive therapy. Hum. Brain Mapp. 39, 1403–1411 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Perlbarg V., et al. , Alterations of the nigrostriatal pathway in a 6-OHDA rat model of Parkinson’s disease evaluated with multimodal MRI. PLoS One 13, e0202597 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Monnot C., Zhang X., Nikkhou-Aski S., Damberg P., Svenningsson P., Asymmetric dopaminergic degeneration and levodopa alter functional corticostriatal connectivity bilaterally in experimental parkinsonism. Exp. Neurol. 292, 11–20 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Honey G. D., et al. , Dopaminergic drug effects on physiological connectivity in a human cortico-striato-thalamic system. Brain 126, 1767–1781 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Kwak Y., et al. , Altered resting state cortico-striatal connectivity in mild to moderate stage Parkinson’s disease. Front. Syst. Neurosci. 4, 143 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Costa R. M., et al. , Rapid alterations in corticostriatal ensemble coordination during acute dopamine-dependent motor dysfunction. Neuron 52, 359–369 (2006). [DOI] [PubMed] [Google Scholar]
80.Gatev P., Darbin O., Wichmann T., Oscillations in the basal ganglia under normal conditions and in movement disorders. Mov. Disord. 21, 1566–1577 (2006). [DOI] [PubMed] [Google Scholar]
81.Hammond C., Bergman H., Brown P., Pathological synchronization in Parkinson’s disease: Networks, models and treatments. Trends Neurosci. 30, 357–364 (2007). [DOI] [PubMed] [Google Scholar]
82.Eusebio A., et al. , Resonance in subthalamo-cortical circuits in Parkinson’s disease. Brain 132, 2139–2150 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Brazhnik E., et al. , State-dependent spike and local field synchronization between motor cortex and substantia nigra in hemiparkinsonian rats. J. Neurosci. 32, 7869–7880 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Moran R. J., et al. , Alterations in brain connectivity underlying beta oscillations in Parkinsonism. PLOS Comput. Biol. 7, e1002124 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Gerfen C. R., Surmeier D. J., Modulation of striatal projection systems by dopamine. Annu. Rev. Neurosci. 34, 441–466 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Caspers J., et al. , Differential functional connectivity alterations of two subdivisions within the right dlPFC in Parkinson’s disease. Front. Hum. Neurosci. 11, 288 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Owens-Walton C., et al. , Increased functional connectivity of thalamic subdivisions in patients with Parkinson’s disease. PLoS One 14, e0222002 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Kahn I., Andrews-Hanna J. R., Vincent J. L., Snyder A. Z., Buckner R. L., Distinct cortical anatomy linked to subregions of the medial temporal lobe revealed by intrinsic functional connectivity. J. Neurophysiol. 100, 129–139 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Vincent J. L., et al. , Coherent spontaneous activity identifies a hippocampal-parietal memory network. J. Neurophysiol. 96, 3517–3531 (2006). [DOI] [PubMed] [Google Scholar]
90.Hillary F. G., et al. , Hyperconnectivity is a fundamental response to neurological disruption. Neuropsychology 29, 59–75 (2015). [DOI] [PubMed] [Google Scholar]
