Hsp90 Regulates GCRV-II Proliferation by Interacting with VP35 as Its Receptor and Chaperone

ABSTRACT

The frequent outbreak of grass carp hemorrhagic disease caused by grass carp reovirus (GCRV), especially the mainly prevalent type II GCRV (GCRV-II), has seriously affected the grass carp culture in China. However, its pathogenic mechanism is still far from clear. In this study, the GCRV-II outer capsid protein VP35 was used as bait to capture interacting partners from Ctenopharyngon idellus kidney (CIK) cells, and heat shock protein 90 (Hsp90) was selected and confirmed interacting with VP35 through the C-terminal domain of Hsp90. Knockdown of Hsp90 or inhibition of Hsp90 activity suppressed GCRV-II proliferation, demonstrating that Hsp90 is an essential factor for GCRV-II proliferation. The confocal microscopy and flow cytometry showed that Hsp90 localized at both membrane and cytoplasm of CIK cells. The entry of GCRV-II into CIK cells was efficiently blocked by incubating the cells with Hsp90 antibody or by pretreating the virus with recombinant Hsp90 protein. Whereas overexpression of Hsp90 in CIK cells, grass carp ovary (GCO) cells, or 293T cells promoted GCRV-II entry, indicating that the membrane Hsp90 functions as a receptor of GCRV-II. Furthermore, Hsp90 interacted with clathrin and mediated GCRV-II entry into CIK cells through clathrin endocytosis pathway. In addition, we found that the cytoplasmic Hsp90 acted as a chaperone of VP35 because inhibition of Hsp90 activity enhanced VP35 polyubiquitination and degraded VP35 through the proteasome pathway. Collectively, our data suggest that Hsp90 functions both as a receptor for GCRV-II entry and a chaperone for the maturation of GCRV-II VP35, thus ensuring efficient proliferation of GCRV-II.

IMPORTANCE Identification of viral receptors has always been the research hot spot in virus research field as receptor functions at the first stage of viral infection, which can be designed as efficient antiviral drug targets. GCRV-II, the causative agent of the grass carp epidemic hemorrhagic disease, has caused tremendous losses in grass carp culture in China. To date, the receptor of GCRV-II remains unknown. This study focused on identifying cellular receptor interacting with the GCRV-II outer capsid protein VP35, studying the effects of their interaction on GCRV-II proliferation, and revealing the underlying mechanisms. We demonstrated that Hsp90 acts both as a receptor of GCRV-II by interacting with VP35 and as a chaperone for the maturation of VP35, thus ensuring efficient proliferation of GCRV-II. Our data provide important insights into the role of Hsp90 in GCRV-II life cycle, which will help understand the mechanism of reovirus infection.

INTRODUCTION

Grass carp (Ctenopharyngodon idella) is one of the most important aquaculture species in China (1). Grass carp reovirus (GCRV), a double-stranded RNA (dsRNA) virus belonging to the family Reoviridae, causes hemorrhage and hyperemia in the fins, gills, muscles, and intestinal bases of grass carp, leading to high mortality rate in grass carp (2, 3). The viral particle of GCRV is nonenveloped, icosahedral,65 to 72 nm in diameter, and surrounded by multiple concentric capsid proteins (2, 4). According to the gene sequences, the reported GCRV can be divided into three genotypes (I, II and III), with the representative isolates being GCRV-873 (genotype I), GCRV-HZ08 (genotype II), and GCRV-104 (genotype III), which vary widely in virulence, cellular sensitivity, immunogenicity, and pathogenicity (3, 5). Epidemiological survey shows that most of the GCRV circulating in China these years are type II strains (6). GCRV-II genome consists of 11 segments named S1-S11 (2). The outer capsid protein of GCRV-II consists of VP4 protein encoded by S6, VP56 protein encoded by S7, and VP35 protein encoded by S11 (7, 8).

The specificity of virus-receptor interaction determines host range, tissue localization, and viral pathogenesis (9). Therefore, identifying viral receptors is important for better understanding and control of the viral diseases (9). The laminin receptor is an interacting partner of the GCRV-I outer capsid protein VP5 and functions as the receptor of GCRV-I (10), while the receptor of GCRV-II or GCRV-III has never been identified.

Heat shock protein (Hsp) is one of the most evolutionarily conserved groups of protein presented across almost all the living organisms (11). Hsp90 consists of an N-terminal ATPase domain that is the target of most Hsp90 inhibitors, a middle domain, and a C-terminal dimerization domain (12, 13). Hsp90 has been known to play important roles in viral replication either as a receptor or a chaperone (9, 14). As a putative receptor, Hsp90 has been proved essential for the entry of infectious bursal disease virus (IBDV) into DF-1 cells (15). Hsp90 has also been reported to be a part of receptor complex mediating dengue virus (DENV) entry and the receptor for Japanese encephalitis virus (JEV) entry into Vero cells (16, 17). When Enterovirus 71 (EV71) binds to its receptor, Hsp90 acts as a cofactor to facilitate viral entry into host cells (18). Hsp90 is a functional part of the receptor complex of red-spotted grouper nervous necrosis virus (RGNNV) and involved in the internalization of RGNNV via the clathrin endocytosis pathway (9). Furthermore, Hsp90 functions as a chaperone for the maturation of viral proteins (11). Hsp90 contributes to the maturation of the polymerase protein L of snakehead vesiculovirus (SHVV) and ensures the effective replication of SHVV (19). However, Hsp90 has never been reported as an interacting partner of viral proteins of aquareoviruses.

