Skip to main content
NCBI home page
American Journal of Physiology - Cell Physiology logoLink to American Journal of Physiology - Cell Physiology
. 2022 Nov 7;323(6):C1664–C1680. doi: 10.1152/ajpcell.00458.2022

Tumor necrosis factor α impedes colonic thiamin pyrophosphate and free thiamin uptake: involvement of JNK/ERK1/2-mediated pathways

Selvaraj Anthonymuthu 1, Subrata Sabui 1,2,5, Alaullah Sheikh 3, James M Fleckenstein 3,4, Hamid M Said 1,2,5,✉
PMCID: PMC9744649  PMID: 36342158

graphic file with name c-00458-2022r01.jpg

Open in a new tab

Keywords: colonic uptake, free thiamin, human differentiated colonoid monolayers, thiamin pyrophosphate, TNFα

Abstract

The aim of this study was to examine the effect of TNFα (i.e., a predominant proinflammatory cytokine produced during chronic gut inflammation) on colonic uptake of thiamin pyrophosphate (TPP) and free thiamin, forms of vitamin B1 that are produced by the gut microbiota and are absorbed via distinct carrier-mediated systems. We utilized human-derived colonic epithelial CCD841 and NCM460 cells, human differentiated colonoid monolayers, and mouse intact colonic tissue preparations together with an array of cellular/molecular approaches in our investigation. The results showed that exposure of colonic epithelial cells to TNFα leads to a significant inhibition in TPP and free thiamin uptake. This inhibition was associated with: 1) a significant suppression in the level of expression of the colonic TPP transporter (cTPPT; encoded by SLC44A4), as well as thiamin transporters-1 & 2 (THTR-1 & -2; encoded by SLC19A2 & SLC19A3, respectively); 2) marked inhibition in activity of the SLC44A4, SLC19A2, and SLC19A3 promoters; and 3) significant suppression in level of expression of nuclear factors that are needed for activity of these promoters (i.e., CREB-1, Elf-3, NF-1A, SP-1). Furthermore, the inhibitory effects were found to be mediated via JNK and ERK1/2 signaling pathways. We also examined the level of expression of cTPPT and THTR-1 & -2 in colonic tissues of patients with active ulcerative colitis and found the levels to be significantly lower than in healthy controls. These findings demonstrate that exposure of colonocytes to TNFα suppresses TPP and free thiamin uptake at the transcriptional level via JNK- and Erk1/2-mediated pathways.

INTRODUCTION

Vitamin B1 (thiamin; also known as the “energy vitamin”) is essential for normal health and physiology of all mammals. In its active and predominant form, i.e., thiamin pyrophosphate (TPP), the micronutrient serves as a cofactor for enzymes that play important roles in a variety of critical cellular metabolic reactions including oxidative-energy metabolism, ATP production, and reduction of oxidative stress (1); it also has anti-inflammatory effects (2). Thus, it is not surprising that deficiency of vitamin B1 at the cellular level leads to impairment in a variety of metabolic activities including energy metabolism/ATP production, oxidative stress, and disturbances in the function/structure of mitochondria, an organelle that contains/utilizes the majority (∼90%) of TPP in cells (3–5). At the systemic level, vitamin B1 deficiency leads to neurological and cardiovascular disorders as well as other abnormalities (1). Deficiency of vitamin B1 in humans occurs in conditions like inflammatory bowel diseases (IBD; 6, 7), sepsis (8), and chronic alcoholism (9). In contrast to the deleterious effects of vitamin B1 deficiency, optimizing its body homeostasis is of benefit in treating sepsis/septic shock (8, 10), and thiamin-responsive megaloblastic anemia (11); it is also of benefit in reducing fatigue in patients with IBD (12).

Humans/mammals cannot synthesize thiamin, rather they obtain the vitamin from two exogenous sources: the diet and the gut microbiota (13–17). Dietary thiamin exists in both phosphorylated and free forms, with the former being hydrolyzed to free thiamin before absorption in the small intestine. Absorption of free thiamin then proceeds via a specialized and specific carrier-mediated mechanism that involves both thiamin transporter-1 & -2 (THTR-1 & -2; products of the SLC19A2 & SLC19A3 genes, respectively; 17). With regards to vitamin B1 generated by the gut microbiota, this source generates both free as well as phosphorylated, i.e., TPP, forms of thiamin (13–15). Colonic uptake of free thiamin is as in the small intestine occurs via a carrier-mediated process that involves THTR-1 & -2 (17, 18). As for the microbiota-generated TPP, this form is not hydrolyzed to free thiamin before absorption because colonocytes express a very low level of surface phosphatases (18, 19). Rather a high-affinity and specific (i.e., not shared with free thiamin) carrier-mediated mechanism exists in the colon for uptake of intact TPP and involves the colonic TPP transporter (cTPPT; product of the SLC44A4 gene) (18). Expression of cTPPT is restricted to the large intestine, and the protein is localized exclusively at the apical membrane domain of the polarized lining epithelia (18, 20). In addition to its relevance to host overall vitamin B1 nutrition/homeostasis, the cTPPT is of special importance to normal physiology of colonocytes. This is because colonocytes are unlike their small intestinal enterocyte counterpart have limited capacity to synthesize the biologically active TPP from free thiamin as they express a very low level of the required enzyme, thiamin pyrophosphokinase (21). The cTPPT system also appears to be of potential pathophysiological relevance as recent genome-wide association studies (GWAS) have suggested that SLC44A4 could be a potential “ulcerative colitis susceptibility” gene (22–24).

Our aim in this study was to examine the effects of TNFα, a proinflammatory cytokine whose level is significantly induced in conditions associated with gut inflammation (as in inflammatory bowel diseases, IBD; 25–27), on colonic TPP and free thiamin uptake and to delineate the mechanism(s) involved. TNFα affects (and in a cell-/tissue-specific manner) a variety of cellular functions including transport events across the plasma membrane (28–34); effects of TNFα on the latter, however, is differential and both inhibition and induction in membrane transport processes have been observed (30–34). Addressing the aforementioned stated aim is of pathophysiological relevance since patients with IBD have suppressed levels of vitamin B1 (6, 7), but little is known about the mechanism(s) involved. In addition, an effect of TNFα on colonic TPP uptake may negatively impact colonocytes energy metabolism, and thus, may contribute to the energy deficit that occurs in the inflamed mucosa (as seen in ulcerative colitis; 35, 36). We used different colonic preparations (cultured human-derived colonic epithelial CCD841 and NCM460 cells, human differentiated colonoid monolayers, and intact mouse colonic tissue) and a range of cell/molecular approaches to address our stated aim. Our results showed that exposure of colonic epithelial cells to TNFα causes significant inhibition in colonic uptake of both TPP and free thiamin. This inhibition was associated with a marked suppression in the level of expression of cTPPT, THTR-1, and THTR-2, is transcriptionally mediated, and is mediated via JNK and ERK1/2 signaling pathways.