91.Klobušiaková P., Mareček R., Fousek J., Výtvarová E., Rektorová I., Connectivity between brain networks dynamically reflects cognitive status of Parkinson’s disease: A longitudinal study. J. Alzheimers Dis. 67, 971–984 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Mevel K., Chételat G., Eustache F., Desgranges B., The default mode network in healthy aging and Alzheimer’s disease. Int. J. Alzheimers Dis. 2011, 535816 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Gorges M., et al. ; LANDSCAPE Consortium, To rise and to fall: Functional connectivity in cognitively normal and cognitively impaired patients with Parkinson’s disease. Neurobiol. Aging 36, 1727–1735 (2015). [DOI] [PubMed] [Google Scholar]
94.Helmich R. C., et al. , Spatial remapping of cortico-striatal connectivity in Parkinson’s disease. Cereb. Cortex 20, 1175–1186 (2010). [DOI] [PubMed] [Google Scholar]
95.O’Gorman Tuura R. L., Baumann C. R., Baumann-Vogel H., Beyond dopamine: GABA, glutamate, and the axial symptoms of Parkinson disease. Front. Neurol. 9, 806 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
96.Whiting P. J., The GABAA receptor gene family: New opportunities for drug development. Curr. Opin. Drug Discov. Devel. 6, 648–657 (2003). [PubMed] [Google Scholar]
97.Kapogiannis D., Reiter D. A., Willette A. A., Mattson M. P., Posteromedial cortex glutamate and GABA predict intrinsic functional connectivity of the default mode network. Neuroimage 64, 112–119 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
98.Douaud G., Filippini N., Knight S., Talbot K., Turner M. R., Integration of structural and functional magnetic resonance imaging in amyotrophic lateral sclerosis. Brain 134, 3470–3479 (2011). [DOI] [PubMed] [Google Scholar]
99.Levar N., Van Doesum T. J., Denys D., Van Wingen G. A., Anterior cingulate GABA and glutamate concentrations are associated with resting-state network connectivity. Sci. Rep. 9, 2116 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
100.Lanoue A. C., Blatt G. J., Soghomonian J. J., Decreased parvalbumin mRNA expression in dorsolateral prefrontal cortex in Parkinson’s disease. Brain Res. 1531, 37–47 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
101.Lanoue A. C., Dumitriu A., Myers R. H., Soghomonian J. J., Decreased glutamic acid decarboxylase mRNA expression in prefrontal cortex in Parkinson’s disease. Exp. Neurol. 226, 207–217 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
102.Ihara M., et al. , Association of vascular parkinsonism with impaired neuronal integrity in the striatum. J. Neural Transm. (Vienna) 114, 577–584 (2007). [DOI] [PubMed] [Google Scholar]
103.van Nuland A. J. M., et al. , GABAergic changes in the thalamocortical circuit in Parkinson’s disease. Hum. Brain Mapp. 41, 1017–1029 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
104.Allen P., Sommer I. E., Jardri R., Eysenck M. W., Hugdahl K., Extrinsic and default mode networks in psychiatric conditions: Relationship to excitatory-inhibitory transmitter balance and early trauma. Neurosci. Biobehav. Rev. 99, 90–100 (2019). [DOI] [PubMed] [Google Scholar]
105.Liu Z., et al. , Tissue specific expression of Cre in rat tyrosine hydroxylase and dopamine active transporter-positive neurons. PLoS One 11, e0149379 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
106.Björklund A., Dunnett S. B., Dopamine neuron systems in the brain: An update. Trends Neurosci. 30, 194–202 (2007). [DOI] [PubMed] [Google Scholar]
107.Marciano S., et al. , PET and fMRI data and codes for “Combining CRISPR-Cas9 and brain imaging to study the link from genes to molecules to networks.” DRYAD. 10.5061/dryad.zw3r228bb. Accessed 20 September 2022. [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File