In this study, Hsp90 is identified as an interacting partner of GCRV-II VP35 and essential for GCRV-II proliferation. On the one hand, Hsp90 localizes on the cell membrane and functions as a receptor of GCRV-II via interacting with the outer capsid protein VP35, mediating the entry of GCRV-II into cells through the clathrin endocytosis pathway. On the other hand, Hsp90 localizes in the cytoplasm and functions as a chaperone of VP35, mediating the maturation of VP35 and avoiding the degradation of VP35 through the proteasome pathway. Taken together, our findings indicate that Hsp90 acts as a receptor and chaperone for GCRV-II VP35.

RESULTS

Hsp90 interacts with GCRV-II VP35.

To determine the cellular binding partners of GCRV-II VP35, pFlag-VP35 or p3×Flag-CMV-14 (empty vector) was transfected into CIK cells, followed by immunoprecipitation using anti-Flag antibody at 24 h posttransfection, and the immunoprecipitated proteins were detected by Western blotting and silver staining (Fig. 1A). Subsequent liquid chromatography-tandem mass spectrometry (LC-MS/MS) revealed a total of 45 candidate proteins potentially interacting with the VP35, and 11 of the 45 proteins that have been reported involving in virus proliferation were listed (Fig. 1B). Among them, Hsp90 was selected for further study due to its important roles in multiple stages of viral life cycles (20). The Hsp90-VP35 interaction was then confirmed using Co-IP (Fig. 1C). Subcellular colocalization revealed that Hsp90 colocalized with VP35 (Fig. 1D). Furthermore, His pulldown was used and proved that Hsp90 directly interacted with VP35 (Fig. 1E and S2). Collectively, these data demonstrate that Hsp90 is an interacting partner of GCRV-II VP35.

FIG 1.

Hsp90 interacts with GCRV-II VP35. (A) CIK cells were transfected with pFlag-VP35 or p3×Flag-CMV-14 (empty vector), and the cells were collected at 24 h posttransfection. Immunoprecipitation was performed using mouse anti-Flag antibody. The eluted samples were examined by Western blotting (IB) and silver staining. The red arrow indicates the VP35 protein. (B) The samples from (A) were analyzed by LC-MS/MS and some potential interacting proteins of VP35 were listed. (C) 293T cells were cotransfected with pFlag-VP35 and pHA-Hsp90, pHA-Hsp90 and p3×Flag-CMV-14, pCMV-HA and pFlag-VP35, respectively. The cells were collected at 24 h posttransfection and then used for Co-IP assay with anti-HA antibody. (D) 293T cells were cotransfected with pEGFP-N1 and pDsRED-VP35, pEGFP-Hsp90, and pDsRED-N1, pEGFP-Hsp90 and pDsRED-VP35, respectively. At 24 h posttransfection, the cells were fixed, permeabilized, incubated with DAPI, and finally detected using confocal microscope. (E) CIK cells were transfected with pFlag-VP35 or p3×Flag-CMV-14, and the cells were collected at 24 h, then incubated with purified recombinant His-Hsp90 or His tag. Pulldown was performed with Ni resin, and the elution was examined by Western blotting.

VP35 interacts with the C-terminal domain of Hsp90.

To determine the critical domain of Hsp90 for VP35 interaction, we constructed the following plasmids according to previous report (9), including pHA-Hsp90-N (encoding the amino acids 1 to 219), pHA-Hsp90-M (encoding the amino acids 286 to 541), and pHA-Hsp90-C (encoding the amino acids 542 to 727) (Fig. 2A). The charged linker serves to connect the N and M regions (13). 293T cells were transfected with pFlag-VP35 together with the upper indicated plasmids. Co-IP results indicated that the C-terminal domain, but not other domains, of Hsp90 interacted with VP35 (Fig. 2B).

FIG 2.

VP35 interacts with the C-terminal domain of Hsp90. (A) Schematic diagram of Hsp90 and its truncated mutants. (B) 293T cells were cotransfected with pFlag-VP35 and pCMV-HA, pFlag-VP35 and pHA-Hsp90-N, pFlag-VP35 and pHA-Hsp90-M, pFlag-VP35 and pHA-Hsp90-C, and pFlag-VP35 and pHA-Hsp90, respectively. The cells were collected at 24 h posttransfection and then used for Co-IP assay with anti-Flag antibody.

Knockdown of Hsp90 suppresses GCRV-II proliferation.