MATERIALS AND METHODS

Chemicals and Antibodies

We obtained [3H]-thiamin pyrophosphate (TPP, specific activity: 0.7 Ci/mmol; radiochemical purity: 98.2%) and [3H]-thiamin (specific activity: 12.8 Ci/mmol; radiochemical purity: 93.3%) from Moravek Biochemicals Inc. (Brea, CA). TNFα was obtained from Peprotech, Rocky Hill, NJ (Cat No. 315-01 A). The following specific inhibitors/blockers were used in this study: the NF-κB pathway-specific inhibitor celastrol (Cat. No.: ant-cls; InvivoGen, San Diego, CA); the p38 pathway-specific inhibitor SB203580 (Cat. No.: 5633; Cell Signaling Technology; Danvers, MA); the ERK1/2 pathway-specific inhibitor PD98059 (Cat. No.: 1672186; Biogems; Westlake village, CA); and the JNK pathway-specific inhibitor SP600125 (Cat. No.: 8177; Cell Signaling Technology; Danvers, MA). The human-specific anti-cTPPT (SLC44A4) rabbit polyclonal antibody used in this study was generated for us by Thermo Fisher Scientific (Waltham, MA); the anti-THTR-1 rabbit polyclonal antibody (Cat. No.: ab229680, Boston, MA) was obtained from Abcam; the anti-THTR-2 rabbit polyclonal antibody (Cat. No.: 13407-1-AP, Rosemont, IL) was from Proteintech; the anti-hypoxia inducing factor-1α (HIF-1α) rabbit monoclonal antibody (Cat. No.: 14179S, Danvers, MA) was from Cell Signaling Technology; and the anti-β-actin mouse monoclonal primary antibody (Cat. No.: SC47778, Dallas, TX) was from Santa Cruz Biotechnology. The secondary antibodies, anti-rabbit IRDye-800 (Cat. No.: 926-32211) and anti-mouse IRDye-680 (Cat. No.: 926–68020) were obtained from LI-COR Bioscience (Lincoln, NE). All other chemicals and reagents used in these studies were of analytical/molecular biology grade and were purchased from authenticated sources.

Cell Lines and Treatment with Proinflammatory Cytokines

Normal human-derived colonic epithelial CCD841 cells were obtained from American Type Tissue Collection (ATCC; Rockville, MD) and maintained at 37°C, in 5% CO2 and in EMEM (Eagle’s minimal essential medium) supplemented with 10% of fetal bovine serum (FBS), 100 μg/mL of streptomycin, and 100 U/mL of penicillin. Normal human-derived colonic epithelial NCM460 cells were obtained from INCELL (San Antonio, TX) and were grown in M3 base cell culture growth medium that was supplemented with 20% of FBS, 100 μg/mL of streptomycin, 100 U/mL of penicillin, and incubated in a 5% CO2 incubator at 37°C. Before treatment with TNFα (Cat.: PHC3011, Invitrogen, Carlsbad, CA), the cells were starved overnight with the respective culture medium containing 0.5% FBS, followed by the addition of 20 ng/mL of TNFα and continuation of incubation for 48 h; uptake studies were then performed as described in the section Carrier-Mediated TPP and Free Thiamin Uptake. In examining the role of the different cell signaling pathway(s) in mediating the TNFα inhibitory effects on colonic TPP and free thiamin uptake, inhibitors of signaling pathways such as celastrol (100 nM; for the NF-κB pathway), SB203580 (1 μM; for the p38 pathway), SP600125 (5 μM; for the JNK pathway), and PD98059 (50 μM; for the ERK1/2 pathway) were added 1 h before treatment with TNFα, after which the incubation continued for 48 h at 37°C.

TNFα Treatment of Mice

Male C57BL/6J mice (8–10 wk; Jackson Laboratory, Bar Harbor, ME) were housed in pathogen-free, well-ventilated cages and exposed to daily 12-h light-dark cycles with conventional mouse chow and water ad libitum. Animals were treated (via intraperitoneal injection) with either TNFα (15 μg/mouse in 100 μL saline buffer) or with saline buffer (controls), and were euthanized 48 h later (37). After euthanizing the animals, the colon was immediately removed, and ∼1 cm in length from identical region of the TNFα-treated and control mice were used for the [3H]-TPP and free [3H]-thiamin uptake studies, as well as for RT-qPCR and Western blot analysis (38). Animal usage and protocols were approved by the Animal Care and Use Committee of the University of California (IACUC), Irvine, CA.

Preparation of Human Differentiated Colonoid Monolayers and TNFα Treatment

Human colonoids (Hu235A) used in this study were prepared from biopsies obtained from healthy adults by members of the Digestive Diseases Research Center of the School of Medicine-Washington University (St. Louis, MO; IRB-201406083) as previously described (39–41). Isolated colonoids were cultured in Matrigel droplets (BD Biosciences) in the 24-well plates followed by the addition of conditioned media [1:1 mixture of the L-WRN cell line collection media and primary culture media (Advanced DMEM/F12; Invitrogen) containing 20% of FBS, 2 mM l-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, 10 μM Y27632 (Reprocell) and 10 μM SB431542 (Peprotech)]. To generate polarized differentiated colonoid monolayers, 5 × 104 cells/well were plated in a 24-well Transwell plate (Corning; Kennebunk, ME) coated with type IV human collagen (Sigma; St. Louis, MO), which allowed the cells to grow for 4 days followed by 2 days’ induction of differentiation via addition of 5% conditioned media and 10 μM Y-27632 inhibitor. Treatment of the differentiated colonoid monolayers with TNFα (20 ng/mL; 48 h) was then performed followed by their use in physiological and molecular investigations as previously described (39, 41).

Carrier-Mediated TPP and Free Thiamin Uptake

Carrier-mediated uptake of TPP and free thiamin by confluent CCD841, NCM460, and human differentiated colonoid monolayers were assessed as described by us previously (39, 41). This was done by incubating control (untreated) and TNFα-treated preparations in Krebs-Ringer (KR) buffer [containing 123 mM NaCl, 4.93 mM KCl, 1.23 mM MgSO4, 0.85 mM CaCl2, 5 mM glucose, 5 mM glutamine, 10 mM HEPES, and 10 mM MES (pH 7.4)] along with [3H]-TPP (0.23 nM) or [3H]-thiamin (15 nM) with and without 1 mM of unlabeled TPP and free thiamin. Incubation was performed in 37°C water bath (10 min for CCD841, and NCM460 cells; 30 min for human differentiated colonoids monolayers). For TPP and thiamin uptake by mouse colonic sheets, ∼1 cm of the colon from the TNFα-treated and control mice were incubated (for 10 min) in vitro in KR buffer [3H]-TPP (0.46 nM) and [3H]-thiamin (30 nM) with and without 1 mM unlabeled TPP and free thiamin (38). At the end of the incubation of cultured cells and colonoids, 1 mL of ice-cold KR buffer was added to each preparation, followed by washing with the same buffer as described earlier (38, 42); for colonic sheets, the sheets were removed, washed, and digested with NaOH. Finally, the levels of [3H]-labeled TPP and thiamin in the washed cells/sheets were counted using liquid scintillation counter (LS6500; Beckman Coulter, Brea, CA). The protein content of each sample was also determined by Bio-Rad DC protein assay kit (Bio-Rad, Carlsbad, CA).

RNA Isolation, cDNA Synthesis, and Real-Time PCR

RNeasy Kit (Qiagen, Hilden, Germany) were used to isolate total RNA from cultured human colonic cell lines, mouse colonic tissues, and human differentiated colonoid monolayers. cDNAs were synthesized from isolated RNA samples using Verso-cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA) as described by us previously (38, 39, 41). Levels of expression of the different mRNAs were assessed by using iQSYBER Green Super mix (Bio-Rad, Carlsbad, CA) in the CFX96 RT-qPCR system. The gene-specific primers used in this study are shown in Table 1, and relative gene expression was quantified by following 2−ΔΔCt method after normalizing the cycle threshold (Ct) values with their respective internal control gene (β-actin) Ct value. To determine [by real-time (RT)-qPCR[ the levels of expression of the human cTPPT, THTR-1, and THTR-2 (as well as PepT-1) mRNAs in colonic tissue of patients with active ulcerative colitis (UC), we used the Origene TissueScan cDNA Array I (Cat. No.: CCRT101, OriGene Technologies, Rockville, MD). This array contained cDNAs prepared from colonic tissue of 9 patients with UC and four healthy subjects. The cDNAs in each sample were normalized with human β-actin.