pnas.2122552119.sapp.pdf^{(1.5MB, pdf)}

Data Availability Statement

[r1] 1.Biswal B., Yetkin F. Z., Haughton V. M., Hyde J. S., Functional connectivity in the motor cortex of resting human brain using echo-planar MRI. Magn. Reson. Med. 34, 537–541 (1995). [DOI] [PubMed] [Google Scholar]

[r2] 2.Ogawa S., Lee T. M., Kay A. R., Tank D. W., Brain magnetic resonance imaging with contrast dependent on blood oxygenation. Proc. Natl. Acad. Sci. U.S.A. 87, 9868–9872 (1990). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r3] 3.Lu H., et al. , Rat brains also have a default mode network. Proc. Natl. Acad. Sci. U.S.A. 109, 3979–3984 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r4] 4.Becerra L., Pendse G., Chang P. C., Bishop J., Borsook D., Robust reproducible resting state networks in the awake rodent brain. PLoS One 6, e25701 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r5] 5.Fox M. D., et al. , The human brain is intrinsically organized into dynamic, anticorrelated functional networks. Proc. Natl. Acad. Sci. U.S.A. 102, 9673–9678 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r6] 6.Jonckers E., Van Audekerke J., De Visscher G., Van der Linden A., Verhoye M., Functional connectivity fMRI of the rodent brain: Comparison of functional connectivity networks in rat and mouse. PLoS One 6, e18876 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r7] 7.Wehrl H. F., et al. , Simultaneous PET-MRI reveals brain function in activated and resting state on metabolic, hemodynamic and multiple temporal scales. Nat. Med. 19, 1184–1189 (2013). [DOI] [PubMed] [Google Scholar]

[r8] 8.Amend M., et al. , Functional resting-state brain connectivity is accompanied by dynamic correlations of application-dependent [¹⁸F]FDG PET-tracer fluctuations. Neuroimage 196, 161–172 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r9] 9.Ionescu T. M., et al. , Elucidating the complementarity of resting-state networks derived from dynamic [¹⁸F]FDG and hemodynamic fluctuations using simultaneous small-animal PET/MRI. Neuroimage 236, 118045 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r10] 10.Badhwar A., et al. , Resting-state network dysfunction in Alzheimer’s disease: A systematic review and meta-analysis. Alzheimers Dement. (Amst.) 8, 73–85 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r11] 11.Bluhm R. L., et al. , Spontaneous low-frequency fluctuations in the BOLD signal in schizophrenic patients: Anomalies in the default network. Schizophr. Bull. 33, 1004–1012 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r12] 12.Volkow N. D., et al. , Imaging endogenous dopamine competition with [11C]raclopride in the human brain. Synapse 16, 255–262 (1994). [DOI] [PubMed] [Google Scholar]

[r13] 13.Laruelle M., Imaging synaptic neurotransmission with in vivo binding competition techniques: A critical review. J. Cereb. Blood Flow Metab. 20, 423–451 (2000). [DOI] [PubMed] [Google Scholar]

[r14] 14.Patel V. D., Lee D. E., Alexoff D. L., Dewey S. L., Schiffer W. K., Imaging dopamine release with Positron Emission Tomography (PET) and (11)C-raclopride in freely moving animals. Neuroimage 41, 1051–1066 (2008). [DOI] [PubMed] [Google Scholar]

[r15] 15.Roffman J. L., et al. , Dopamine D1 signaling organizes network dynamics underlying working memory. Sci. Adv. 2, e1501672 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r16] 16.McCutcheon R. A., et al. , Mesolimbic dopamine function is related to salience network connectivity: An integrative positron emission tomography and magnetic resonance study. Biol. Psychiatry 85, 368–378 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r17] 17.Nagano-Saito A., et al. , Posterior dopamine D2/3 receptors and brain network functional connectivity. Synapse 71, e21993 (2017). [DOI] [PubMed] [Google Scholar]

[r18] 18.Hahn A., et al. , Differential modulation of the default mode network via serotonin-1A receptors. Proc. Natl. Acad. Sci. U.S.A. 109, 2619–2624 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r19] 19.Vidal B., et al. , In vivo biased agonism at 5-HT(1A) receptors: Characterisation by simultaneous PET/MR imaging. Neuropsychopharmacology 43, 2310–2319 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r20] 20.Shiyam Sundar L. K., et al. , Fully integrated PET/MR imaging for the assessment of the relationship between functional connectivity and glucose metabolic rate. Front. Neurosci. 14, 252 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r21] 21.Sander C. Y., Hooker J. M., Catana C., Rosen B. R., Mandeville J. B., Imaging agonist-induced D2/D3 receptor desensitization and internalization in vivo with PET/fMRI. Neuropsychopharmacology 41, 1427–1436 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r22] 22.Ionescu T. M., et al. , Striatal and prefrontal D2R and SERT distributions contrastingly correlate with default-mode connectivity. Neuroimage 243, 118501 (2021). [DOI] [PubMed] [Google Scholar]