Three specific siRNAs of Hsp90 were synthesized to knockdown cellular Hsp90 expression. The results showed that transfection of siHsp90-1 resulted in more efficient knockdown of Hsp90 than siHsp90-2 or siHsp90-3 (Fig. 3A). To evaluate the effects of knockdown of Hsp90 on GCRV-II proliferation, CIK cells were transfected with siHsp90-1 or control siRNA (siNC) for 24 h, and then infected with GCRV-II for 48 h. The results showed that transfection with siHsp90-1 reduced viral proliferation at the protein level compared with that of siNC (Fig. 3B bottom). Furthermore, the pFlag-VP35 plasmid was used as a positive standard plasmid to establish an absolute quantitative detection method for the copy number of GCRV-II in the supernatant. Absolute quantification showed that transfection with siHsp90-1 reduced the virion copy number in the supernatant compared with that of siNC (Fig. 3B top). siHsp90-2 and siHsp90-3 were also used to assess the effect of Hsp90 knockdown on GCRV-II proliferation, thereby excluding the off-target effect (Fig. S1). The results showed that siHsp90-3, but not siHsp90-2, reduced viral proliferation. All the results indicate that knockdown of Hsp90 suppresses GCRV-II proliferation.

FIG 3.

Knockdown of Hsp90 suppresses GCRV-II proliferation. (A) CIK cells were transfected with siNC, siHsp90-1, siHsp90-2, or siHsp90-3. The Hsp90 in CIK cells was measured at 24 h posttransfection using qRT-PCR and Western blotting; β-actin was used as the internal control. (B) CIK cells were transfected with siNC or siHsp90-1, followed by GCRV-II infection. At 48 h postinfection, GCRV-II in cells was measured using Western blotting, and viral copy number in supernatants were measured by absolute quantification. All the data are representative of at least two independent experiments, with each determination performed in triplicate (mean ± SD). * and ** indicate statistically significant differences (*, P < 0.05; **, P < 0.01).

Inhibition of Hsp90 activity suppresses GCRV-II proliferation.

To further evaluate the effects of Hsp90 activity on GCRV-II proliferation, the Hsp90 inhibitors geldanamycin and 17-DMAG were used. The suitable concentration of geldanamycin or 17-DMAG to CIK cells were determined by cell viability assay (Fig. 4A and B). Subsequently, CIK cells were infected with GCRV-II and cultured with 3 μM geldanamycin or 17-DMAG for 48 h. The results showed that inhibition of Hsp90 activity by either geldanamycin or 17-DMAG reduced viral proliferation based on the protein level and the viral particle numbers (Fig. 4C and D). 17-DMAG had a stronger inhibitory effect than that of geldanamycin (Fig. 4C and D). These results suggest that Hsp90 activity is required for GCRV-II proliferation.

FIG 4.

Inhibition of Hsp90 activity suppresses GCRV-II proliferation. (A, B) CIK cells were treated with the indicated concentrations of geldanamycin or 17-DMAG for 48 h. The cell viability was determined and calculated as a percentage of the viability of cells treated with DMSO. (C-D) CIK cells were infected with GCRV-II and treated with 3 μM geldanamycin (C) or 17-DMAG (D). At 48 h postinfection, GCRV-II in cells was measured using Western blotting, and viral copy numbers in supernatants were measured by absolute quantification. All the data are representative of at least two independent experiments, with each determination performed in triplicate (mean ± SD). * and ** indicate statistically significant differences (*, P < 0.05; **, P < 0.01).

Hsp90 localizes at both the membrane and cytoplasm of CIK cells.

To investigate the subcellular localization of Hsp90, CIK cells were fixed with 4% paraformaldehyde together with or without Triton X-100, followed by incubation with anti-Hsp90 antibody, Dil, and DAPI. When the cells were treated with Triton X-100, the Dil-stained cell membrane (red) was scattered in dots, and Hsp90 (green) was distributed in the cytoplasm (Fig. 5A top). While without Triton X-100 treatment, the Dil-stained cell membrane was intact, and colocalized signal (yellow) of Dil and Hsp90 was observed at cell membrane (Fig. 5A bottom), indicating that Hsp90 localizes both at the membrane and cytoplasm of CIK cells. To further determine the presence of Hsp90 at the membrane of CIK cells, the cells were treated with anti-Hsp90 antibody and then analyzed by flow cytometry. The results showed that 10.1% of the cells showed positive signals (Fig. 5B). These data indicate that Hsp90 can localize on the membrane and cytoplasm of CIK cells.

FIG 5.

Hsp90 localizes at both the membrane and cytoplasm of CIK cells. (A) CIK cells were fixed with 4% paraformaldehyde and then treated with (top) or without (bottom) Triton X-100. The cells were immunostained with rabbit anti-Hsp90 antibody and then with FITC-labeled goat anti-rabbit IgG. Cell nuclei were stained with DAPI, and cell membrane was stained with Dil. The cells were observed under a confocal microscope. (B) CIK cells were incubated with PBS (control) or anti-Hsp90 antibody, then stained with APC-labeled goat anti-rabbit IgG, followed by flow cytometry.

Hsp90 mediates GCRV-II entry.