Table 1.

List of primer sequences used for RT-qPCR

Gene Name Forward Primers (5′–3′) Reverse Primers (5′—3′) Gene Accession Number Amplicon Length
Human cTPPT TGCTGATGCTCATCTTCCTGCG GGACAAAGGTGACCAGTGGGTA NM_025257.3 120 bp
Human THTR-1 GCCAGACCGTCTCCTTGTA TAGAGAGGGCCCACCACAC NM_006996.3 101 bp
Human THTR-2 TTCCTGGATTTACCCCACTG GTATGTCCAAACGGGGAAGA NM_025243.4 154 bp
Human CREB-1 TTAACCATGACCAATGCAGCA TGGTATGTTTGTACGTCTCCAGA XM_047443435.1 140 bp
Human Elf-3 TCTTCCCCAGCGATGGTTTTC TCCCGGATGAACTCCCACA NM_004433.5 166 bp
Human SP-1 CCATACCCCTTAACCCCG GAATTTTCACTAATGTTTCCCACC NM_138473.3 187 bp
Human GKLF-4 CCGCTCCATTACCAAGAGCT ATCGTCTTCCCCTCTTTGGC NM_004235.6 78 bp
Human NF-1A GCAGGCCCGAAAACGAAAATA TTTGCCAGAAGTCGAGATGCC NM_001134673.4 135 bp
Human PepT-1 TCTTTGGTTATCCCCTGAGCA GGCGGTGGACAGGTTATCATC NM_005073.4 137 bp
Human β-actin CATCCTGCGTCTGGACCT TAATGTCACGCACGATTTCC NM_001101.5 116 bp
Mouse cTPPT TGCCTACCAGAGTGTGAAGGAG TGGCTTCCTTCAGCAGAGCGAT XM_006524885.2 134 bp
Mouse THTR-1 GTTCCTCACGCCCTACCTTC GCATGAACCACGTCACAATC NM_054087.3 191 bp
Mouse THTR-2 TCATGCAAACAGCTGAGTTCT CTCCGACAGTAGCTGCTCA XM_021167002.2 121 bp
Mouse β-actin ATCCTCTTCCTCCCTGGA TTCATGGATGCCACAGGA NM_007393.5 136 bp
Open in a new tab

CREB, cAMP responsive element–binding protein; cTPPT, colonic thiamin pyrophosphate transporter; Elf-3, E74-like ETS transcription factor 3; GKLF-4, gut-enriched Krüppel-like factor 4; NF-1A, neurofibromatosis-1; SP-1, specificity protein 1; THTR-1, thiamin transporter-1; THTR-2, thiamin transporter-2.

Western Blotting

Total protein was isolated from the aforementioned colonic preparations using radio-immunoprecipitation assay buffer (RIPA; Sigma, St. Louis, MO) containing 1% of protease inhibitor cocktail. Protein levels were quantified by Bio-Rad DC protein assay kit (Bio-Rad, Carlsbad, CA). Afterward, an equal amount (25 μg) of the protein was loaded on 4%–12% Bis–Tris gels (NuPAGE, Invitrogen) as previously described (39, 41). Proteins were then blotted onto polyvinylidene difluoride membranes and probed with primary antibodies such as anti-cTPPT (1:500), anti-THTR-1 (1:1,000), anti-THTR-2 (1:1,000), anti-HIF-1α (1:500), and anti-β-actin (1:2,000). Specificity of the cTPPT, THTR-1, and THTR-2 antibodies has been validated in our laboratory previously using different approaches that include overexpression of tagged-proteins or gene-specific silencing (26, 27). Other antibodies were validated by either the respective company or by other investigators using knockout animal models and/or gene knockdown approaches. The primary antibody-bound protein bands from the blots were then identified with corresponding anti-rabbit IR-800 dye (1: 30,000) and anti-mouse IR-680 dye (1: 30,000) secondary antibodies; incubation was performed at room temperature for 1 h. Relative expression of specific protein band was calculated by comparing the fluorescence intensity in an Odyssey infrared imaging system (LI-COR Bioscience, Lincoln, NE) with respect to corresponding internal protein.

Transfection and Promoter Analysis

The full-length and minimal promoter constructs (3 μg/well) of the human SLC44A4, SLC19A2, and SLC19A3 genes (previously cloned and characterized in our laboratory; 20, 43, 44) were transfected [together with Renilla luciferase-thymidine kinase plasmid (100 ng)] into CCD841 cells using Lipofectamine 2000 reagent (Life Technologies, Carlsbad, CA). Cells were then exposed to TNFα (and pathways inhibitors) for 48 h followed by measuring firefly luciferase reporter activity. Data were normalized relative to Renilla-luciferase activity using a Glomax 20/20 Luminometer (Promega, Madison, WI) with the help of dual-luciferase assay system (Promega, Madison, WI).

Statistical Analysis

All carrier-mediated TPP and free thiamin uptake, qPCR, immunoblotting analysis, and luciferase-reporter assays data are the results of 3–4 independent experiments and are presented as means ± standard error. In all figures, the graphical data were presented as percentage relative to controls using GraphPad Prism 8 software (GraphPad Software, Inc). Statistical analyses were performed using unpaired Student’s t test and one-way analysis of variance (ANOVA); P < 0.05 was considered as statistically significant.

RESULTS

Effects of TNFα on Physiological and Molecular Parameters of Colonic Uptake of TPP and Free Thiamin

Effect of TNFα on colonic uptake of TPP and free thiamin.

In the first set of experiments, we examined the effect of TNFα on colonic uptake of TPP. For this, we exposed (for 48 h) human-derived colonic epithelial CCD841 and NCM460 cells to clinically relevant level of TNFα (20 ng/mL) and then examined initial rate (7 min) of carrier-mediated TPP (0.23 μM) uptake. The results showed a significant (P < 0.01 for both) inhibition in TPP uptake by cells exposed to TNFα compared with untreated controls (Fig. 1, A and B). Similar inhibition (P < 0.01) in carrier-mediated TPP uptake was observed when human differentiated colonoid monolayers were exposed (for 48 h) to TNFα (20 ng/mL) (Fig. 1C). Finally, we extended our studies to mouse colonic tissue and examined the effect of TNFα (administered intraperitoneally at 15 μg/mouse for 48 h before euthanized; 37) on initial rate (7 min) of TPP (0.46 μM) uptake by intact colonic sheets. The results again showed a significant (P < 0.05) inhibition in colonic TPP uptake by colonic sheets prepared from TNFα-treated mice compared with untreated controls (Fig. 1D).

Figure 1.

Figure 1.

Open in a new tab

Effect of TNFα on carrier-mediated thiamin pyrophosphate (TPP) uptake by human-derived colonic epithelial CCD841 and NCM460 cells (A and B); human differentiated colonoid monolayers (C); and mouse intact colonic sheets (D). CCD841and NCM460 cells as well as human differentiated colonoid monolayers were treated with human TNFα (20 ng/mL) for 48 h followed by examination of carrier-mediated [3H]-TPP uptake (see materials and methods). For the mice study, animals were injected with mouse TNFα (15 μg ip) followed by examination of carrier-mediated [3H]-TPP uptake using isolated colonic sheet preparations. Data are means ± SE of 3–4 independent experiments. Statistical analysis of the data on TPP uptake by human colonic epithelial cells (**P < 0.01), human differentiated colonoid monolayers (**P < 0.01), and mouse colonic sheets (*P < 0.05) was performed using the Student’s t test.