[r23] 23.Betley J. N., Sternson S. M., Adeno-associated viral vectors for mapping, monitoring, and manipulating neural circuits. Hum. Gene Ther. 22, 669–677 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r24] 24.Jinek M., et al. , RNA-programmed genome editing in human cells. eLife 2, e00471 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r25] 25.Cong L., et al. , Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r26] 26.Whitworth K. M., et al. , Use of the CRISPR/Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biol. Reprod. 91, 78 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r27] 27.Chen Y., et al. , Functional disruption of the dystrophin gene in rhesus monkey using CRISPR/Cas9. Hum. Mol. Genet. 24, 3764–3774 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r28] 28.Chang N., et al. , Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23, 465–472 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r29] 29.Platt R. J., et al. , CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell 159, 440–455 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r30] 30.Yu Z., et al. , Highly efficient genome modifications mediated by CRISPR/Cas9 in Drosophila. Genetics 195, 289–291 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r31] 31.Musunuru K., et al. , In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature 593, 429–434 (2021). [DOI] [PubMed] [Google Scholar]

[r32] 32.Ousterout D. G., et al. , Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy. Nat. Commun. 6, 6244 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r33] 33.Swiech L., et al. , In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat. Biotechnol. 33, 102–106 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r34] 34.Wilbie D., Walther J., Mastrobattista E., Delivery aspects of CRISPR/Cas for in vivo genome editing. Acc. Chem. Res. 52, 1555–1564 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r35] 35.Wu W. Y., Lebbink J. H. G., Kanaar R., Geijsen N., van der Oost J., Genome editing by natural and engineered CRISPR-associated nucleases. Nat. Chem. Biol. 14, 642–651 (2018). [DOI] [PubMed] [Google Scholar]

[r36] 36.Zetsche B., et al. , Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759–771 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r37] 37.Kleinstiver B. P., et al. , Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 523, 481–485 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r38] 38.Ran F. A., et al. , In vivo genome editing using Staphylococcus aureus Cas9. Nature 520, 186–191 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r39] 39.Nishimasu H., et al. , Crystal structure of Staphylococcus aureus Cas9. Cell 162, 1113–1126 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r40] 40.Sun H., et al. , Development of a CRISPR-SaCas9 system for projection- and function-specific gene editing in the rat brain. Sci. Adv. 6, eaay6687 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r41] 41.Kumar N., et al. , The development of an AAV-based CRISPR SaCas9 genome editing system that can be delivered to neurons in vivo and regulated via doxycycline and cre-recombinase. Front. Mol. Neurosci. 11, 413 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r42] 42.Hunker A. C., et al. , Conditional single vector CRISPR/SaCas9 viruses for efficient mutagenesis in the adult mouse nervous system. Cell Rep. 30, 4303–4316.e6 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r43] 43.Marciano S., et al. , Combining CRISPR/Cas9 and brain imaging: From genes to molecules to networks. BioRxiv [Preprint] (2021). [DOI] [PMC free article] [PubMed]

[r44] 44.Liu Y., Edwards R. H., The role of vesicular transport proteins in synaptic transmission and neural degeneration. Annu. Rev. Neurosci. 20, 125–156 (1997). [DOI] [PubMed] [Google Scholar]

[r45] 45.Miyanishi K., et al. , Behavioral tests predicting striatal dopamine level in a rat hemi-Parkinson’s disease model. Neurochem. Int. 122, 38–46 (2019). [DOI] [PubMed] [Google Scholar]

