Abstract
Many efforts have been made around the world to combat SARS-CoV-2. Among these are recombinant antibodies considered to be suitable as an alternative for some diagnostics/therapeutics. Based on their importance, this study aimed to investigate the expression, purification, and efficiency of a new potent recombinant scFv in the E. coli BL21 (DE3) system. The expression studies were performed after confirming the scFv cloning into the pET28a vector using specific PCRs. After comprehensive expression studies, a suitable strategy was adopted to extract and purify periplasmic proteins using Ni2+-NTA resin. Besides the purified scFv, the crude bacterial lysate was also used to develop a sandwich ELISA (S-ELISA) for the detection of SARS-CoV-2.
The use of PCR, E. coli expression system, western blotting (WB), and S-ELISA confirmed the functionality of this potent scFv. Moreover, the crude bacterial lysate also showed good potential for detecting SARS-CoV-2. This could be decreasing the costs and ease its utilization for large-scale applications.
The production of high-quality recombinant proteins is essential for humankind. Moreover, with attention to the more aggressive nature of SARS-CoV-2 than other coronaviruses, the development of an effective detection method is urgent. Based on our knowledge, this study is one of the limited investigations in two fields: (1) The production of anti-SARS-CoV-2 scFv using E. coli [as a cheap heterologous host] in relatively high amounts and with good stability, and (2) Designing a sensitive S-ELISA for its detection. It may also be utilized as potent therapeutics after further investigations.
Keywords: Recombinant scFv, SARS-CoV-2, Sandwich ELISA, Escherichia coli, Expression, Purification
1. Introduction
The coronavirus disease-2019 (COVID-19) emerged in late December 2019 from Wuhan, China, spread rapidly around the globe, and became a pandemic. The causative agent of the COVID-19 pandemic was nominated as SARS-CoV-2 by World Health Organization (WHO). This virus is an enveloped, positive-sense single-strand RNA virus belonging to the Coronaviridae family. The dominant feature of this disease is the high mortality and morbidity rate in comparison with MERS (Middle East Respiratory Syndrome) and SARS (severe acute respiratory syndrome). So, various complications have been reported including acute respiratory distress syndrome (ARDS), vascular thrombosis, coagulopathy, etc. [1,2].
To combat this virus, many diagnostic and therapeutic agents have been introduced. These agents may be small chemical compounds and peptides’ therapeutic proteins (such as antibodies or nanobodies), etc. As the important components of the immune system, the capability of antibodies for highly specific binding with various ligands (including viral proteins, tumor-associated markers, etc.) and their great applications turn them into an interesting field of research. So, as a fast-growing field in the pharmaceutical industry, about 131 antibody therapeutics are currently approved by FDA for clinical use in the United States or European Union by November 2021, since their first introduction in the 1980s. Among these, there are 20 antibodies for COVID-19 disease that are considered for emergency use or approval by November 15, 2021. Moreover, it is worth nothing to say that the global antibody market size is approximately $145.7 billion in 2022, and it is estimated to grow to $248.9 billion by the end of 2027 (https://www.marketdataforecast.com/). In this regard, researchers are focused on maximizing their production and efficiency [[3], [4], [5], [6]].
The neutralizing antibodies could have various formats i.e., Fab (antigen-binding fragments), diabody, minibody, scFv (single-chain fragment variable), scFv-zipper, single-domain antibody (dAb), or nanobodies. Among these, the scFv format is a good choice based on the following reasons: (1) the low molecular weight (27–30 kDa), (2) improvement of thermostability and solubility, (3) the low immunogenicity, (4) high specificity, (5) no requirement to post-translational modifications (PTMs), (6) more rapid clearance, etc. This antibody has been frequently used for the treatment or detection of various diseases, e.g., Infectious Bursal Disease (IBD), human H5N1 influenza virus, Newcastle virus disease [7], and tumor imaging [3,5,[8], [9], [10]].
After the selection of a suitable antibody format, the selection of a good and robust heterologous host is an important issue for its rapid production and purification, and the following commercial and academic purposes [11].
Among the great vast of expression hosts, the bacterium Escherichia coli stands for the reduction of downstream bioprocesses according to some reasons including (1) the low-cost and low growth requirements, (2) its well-characterized physiology and genetics for the production of proteins, (3) its capability for mass-production of the recombinant proteins in a relatively short time, (4) ease of its manipulation. Therefore, as a valuable cell factory for the production of recombinant proteins, designing the expression systems based on this attractive host gets the most attention in recent years [[11], [12], [13]].
In contrast to the relatively reductive nature of the cytoplasm, the oxidizing environment of E. coli periplasmic space enables the proper disulfide bond formation in recombinant proteins using the disulfide bond formation (Dsb)-system. For this, various studies have targeted the proteins (especially disulfide bond-harboring ones) to this space to ensure their proper native conformation and facilitate the translocation across the cytoplasmic membrane by fusion of a peptide signal sequence (e.g., PelB, PhoA, OmpA, MalE) to their N-terminal sequence, too. Every of these signal sequences is translocated by discrete secretion pathways, e.g., the Sec-pathway is used for the translocation of OmpA, PhoA, and PelB signal peptides. Moreover, some strains of E. coli have a superior advantage. For example, E. coli BL21 (DE3) is one suitable host due to the lack of cellular proteases (opmT and Lon) and decrease in protease activity [3,[12], [13], [14], [15]].
Accordingly, we investigated the ability of E. coli BL21 (DE3) for successful expression of a potent recombinant anti-RBD scFv, in the current study. This scFv has been recently designed by in-depth and comprehensive bioinformatics studies. Following, the potential of the purified scFv in the detection of whole viral particles was studied based on the designed sandwich ELISA (S-ELISA).
2. Materials and methods
2.1. Transformation
After cloning the gene cassette of the scFv construct into the pET28a vector, this vector was transformed into E. coli BL21 (DE3) competent cells (for expression studies) by the heat shock method according to Sambrook and Russel [16]. The inoculated plates with transformants of E. coli BL21 and control negative samples were incubated at 37 °C for 18–24 h s.
2.2. Plasmid extraction
One transformant colony was cultured in 10 ml LB broth medium at 37 °C, 220 rpm, overnight. The plasmid extraction was done using the Yekta-Tajhiz plasmid extraction kit according to the manufacturer's instructions. The extraction product was analyzed by 0.8% agarose in 0.5X TAE (Tris-Acetate-EDTA) buffer at 85 V for 90min.
2.3. Polymerase chain reaction (PCR)
At this stage, PCR was done for amplification of ∼280bp fragment and confirmation of the proper cloning of scFv construct into pET28a vector. For this, forward and reverse primers (Table 1 ) were designed using OligoAnalyzer v7.0 and analyzed by Primer-BLAST and oligoanalyzer servers. These primers were synthesized by the metaBion company.
Table 1.