To determine whether GCRV-II uses Hsp90 for its entry into CIK cells, CIK cells were cultured with 17-DMAG at 28°C for 2 h, then infected with GCRV-II at 4°C for 1 h (Fig. 6A) or at 28°C for 2 h or 4 h (Fig. 6B). At 4°C, the virus can bind to cells but cannot enter cells (3). As shown in Fig. 6A and B, inhibition of Hsp90 activity by 17-DMAG suppressed both binding and entry of GCRV-II to CIK cells. To further determine that Hsp90 is a receptor of GCRV-II, GCRV-II was preincubated with purified His-Hsp90 protein at 0.5, 1, or 2 μg/mL, or His tag as control (Fig. S2). The mixture was then added to CIK cells, and the results showed pretreatment of GCRV-II with purified His-Hsp90 protein blocked the infection of GCRV-II compared to that of His tag (Fig. 6C). In addition, when CIK cells were pretreated with anti-Hsp90 antibody (1:50) or IgG as control, followed by GCRV-II infection, the anti-Hsp90 antibody blocked the entry of GCRV-II into CIK cells (Fig. 6D). CIK cells were transfected with pEGFP-Hsp90 or the empty vector pEGFP-N1, followed by GCRV-II infection at 4°C for 1 h or at 28°C for 2 h or 4 h. The binding and entry ability of GCRV-II to CIK cells were significantly promoted (Fig. 6E and F), confirming that Hsp90 promotes GCRV-II entry into CIK cells. Furthermore, the experiment was also performed using GCO cells (Fig. 6G and H) and 293T cells (Fig. 6I and J), which are GCRV-II permissive and non-permissive cells, respectively, and overexpression of Hsp90 also enabled the virus to bind and enter these cells. Taken together, these results indicate that Hsp90 acts as a receptor to facilitate GCRV-II entry.

FIG 6.

Hsp90 mediates GCRV-II entry. (A, B) CIK cells were treated with 17-DMAG (3 μM) or DMSO at 28°C for 2 h, then infected with GCRV-II at 4°C for 1 h (A) or at 28°C for 2 h or 4 h (B). The VP35 mRNA in cells was quantified by qRT-PCR. (C) GCRV-II virus particles were incubated with different concentrations of recombinant His (control) or His-Hsp90 at 4°C for 4 h and then incubated with CIK cells at 4°C for 4 h. The VP35 mRNA in cells was quantified by qRT-PCR. (D) CIK cells were incubated with anti-Hsp90 antibody or IgG at 28°C for 3 h and then infected with GCRV-II at 28°C for 2 h, 4 h, and 6 h. The VP35 mRNA in cells was quantified by qRT-PCR. (E-J) CIK cells (E and F), GCO cells (G and H), and 293T cells (I and J) were transfected with pEGFP-Hsp90 or pEGFP-N1, then infected with GCRV-II at 4°C for 1 h (E, G, and I) or at 28°C for 2 h or 4 h (F, H, and J). The VP35 mRNA in cells was quantified by qRT-PCR. All the data are representative of at least two independent experiments, with each determination performed in triplicate (mean ± SD). * and ** indicate statistically significant differences (*, P < 0.05; **, P < 0.01).

Hsp90 mediates GCRV-II entry through clathrin endocytosis pathway.

The current study shows that GCRV-I and GCRV-III can enter cells through a clathrin-mediated pathway (3, 21). In addition, GCRV-I can also enter cells via a caveolae-mediated pathway (22). However, it is unknown which pathway mediates the entry of GCRV-II into cells. Here, we used the caveolae endocytosis pathway inhibitors nystatin and genistein and the clathrin endocytosis pathway inhibitor chlorpromazine. Moreover, dynasore was used to determine whether dynamin is involved in GCRV-II entry. Cell viability assays showed negligible cytotoxic effects on CIK cells at 40 μM concentrations of all the inhibitors (Fig. 7A). CIK cells were cultured with inhibitors at 28°C for 2 h, then infected with GCRV-II at 4°C for 1 h for virus binding, followed by washing with PBS to remove any unbound virus, and then incubated at 28°C for 4 h for virus entry. As shown in Fig. 7B to E, chlorpromazine and dynasore, but not genistein or nystatin, significantly decreased the GCRV-II entry into CIK cells. The data indicate that GCRV-II enters cells via the clathrin endocytosis pathway and is dependent on dynamin. Furthermore, Co-IP shows that Hsp90 interacts with clathrin in CIK cells (Fig. 7F). Taken together, these results suggest that Hsp90 facilitates GCRV-II entering CIK cells through clathrin endocytosis with dependence on dynamin, rather than the caveolae endocytosis pathway.

FIG 7.

Hsp90 mediates GCRV-II entry through clathrin endocytosis pathway. (A) CIK cells were treated with the indicated concentrations of nystatin, genistein, chlorpromazine, or dynasore for 4 h. The cell viability was determined and calculated as a percentage of the viability of cells treated with DMSO. (B-E) CIK cells pretreated with different doses of chlorpromazine, dynasore, genistein, or nystatin at 28°C for 2 h, then infected with GCRV-II at 4°C for 1 h, followed by washing with PBS to remove unbound viruses, and then incubated at 28°C for 4 h. The VP35 mRNA in cells was quantified by qRT-PCR. All the data are representative of at least two independent experiments, with each determination performed in triplicate (mean ± SD). * and ** indicate statistically significant differences (*, P < 0.05; **, P < 0.01). (F) CIK cells were transfected with pHA-Hsp90 or pCMV-HA. The cells were collected at 24 h posttransfection and then used for Co-IP assay with anti-clathrin heavy chain antibody.

Hsp90 dysfunction mediates the degradation of VP35 through the proteasome pathway.

Hsp90 is critical for protein maturation, accurate folding, and maintenance of protein stability (20). To explore whether Hsp90 in the cytoplasm acts as a chaperone for VP35, CIK cells were transfected with plasmid pFlag-VP35 and then cultured with or without Hsp90 inhibitor 17-DMAG. The results showed that the levels of VP35 were significantly decreased in the presence of 17-DMAG (Fig. 8A), indicating that GCRV-II VP35 is a client protein of Hsp90. To explore the degradation pathway of the VP35 mediated by Hsp90 dysfunction, CIK cells were transfected with plasmid pFlag-VP35 and then cultured with or without 17-DMAG, together with proteasome inhibitor MG132, autophagy pathway inhibitor 3-MA, or lysosomal pathway inhibitor NH₄Cl. We found that the Hsp90 dysfunction-mediated degradation of the VP35 protein was eliminated by MG132, but not other inhibitors (Fig. 8B), indicating that the VP35 was degraded through the proteasomal pathway. To determine whether VP35 was polyubiquitinated, 293T cells were transfected with plasmid pFlag-VP35 and pHA-Ub. Then, cells were treated with or without 17-DMAG. Co-IP experiments showed that VP35 could be ubiquitinated, and inhibition of Hsp90 activity enhanced its polyubiquitination (Fig. 8C). All data suggest that Hsp90 is a chaperone of VP35, and its dysfunction enhances VP35 polyubiquitination, which then mediates its degradation through the proteasomal pathway (Fig. 8C).

FIG 8.

Inhibition of Hsp90 activity enhances the ubiquitination and proteasomal degradation of VP35. (A) CIK cells were transfected with pFlag-VP35 and cultured in medium containing 17-DMAG (3 μM) or DMSO. The cells were harvested at 24 h posttransfection and the VP35 proteins were determined by Western blotting; β-actin was used as the internal control. (B) CIK cells were transfected with pFlag-VP35 and cultured in medium containing 17-DMAG (3 μM) or DMSO, together with MG132 (5 μM), NH₄Cl (15 μM), or 3-MA (60 μM). At 24 h posttransfection, the cells were harvested and the VP35 proteins were determined by Western blotting; β-actin was used as the internal control. (C) 293T cells were cotransfected with pFlag-VP35 and pCMV-HA, pFlag-VP35 and pHA-Ub, and cultured in medium with or without 17-DMAG (3 μM). The cells were collected at 24 h posttransfection and then used for Co-IP assay with anti-Flag antibody.

DISCUSSION

The viral life cycle can be divided into the following stages: entry, genome replication, protein expression, assembly, and release from host cells (23). Recognition of viral receptors is the first and crucial step for viruses to invade host cells (24). Identification of viral receptors on susceptible cells is pivotal for developing therapeutic agents to block viral infection (23). GCRV infection results in extremely high mortality among grass carp, which causes severe economic losses in grass carp culture (2). Several attempts have been made to find out the receptor of GCRV, but only laminin receptor has been identified as a receptor of GCRV-I via binding with its outer capsid protein VP5 (10). However, the receptor for the most prevalent GCRV-II remains unidentified.

The outer capsid protein is known to play a crucial role in the process of virus attaching to the surface of host cells (10). The S11 segment of GCRV-I and GCRV-III is predicted to encode non-structured proteins (NS26 and VP8/VP15, respectively), while the S11 fragment of GCRV-II encodes a 35-kDa protein (VP35) with a conserved putative zinc-binding motif similar to GCRV-I outer capsid protein VP7 (25–27). Thereby, the VP35 of GCRV-II was selected to identify viral receptors.

Hsp90 plays a crucial role in viral entry into host cells (28). Currently, Hsp90 has been reported as a cellular receptor by various viruses. As a cellular receptor for IBDV, JEV, EV71, and RGNNV, Hsp90 localized at the cell membrane to interact with viral outer capsid proteins and plays an important role in viral binding and entry (9, 15, 17, 18). Together with these reports, we found that Hsp90 localized at the CIK cell membrane and interacted with the viral capsid protein VP35 through its C-terminal domain, acting as a novel functional receptor for GCRV-II. Although the evidence for the Hsp90 client-binding site converges to the Hsp90 M domain, additional client-specific contacts with the Hsp90 N and C domains are possible (29). However, Hsp90 does not have a transmembrane region. Previous studies have reported that Hsp90 can reach the extracellular space through secretion (30). Whether Hsp90 is secreted to the extracellular space and binds to cell membrane proteins, thereby localizing on the membrane, and functioning as a receptor or coreceptor remains to be explored.