[r46] 46.Tomasi D., et al. , Dopamine transporters in striatum correlate with deactivation in the default mode network during visuospatial attention. PLoS One 4, e6102 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r47] 47.Sambataro F., et al. , DRD2 genotype-based variation of default mode network activity and of its relationship with striatal DAT binding. Schizophr. Bull. 39, 206–216 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r48] 48.Tritsch N. X., Ding J. B., Sabatini B. L., Dopaminergic neurons inhibit striatal output through non-canonical release of GABA. Nature 490, 262–266 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r49] 49.Tritsch N. X., Oh W. J., Gu C., Sabatini B. L., Midbrain dopamine neurons sustain inhibitory transmission using plasma membrane uptake of GABA, not synthesis. eLife 3, e01936 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r50] 50.Chatterjee D., et al. , Enhanced CNS transduction from AAV.PHP.eB infusion into the cisterna magna of older adult rats compared to AAV9. Gene Ther. 29, 390–397 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r51] 51.Creese I., Burt D. R., Snyder S. H., Dopamine receptor binding enhancement accompanies lesion-induced behavioral supersensitivity. Science 197, 596–598 (1977). [DOI] [PubMed] [Google Scholar]

[r52] 52.Konieczny J., Czarnecka A., Lenda T., Kamińska K., Antkiewicz-Michaluk L., The significance of rotational behavior and sensitivity of striatal dopamine receptors in hemiparkinsonian rats: A comparative study of lactacystin and 6-OHDA. Neuroscience 340, 308–318 (2017). [DOI] [PubMed] [Google Scholar]

[r53] 53.Wang Y. M., et al. , Knockout of the vesicular monoamine transporter 2 gene results in neonatal death and supersensitivity to cocaine and amphetamine. Neuron 19, 1285–1296 (1997). [DOI] [PubMed] [Google Scholar]

[r54] 54.Seeman P., et al. , Dopamine receptors in the central nervous system. Fed. Proc. 37, 131–136 (1978). [PubMed] [Google Scholar]

[r55] 55.Gnanalingham K. K., Robertson R. G., The effects of chronic continuous versus intermittent levodopa treatments on striatal and extrastriatal D1 and D2 dopamine receptors and dopamine uptake sites in the 6-hydroxydopamine lesioned rat–an autoradiographic study. Brain Res. 640, 185–194 (1994). [DOI] [PubMed] [Google Scholar]

[r56] 56.Graham W. C., Crossman A. R., Woodruff G. N., Autoradiographic studies in animal models of hemi-parkinsonism reveal dopamine D2 but not D1 receptor supersensitivity. I. 6-OHDA lesions of ascending mesencephalic dopaminergic pathways in the rat. Brain Res. 514, 93–102 (1990). [DOI] [PubMed] [Google Scholar]

[r57] 57.Antonini A., Schwarz J., Oertel W. H., Pogarell O., Leenders K. L., Long-term changes of striatal dopamine D2 receptors in patients with Parkinson’s disease: A study with positron emission tomography and [11C]raclopride. Mov. Disord. 12, 33–38 (1997). [DOI] [PubMed] [Google Scholar]

[r58] 58.Kraemmer J., et al. , Correlation of striatal dopamine transporter imaging with post mortem substantia nigra cell counts. Mov. Disord. 29, 1767–1773 (2014). [DOI] [PubMed] [Google Scholar]

[r59] 59.Sossi V., et al. , Dopamine transporter relation to levodopa-derived synaptic dopamine in a rat model of Parkinson’s: An in vivo imaging study. J. Neurochem. 109, 85–92 (2009). [DOI] [PubMed] [Google Scholar]

[r60] 60.Zigmond M. J., Hastings T. G., Perez R. G., Increased dopamine turnover after partial loss of dopaminergic neurons: Compensation or toxicity? Parkinsonism Relat. Disord. 8, 389–393 (2002). [DOI] [PubMed] [Google Scholar]