In the second set of experiments, we examined the effect of exposure to TNFα on initial rate (7 min) of carrier-mediated uptake of free thiamin (15 nM) by human colonic epithelial CCD84 and NCM460 cells, human differentiated colonoid monolayers, and by mouse intact colonic sheets. Treatment with TNFα was done as described earlier. The results again showed that exposure to TNFα causes significant (P < 0.01 for all) inhibition in uptake of free thiamin by all the different colonic preparations (Fig. 2, A–D).

Figure 2.

Figure 2.

Open in a new tab

Effect of TNFα on carrier-mediated uptake of free [3H]-thiamin by: human-derived colonic epithelial CCD841 and NCM460 cells (A and B); human differentiated colonoid monolayers (C); and mouse intact colonic tissue (D). Data are means ± SE of 3–4 independent experiments. Statistical analysis was performed using the Student’s t test. **P < 0.01.

Effect of TNFα on molecular parameters of colonic TPP and free thiamin uptake processes.

In these studies, we examined the effect of exposure of human-derived colonic epithelial CCD841 cells to TNFα (20 ng/mL for 48 h) on the level of expression of cTPPT protein (by Western blotting) and mRNA (by RT-qPCR). The results showed significant reduction in the level of expression for both the cTPPT protein (P < 0.05; Fig. 3A) and mRNA (P < 0.01; Fig. 3B). Similarly, exposure of the CCD841 cells to TNFα caused significant inhibition in the levels of expression of THTR-1 & -2 proteins (P < 0.05–0.01) and mRNAs (P < 0.01 for both) (Fig. 3, Ci and ii and Di and ii).

Figure 3.

Figure 3.

Open in a new tab

Effect of TNFα on the level of expression of colonic thiamin pyrophosphate transporter (cTPPT), thiamin transporters-1 (THTR)-1 and -2 in CCD841 cells. A and B: effects on the level of expression of cTPPT protein and mRNA, respectively. C and D: effects on the levels of expression of THTR-1 (i) and THTR-2 (ii) proteins and mRNAs, respectively. Western blotting and RT-qPCR were performed as described in materials and methods. Data were normalized relative to β-actin expression and comparison was made relative to simultaneously performed controls. Data are means ± SE of multiple (n = 4) independent experiments. Statistical analysis was performed using the Student’s t test. *P < 0.05; **P < 0.01.

We also examined the effect of TNFα on level of expression of cTPPT and THTR-1 & -2 in human differentiated colonoid monolayers and intact colonic tissue of mice treated with the cytokine in vivo. The results again showed a significant (P < 0.05–0.01) inhibition in the level of protein and mRNA expression of all the three vitamin B1 transporters (Fig. 4, Ai–iii and Bi–vi).

Figure 4.

Figure 4.

Open in a new tab

Effect of TNFα on the level of expression of colonic thiamin pyrophosphate transporter (cTPPT; i), thiamin transporter-1 (THTR-1; ii), and thiamin transporter-2 (THTR-2; iii) in human differentiated colonoid monolayers (A) and mouse intact colonic tissue (B). A shows the effect of TNFα on mRNA expression (i–iii) and B shows the effect of TNFα on protein (i–iii) and mRNA (iv–vi) expression. Data are means ± SE of multiple (n = 3) independent experiments and were normalized relative to β-actin. Statistical analysis was performed using the Student’s t test. *P < 0.05; **P < 0.01.

Involvement of transcriptional mechanism(s) in mediating the effects of TNFα on colonic TPP and free thiamine uptake.

Changes in the level of expression of mRNA of a particular gene can be caused by different mechanisms. One such important mechanism is via changes in transcription rate of the involved gene. In this study, we investigated whether such a mechanism is involved in mediating the effects of TNFα on the levels of expression of cTPPT and THTR-1 & -2 in colonic epithelial cells. In examining the effect of TNFα on SLC44A4 transcription, we exposed (for 48 h) human colonic epithelial CCD841 cells transfected with full-length (as well as minimal) SLC44A4 promoters (both fused to the luciferase reporter gene) to TNFα (20 ng/mL), followed by examination of promoter activity. The results showed that such exposure leads to a significant (P < 0.01 for both) reduction in the activity of the SLC44A4 full-length as well as the minimal promoters (Fig. 5A). These findings suggest that transcriptional mechanism(s) is involved in mediating (at least part of) the effect of TNFα on colonic carrier-mediated TPP uptake; they also suggest that the TNFα-responsive region(s) is located within the minimal region of the SLC44A4 promoter. Since, the cAMP responsive element-binding protein (CREB) and E74-like ETS transcription factor 3 (Elf-3) play important roles in regulating basal activity of the SLC44A4 promoter (as shown in previous studies from our laboratory; 20), we examined whether the effect of TNFα on activity of this promoter is (at least in part) mediated via suppression in the level of expression of these transcription factors. For this, CCD841 cells were treated with TNFα as described earlier, followed by determination (by RT-qPCR) of the levels of expression of CREB-1 and Elf-3. The results showed significant (P < 0.05 for both) reduction in the level of expression of both transcription factors in cells treated with TNFα compared with untreated controls (Fig. 5B, i and ii). Similarly, the levels of expression of CREB-1 and Elf-3 mRNAs in human differentiated colonoid monolayers exposed to TNFα were found to be significantly reduced following treatment with this proinflammatory cytokine (P < 0.05 and P < 0.01, respectively; Fig. 5C, i and ii). Finally, we also examined the effect of exposure of CCD841 cells to TNFα on the level of expression of the nuclear factor HIF-1α, since recent studies have shown that induction in the level of this factor leads to a suppression in the activity of the SLC44A4, SLC19A2, and SLC19A3 promoter (39). The results indeed showed a significant (P < 0.01) induction in the level of expression of HIF-1α in CCD841 cells treated with TNFα compared with untreated controls (Fig. 5D).

Figure 5.

Figure 5.

Open in a new tab

Effect of TNFα on activity of the SLC44A4 promoter and on expression of nuclear factors that regulates them in colonic epithelial cells. A: effect on activity of the SLC44A4 full-length (and minimal) promoter expressed in CCD841 cells. B: effect on mRNA expression of cAMP responsive element-binding protein 1 (CREB-1; i) and E74-like ETS transcription factor 3 (Elf-3; ii) in CCD841 cells. C: effect on mRNA expression of CREB-1 (i) and Elf-3 (ii) in human differentiated colonoid monolayers. D: effect of TNFα on hypoxia inducing factor-1α (HIF-1α) protein expression in CCD841 cells. Activity of the luciferase reporter was normalized relative to renilla luciferase activity (see materials and methods). The mRNA and protein expression were normalized relative to β-actin and compared with their respective controls. Data are means ± SE of 3–4 independent experiments. Statistical analysis was performed using the Student’s t test. *P < 0.05; **P < 0.01.