Many viruses have been reported to utilize multiple endocytic pathways to enter host cells. For example, mammalian orthoreovirus (MRV) can use both dynamin-dependent and dynamin-independent endocytic pathways to enter cells (31). Real-time tracking experiments revealed that the quantum dot-labeled GCRV-I particles were colocalized with caveolin-1 and were transported along microtubules, suggesting that GCRV-I can use caveolae-mediated endocytosis to initiate infection (22, 32). Analysis using multiple endocytic pathway inhibitors demonstrated that GCRV-I enters CIK cells via clathrin-mediated endocytosis pathway and is dependent on dynamin (3, 21). Our data suggest that Hsp90 promotes GCRV-II entry into CIK cells through clathrin-mediated endocytic pathway and is dependent on dynamin, rather than the caveolae-mediated endocytosis pathway.

Hsp90 is critical for protein maturation, accurate folding, maintenance of protein stability, and plays an important role in the life cycle of viruses (20, 33). By maintaining viral protein stability, Hsp90 can affect the proliferation of various viruses, including SHVV, herpes simplex virus 1 (HSV-1), mumps virus (MuV), vesicular stomatitis virus (VSV), human respiratory syncytial virus (HRSV), and influenza A virus (IAV) (19, 34–38). During SHVV infection, Hsp90 contributes to the maturation of viral polymerase protein L for efficient replication of SHVV, and upon inhibition of Hsp90, soluble and insoluble L proteins are degraded by autophagy and proteasomal pathways, respectively (19). The viral polymerase proteins of HSV-1 and MuV are also degraded by the proteasome pathway in the presence of Hsp90 inhibitors (34, 35). Here, stabilization of VP35 by Hsp90 is required to maintain GCRV-II proliferation, as Hsp90 dysfunction allows VP35 to be degraded through the proteasomal pathway. Hsp90 also plays a role in viral gene expression, genome replication, and virion maturation (20). To affect viral gene expression, Hsp90 interacts with the conserved herpesvirus protein kinase (CHPK), which is expressed by all eight human herpesviruses, and is essential for viral gene translation (39). In the case of poliovirus, Hsp90 affects virion maturation by affecting the capsid precursor P1 (40). Hsp90 can increase the affinity between core protein dimers to induce hepatitis B virus (HBV) capsid formation and inhibit HBV capsid dissociation from HBV core protein (41). Our study shows that Hsp90 functions as a receptor of GCRV-II during GCRV-II invasion via interacting with VP35 and as a chaperone of GCRV-II VP35 in the infected cells. Whether Hsp90 affects other life processes of GCRV-II, especially the maturation of the virus by interacting with the outer capsid, remains to be explored.

Taken together, grass carp Hsp90 regulates GCRV-II proliferation by interacting with the outer capsid protein VP35 as its receptor and chaperone. This study is the first report to reveal the interaction between the GCRV-II VP35 and host Hsp90 and indicates that Hsp90 activity is required for the entry and proliferation of GCRV-II (Fig. 9). Our data will provide new insights into understanding of the pathogenesis of GCRV-II and provide new perspectives for the control of GCRV-II infection.

FIG 9.

The role of VP35-Hsp90 interaction in GCRV-II life cycle. A model showing the function of Hsp90 on GCRV-II entry and replication in CIK cells. Hsp90 or other receptors interact with GCRV-II and the clathrin complex promotes GCRV-II internalization through the clathrin-mediated endocytic pathway. Hsp90 functions in maintaining the stability of VP35. Inhibition of Hsp90 activity degrades VP35 through the proteasomal pathway.

MATERIALS AND METHODS

Cells and viruses.

Ctenopharyngon idellus kidney (CIK) cells and grass carp ovary (GCO) cells were grown in minimum essential medium (MEM) (HyClone) at 28°C and 5% CO₂ atmosphere. 293T cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (HyClone) at 37°C and 5% CO₂ atmosphere. All cell culture media were supplemented with 10% fetal bovine serum (FBS) (Gibco), 100 g/mL penicillin (Sigma), and 100 g/mL of streptomycin (Sigma). The GCRV-II strain GCRV-AH528 was stored in our laboratory.

Regents and antibodies.

17-DMAG, geldanamycin, MG132, 3-MA, NH₄Cl, chlorpromazine, dynasore, genistein, and nystatin were purchased from Selleck Biotechnology Co., LTD. (Shanghai, China). Small interfering RNAs (siRNAs) of Hsp90 (siHsp90) and the control siRNA (siNC) were synthesized from GenePharma Co., LTD. The rabbit anti-GCRV-II-VP4 antibody was prepared and stored in our laboratory. The mouse anti-Flag, anti-HA, anti-His, anti-β-actin antibodies, and the rabbit anti-Hsp90, anti-Clathrin antibodies, and IgG were purchased from Abclonal Technology Co., LTD. Goat anti-mouse-IgG and anti-rabbit-IgG secondary antibodies were purchased from Abclonal Technology Co., LTD.

Plasmid construction and transfection.

The full-length GCRV-II VP35 gene (GenBank: KR180378.1) was amplified using the cDNAs reverse-transcribed from GCRV-II infected CIK cells and cloned into p3×Flag-CMV-14 and pDsRed-N1 using primers as listed in Table 1. Hsp90 and its mutants were amplified using the cDNAs reverse-transcribed from CIK cells and cloned into pCMV-HA, pEGFP-N1, and pET-32a (+) using primers as listed in Table 1. Ubiquitin (Ub) was amplified using the cDNAs reverse-transcribed from CIK cells and cloned into pCMV-HA using primers as listed in Table 1. When the cells were grown to 70%–80% confluence, the plasmids or RNAs were mixed with TransIntro EL transfection reagent (TransGen Biotech, Beijing, China) in Opti-MEM medium (Invitrogen), followed by the incubation at room temperature for 20 min. The mixed solution is then transferred to the cell plates. At 6 h posttransfection, the Opti-MEM medium was replaced by MEM or DMEM containing 10% FBS and the cells were cultured for further 18 h.

TABLE 1.

Primers used in this study

Application	Primer	Sequence (5′–3′)
Expression	Flag-VP35-FW	TTAAGCTTATGGAATCAGCAAAACCATTGACGTTT
	Flag-VP35-BW	CTGGTACCGACTGTCCCTGGATCTCAGGTTTGAAG
	DsRed-VP35-FW	CCGCTCGAGATGGAACCAGCAAAACCATTGACGT
	DsRed-VP35-BW	CCGGAATTCGCTGTCCCTGGATCTCAGGTTTGAAG
	HA-Hsp90-FW	CCGGAATTCGGATGCCTGAAGAAATGCGCCAA
	HA-Hsp90-BW	CCGCTCGAGTGTATCAACTTCCTCCATGCGAGA
	HA-Hsp90-N-FW	CCGGAATTCGGATGCCTGAAGAAATGCGCCAA
	HA-Hsp90-N-BW	CCGCTCGAGATTCCTTCTCCACGAAGAGAGT
	HA-Hsp90-M-FW	CCGGAATTCGGACCAAACCCATCTGGACCCGC
	HA-Hsp90-M-BW	CCGCTCGAGATCCCTCTTTGGTGACGGACAC
	HA-Hsp90-C-FW	CCGCTCGAGGTCTGGAGCTGCCTGAGGATGAAG
	HA-Hsp90-C-BW	ATAAGAATGCGGCCGCATCAACTTCCTCCATGCGAGA
	EGFP-Hsp90-FW	CCGCTCGAGATGCCTGAAGAAATGCGCCAA
	EGFP-Hsp90-BW	CCGGAATTCGATCAACTTCCTCCATGCGAGA
	His-Hsp90-FW	CGCGGATCCATGCCTGAAGAAATGCGCCAAGAT
	His-Hsp90-BW	ATAAGAATGCGGCCGCATTAATCAACTTCCTCCATGCG
	HA-Ub-FW	CCGGAATTCGGATGCAGATCTTTGTGAAA
	HA-Ub-RW	CCGCTCGAGAACCGCCCCTCAGACGCAG
qRT-PCR	q-VP35-FW	CAGTGGGAAGGACCTCAAG
	q-VP35-BW	ACACCAAACTGCCCAATCA
	q-Hsp90-FW	GGTCACGGTCATCACTAAA
	q-Hsp90-BW	CCTCGACGTACTCGGTCTG

Virus infection.

When CIK cells were grown to 80%–90% confluence, GCRV-II were added and incubated with CIK cells for 2 h. The medium was then replaced with MEM medium containing 5% FBS. The supernatants and cells were collected at appropriate time points for viral detection.

Coimmunoprecipitation (Co-IP).

Cell monolayers were washed with PBS and lysed with lysis buffer containing 25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40, and 5% glycerol (Thermo Scientific). The supernatant was incubated with the anti-HA, anti-Flag, or anti-clathrin antibody at 4°C for 2 h. The interacting complexes were precipitated by incubation with protein A/G Magnetic Beads (MedChemExpress) at 4°C for 2 h. The eluted samples were then used for Western blotting.

Western blotting.

Samples were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Biosharp). The membranes were blocked with 5% skim milk in TBST buffer (25 mM Tris-HCl, 150 mM NaCl, 0.1% Tween 20, pH 7.5) at 4°C overnight, followed by incubation with the indicated primary antibodies (1:1000 to 1:2000) at room temperature for 4 h. The membrane was washed with TBST buffer for three times and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit-IgG antibody (1:5000) or anti-mouse-IgG antibody (1:5000) at room temperature for 1 h. The membrane was washed with TBST buffer, placed in ECL luminescent solution, and analyzed by chemiluminescence.

qRT-PCR.