[r61] 61.Takahashi N., et al. , VMAT2 knockout mice: Heterozygotes display reduced amphetamine-conditioned reward, enhanced amphetamine locomotion, and enhanced MPTP toxicity. Proc. Natl. Acad. Sci. U.S.A. 94, 9938–9943 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r62] 62.Fon E. A., et al. , Vesicular transport regulates monoamine storage and release but is not essential for amphetamine action. Neuron 19, 1271–1283 (1997). [DOI] [PubMed] [Google Scholar]

[r63] 63.Mooslehner K. A., et al. , Mice with very low expression of the vesicular monoamine transporter 2 gene survive into adulthood: Potential mouse model for parkinsonism. Mol. Cell. Biol. 21, 5321–5331 (2001). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r64] 64.Caudle W. M., et al. , Reduced vesicular storage of dopamine causes progressive nigrostriatal neurodegeneration. J. Neurosci. 27, 8138–8148 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r65] 65.Taylor T. N., et al. , Nonmotor symptoms of Parkinson’s disease revealed in an animal model with reduced monoamine storage capacity. J. Neurosci. 29, 8103–8113 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r66] 66.Back S., et al. , Neuron-specific genome modification in the adult rat brain using CRISPR-Cas9 transgenic rats. Neuron 102, 105–119 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r67] 67.Gambhir S. S., et al. , Imaging adenoviral-directed reporter gene expression in living animals with positron emission tomography. Proc. Natl. Acad. Sci. U.S.A. 96, 2333–2338 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r68] 68.Haywood T., et al. , Positron emission tomography reporter gene strategy for use in the central nervous system. Proc. Natl. Acad. Sci. U.S.A. 116, 11402–11407 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r69] 69.Zimmer E. R., Parent M. J., Cuello A. C., Gauthier S., Rosa-Neto P., MicroPET imaging and transgenic models: A blueprint for Alzheimer’s disease clinical research. Trends Neurosci. 37, 629–641 (2014). [DOI] [PubMed] [Google Scholar]

[r70] 70.Andrews-Hanna J. R., The brain’s default network and its adaptive role in internal mentation. Neuroscientist 18, 251–270 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r71] 71.Göttlich M., et al. , Altered resting state brain networks in Parkinson’s disease. PLoS One 8, e77336 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r72] 72.Huang S., et al. , Multisensory competition is modulated by sensory pathway interactions with fronto-sensorimotor and default-mode network regions. J. Neurosci. 35, 9064–9077 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r73] 73.Wu C. W., et al. , Synchrony between default-mode and sensorimotor networks facilitates motor function in stroke rehabilitation: A pilot fMRI study. Front. Neurosci. 14, 548 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r74] 74.Wang J., et al. , Functional reorganization of intra- and internetwork connectivity in major depressive disorder after electroconvulsive therapy. Hum. Brain Mapp. 39, 1403–1411 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r75] 75.Perlbarg V., et al. , Alterations of the nigrostriatal pathway in a 6-OHDA rat model of Parkinson’s disease evaluated with multimodal MRI. PLoS One 13, e0202597 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r76] 76.Monnot C., Zhang X., Nikkhou-Aski S., Damberg P., Svenningsson P., Asymmetric dopaminergic degeneration and levodopa alter functional corticostriatal connectivity bilaterally in experimental parkinsonism. Exp. Neurol. 292, 11–20 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r77] 77.Honey G. D., et al. , Dopaminergic drug effects on physiological connectivity in a human cortico-striato-thalamic system. Brain 126, 1767–1781 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r78] 78.Kwak Y., et al. , Altered resting state cortico-striatal connectivity in mild to moderate stage Parkinson’s disease. Front. Syst. Neurosci. 4, 143 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r79] 79.Costa R. M., et al. , Rapid alterations in corticostriatal ensemble coordination during acute dopamine-dependent motor dysfunction. Neuron 52, 359–369 (2006). [DOI] [PubMed] [Google Scholar]