The properties of forward and reverse primers.
| Name | Sequence (5′-3′) | Length | Tm | GC |
|---|---|---|---|---|
| Forward | TATCTCTACCCCGATGGACG | 20 | 67.8 | 55 |
| Reverse | AGAGAAACGGTCCGGAACAC | 20 | 69.6 | 55 |
The PCR was carried out in 20 μl volume containing: 2 μl DNA plasmid as a template, 10 μl of PCR Master Mix (Amplicon, 1.5 mM MgCl2), and 0.5 μl of each primer (10pM). The gene of interest was amplified using the following thermal cycling program: initial denaturation at 95 °C for 4min, followed by 30 cycles at 94 °C for 40sec, 55,60 °C for 30sec, 72 °C for 1min, with the final extension at 72 °C for 10min. The final products were analyzed with 1% agarose in 0.5X TAE buffer at 85 V for 75min.
2.4. Expression studies
Expression of the pET28a-scFv construct was performed in E. coli BL21 (DE3). Briefly, the transformed bacterium was cultured in Luria-Bertani (LB) broth (30 μg/ml kanamycin) and incubation was done at 37 °C, 220 rpm, overnight. Sub-culture was done at 1:50 (v/v) ratio in 100 ml of fresh LB broth medium (30 μg/ml kanamycin) and incubation was done under the above-mentioned conditions. When optical density at 600 nm (OD600) reached ∼0.8–0.9, 2 ml of culture was withdrawn as expression-control negative. Thereafter, the expression of the target protein was induced by the addition of isopropyl-β-d-Galactopyranoside (IPTG) (as an analog of allo-lactose for induction of lac promoter) at a final concentration of 0.5 and 1.0 mM [17]. The samples were incubated at 30 °C, 200 rpm. The expression time-course studies were performed in 2, 4, 6, 8, 15, and 24 h s. after the promoter induction. Finally, pellets were harvested by centrifugation of each sample at 7000 rpm, 10min at 22 °C, and were processed for further studies [18,19].
2.4.1. Total protein extraction
Following the centrifugation of all the above-mentioned samples, the gathered pellets were resuspended in protein sample buffer (5X) plus 2-mercapto ethanol according to the Laemmli (1970) protocol [16]. Based on the predicted molecular weight of scFv (∼30 kDa), the resolving and stacking SDS-PAGE gel concentration was selected as 14% and 4%, respectively. Electrophoresis was done in running buffer (25 mM Tris-base, 192 mM glycine, 1% SDS, pH 8.3; [CinnaGen Co., Tehran, Iran]) at 85 V for 2–3 h s. The gel was stained by staining solution (1% Coomassie blue R-250, [Merck, Darmstadt city, Germany]) and de-stained by 7% acetic acid (Merck, Darmstadt city, Germany); 5% methanol (Merck, Darmstadt city, Germany); 88% water solution. The molecular mass standard (CinnaGen Co., Tehran, Iran) was run in parallel with other samples in order to calculate the molecular weights of the proteins [20,21].
2.4.2. Periplasmic proteins extraction
At this stage, two methods were adopted and compared for the preparation of the periplasmic proteins: (1) the osmotic shock method, and (2) the sonication method.
-
1)
Generation of spheroplasts was done according to Abdolrasouli [22]. However, it should be noted that the presence of EDTA (as a chelating agent) in one buffer could interfere with the function of Ni2+-NTA resin in the purification stage. For this, as described later, the preferred method for the extraction of periplasmic proteins at the following stages was sonication.
-
2)
All samples were treated by lysis buffer (50% v/v) [20 mM Tris-Cl (pH 7.4), triton X-100 1% (w/v), 137 mM NaCl, 50 μM EDTA] for 30min on ice. Thereafter, pulse-sonication was performed for 5 1min (1min working and 1min resting) on the ice at 16–20% amplitude [23].
For inhibition of the possible proteases in extracted samples, 1.0 mM PMSF (phenyl methyl sulfonyl fluoride) was added to each sample as a protease inhibitor. The suspensions were incubated at room temperature for 1 h s. After centrifugation at 10000 rpm, 20min, and 4 °C, the soluble and insoluble fractions were analyzed using reducing SDS-PAGE as described before [17,24].
2.4.3. Determination of the protein solubility for downstream stages
It was so important to determine the best bacterial fraction for utilization in the purification stage. For this, in order to determine the distribution of the recombinant scFv between the soluble and insoluble fractions, the time-course studies were performed under the best IPTG concentration at 30 °C, 200 rpm, as described before. Both harvested fractions (pellet and supernatant) from each sample at the predefined intervals were analyzed using reducing SDS-PAGE [25].
2.5. Western blotting (WB)
The expression of the scFv construct was confirmed by the western blotting (immunoblotting) technique. In the current study, the nitrocellulose membrane was used for blotting and the wet blotter was applied for western blotting. Briefly, SDS-PAGE was done as described above without protein staining of the gel. Thereafter, the sandwich was assembled as follows in cathode→ anode direction: support pad → watman no. 1 filter paper→ SDS-PAGE gel → nitrocellulose membrane → watman no. 1 filter paper→ support pad. The blotting procedure was performed at 20 V for 2–3 h s. in presence of transfer buffer [25 mM Tris, 192 mM glycine, 20% (v/v) methanol, up to 1L double-distilled water, pH 8.3]. Following, the remaining protein-binding sites on the nitrocellulose membrane were blocked by 5% (w/v) skimmed milk powder in PBST buffer i.e., 1X phosphate-buffered saline [PBS: 6.4 g/L NaCl, 0.16 g/L KCl, 1.152 g/L Na2HPO4, 0.192 g/L KH2PO4, pH 7.2] plus 0.05% (v/v) tween 20. Blocking was done at 4 °C, overnight. Thereafter, washing was performed three times with PBST. In the following stage, the membrane was incubated by anti-poly histidine monoclonal antibody at 1:1000 in 1% (w/v) Bovine Serum Albumin (BSA)/PBST, for 2 h s. at room temperature. The washing was repeated and the 4-chloro-1-naphthol (4CN) (Merck, Darmstadt city, Germany) solution was added as the enzyme chromogen substrate. After incubation at room temperature in dark and appearing a purple precipitate of protein band, the reaction was stopped by tap water [26,27].
2.6. Protein purification
In the current study, Ni-NTA (Nitrilozceticacid) (QIAGEN, USA) resin was used for protein purification based on the presence of C-terminal poly His tag in the target scFv. This resin is cross-linked by Ni2+ which could selectively interact with poly-histidine residues on the recombinant proteins [23,28].
Briefly, the purification was performed in the native condition with equilibration, washing (plus 20 mM imidazole), and elution (plus 250 mM imidazole) buffers according to the manufacturer's instructions. It should be noted that a pH 7.5 was adopted as the best one for all buffers. All collected samples from various purification stages were analyzed using SDS-PAGE as described before. Moreover, protein concentration was measured by the Bradford method, and BSA (SIGMA-ALDRICH, St. Louis, USA) was used in 0–2.5 mg/ml as standard (Bradford reactant) [29].