Total RNA was extracted using TRIzol reagent (TaKaRa) according to the manufacturer’s instructions. The RNA was reverse transcribed into cDNA using the PrimeScript RT reagent kit with gDNA Eraser (TaKaRa). For the absolute quantification, the number of plasmid copies per unit volume of DNA samples was calculated using the DNA/RNA copy number calculator (http://www.endmemo.com/bio/dnacopynum.php). The plasmid was diluted 10 times and acted as the template for qRT-PCR amplification using 2×TSINGKE Master qPCR Mix (Tsingke) to prepare a standard curve. Primers are listed in Table 1. The qRT-PCR was performed on the BIO-RAD CFX Connect Real-Time System, and the amplification conditions were 95°C for 3 min, followed by 40 cycles at 95°C for 10 s, 55°C for 30 s, and then a melt curve was acquired from 65°C to 95°C. The samples to be tested were amplified by qRT-PCR under the same conditions, and the number of virus copies in the samples was obtained through the established standard curve. For the relative quantification, quantitative primers and internal reference primers were used to amplify the target gene fragments. The reaction system and amplification conditions were the same as those of the absolute quantification. After qRT-PCR, the melting curve was analyzed to ensure the specificity of the reaction. Using β-actin as an internal reference gene, the data were analyzed by the 2^-ΔΔCt method.

Immunofluorescence (IF) assay.

CIK cells were seeded into 12-well plates with glass coverslips and grew to 70% to 80% confluence, followed by the fixation with 4% paraformaldehyde at room temperature for 15 min. After being washed three times with PBS, cells were treated with or without 0.5% Triton X-100 for membrane permeabilization at room temperature for 15 min. Then the cells were blocked with 5% bovine serum albumin (BSA) at room temperature for 1 h. The fixed cells were incubated with the primary antibodies (1:100 to 1:200) at 4°C overnight. After being washed three times with PBS, cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary antibodies (1:200) at 37°C for 1 h. After being washed three times with PBS, cells were stained with 10 μg/mL Dil at 37°C for 10 min and 10 μg/mL DAPI at 37°C for 5 min. After three-time wash with PBS, the samples were detected using confocal microscope (Nikon N-STORM).

Flow cytometry.

200 μL CIK cells (5 × 10⁶ cells/mL) were incubated with rabbit anti-Hsp90 antibody (1:100) on ice for 45 min. After washing three times with PBS containing 2% FBS, the allophycocyanin (APC)-conjugated goat anti-rabbit-IgG (1:100) antibody was added, and the cells were incubated at 4°C for 45 min. Cells were washed three times with PBS and then detected using the flow cytometer FACSVerse (BD Biosciences). The data were analyzed using FlowJo software (Tree Star).

Protein purification and His pulldown.

The plasmid pET32a-Hsp90 was transformed into Escherichia coli Rosetta 2 (DE3) cells for prokaryotic expression. The expression of the fusion protein was induced with isopropyl-β-D-1-thiogalactopyranoside (IPTG) and purified by Ni-NTA resin chromatography (Amersham Biosciences). For His pulldown, 293T cells were transfected with plasmid pFlag-VP35 or p3×Flag-CMV-14, respectively. At 24 h after transfection, cells were lysed with lysis buffer on ice for 30 min. His-Hsp90 protein (0.5 μg) or His tag (0.5 μg) were, respectively, incubated with cell lysates at 4°C for 30 min, then Ni-binding resin (20 μL) was added to the mixture and incubated at 4°C for 8 h. The resin was washed with wash buffer (50 mM NaH₂PO₄, 300 mM NaCl, 20 mM imidazole, 10 mM β-Mercaptoethanol, pH 8.0) and eluted with elution buffer (50 mM NaH₂PO₄, 300 mM NaCl, 250 mM imidazole, 10 mM β-Mercaptoethanol, pH 8.0) and then analyzed using SDS-PAGE and Western blotting.

Blocking assays.

CIK cells grown in 12-well plates were incubated with rabbit anti-Hsp90 antibody (1:50) or IgG antibody (1:50) at 28°C for 3 h. After washing with PBS, cells were infected with GCRV-II and stayed at 28°C for 2 h or 4 h, respectively. Cells were washed three times with PBS to remove free virus particles, and the cell samples were harvested. Different concentrations (0.5 μg/mL, 1 μg/mL, 2 μg/mL) of the recombinant His-Hsp90 protein or His tag were incubated with GCRV-II at 4°C for 4 h, the mixtures was then added onto CIK cells and stayed at 4°C for 4 h. Cells were then washed three times with PBS to remove free virus particles, and the cell samples were harvested.

Statistical analysis.

All statistical analysis were performed using GraphPad Prism version 9.0 (GraphPad Software). The P-value was analyzed by Student's t test or one-way analysis of variance (ANOVA) with Dunnett's post hoc test. For all tests, P < 0.05 (*) is considered statistically significant, and P < 0.01 (**) is considered highly statistically significant. Data are expressed as mean ± analysis of variance.