[r80] 80.Gatev P., Darbin O., Wichmann T., Oscillations in the basal ganglia under normal conditions and in movement disorders. Mov. Disord. 21, 1566–1577 (2006). [DOI] [PubMed] [Google Scholar]

[r81] 81.Hammond C., Bergman H., Brown P., Pathological synchronization in Parkinson’s disease: Networks, models and treatments. Trends Neurosci. 30, 357–364 (2007). [DOI] [PubMed] [Google Scholar]

[r82] 82.Eusebio A., et al. , Resonance in subthalamo-cortical circuits in Parkinson’s disease. Brain 132, 2139–2150 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r83] 83.Brazhnik E., et al. , State-dependent spike and local field synchronization between motor cortex and substantia nigra in hemiparkinsonian rats. J. Neurosci. 32, 7869–7880 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r84] 84.Moran R. J., et al. , Alterations in brain connectivity underlying beta oscillations in Parkinsonism. PLOS Comput. Biol. 7, e1002124 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r85] 85.Gerfen C. R., Surmeier D. J., Modulation of striatal projection systems by dopamine. Annu. Rev. Neurosci. 34, 441–466 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r86] 86.Caspers J., et al. , Differential functional connectivity alterations of two subdivisions within the right dlPFC in Parkinson’s disease. Front. Hum. Neurosci. 11, 288 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r87] 87.Owens-Walton C., et al. , Increased functional connectivity of thalamic subdivisions in patients with Parkinson’s disease. PLoS One 14, e0222002 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r88] 88.Kahn I., Andrews-Hanna J. R., Vincent J. L., Snyder A. Z., Buckner R. L., Distinct cortical anatomy linked to subregions of the medial temporal lobe revealed by intrinsic functional connectivity. J. Neurophysiol. 100, 129–139 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r89] 89.Vincent J. L., et al. , Coherent spontaneous activity identifies a hippocampal-parietal memory network. J. Neurophysiol. 96, 3517–3531 (2006). [DOI] [PubMed] [Google Scholar]

[r90] 90.Hillary F. G., et al. , Hyperconnectivity is a fundamental response to neurological disruption. Neuropsychology 29, 59–75 (2015). [DOI] [PubMed] [Google Scholar]

[r91] 91.Klobušiaková P., Mareček R., Fousek J., Výtvarová E., Rektorová I., Connectivity between brain networks dynamically reflects cognitive status of Parkinson’s disease: A longitudinal study. J. Alzheimers Dis. 67, 971–984 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r92] 92.Mevel K., Chételat G., Eustache F., Desgranges B., The default mode network in healthy aging and Alzheimer’s disease. Int. J. Alzheimers Dis. 2011, 535816 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r93] 93.Gorges M., et al. ; LANDSCAPE Consortium, To rise and to fall: Functional connectivity in cognitively normal and cognitively impaired patients with Parkinson’s disease. Neurobiol. Aging 36, 1727–1735 (2015). [DOI] [PubMed] [Google Scholar]

[r94] 94.Helmich R. C., et al. , Spatial remapping of cortico-striatal connectivity in Parkinson’s disease. Cereb. Cortex 20, 1175–1186 (2010). [DOI] [PubMed] [Google Scholar]

[r95] 95.O’Gorman Tuura R. L., Baumann C. R., Baumann-Vogel H., Beyond dopamine: GABA, glutamate, and the axial symptoms of Parkinson disease. Front. Neurol. 9, 806 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r96] 96.Whiting P. J., The GABAA receptor gene family: New opportunities for drug development. Curr. Opin. Drug Discov. Devel. 6, 648–657 (2003). [PubMed] [Google Scholar]