In examining the effect of TNFα on transcriptional activities of the SLC19A2 and SLC19A3 genes, we again exposed CCD84 cells transfected with the SLC19A2 and SLC19A3 full-length (and minimal) promoters to the TNFα, followed by determination of luciferase activity. The results showed significant (P < 0.05–0.01) reduction in the activity of both SLC19A2 and SLC19A3 full-length (as well as minimal) promoters compared with untreated controls (Fig. 6A, i and ii). Since the activities of the SLC19A2 and SLC19A3 promoters depend on the transcription factors specificity protein 1 (SP-1), gut-enriched Krüppel-like factor 4 (GKLF-4), and neurofibromatosis-1 (NF-1) (43, 44), we also examined (by RT-qPCR) if TNFα affects the level of expression of these transcription factors in human colonic CCD841 cells. The results showed significant reduction in the level of expression of SP-1 and NF-1A (P < 0.01 for both), but not that of GKLF-4, in CCD841 cells treated with TNFα compared with untreated controls (Fig. 6B, i–iii) [Note: When human differentiated colonoid monolayers were used as model, exposure to TNFα was also found to cause a significant (P < 0.05–0.01) inhibition in the level of expression of Sp-1 and NF-1A compared wih untreated controls (Fig. 6C, i and ii)].

Figure 6.

Figure 6.

Open in a new tab

Effect of TNFα on activity of the SLC19A2 and SLC19A3 promoters and on expression of nuclear factors that regulates them in colonic epithelial cells. A: effect on activity of the SLC19A2 (i) and SLC19A3 (ii) full-length (and minimal) promoters expressed in CCD841 cells. B: effect on mRNA expression of specificity protein 1 (SP-1; i), gut-enriched Krüppel-like factor 4 (GKLF-4; ii), and neurofibromatosis-1A (NF-1A; iii) in CCD841 cells. C: effect on mRNA expression of SP-1 (i) and NF-1A (ii) in human differentiated colonoid monolayers. Activity of the luciferase reporter was normalized relative to renilla luciferase activity (see materials and methods). mRNA data were normalized relative to β-actin and compared with their respective controls. Data are means ± SE of multiple (n = 4) independent experiments. Statistical analysis was performed using the Student’s t test. *P < 0.05; **P < 0.01. NS, not significant.

Signaling Pathway(s) That Mediates the Effects of TNFα on Colonic TPP and Free Thiamin Uptake Processes

It has been shown that TNFα exerts its effects on cell physiology via NF-κB-, p38-, JNK-, and ERK1/2-mediated signaling pathways (34, 45). Thus, we aimed in these studies to determine if these signaling pathways are also involved in mediating the inhibitory effects of TNFα on colonic of TPP and free thiamin uptake. For this, we examined the effects of blocking the NF-κB-, p38-, JNK-, and ERK1/2- mediated signaling pathways with specific pharmacological inhibitors on colonic TPP and free thiamin uptake. Blocking the NF-κB pathway was performed using celastrol (46), and that of p38, JNK, and ERK1/2 mitogen-activated protein kinase (MAPK) pathways were done using SB203580, SP600125, and PD98059, respectively (47, 48). In these studies, CCD841cells were treated with TNFα (20 ng/mL) plus the respective inhibitor (see materials and methods) followed by examining carrier-mediated TPP uptake. The results showed that while blocking NF-κB and p38 pathway have no effect on TNFα-mediated inhibition in TPP uptake, blocking JNK and ERK1/2 led to significant (P < 0.01 for both) attenuation in the degree of inhibition of TPP uptake by TNFα (Fig. 7, A–D). These findings suggest a role for the latter (but not the former) signaling pathways in mediating the TNFα inhibitory effect in TPP uptake. In other studies, we examined the effect of blocking JNK and ERK1/2 pathways (with the use of SP600125, and PD98059, respectively) on the level of expression of cTPPT protein, mRNA, and SLC44A4 promoter activity as well as on the level of expression of the nuclear factors CREB-1, Elf-3, and HIF-1α. The results showed significant recovery in the inhibitory effect of TNFα on cTTPT protein and mRNA expression, as well as SLC44A4 promoter activity (Fig. 8, Ai and ii–Ci and ii); it also led to recovery in the inhibitory effects of TNFα on the level of expression of CREB-1, Elf-3, and HIF-1α (Fig. 9, Ai–iii and Bi–iii).

Figure 7.

Figure 7.

Open in a new tab

Role of NF-κB, p38, JNK, and ERK1/2 signaling pathways in mediating the inhibitory effect of TNFα on colonic carrier-mediated uptake of [3H]-thiamin pyrophosphate (TPP) by CCD 841 cells. Pretreatment of cells with the different inhibitors was done as described in materials and methods. TPP uptake by cells were pretreated with: celastrol (inhibitor of the NF-κB pathway) (A); SB203580 (inhibitor of the p38 pathway) (B); SP600125 (inhibitor of the JNK pathway) (C); and PD98059 (inhibitor of the ERK1/2 pathway) and TNFα (D). Data are means ± SE of multiple (n = 4) independent experiments. Statistical analysis was performed using the Student’s t test and ANOVA. *P < 0.05; **P < 0.01; NS, not significant.

Figure 8.

Figure 8.

Open in a new tab

Role of JNK (i) and ERK1/2 (ii) signaling pathways in mediating the inhibitory effect of TNFα on level of expression of colonic thiamin pyrophosphate transporter (cTPPT) protein (A), cTPPT mRNA (B), and activity of the SLC44A4 minimal promoter in CCD841 cells (C). The cTPPT protein and mRNA expression were normalized relative to expression of β-actin and compared with their respective controls. Luciferase data was normalized relative to Renilla luciferase and presented as described it in materials and methods. Presented data are means ± SE of 3–4 independent experiments. The Student’s t test and ANOVA were used for statistical analysis. *P < 0.05; **P < 0.01.

Figure 9.

Figure 9.

Open in a new tab

Role of JNK (A) and ERK1/2 (B) signaling pathways in mediating the inhibitory effect of TNFα on level of mRNA expression of nuclear factors: cAMP responsive element-binding protein (CREB-1; i) and E74-like ETS transcription factor 3 (Elf-3; ii), and on protein expression of hypoxia inducing factor-1α (HIF-1α; iii), in colonic CCD841 cells. All mRNA and protein data were normalized relative to β-actin and compared with their simultaneously performed controls. Presented data are means ± SE of 3–4 independent experiments. The Student’s t test and ANOVA were used for statistical analysis. *P < 0.05; **P < 0.01.

Similar approach was used to determine possible role of the NF-κB-, p38-, JNK-, and ERK1/2-singling pathways in mediating the inhibitory effect of TNFα on colonic uptake of free thiamin. The result again showed that treating CCD841 cells with SP600125 and PD98059 (but not celastrol and SB203580) led to a significant reversal in the inhibitory effect of TNFα on free thiamin uptake (Fig. 10, A–D), level of expression of THTR-1 & -2 proteins (Fig. 11A, i and ii) and mRNAs (Fig. 11B, i and ii), as well as activities of the SLC19A2 and SLC19A3 promoters (Fig. 11C, i and ii). The latter treatments also led to attenuation in the degree of TNFα inhibition in the level of expression of the nuclear factors SP-1 and NF-1A (Fig. 12, Ai and ii and Bi and ii).

Figure 10.

Figure 10.

Open in a new tab

Role of NF-κB, p38, JNK, and ERK1/2 signaling pathways in mediating the inhibitory effect of TNFα on colonic carrier-mediated uptake of [3H]-free thiamin by CCD841 cells. Cells were pretreated (see MATERIALS AND METHODS) with TNFα and: celastrol (inhibitor of the NF-κB pathway) (A); SB203580 (inhibitor of the p38 pathway) (B); SP600125 (inhibitor of the JNK pathway) (C); and PD98059 (inhibitor of the ERK1/2 pathway) (D). Data are means ± SE of multiple (n = 4) independent experiments. The Student’s t test and ANOVA were used for statistical analysis. *P < 0.05; **P < 0.01; NS, not significant.

Figure 11.

Figure 11.

Open in a new tab

Role of JNK (i) and ERK1/2 (ii) signaling pathways in mediating the inhibitory effect of TNFα on level of expression of thiamin transporter-1 (THTR-1) and thiamin transporter-2 (THTR-2) proteins (A), mRNAs (B), and activity of the SLC19A2 and SLC19A3 minimal promoters in CCD841 cells (C). Data are means ± SE of 3–4 independent experiments. The Student’s t test and ANOVA were used for statistical analysis. *P < 0.05; **P < 0.01.

Figure 12.

Figure 12.

Open in a new tab

Role of JNK (A) and ERK1/2 (B) signaling pathways in mediating the inhibitory effect of TNFα on level of mRNA expression of nuclear factors: specificity protein 1 (SP-1; i), and neurofibromatosis-1A (NF-1A; ii) in CCD841 cells. Data were normalized relative to β-actin and compared with their simultaneously performed controls. Data are means ± SE of multiple (n = 4) independent experiments. Statistical analysis was performed using the Student’s t test and ANOVA. *P < 0.05; **P < 0.01.

Expression of cTPPT and THTR-1 & -2 in Colonic Tissue of Patients with Active Ulcerative Colitis

To determine whether the levels of expression of the cTPPT and THTR-1 & -2 in colonic tissue of patients with active ulcerative colitis are reduced, we examined (by qPCR) and compared the level of mRNA expression of these transporters (together with level of the unrelated PepT1, i.e., SLC15A1; level of the latter is known to be induced in inflamed colonic tissue of patient with UC compared with healthy controls; 49). For this, we obtained (from Origene; Rockville, MD) a Tissue-Scan Array that contains colonic tissue samples (biopsies) from patients with active UC patients (n = 9) and healthy control subjects (n = 4) to perform the qPCR. The results showed a significant reduction in the level of expression of cTPPT and THTR-1 & -2 mRNAs in colonic tissue of patients with UC compared with that of healthy controls (Fig. 13, A–C). The level of expression of PepT1 (SLC15A1) mRNA, on the other hand, was as reported previously (31, 43), significantly (P < 0.05) induced in colonic tissue of patients with UC compared with healthy controls (Fig. 13D).

Figure 13.

Figure 13.

Open in a new tab

Relative level of mRNA expression of colonic thiamin pyrophosphate transporter (cTPPT; A), thiamin transporter-1 (THTR-1; B), thiamin transporter-1 (THTR-2; C), and PEPT-1 (D) (used as a positive control) in colonic tissue of patients with active ulcerative colitis (UC) (n = 9) and healthy controls (n = 4). The Student’s t test was used for statistical analysis. *P < 0.05; **P < 0.01.

DISCUSSION

The aim of this investigation was to examine the effect of the proinflammatory cytokine TNFα on colonic uptake of the microbiota-generated forms of vitamin B1 (i.e., TPP and free thiamin) and to determine the mechanism(s) involved. TNFα is a prominent proinflammatory cytokine whose level is markedly induced in conditions associated with gut inflammation, like IBD (25–27). We used several colonic epithelial cell models in our investigations. The results showed that exposure of human-derived colonic epithelial CCD841 and NCM460 cells, human differentiated colonoid monolayers, and mouse intact colonic tissue to TNFα leads to a significant inhibition in carrier-mediated uptake of both TPP and free thiamin. In both cases, the inhibition was found to be associated with a significant suppression in the level of expression of the involved transporters (i.e., cTPPT, THTR-1 and -2) and in promoter activity of their respective genes (i.e., SLC44A4, SLC19A2, and SLC19A3, respectively). Exposure to TNFα also caused suppression in the level of expression of CREB-1, Elf-3, NF-1A, and SP-1, nuclear factors that play important roles in driving promoter activity of the aforementioned genes (20, 39, 43, 44); on the other hand, such exposure leads to an induction in the level of expression of HIF1α, a suppresser to promoter activity of all the aforementioned three genes (39). These findings demonstrate that the inhibitor effects of TNFα on colonic TPP and free thiamin uptake is mediated (at least in part) at the level of transcription of the genes of the involved transporters.

To gain insight into the signaling mechanism(s) that mediates the inhibitory effects of TNFα on the physiological/molecular parameters of the TPP and free thiamin colonic uptake processes, we investigated the possible involvement of NF-κB, p38, JNK, and ERK1/2 (signaling pathways that have been reported as being involved in mediating the cellular effects of this proinflammatory cytokine; 34, 45). Although no role for the NF-κB and p38 pathways was found, roles for the JNK and ERK1/2 pathways were evident in both cases. The latter was shown by the findings that inhibiting these pathways led to attenuation in the degree of inhibition in TPP and free thiamin uptake, level of expression of the cTPPT and THTR-1 and -2 proteins and mRNAs, as well as in the activity of the respective gene promoters. It was also associated with attenuation in the degree of TNFα inhibition in the level of expression of nuclear factors that drives the promoter activity of the SLC44A4, SLC19A2, and SLC19A3 genes.

Finally, and to establish translational relevance to our findings, we used colonic tissue samples from patients with active UC to show that the levels of expression of cTPPT, THTR-1 and -2 are indeed significantly reduced compared with their levels in colonic tissue of healthy controls. Interestingly and as seen earlier (31, 49), the level of expression of the unrelated PepT1 (SLC15A1) in colonic tissue of these patients with UC was found to be significantly higher than its level in colonic tissue of healthy controls. The latter finding further confirms the differential nature of proinflammatory cytokines effects on the expression of membrane transporters (30, 32–34, 42).

In summary, results of these investigations show that exposure of colonic epithelia to TNFα causes significant suppression in colonic uptake of TPP and free thiamin. This inhibition appears to be exerted at the level of transcription of the involved vitamin B1 transporters genes, and is mediated via JNK and Erk1/2 signaling pathways.

GRANTS

This work was supported by grants from the Department of Veterans Affairs I01BX001142 (to H. M. Said); 5I01BX001469-05 (to J.M.F.), and the National Institutes of Health DK56061, AA018071, and AA-018071S1 (to H.M.S.); AI089894 and AI126887 (to J.M.F.); T32AI007172 (to A.S.); and P30 DK052574 to the Washington University Digestive Diseases Research Center Grant. H.M.S. is recipient of a Senior Research Career Scientist Award (No. IK6BX006189) from the Department of Veterans Affairs.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

S.S. and H.M.S. conceived and designed research; S.A., S.S., and A.S. performed experiments; S.A., S.S., and A.S. analyzed data; S.A., S.S., J.M.F., and H.M.S. interpreted results of experiments; S.A., S.S., and A.S. prepared figures; S.A., S.S., and H.M.S. drafted manuscript; S.A., S.S., A.S., J.M.F., and H.M.S. edited and revised manuscript; S.A., S.S., A.S., J.M.F., and H.M.S. approved final version of manuscript.

REFERENCES

  • 1. Singleton CK, Martin PR. Molecular mechanisms of thiamine utilization. Curr Mol Med 1: 197–207, 2001. doi: 10.2174/1566524013363870. [DOI] [PubMed] [Google Scholar]
  • 2. Sambon M, Wins P, Bettendorff L. Neuroprotective effects of thiamine and precursors with higher bioavailability: focus on benfotiamine and dibenzoylthiamine. Int J Mol Sci 22: 5418, 2021. doi: 10.3390/ijms22115418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Hazell AS, Butterworth RF. Update of cell damage mechanisms in thiamine deficiency: focus on oxidative stress, excitotoxicity and inflammation. Alcohol 44: 141–147, 2009. doi: 10.1093/alcalc/agn120. [DOI] [PubMed] [Google Scholar]
  • 4. Hernandez-Vazquez Ad J, Garcia-Sanchez JA, Moreno-Arriola E, Salvador-Adriano A, Ortega-Cuellar D, Velazquez-Arellano A. Thiamine deprivation produces a liver atp deficit and metabolic and genomic effects in mice: findings are parallel to those of biotin deficiency and have implications for energy disorders. J Nutrigenet Nutrigenomics 9: 287–299, 2016. doi: 10.1159/000456663. [DOI] [PubMed] [Google Scholar]
  • 5. Bettendorff L, Goessens G, Sluse F, Wins P, Bureau M, Laschet J, Grisar T. Thiamine deficiency in cultured neuroblastoma cells: effect on mitochondrial function and peripheral benzodiazepine receptors. J Neurochem 64: 2013–2021, 1995. doi: 10.1046/j.1471-4159.1995.64052013.x. [DOI] [PubMed] [Google Scholar]
  • 6. Fernandez-Banares F, Abad-Lacruz A, Xiol X, Gine JJ, Dolz C, Cabre E, Esteve M, Gonzalez-Huix F, Gassull MA. Vitamin status in patients with inflammatory bowel disease. Am J Gastroenterol (Springer Nature) 84: 744–748, 1989. [PubMed] [Google Scholar]
  • 7. Weisshof R, Chermesh I. Micronutrient deficiencies in inflammatory bowel disease. Curr Opin Clin Nutr Metab Care 18: 576–581, 2015. doi: 10.1097/MCO.0000000000000226. [DOI] [PubMed] [Google Scholar]
  • 8. Woolum JA, Abner EL, Kelly A, Bastin MLT, Morris PE, Flannery AH. Effect of thiamine administration on lactate clearance and mortality in patients with septic shock. Crit Care Med 46: 1747–1752, 2018. doi: 10.1097/CCM.0000000000003311. [DOI] [PubMed] [Google Scholar]
  • 9. Victor M, Adams RD, Collins GH. The Wernicke-Korsakoff syndrome. A clinical and pathological study of 245 patients, 82 with post-mortem examinations. Contemp Neurol Ser 7: 1–206, 1971. [PubMed] [Google Scholar]
  • 10. Mallat J, Lemyze M, Thevenin D. Do Not Forget to Give Thiamine To Your Septic Shock Patient! (Online). https://jtd.amegroups.com/article/view/7378 [2022 May 28]. [DOI] [PMC free article] [PubMed]
  • 11. Neufeld EJ, Fleming JC, Tartaglini E, Steinkamp MP. Thiamine-responsive megaloblastic anemia syndrome: a disorder of high-affinity thiamine transport. Blood Cells Mol Dis 27: 135–138, 2001. doi: 10.1006/bcmd.2000.0356. [DOI] [PubMed] [Google Scholar]
  • 12. Costantini A, Pala MI. Thiamine and fatigue in inflammatory bowel diseases: an open-label pilot study. J Altern Complement Med 19: 704–708, 2013. doi: 10.1089/acm.2011.0840. [DOI] [PubMed] [Google Scholar]
  • 13. Magnúsdóttir S, Ravcheev D, de Crécy-Lagard V, Thiele I. Systematic genome assessment of B-vitamin biosynthesis suggests co-operation among gut microbes. Front Genet 6: 148, 2015. doi: 10.3389/fgene.2015.00148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, et al. Enterotypes of the human gut microbiome. Nature 473: 174–180, 2011. [Erratum in Nature 474: 666, 2011]. doi: 10.1038/nature09944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Cummings JH. The large intestine. Its role in mammalian nutrition and homeostasis. Gut 22: 780–780, 1981. doi: 10.1136/gut.22.9.780. [DOI] [Google Scholar]
  • 16. Rindi G, Laforenza U. Thiamine intestinal transport and related issues: recent aspects. Proc Soc Exp Biol Med 224: 246–255, 2000. doi: 10.1046/j.1525-1373.2000.22428.x. [DOI] [PubMed] [Google Scholar]
  • 17. Said HM, Nexo E. Gastrointestinal handling of water-soluble vitamins. Compr Physiol 8: 1291–1311, 2018. doi: 10.1002/cphy.c170054. [DOI] [PubMed] [Google Scholar]
  • 18. Nabokina SM, Said HM. A high-affinity and specific carrier-mediated mechanism for uptake of thiamine pyrophosphate by human colonic epithelial cells. Am J Physiol Gastrointest Liver Physiol 303: G389–G395, 2012. doi: 10.1152/ajpgi.00151.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Dawson I, Pryse-Davies J. The distribution of certain enzyme systems in the normal human gastrointestinal tract. Gastroenterology 44: 745–760, 1963. doi: 10.1016/S0016-5085(63)80084-0. [DOI] [PubMed] [Google Scholar]
  • 20. Nabokina SM, Ramos MB, Valle JE, Said HM. Regulation of basal promoter activity of the human thiamine pyrophosphate transporter SLC44A4 in human intestinal epithelial cells. Am J Physiol Cell Physiol. 308: C750–C757, 2015. [Erratum in Am J Physiol Cell Physiol 313: C473, 2017]. doi: 10.1152/ajpcell.00381.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zhao R, Gao F, Goldman ID. Molecular cloning of human thiamin pyrophosphokinase. Biochim Biophys Acta 1517: 320–322, 2001. doi: 10.1016/s0167-4781(00)00264-5. [DOI] [PubMed] [Google Scholar]
  • 22. Gupta A, Thelma BK. Identification of critical variants within SLC44A4, an ulcerative colitis susceptibility gene identified in a GWAS in north Indians. Genes Immun 17: 105–109, 2016. doi: 10.1038/gene.2015.53. [DOI] [PubMed] [Google Scholar]
  • 23. Gupta A, Juyal G, Sood A, Midha V, Yamazaki K, Vich Vila A, Esaki M, Matsui T, Takahashi A, Kubo M, Weersma RK, Thelma BK. A cross-ethnic survey of CFB and SLC44A4, Indian ulcerative colitis GWAS hits, underscores their potential role in disease susceptibility. Eur J Hum Genet 25: 111–122, 2016. doi: 10.1038/ejhg.2016.131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Wu J, Cheng Y, Zhang R, Shen H, Ma L, Yang J, Zhang Y, Zhang J. Evaluating the association of common variants of the SLC44A4 gene with ulcerative colitis susceptibility in the Han Chinese population. Genet Test Mol Biomarkers 21: 555–559, 2017. doi: 10.1089/gtmb.2017.0010. [DOI] [PubMed] [Google Scholar]
  • 25. Hagel AF, de Rossi T, Konturek PC, Albrecht H, Walker S, Hahn EG, Raithel M. Plasma histamine and tumour necrosis factor-alpha levels in Crohn’s disease and ulcerative colitis at various stages of disease. J Physiol Pharmacol 66: 549–556, 2015. [PubMed] [Google Scholar]
  • 26. Ruder B, Atreya R, Becker C. Tumour necrosis factor alpha in intestinal homeostasis and gut related diseases. Int J Mol Sci 20: 1887, 2019. doi: 10.3390/ijms20081887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Gareb B, Otten AT, Frijlink HW, Dijkstra G, Kosterink JGW. Review: local tumor necrosis factor-α inhibition in inflammatory bowel disease. Pharmaceutics 12: 539, 2020. doi: 10.3390/pharmaceutics12060539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ohmori Y, Wyner L, Narumi S, Armstrong D, Stoler M, Hamilton TA. Tumor necrosis factor-alpha induces cell type and tissue-specific expression of chemoattractant cytokines in vivo. Am J Pathol 142: 861–870, 1993. [PMC free article] [PubMed] [Google Scholar]
  • 29. Wang Y, Feng G, Wang J, Zhou Y, Liu Y, Shi Y, Zhu Y, Lin W, Xu Y, Li Z. Differential effects of tumor necrosis factor-α on matrix metalloproteinase-2 expression in human myometrial and uterine leiomyoma smooth muscle cells. Hum Reprod 30: 61–70, 2015. doi: 10.1093/humrep/deu300. [DOI] [PubMed] [Google Scholar]
  • 30. Li M, Wang W, Cheng Y, Zhang X, Zhao N, Tan Y, Xie Q, Chai J, Pan Q. Tumor necrosis factor α upregulates the bile acid efflux transporter OATP3A1 via multiple signaling pathways in cholestasis. J Biol Chem 298: 101543, 2022. doi: 10.1016/j.jbc.2021.101543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Vavricka SR, Musch MW, Fujiya M, Kles K, Chang L, Eloranta JJ, Kullak-Ublick GA, Drabik K, Merlin D, Chang EB. Tumor necrosis factor-α and interferon-gamma increase PepT1 expression and activity in the human colon carcinoma cell line Caco-2/bbe and in mouse intestine. Pflugers Arch 452: 71–80, 2006. doi: 10.1007/s00424-005-0007-8. [DOI] [PubMed] [Google Scholar]
  • 32. Chen H, Xu H, Dong J, Li J, Ghishan FK. Tumor necrosis factor-α impairs intestinal phosphate absorption in colitis. Am J Physiol Gastrointest Liver Physiol 296: G775–G281, 2009. doi: 10.1152/ajpgi.90722.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Talukder JR, Boyd B, Griffin A, Jaima A, Rajendran VM. Inflammatory cytokine TNF-α inhibits Na+–glutamine cotransport in intestinal epithelial cells. Can J Physiol Pharmacol 91: 275–284, 2013. doi: 10.1139/cjpp-2011-0488. [DOI] [PubMed] [Google Scholar]
  • 34. Mochizuki T, Satsu H, Shimizu M. Signaling pathways involved in tumor necrosis factor α-induced upregulation of the taurine transporter in Caco-2 cells. FEBS Lett 579: 3069–3074, 2005. doi: 10.1016/j.febslet.2005.04.063. [DOI] [PubMed] [Google Scholar]
  • 35. Kameyama J-I, Narui H, Inui M, Sato T. Energy level in large intestinal mucosa in patients with ulcerative colitis. Tohoku J Exp Med 143: 253–254, 1984. doi: 10.1620/tjem.143.253. [DOI] [PubMed] [Google Scholar]
  • 36. Roediger WEW. The colonic epithelium in ulcerative colitis: an energy-deficiency disease? Lancet 316: 712–715, 1980. doi: 10.1016/s0140-6736(80)91934-0. [DOI] [PubMed] [Google Scholar]
  • 37. Staelens J, Wielockx B, Puimège L, van Roy F, Guénet J-L, Libert C. Hyporesponsiveness of SPRET/Ei mice to lethal shock induced by tumor necrosis factor and implications for a TNF-based antitumor therapy. Proc Natl Acad Sci USA 99: 9340–9345, 2002. doi: 10.1073/pnas.142293699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Anandam KY, Sabui S, Thompson MM, Subramanian S, Said HM. Enterohemorrhagic Escherichia coli infection inhibits colonic thiamin pyrophosphate uptake via transcriptional mechanism. PLoS One 14: e0224234, 2019. doi: 10.1371/journal.pone.0224234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Sabui S, Ramamoorthy K, Romero JM, Simoes RD, Fleckenstein JM, Said HM. Hypoxia inhibits colonic uptake of the microbiota-generated forms of vitamin B1 via HIF-1α-mediated transcriptional regulation of their transporters. J Biol Chem 298: 101562, 2022. doi: 10.1016/j.jbc.2022.101562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Sheikh A, Tumala B, Vickers TJ, Alvarado D, Ciorba MA, Bhuiyan TR, Qadri F, Singer BB, Fleckenstein JM. CEACAMs serve as toxin-stimulated receptors for enterotoxigenic Escherichia coli. Proc Natl Acad Sci USA 117: 29055–29062, 2020. doi: 10.1073/pnas.2012480117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Ramamoorthy K, Sabui S, Srinivasan P, Al-Juburi S, Pham Q, Chu BD, Simoes RD, Fleckenstein JM, Said HM. Effect of chronic alcohol exposure on gut vitamin B7 uptake: involvement of epigenetic mechanisms and effect of alcohol metabolites. Am J Physiol Gastrointest Liver Physiol 321: G123–G133, 2021. doi: 10.1152/ajpgi.00144.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Hardin J, Kroeker K, Chung B, Gall DG. Effect of proinflammatory interleukins on jejunal nutrient transport. Gut 47: 184–191, 2000. doi: 10.1136/gut.47.2.184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Reidling JC, Said HM. In vitro and in vivo characterization of the minimal promoter region of the human thiamin transporter SLC19A2. Am J Physiol Cell Physiol 285: C633–C641, 2003. doi: 10.1152/ajpcell.00076.2003. [DOI] [PubMed] [Google Scholar]
  • 44. Nabokina SM, Said HM. Characterization of the 5′-regulatory region of the human thiamin transporter SLC19A3: in vitro and in vivo studies. Am J Physiol Gastrointest Liver Physiol 287: G822–G829, 2004. doi: 10.1152/ajpgi.00234.2004. [DOI] [PubMed] [Google Scholar]
  • 45. Kataoka T. Chemical biology of inflammatory cytokine signaling. J Antibiot (Tokyo) 62: 655–667, 2009. doi: 10.1038/ja.2009.98. [DOI] [PubMed] [Google Scholar]
  • 46. Sethi G, Ahn KS, Pandey MK, Aggarwal BB. Celastrol, a novel triterpene, potentiates TNF-induced apoptosis and suppresses invasion of tumor cells by inhibiting NF-κB-regulated gene products and TAK1-mediated NF-κB activation. Blood 109: 2727–2735, 2007. [Erratum in Blood 122: 1327, 2013]. doi: 10.1182/blood-2006-10-050807. [DOI] [PubMed] [Google Scholar]
  • 47. Yin Y, Wang S, Sun Y, Matt Y, Colburn NH, Shu Y, Han X. JNK/AP-1 pathway is involved in tumor necrosis factor-alpha induced expression of vascular endothelial growth factor in MCF7 cells. Biomed Pharmacother 63: 429–435, 2009. doi: 10.1016/j.biopha.2009.04.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Sato S, Imachi H, Lyu J, Miyai Y, Fukunaga K, Dong T, Ibata T, Kobayashi T, Yoshimoto T, Kikuchi F, Yonezaki K, Yamaji N, Iwama H, Murao K. Effect of TNF-α on the expression of ABCA1 in pancreatic β-cells. J Mol Endocrinol 61: 185–193, 2018. doi: 10.1530/JME-18-0167. [DOI] [PubMed] [Google Scholar]
  • 49. Wojtal KA, Eloranta JJ, Hruz P, Gutmann H, Drewe J, Staumann A, Beglinger C, Fried M, Kullak-Ublick GA, Vavricka SR. Changes in mRNA expression levels of solute carrier transporters in inflammatory bowel disease patients. Drug Metab Dispos 37: 1871–1877, 2009. doi: 10.1124/dmd.109.027367. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Cell Physiology are provided here courtesy of American Physiological Society

RESOURCES