2.7. Study on the efficiency of the scFv using sandwich ELISA
As a critical stage for the possible application of the synthesized recombinant scFv in diagnostic assays, the proper folding, function, and specificity of the purified scFv were determined using sandwich ELISA (S-ELISA). Moreover, for comparison and determining the necessity of strict purification strategies for large-scale industrial applications, the functionality of two other formats was also studied, i.e., the whole bacterial sample after 15 h s. of induction (as crude bacterial lysate) and the gathered supernatant from the treatment of the expression pellet with urea. After the Bradford assay, the ELISA microtiter plate (SPL life sciences, Gyeonggi-do, Korea, Republic) was coated with the 1–2 μg/well of these samples (as a capture antibody) in coating buffer (1.50 g/L Na2CO3, 2.93 g/L Na2HCO3 in 1000 ml distilled water, pH 8.0–8.2), and incubated at 4 °C, overnight. Thereafter, washing was performed three times with PBST buffer. The blocking was performed for 1 h with two blocking agents to select the best blocking agent for future applications: (1) 4% (w/v) skimmed milk powder (Merck, Darmstadt city, Germany) in PBS buffer at room temperature, and (2) 0.3% (v/v) tween 20 in PBS buffer at 37 °C. After three times washing with PBST, 20μg/well of the concentrated viral antigen with PEG:NaCl (30%:6.4% w/v) method was added to each well. Following the 1 h s. incubation at room temperature and three times washing with PBST, 100 μl of the secondary antibody (i.e., the COVID-19-positive human serum) was added to each well in 1:50 and 1:10 dilution, separately. It should be noted that for each coated sample, the two-control negatives were also applied i.e., COVID-19-negative human serum and PBS buffer. Then, the plate was incubated at room temperature for 2 h s. and washed with PBST. Horseradish peroxidase (HRP)-conjugated A+G antibody (100 μl) was added to each well in 1:2000 dilution in PBS buffer. After 2 h s. incubation at room temperature, reactions were developed by adding 60 μl of TMB (3, 3′, 5, 5′- tetramethyl benzidine) (IDvet, Grabels, France) as a substrate. Finally, the reactions were stopped by 2 M sulfuric acid (Merck, Darmstadt city, Germany). The absorbance at 450 nm was determined by an ELISA microtitre plate reader (AccuReader, Metertech Inc., Taipei, Taiwan) [19,28].
2.8. Statistical analysis
The gathered results of the ELISA stage were analyzed using SPSS software version 26.0 and their significance level was evaluated.
2.9. Ethics approval
This work was performed at the Shahid Chamran University of Ahvaz and the Ethical Committee of this institution has approved the work (Ethical code: EE/1400.3.02.25165/Scu.ac.ir).
3. Results
3.1. Transformation
After 18–24 h s. incubation at 37 °C, the results indicated the growth of transformed bacteria on the LB-agar medium (30 μg/ml kanamycin), whereas there was not any growth on the control negative medium (Data not shown). This indicates the successful ligation of the scFv construct to the pET28a vector and the successful transformation.
3.2. Plasmid extraction
Plasmid extraction results showed the typical distinct bands of circular plasmids on the agarose gel. It was expected that a band with ∼6190bp size was seen on the agarose but it should be noted that the observed difference is based on the fact that circular DNA (such as plasmid) has about 30% lower movement on agarose in comparison to a linear DNA (such as DNA ladder). So, it places in a higher position than anticipation (Fig. 1 ). Moreover, the investigation of its quality by nanodrop revealed its concentration as 83.2 ng/ml.
Fig. 1.

Plasmid extraction results. Lane 1: 1 kb DNA ladder; Lane 2: The extracted plasmid.
3.3. Polymerase chain reaction (PCR)
The insertion of the recombinant scFv gene into the expression plasmid was analyzed using specific PCR for ∼280bp fragment (Fig. 2 ).
Fig. 2.

PCR results. Lane 1: DNA ladder (1 Kb); Lane 2: Amplification at 55 °C; Lane 3: Amplification at 60 °C; Lane 4: Control negative.
3.4. Expression studies
The expression vector, pET28a, with the scFv gene positioned between the NcoI and BamHI RE site, was used for the generation of the transformants of E. coli BL21 (DE3). To obtain the target protein, the promoter was induced by the addition of 0.5 mM and 1 mM of IPTG, separately. All samples were run on 14% SDS-PAGE under reducing conditions to confirm the expression of scFv. The following figures indicate the total protein and periplasmic protein expression of E. coli BL21 (DE3) in a final concentration of 0.5 mM and 1 mM of IPTG.
As shown in Fig. 3, Fig. 4, Fig. 5 and judging from the presence of ∼30 kDa band in the two experiments, the expression was successful for both IPTG concentrations. However, the protein solubility was determined as follows to select the suitable fraction for the following stages.
Fig. 3.
Expression of total protein in (A) 0.5 mM, (B) 1 mM of IPTG. Lane 1: Protein marker (10–250 kDa), Lane 2: Expression after 0 h s. Lane 3: Expression after 2 h s. Lane 4: Expression after 4 h s. Lane 5: Expression after 6 h s. Lane 6: Expression after 8 h s. Lane 7: Expression after 15 h s. Lane 8: Expression after 24 h s. of induction. In each section, the right arrow shows the corresponding ∼30 kDa band of recombinant scFv.
Fig. 4.
Expression of periplasmic proteins in (A) 0.5 mM of IPTG: Lane 1: Expression after 0 h s. Lane 2: Protein marker (10–250 kDa), Lane 3: Expression after 2 h s. Lane 4: Expression after 4 h s. Lane 5: Expression after 6 h s. Lane 6: Expression after 8 h s. Lane 7: Expression after 15 h s. Lane 8: Expression after 24 h s. of induction (B) 1 mM of IPTG. Lane 1: Protein marker (10–250 kDa), Lane 2: Expression after 0 h s. Lane 3: Expression after 2 h s. Lane 4: Expression after 4 h s. Lane 5: Expression after 6 h s. Lane 6: Expression after 8 h s. Lane 7: Expression after 15 h s. Lane 8: Expression after 24 h s. of induction by osmotic shock protocol. In each section, the right arrow shows the corresponding ∼30 kDa band of recombinant scFv.
Fig. 5.
Expression of periplasmic proteins in (A) 0.5 mM of IPTG: Lane 1: Protein marker (10–250 kDa), Lane 2: expression after 24 h s. Lane 3: Expression after 15 h s. Lane 4: Expression after 8 h s. Lane 5: Expression after 6 h s. Lane 6: Expression after 4 h s. Lane 7: Expression after 2 h s. Lane 8: Expression after 0 h s. of induction (B) 1 mM of IPTG: Lane 1: Protein marker (10–250 kDa), Lane 2: Expression after 0 h s. Lane 3: Expression after 2 h s. Lane 4: Expression after 4 h s. Lane 5: Expression after 6 h s. Lane 6: Expression after 8 h s. Lane 7: Expression after 15 h s. Lane 8: Expression after 24 h s. of induction by sonication. In each section, the right arrow shows the corresponding ∼30 kDa band of recombinant scFv.
3.4.1. Determination of the protein solubility for downstream stages
Comparing the gathered results, transformants of E. coli BL21 expressed the recombinant scFv in both the soluble and insoluble fractions. However, it was observed that the most amount of scFv was present in the insoluble fraction after 15 h s. induction in presence of 1.0 mM IPTG (Fig. 6 ). With this regard, this fraction was selected for the following studies.
Fig. 6.
Determination the recombinant scFv solubility. (A) Lane 1: Protein marker (10–250 kDa), Lane 2: Supernatant, and Lane 3: Pellet after 0 h s. of induction, Lane 4: Supernatant, and Lane 5: Pellet after 2 h s. of induction, Lane 6: Supernatant, and Lane 7: Pellet after 4 h s. of induction, Lane 8: Supernatant, and Lane 9: Pellet after 6 h s. of induction, (B) Lane 1: Protein marker (10–250 kDa), Lane 2: Supernatant, and Lane 3: Pellet after 8 h s. of induction, Lane 4: Supernatant, and Lane 5: Pellet after 15 h s. of induction, Lane 6: Supernatant, and Lane 7: Pellet after 24 h s. of induction. In each section, the right arrow shows the corresponding ∼30 kDa band of recombinant scFv.
3.5. Western blotting
The purity and functionality of the target protein were detected by western blotting (Fig. 7 ). As it was shown, it was observed that conjugated anti-His-tag antibody specifically reacts with the recombinant scFv containing the poly-His tag and there are not any non-specific bands.
Fig. 7.
Western blotting of recombinant scFv. Lane 1: Protein marker (10–250 kDa), Lane 2: Pellet after 15 h s. of induction. The left arrow shows the corresponding ∼30 kDa band of recombinant scFv.
3.6. Protein purification
As it was said, the most amount of the recombinant scFv presented in the insoluble fraction. Accordingly, this fraction was solubilized in 7.0 M urea solution and utilized for further investigations. By utilization of various pHs (6.0, 7.0, 7.5, and 8.0) for the purification buffers, the procedure was followed by the best pH (7.5) (Data not shown). Finally, the purification using Ni2+-NTA resin resulted in a ∼30 kDa band (corresponding to the target scFv) on the 14% SDS-PAGE gel with a relatively high purity (Fig. 8 ). This purity was suitable for the following studies.
Fig. 8.
Purification of the recombinant scFv. (A) Lane 1: Protein marker (10–250 kDa), Lane 2: Flow through sample, Lane 3: Washing 1 sample, Lane 4: Washing 2 sample, Lane 5: Elution 1 sample, Lane 6: Elution 2 sample, Lane 7: Wash-final sample. The right arrow shows the corresponding ∼30 kDa band of recombinant scFv.
Moreover, the protein concentration was calculated based on the Bradford assay as in the previous stages. Accordingly, the amount of the purified scFv was calculated as 3.40 g/L. It should be noted that the cost for production of this scFv was evaluated as 1.00 mg/ml/0.145$ (including the costs of the recombinant construct synthesis for its use alongside all stages of the present work and future studies). On the other hand, the lower costs (e.g., culture media ingredients, growth requirements, inexpensive and accessible laboratory instruments, etc.), and the required time for the recombinant protein expression by E. coli, are also comparable with the other expressing platforms (especially hybridoma technology and the mammalian expression systems).
3.7. Study on the efficiency of the purified scFv via S-ELISA
To provide some evidence about the correct folding and functionality of the purified scFv, the S-ELISA assay was performed as described before. The specific binding capacity and high affinity of the crude and purified scFv were confirmed by the ELISA assay for both blocking agents (i.e., skimmed milk and tween 20). However, as it could be observed, the results showed a slightly better reaction with skimmed milk than with the tween 20 blocking agent (Fig. 9 ). On the other hand, both negative controls did not show any positive reaction. These results indicated the good sensitivity of synthetic recombinant scFv in the detection of SARS-CoV-2 whole particles.
Fig. 9.
Graphical representation of ELISA results. Reactivity of recombinant scFv in various forms to COVID positive serums in presence of two blocking agents: (A) Tween 20 blocker, (B) Skimmed milk blocker.
However, the statistical analysis did not show a significant difference between the purified and crude protein formats (P > 0.05).
4. Discussion
Based on the International Committee on Taxonomy of Viruses (ICTV), the SARS-CoV-2 belongs to the beta genus of coronaviruses. The coronaviruses belong to the Othocoronavirinae sub-family, Coronaviridae family, Coronavirinae sub-order, and Nidovirales order. This family infects the respiratory tract of humans, other mammalians, and birds, and thus they are not only important for public health but also may cause economical and veterinary issues [[30], [31], [32], [33]].
Like other coronaviruses, the genome of SARS-CoV-2 has at least 10 open-reading frames (ORFs) which encode 16 non-structural proteins (nsp) and accessory proteins (ORF3a, ORF6, ORF7a,b, ORF8, ORF10). Among these, some ORFs encode the four main structural proteins: The spike (S), The envelope (E), The nucleocapsid (N), and the membrane (M). These structural proteins are necessary for virion assembly and CoV infection [30,[34], [35], [36], [37], [38], [39]].
The spike glycoprotein is a key mediator for the infection of target cells by SARS-CoV-2. It is the main determinant of virus neutralization. This protein consists of S1 and S2 functional subunits which could be proteolytically cleaved. The RBD region of the spike is located within the S1 subunit. This domain interacts with the angiotensin-converting enzyme-2 (ACE-2) receptor located on the target host cells to enter them. It is a mediator of membrane fusion and receptor binding; therefore, it determines the pathogenicity and tropism to the host cells. This domain could be targeted by neutralizing antibodies (nAbs) for the prevention of virus particles entering [1,38,40].
With this regard, the development of diagnostics and therapeutics tools has rapidly grown with unprecedented race as the greatest combat against the SARS-CoV-2 outbreak. For example, there are 40 approved vaccines and 217 vaccine candidates by July 6, 2020 in the prophylactic field (http://covid19.trackvaccines.org). Previous studies reported many recombinant antibodies against the different proteins of SARS-CoV-2. Among this, much evidence showed the high efficiency of vaccines targeting the spike protein because the mutations in the spike gene highly impress the virus virulence and pathogenesis. On the other hand, the RBD could generate a similar immune response and protection in comparison to the whole spike. Accordingly, various prophylactic and therapeutic agents have been developed based on this domain. Among these, the nAbs have attracted the most attention, recently. This is due to the fact that nAbs address the high concerns about the possible effects of antibody-dependent enhancement (ADE) of disease or infection, which could be raised by the non-neutralizing antibodies [31,37,[40], [41], [42]].
Recently, advancements in recombinant antibody production based on bioinformatics studies, have attracted the most attention. Moreover, in contrast to several limitations of whole antibody production in E. coli (e.g., inability to glycosylation, lower production yields, proper folding problems, etc.), other fragments such as Fab and scFv produce faster and easier in bacterial expression platforms [3,13]. In this regard, we used a cross-reactive anti-RBD scFv which was produced based on the comprehensive in-silico and bioinformatics studies. This scFv was successfully expressed in both the soluble and insoluble forms and its efficiency against the SARS-CoV-2 particles was evaluated.
Many factors affect the successful expression of recombinant proteins including a suitable host with a compatible expressing system, an expression vector, precise codon optimization, etc.
Several traditional platforms have been used for the production of recombinant proteins (e.g., antibodies) such as hybridoma technology [33,43,44], mammalian expression systems [9,45,46], transgenic animal and plant cells [9,[47], [48], [49], [50]], insect cells [51,52], phage display technology [53,54]. These systems have their potential advantages and limitations. As a frequently used platform in the generation of monoclonal antibodies (mAbs), hybridoma cell cultures have various disadvantages including the high costs for recombinant protein production, time-consuming processes, etc. In this regard, many types of research have been coordinated for the utilization of cheap and efficient bacterial expression systems, recently. In the current study, we successfully expressed the recombinant scFv with a relatively high yield and efficiency in E. coli BL21 (DE3). Many types of research are in accordance with our study [3,13,14,[55], [56], [57]]. As it was noted previously, the evaluated cost for the production of 1 mg scFv/ml was 0.145$ in this study. In some studies, the relatively high production costs in different expression systems (i.e., yeast, and mammalian cells) have been reported in comparison to the E. coli expression platform. For example, Lebozec et al. (2018) conducted studies in fed-batch conditions using these three platforms for the production of a humanized Fab fragment ACT017. They reported the following costs for each system: 49,616$ for 7.0 g/L protein production using E. coli, 54,989$ for 1.8 g/L protein production using Pichia pastoris, and 144,534$ for 1.0 g/L protein production using CHO cell line, during 42 h s., 108 h s., and 10 days, respectively [58]. These results are comparable with the present study in terms of production costs, cultivation time, and volumetric productivity.
As another important factor in expression studies, the pET system family consists of advanced and powerful vectors that have been developed in the field of cloning and expression in E. coli. In this system, the protein-coding sequence is located downstream of a T7 promoter (a strong bacteriophage transcription signal) [59]. Moreover, the 6x-HisTag sequence is inserted at the N-terminal of the recombinant protein coding sequence for the following purification stages [15]. According to these advantages, these vectors have been used in the current study and various studies with different purposes including Rostami et al. (2013) [56], Rouhani Nejad et al. (2017) [60], Zhang et al. (2018) [13], Khobbakht et al., 2018 [15], Roghanian et al., 2019 [25], Alizadeh et al. (2019) [61].
As the important disease management measures, emerging detection tests have high importance. Moreover, it is important to develop accurate, rapid, and sensitive diagnostics for efficient control of any infectious agent. Accordingly, there are two approaches to the diagnosis of COVID-19 infections including clinical approaches and in-vitro diagnostic platforms (i.e., nucleic acid amplification tests (NAAT) and antibody/or antigen-based serological assays [e.g., ELISA]). While RT-PCR has been introduced as a gold standard for the diagnosis of SARS-CoV-2, NAAT has its own drawbacks as a detective tool for SARS-CoV-2 infection. Accordingly, it is so important to develop rapid, accurate, and sensitive immune-based diagnostics to combat emerging infectious agents [8,17,[62], [63], [64]].
In contrast to NAAT approaches in the field of detection and tracking the evolution of SARS-CoV-2, the immune and antibody-based ones could be used for epidemiological investigations [63]. Among these, ELISA could detect the whole virus/its sub-particles or detect antiviral antibodies in serum samples. As an antibody-based diagnostic tool, the sandwich ELISA (S-ELISA) attract high attention in recent years [17]. This platform recommends high specificity and sensitivity for the detection of antigens and reduces the rate of false-positive results [64]. In this regard, this technique has been widely used for the detection of various infections including Foot-and-Mouth Disease (FMD) [62], and SARS-CoV [65].
For its importance, the S-ELISA was designed in the present study and the results showed the good reactivity of the purified and unpurified recombinant scFv. Since it was confirmed elsewhere (data is under publication) that this recombinant immunoinformatics-based scFv is a nAb rather than a binding antibody (bAbs), these results could point out its importance. This is in contrast to the results by Chan et al. [17] which reported more efficiency of natural Fab libraries over the synthetic scFv for utilization as a capture antibody in the capture ELISA kit [17]. This technique has also been used to confirm the potency of recombinant antibodies such as Alibeiki et al. [23].
Besides the diagnostic value of recombinant/isolated antibodies, these products could also be used for therapeutic purposes. This ability was reported with the comparison of the efficiency of two different combination products in treatments of mild-to-moderate COVID-19 patients, i.e., casirivimab plus imdevimab (antibodies targeting non-overlapping epitopes of the RBD), and bamlaniviman plus etesevimab (two mAbs which react with overlapping epitopes in the spike RBD region) [66].
5. Conclusion
Herein, we reported the successful expression of a potent recombinant scFv which was designed by third-generation technology (in-silico methods). Moreover, the expression of recombinant scFv was studied using pET28a (as an expressing vector harboring the efficient T7 promoter) and E. coli BL21 (DE3) (as a heterologous host). The SDS-PAGE and western blotting analysis showed the presence and its successful expression in both soluble and insoluble fractions. According to the good expression and the purification yield on one hand, and the potent in-vitro reaction, on the other hand, it is possible that this scFv could introduce to the diagnostics and may be utilized as a potent nAb. Moreover, it could be utilized as a complementary tool for the RT-PCR detection approach which is being used as a gold standard.
Author statement
Fatemeh Yaghoobizadeh: The conceptualization, Methodology, Data curation, Formal analysis, Validation, Investigation, Resources, Writing-original draft/ Writing- review & editing, Project administration
Mohammad Roayaei Ardakani: The conceptualization, Methodology, Data curation, Formal analysis, Validation, Resources, Supervision, Writing-original draft/ Writing- review & editing, Funding acquisition
Mohammad Mehdi Ranjbar: The conceptualization, Data curation, Methodology, Formal analysis, Validation, Resources, Supervision, Writing-original draft/ Writing- review & editing
Hamid Galehdari: The conceptualization, Data curation, Formal analysis, Resources
Mohammad Khosravi: The conceptualization, Data curation, Formal analysis, Resources
Funding
This work was supported by the Center for International Scientific Studies & Collaboration (CISSC), Ministry of Science Research and Technology, Iran.
Declaration of competing interest
The authors declare there are no competing interests.
Acknowledgments
We thank Dr. Majid Esmaeilizad (Research and Development Department, Razi Vaccine and Serum Research Institute, Iran) for his valuable guidance.
Data availability
Data will be made available on request.
References
- 1.McCallum M., Bassai J., De Marco A., Chen A., Walls A.C., Di Iulio J., Tortorici M.A., Navarro M.J., Silacci-Fregni C., Saliba C., Sprouse K.R., Agostini M., Pinto D., Culap K., Bianchi S., Janoni S., Cameroni E., Bowen J.E., Tilles S.W., Pizzuto M.S., Guastalla S.B., Bona G., Pellanda A.F., Garzoni C., Voorhis W.C.V., Rosen L.E., Snell G., Telenti A., Virgin H.W., Piccoli L., Corti D., Veesler D. SARS-CoV-2 immune evasion by the B.1.427/B.1.429 variant of concern. Science. 2021;373(6555):648–654. doi: 10.1126/science.abi7994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Park Y.S. Thrombosis and severe acute respiratory syndrome coronavirus 2 vaccines: vaccine-induced immune thrombotic thrombocytopenia. Clin. Exp. Pediatr. 2021;64(8):400–405. doi: 10.3345/cep.2021.00717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Golchin M. Faculty of Biomedical and Life Science, University of Glasgow; 2004. Recombinant Antibodies against the K99 Colonisation Factor of E. coli. Ph.D. Dissertation, Division of Infection and Immunity. [Google Scholar]
- 4.Kaplon H., Chenoweth A., Crescioli S., Reichert J.M. Antibodies to watch in 2022. mAbs. 2022;14:1. doi: 10.1080/19420862.2021.2014296. 2014296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kim D.J., Chung J.H., Ryu Y.S., Rhim J.H., Kim C.W., Suh Y., Chung H.K. Production and characterization of a recombinant scFv reactive with human gastrointestinal carcinomas. Br. J. Cancer. 2002;87:405–413. doi: 10.1038/sj.bjc.6600365. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Singh N., Villoutreix B.O. Resources and computational strategies to advance small molecule SARS-CoV-2 discovery: lessons from the pandemic and preparing for future health crises. Comput. Struct. Biotechnol. J. 2021;19:2537–2548. doi: 10.1016/j.csbj.2021.04.059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zhang L., Cao Y., Liu M., Chen X., Xiang Q., Tian J. Functional recombinant single chain variable fragment antibody against Agkistrodon acutus venom. Exp. Ther. Med. 2019;17:3768–3774. doi: 10.3892/etm.2019.7348. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Antoine D., Mohammadi M., Vitt M., Dickie M., Jyoti S.S., Tilbury M.A., Johnson P.A., Wawrousek K.E., Wall J.G. Rapid, Point-of-Care scFv-SERS assay for femtogram level detection of SARS-CoV-2. ACS Sens. 2022;7:866–873. doi: 10.1021/acssensors.1c02664. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Frenzel A., Hust M., Schirrmann T. Expression of recombinant antibodies. Front. Microbiol. 2013;4(217) doi: 10.3389/fimmu.2013.00217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sandomenico A., Sivaccumar J.P., Ruvo M. Evolution of Escherichia coli expression system in producing antibody recombinant fragments. Int. J. Mol. Sci. 2020;21(17):6324. doi: 10.3390/ijms21176324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Socol C.T., Trif M., Criste F.L., Mierliţă D., Şonea C.G., Rusu A.V. Optimization of expression and purification of recombinant protein in E. coli based on a leptin model. Rom. Biotechnol. Lett. 2020;25(4):1810–1815. doi: 10.25083/rbl/25.4/1810.1815. [DOI] [Google Scholar]
- 12.Karyolaimos A., Ampah-Korsah H., Hillenaar T., Mestre Borras A., Dolata K.M., Sievers S., Riedel K., Daniels R., de Gier J.-W. Enhancing recombinant protein yields in the E. coli periplasm by combining signal peptide and production rate screening. Front. Microbiol. 2019;10:1511. doi: 10.3389/fmicb.2019.01511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zhang W., Lu J., Zhang S., Liu L., Pang X., Lv J. Development an effective system to expression recombinant protein in E. coli via comparison and optimization of signal peptides: expression of Pseudomonas fluorescens BJ-10 thermostable lipase as case study. Microb. Cell Factories. 2018;17(1):50. doi: 10.1186/s12934-018-0894-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Baugmarten T., Ytterberg J., Zubarev R.A., de Gier J.W. Optimizing recombinant protein production in the E. coli periplasm alleviates stress. Appl. Environ. Microbiol. 2018 doi: 10.1128/AEM.00270-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Khobbakht D., Amani J., Zare S., NourMohammadi Z. Cloning and the evaluation of gene expression and purification of gene encoding recombinant protein containing binding subunit of coli surface antigens CS1 and CS2 from enterotoxigenic Escherichia coli. J. Fasa Univ. Med. Sci. 2018;8(4):1025–1035. [Google Scholar]
- 16.Sambrook J., Russel D.W. Cold Spring Harbor Laboratory; New York. USA.: 2001. Molecular Cloning, a Laboratory Manual. [Google Scholar]
- 17.Chan C.E.Z., Chan A.H.Y., Lim A.P.C., Hanson B.J. Comparison of the efficiency of antibody selection from semi-synthetic scFv and non-immune Fab phage display libraries against protein targets for rapid development of diagnostic immunoassays. J. Immunol. Methods. 2011;373(1–2):79–88. doi: 10.1016/j.jim.2011.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.He K., Wei F., Zhang X., Li J., Zhang D., Wei D. Production and characterization of a single-chain Fv antibody–alkaline phosphatase fusion protein specific for ampicillin. Food Agric. Immunol. 2019;30(1):1–12. doi: 10.1080/09540105.2018.1540550. [DOI] [Google Scholar]
- 19.Shahmirzaie M., Safarnejad M.R., Rakhshandehroo F., Safarpour H., Hosseini Shirazi F., Zamanizadeh H.R., Elbeaino T. Generation and molecular docking analysis of specific single-chain variable fragments selected by phage display against the recombinant nucleocapsid protein of fig mosaic virus. J. Virol. Methods. 2019;276 doi: 10.1016/j.jviromet.2019.113796. [DOI] [PubMed] [Google Scholar]
- 20.Gharibi D., Khosravi M., Hosseini Z., Boroun F., Barzegar K., Foroughi-Far A. Antibacterial effects of aloe vera extracts on some human and animal bacterial pathogens. J. Med. Microbiol. Infect. Dis. 2015;3(1–2):6–10. [Google Scholar]
- 21.Khosravi M., Mayahi M., Kaviani F., Nemati M. The effects of isolated fractions of Mesobuthuseupeus scorpion venom on humoral immune response. J. Arthropod. Borne Dis. 2017;11(4):497–503. [PMC free article] [PubMed] [Google Scholar]
- 22.Abdolrasouli N. Payam Nur university; 2012. Study on the Expression of Alpha 2b Interferon in E. coli Expression System. [Dissertation] ([In Persian]) [Google Scholar]
- 23.Alibeiki M., Golchin M., Tabatabaei M. Development of a double-recombinant antibody sandwich ELISA for quantitative detection of epsilon toxoid concentration in inactivated Clostridium perfringens vaccines. BMC Vet. Res. 2020;16:361. doi: 10.1186/s12917-020-02572-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Roayaei M., Galehdari H. Cloning and expression of Thermus aquaticus DNA polymerase in Escherichia coli. Jundishapur J. Microbiol. 2008;1(1):1–5. [Google Scholar]
- 25.Roghanian P., Amani J., Zare S., Nour Mohammadi Z. Design, construction, expression and purification of the gene encoding chimeric cfae, cotd protein, from enterotoxigenic Escherichia coli. J. Arak Uni. Med. Sci. 2019;22(1):96–107. [Google Scholar]
- 26.Hay F.C., Westwood O.M.R., Nelson P.N. fourth ed. Blackwell Science Ltd; 2002. Practical Immunology. [Google Scholar]
- 27.Petrus M.L.C., Kiefer L.A., Puri P., Heemskerk E., Seaman M.S., Barouch D.H., et al. A microbial expression system for high-level production of scFv HIV-neutralizing antibody fragments in Escherichia coli. Appl. Microbiol. Biotechnol. 2019;103(21–22):8875–8888. doi: 10.1007/s00253-019-10145-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Asiabanha-Rezaee M. Tarbiat Modares University; 2016. Production of Monoclonal Antibodies against Cardiac Troponin I Marker (cTnI) and Development of Immunostrip Assay Based Gold Nanoparticle for Clinical Diagnosis in Human Serum. [Dissertation] ([In Persian]) [Google Scholar]
- 29.MehrAzin H., Honari H., Saadati M., Alizadeh H., Nazarian Sh. Production of polyclonal antibody against domain 4 of protective antigen of Bacillus anthracis in laboratory animals. Passive Defence Sci. Technol. 2011;3:19–25. ([In Persian]) [Google Scholar]
- 30.Chen Y., Liu Q., Guo D. Emerging coronaviruses: genome structure, replication, and pathogenesis. J. Med. Virol. 2020;92:418–423. doi: 10.1002/jmv.25681. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Chukwudozie O.S., Duru V.C., Ndiribe C.C., Aborode A.T., Oyebanji V.O., Emikpe B.O. The relevance of bioinformatics applications in the discovery of vaccine candidates and potential drugs for COVID-19 treatment. Bioinf. Biol. Insights. 2021;15:1–8. doi: 10.1177/11779322211002168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.V'Kovski P., Kratzel A., Steiner S., Stadler H., Thiel V. Coronavirus biology and replication: implications for SARS- CoV-2. Nat. Rev. Microbiol. 2020;9:155–170. doi: 10.1038/s41579-020-00468-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wang N., Shang J., Jiang S., Du L. Subunit vaccines against emerging pathogenic human coronaviruses. Front. Microbiol. 2020;11:298. doi: 10.3389/fmicb.2020.00298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Durmaz B., Abdulmajed O., Durmaz R. Mutations observed in the SARS-CoV-2 spike glycoprotein and their effects in the interaction of virus with ACE-2 receptor. Medeni. Med. J. 2020;35:253–260. doi: 10.5222/MMJ.2020.98048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Liu W., Liu L., Kou G., Zheng Y., Ding Y., Ni W., Wang Q., Tan L., Wu W., Tang S., Xiong Z., Zheng S. Evaluation of nucleocapsid and spike protein-based ELISAs for detecting antibodies against SARS-CoV-2. J. Clin. Microbiol. 2020;58(6):20. doi: 10.1128/JCM.00461-20. e00461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Parray H.A., Chiranjivi A.K., Asthana S., Yadav N., Shrivastava T., Mani S., Sharma C., Vishwakarma P., Das S., Pindari K., Sinha S., Samal S., Ahmed S., Kumar R. Identification of an anti-SARS-CoV-2 receptor binding domain directed human monoclonal antibody from a naïve semi-synthetic library. J. Biol. Chem. 2020;295(36):12814–12821. doi: 10.1074/jbc.AC120.014918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Rehman H.M., Mirza M.U., Ahmad M.A., Saleem M., Froeyen M., Ahmad S., Gul R., Aslam M.S., Sajjad M., Bhinder M.H. A putative prophylactic solution for COVID-19: development of novel multiepitope vaccine candidate against SARS‐COV‐2 by comprehensive immunoinformatic and molecular modelling approach. Biology. 2020;9(9):296. doi: 10.20944/preprints202003.0242.v1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Tian X., Li C., Huang A., Xia S., Lu S., Shi Z., Lu L., Jiang S., Yang Z., Wu Y., Ying T. Potent binding of 2019 novel coronavirus spike protein by a SARS coronavirus-specific human monoclonal antibody. Emerg. Microb. Infect. 2020;9(1):382–385. doi: 10.1080/22221751.2020.1729069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Li X., Geng M., Peng Y., Meng L., Lu S. Molecular immune pathogenesis and diagnosis of COVID-19. J. Pharm. Anal. 2020;10(2):102–108. doi: 10.1016/j.jpha.2020.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Jegouic S.M., Loureiro S., Thom M., Paliwal D., Jones I.M. Recombinant SARS-CoV-2 spike proteins for sero-surveillance and epitope mapping. bioRxiv. 2020 doi: 10.1101/2020.05.21.109298. [DOI] [Google Scholar]
- 41.Walls A.C., Park Y.J., Tortorici M.A., Wall A., McGuire A.T., Veesler D. Structure, function and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 2020;181(2):281–292. doi: 10.1101/2020.02.19.956581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wu Y., Huang X., Yuan L., Wang S., Zhang Y., Xiong H., Chen R., Ma J., Qi R., Nie M., Xu J., Zhang Z., Chen L., Wei M., Zhou M., Cai M., Shi Y., Zhang L., Yu H., Hong J., Wang Z., Hong Y., Yue M., Li Z., Chen D., Zheng Q., Li S., Chen Y., Cheng T., Zhang J., Zhang T., Zhu H., Zhao Q., Yuan Q., Guan Y., Zia N. A recombinant spike protein subunit vaccine confers protective immunity against SARS-CoV-2 infection and transmission in hamsters. Sci. Transl. Med. 2021 doi: 10.1126/scitranslmed.abg1143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Monzavi-Karbassi B., Kieber-Emmons T. Current concepts in cancer vaccine strategies. Biotechniques. 2001;30(1):170–176. doi: 10.2144/01301dd02. [DOI] [PubMed] [Google Scholar]
- 44.Xiong H.L., Wu J.T., Cao J.L., Yang R., Ma J., Qiao X.Y., Yao X.Y., Zhang B.H., Zhang Y.L., Hou W.H., Shi Y., Xu J.J., Zhang L., Wang S.J., Fu B.R., Yang T., Ge S.X., Zhang J., Yuan Q., Huang B.Y., Li Z.Y., Zhang T.Y., Xia N.S. Robust neutralization assay based on SARS-CoV-2 S-bearing vesicular stomatitis virus (VSV) pseudovirus and ACE2-overexpressed BHK21 cells. Emerg. Microb. Infect. 2020;9(1):2105–2113. doi: 10.1080/22221751.2020.1815589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Jones D., Kroos N., Anema R., van Montfort B., Vooys A., van der Kraats S. High-level expression of recombinant IgG in the human cell line per. c6. Biotechnol. Prog. 2003;19(1):163–168. doi: 10.1021/bp025574h. [DOI] [PubMed] [Google Scholar]
- 46.Wurm F.M. Production of recombinant protein therapeutics in cultivated mammalian cells. Nat. Biotechnol. 2004;22:1393–1398. doi: 10.1038/nbt1026. [DOI] [PubMed] [Google Scholar]
- 47.Amian A.A., Papenbrock J., Jacobsen H.-J., Hassan F. Enhancing transgenic pea (Pisum sativum L.) resistance against fungal diseases through stacking of two antifungal genes (chitinase and glucanase) GM Crops. 2011;2(2):104–109. doi: 10.4161/gmcr.2.2.16125. [DOI] [PubMed] [Google Scholar]
- 48.Flisikowska T., Thorey I.S., Offner S., Ros F., Lifke V., Zeitler B. Efficient immunoglobulin gene disruption and targeted replacement in rabbit using zinc finger nucleases. PLoS One. 2011;(6):6. doi: 10.1371/journal.pone.0021045. e21045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Kuroiwa Y., Kasinathan P., Matsushita H., Sathiyaselan J., Sullivan E.J., Kakitani M. Sequential targeting of the genes encoding immunoglobulin-muandprion protein in cattle. Nat. Genet. 2004;36(7):775–780. doi: 10.1038/ng1373. [DOI] [PubMed] [Google Scholar]
- 50.McCormick A.A., Reddy S., Reinl S.J., Cameron T.I., Czerwinkski D.K., Vojdani F. Plant-produced idiotype vaccines for the treatment of non-Hodgkin’s lymphoma: safety and immunogenicity in a phase I clinical study. Proc. Natl. Acad. Sci. U.S.A. 2008;105(29):10131–10136. doi: 10.1073/pnas.0803636105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Gouveia R., Kandzia S., Conradt H.S., Costa J. Production and N-glycosylation of recombinant human cell adhesion molecule L1 from insect cells using the stable expression system. Effect of dimethyl sulfoxide. J. Biotechnol. 2010;145(2):130–138. doi: 10.1016/j.jbiotec.2009.10.018. [DOI] [PubMed] [Google Scholar]
- 52.Fernandes F., Vidigal J., Dias M.M., Prather K.L., Coroadinha A.S. Flipase-mediated cassette exchange in Sf9 insect cells for stable gene expression. Biotechnol. Bioeng. 2012;109(11):2836–2844. doi: 10.1002/bit.24542. [DOI] [PubMed] [Google Scholar]
- 53.Wrapp D., De Vlieger D., Corbett K.S., Torres G.M., Wang N., Van Breedam W., Roose K., van Schie L., Team V.-C.C.-R., Hoffmann M., Pohlmann S., Graham B.S., Callewaert N., Schepens B., Saelens X., McLellan J.S. Structural basis for potent neutralization of betacoronaviruses by single-domain camelid antibodies. Cell. 2020;181(5):1004. doi: 10.1016/j.cell.2020.04.031. 1015e1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Zeng X., Lingfang L., Jing L., Xinlei L., Liu B., Kong Y., Zeng S., Du J., Xiao H., Zhang T., Zhang S., Liu J. Isolation of a human monoclonal antibody specific for the receptor binding domain of SARS-CoV-2 using a competitive phage biopanning strategy. Antib. Ther. 2020;3(2):95–100. doi: 10.1093/abt/tbaa008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Mesri R., Esmailizad M., Ahmadzadeh M., Mohammadi S., Angaji S.A., Yazdanpour Z., Mirhaghgo Jalali F. Cloning of linear T-cell epitopes of EG95 antigen of Echinococcus granulosus into pGEX4t1 vector and expression analysis by SDS-PAGE. J. Fasa Univ. Med. Sci. 2016;6(3):311–318. [Google Scholar]
- 56.Rostami H., Moosavi S.J., Ebrahimi F., Hajizadeh A. Cloning and expression of the catalytic domain of botulinum neurotoxin type E in E. coli. J. Maz. Univ. Med. Sci. 2013;23(97):148–157. ([In Persian]) [Google Scholar]
- 57.Sato M., Kitani H., Kojima K. Development and validation of scFv-conjugated affinity silk protein for specific detection of carcinoembryonic antigen. Sci. Rep. 2017;7(1) doi: 10.1038/s41598-017-16277-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Lebozec K., Jandrot-Perrus M., Avenard G., Favre-Bulle O., Billiald P. Quality and cost assessment of a recombinant antibody fragment produced from mammalian, yeast and prokaryotic host cells: a case study prior to pharmaceutical development. N. Biotech. 2018;44:31–40. doi: 10.1016/j.nbt.2018.04.006. [DOI] [PubMed] [Google Scholar]
- 59.pET System Manual 11th Edition. Novagen®. User protocol TB055.
- 60.Rouhani Nejad H., Yari S., Deldar A.A., Hamidi A.A. Cloning and expression of human growth hormone gene by thioredoxin tag. Journal of Cell & Tissue. 2017;7(4):399–405. [Google Scholar]
- 61.Alizadeh R., Kardani N., Khodakarami A., Khajeh Kh, Dabirmanesh B. Cloning, expression and characterization of carboxypeptidase G2 enzyme from Pseudomonas sp. strain RS-16 in E. coli. Razi J. Med. Sci. 2019;26(10):8–18. [Google Scholar]
- 62.Khan S., Ali Shah S.A., Jamal S.M. Evaluation of sandwich enzyme-linked immunosorbent assay and reverse transcription polymerase chain reaction for the diagnosis of foot-and-mouth disease. Intervirology. 2021;64(4):209–214. doi: 10.1159/000517003. [DOI] [PubMed] [Google Scholar]
- 63.Mardian Y., Kosasih H., Karyana M., Neal A., Lau C.Y. Review of current COVID-19 diagnostics and opportunities for further development. Front. Med. 2021;8 doi: 10.3389/fmed.2021.615099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Svobodova M., Skouridou V., Jauset-Rubio M., Vieitez I., Fernandez-Villar A., Alvargonzalez J.J.C., Poveda E., Bofill C.B., Sans T., Bashammakh A., Alyoubi A.O., O'Sullivan C.K. Aptamer sandwich assay for the detection of SARS-CoV-2 spike protein antigen. ACS Omega. 2021;6(51) doi: 10.1021/acsomega.1c05521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Yu F., Le M.Q., Inoue S., Hasebe F., Parquet M.C., Morikawa S., Morita K. Recombinant truncated nucleocapsid protein as antigen in a novel immunoglobulin M Capture Enzyme-Linked Immunosorbent assay for diagnosis of Severe Acute Respiratory Syndrome coronavirus infection. Clin. Vaccine Immunol. 2007;14(2):146–149. doi: 10.1128/CVI.00360-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Bayarri-Olmos R., Idorn M., Rosbjerg A., Perez-Alos L., Bo Hansen C., Johnsen L.B., Helgstrand C., Zosel F., Bjelke J.R., Oberg F.K., Sogaard M., Paludan S.R., Bak-Thomsen T., Jardine J.G., Skjoedt M.O., Garred P. SARS-CoV-2 neutralizing antibody responses towards full-length spike protein and the receptor-binding domain. J. Immunol. Res. 2021;207(3):878–887. doi: 10.4049/jimmunol.2100272. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be made available on request.