[r97] 97.Kapogiannis D., Reiter D. A., Willette A. A., Mattson M. P., Posteromedial cortex glutamate and GABA predict intrinsic functional connectivity of the default mode network. Neuroimage 64, 112–119 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r98] 98.Douaud G., Filippini N., Knight S., Talbot K., Turner M. R., Integration of structural and functional magnetic resonance imaging in amyotrophic lateral sclerosis. Brain 134, 3470–3479 (2011). [DOI] [PubMed] [Google Scholar]

[r99] 99.Levar N., Van Doesum T. J., Denys D., Van Wingen G. A., Anterior cingulate GABA and glutamate concentrations are associated with resting-state network connectivity. Sci. Rep. 9, 2116 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r100] 100.Lanoue A. C., Blatt G. J., Soghomonian J. J., Decreased parvalbumin mRNA expression in dorsolateral prefrontal cortex in Parkinson’s disease. Brain Res. 1531, 37–47 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r101] 101.Lanoue A. C., Dumitriu A., Myers R. H., Soghomonian J. J., Decreased glutamic acid decarboxylase mRNA expression in prefrontal cortex in Parkinson’s disease. Exp. Neurol. 226, 207–217 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r102] 102.Ihara M., et al. , Association of vascular parkinsonism with impaired neuronal integrity in the striatum. J. Neural Transm. (Vienna) 114, 577–584 (2007). [DOI] [PubMed] [Google Scholar]

[r103] 103.van Nuland A. J. M., et al. , GABAergic changes in the thalamocortical circuit in Parkinson’s disease. Hum. Brain Mapp. 41, 1017–1029 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r104] 104.Allen P., Sommer I. E., Jardri R., Eysenck M. W., Hugdahl K., Extrinsic and default mode networks in psychiatric conditions: Relationship to excitatory-inhibitory transmitter balance and early trauma. Neurosci. Biobehav. Rev. 99, 90–100 (2019). [DOI] [PubMed] [Google Scholar]

[r105] 105.Liu Z., et al. , Tissue specific expression of Cre in rat tyrosine hydroxylase and dopamine active transporter-positive neurons. PLoS One 11, e0149379 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[r106] 106.Björklund A., Dunnett S. B., Dopamine neuron systems in the brain: An update. Trends Neurosci. 30, 194–202 (2007). [DOI] [PubMed] [Google Scholar]

[r107] 107.Marciano S., et al. , PET and fMRI data and codes for “Combining CRISPR-Cas9 and brain imaging to study the link from genes to molecules to networks.” DRYAD. 10.5061/dryad.zw3r228bb. Accessed 20 September 2022. [DOI] [PMC free article] [PubMed]

PERMALINK

Combining CRISPR-Cas9 and brain imaging to study the link from genes to molecules to networks

Sabina Marciano

Tudor M Ionescu

Ran Sing Saw

Rachel Y Cheong

Deniz Kirik

Andreas Maurer

Bernd J Pichler

Kristina Herfert

Significance

Abstract

Results

In Vitro Validation of CRISPR-SaCas9–Induced VMAT2 Knockdown in Rat Primary Cortical Neurons.

Fig. 1.

Table 1.

CRISPR-SaCas9–Induced VMAT2 Knockdown Elicits Postsynaptic Changes but No Nerve Terminal Loss or Neuroinflammation in the Adult Rat Brain.

Fig. 2.

CRISPR-SaCas9–Induced VMAT2 Knockdown Impairs Motor Function.

Fig. 3.

Ex Vivo Validation of the CRISPR-SaCas9-Induced VMAT2 Knockdown.

Fig. 4.

Table 2.

Table 3.

Increased rs-FC after CRISPR-SaCas9–Induced VMAT2 Knockdown.

Fig. 5.

CRISPR-SaCas9–Induced VMAT2 Knockdown Alters GABA Signaling.

Fig. 6.

Discussion

Limitations and General Remarks.

Conclusions.

Materials and Methods

Animals.

Viral Vectors.

Study Design of the In Vivo Experiments.

Statistics.

Supplementary Material

Acknowledgments

Footnotes

Data, Materials, and Software Availability

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases