Knockout of ykcB, a Putative Glycosyltransferase, Leads to Reduced Susceptibility to Vancomycin in Bacillus subtilis

ABSTRACT

Vancomycin resistance of Gram-positive bacteria poses a serious health concern around the world. In this study, we searched for vancomycin-tolerant mutants from a gene deletion library of a model Gram-positive bacterium, Bacillus subtilis, to elucidate the mechanism of vancomycin resistance. We found that knockout of ykcB, a glycosyltransferase that is expected to utilize C55-P-glucose to glycosylate cell surface components, caused reduced susceptibility to vancomycin in B. subtilis. Knockout of ykcB altered the susceptibility to multiple antibiotics, including sensitization to β-lactams and increased the pathogenicity to silkworms. Furthermore, the ykcB-knockout mutant had (i) a decreased amount of lipoteichoic acid, (ii) decreased biofilm formation, and (iii) an increased content of diglucosyl diacylglycerol, a glycolipid that shares a precursor with C55-P-glucose. These phenotypes and vancomycin tolerance were abolished by knockout of ykcC, a gene in the same operon with ykcB probably involved in C55-P-glucose synthesis. Overexpression of ykcC enhanced vancomycin tolerance in both the parent strain and the ykcB-knockout mutant. These findings suggest that ykcB deficiency induces structural changes of cell surface molecules depending on the ykcC function, leading to reduced susceptibility to vancomycin, decreased biofilm formation, and increased pathogenicity to silkworms.

IMPORTANCE Although vancomycin is effective against Gram-positive bacteria, vancomycin-resistant bacteria are a major public health concern. While the vancomycin-resistance mechanisms of clinically important bacteria such as Staphylococcus aureus, Enterococcus faecium, and Streptococcus pneumoniae are well studied, they remain unclear in other Gram-positive bacteria. In the present study, we searched for vancomycin-tolerant mutants from a gene deletion library of a model Gram-positive bacterium, Bacillus subtilis, and found that knockout of a putative glycosyltransferase, ykcB, caused vancomycin tolerance in B. subtilis. Notably, unlike the previously reported vancomycin-resistant bacterial strains, ykcB-deficient B. subtilis exhibited increased virulence while maintaining its growth rate. Our results broaden the fundamental understanding of vancomycin-resistance mechanisms in Gram-positive bacteria.

INTRODUCTION

Antibiotics are widely used to treat bacterial infections, but the emergence of antibiotic-resistant bacteria is now a common and intractable problem. Vancomycin is a glycopeptide antibiotic that inhibits the polymerization of peptidoglycans in the cell wall of Gram-positive bacteria by binding to d-alanyl d-alanine residues. The emergence of vancomycin-resistant strains of Staphylococcus aureus, Streptococcus pneumoniae, and Enterococcus faecium poses a serious problem (1). In particular, vancomycin is one of the few effective antibiotics against methicillin-resistant S. aureus (MRSA), a bacterium resistant to many antibiotics, including β-lactams, but several cases of vancomycin-resistant MRSA have been reported (2). Understanding the mechanisms of vancomycin resistance is critical to the development of new, effective antibiotics.

Vancomycin-resistant S. aureus is classified into two types: vancomycin-resistant S. aureus (VRSA) and vancomycin intermediate-resistant S. aureus (VISA) (2). While the vancomycin MIC of vancomycin-sensitive S. aureus is typically 0.5 to 2 μg/mL, the MICs for VRSA and VISA are ≥16 μg/mL and 4 to 8 μg/mL, respectively (3). The vancomycin resistance of VRSA is caused by the acquisition of the E. faecium vanA gene, which encodes a d-alanyl d-lactate ligase and changes the peptidoglycan structure (4). On the other hand, the vancomycin resistance of VISA is caused by gene mutations that result in cell wall thickening, such as rpoB (5), graS (6), walK (7), and sdrC (8). VRSA and VISA have reduced growth rates compared with vancomycin-sensitive S. aureus (8–11). Furthermore, the attenuation of virulence in VISA was demonstrated in a mouse model of sepsis and a Galleria mellonella infection model (12–14). VISA also has a reduced ability to form biofilm, which is suggested to correlate with both decreased virulence and vancomycin resistance (15, 16). While the molecular mechanisms underlying vancomycin resistance in clinically important bacteria, including S. aureus, have been studied, they remain unclear in other Gram-positive bacteria.

In the present study, we searched for vancomycin-tolerant mutants from a gene deletion library of a model Gram-positive bacterium, Bacillus subtilis, and identified that knockout of ykcB, a gene encoding a putative glycosyltransferase, caused vancomycin tolerance. By analogy with the CsbB–GtcA-YfhO multicomponent glycosylation system, YkcB is proposed to be a component of a glycosylation system that adds the glucose residue to some compartment (17). CsbB is thought to transfer the N-acetylglucosamine (GlcNAc) residue onto the lipid carrier undecaprenyl phosphate (C55-P) to generate C55-P-GlcNAc (18). C55-P-GlcNAc is translocated across the membrane by the putative flippase GtcA (19, 20). The GlcNAc residues are finally transferred to the lipoteichoic acid polymer by the glycosyltransferase YfhO (18). The transglycosylation step releases undecaprenyl pyrophosphate (C55-PP), which is recycled as the lipid carrier after conversion to C55-P. On the other hand, ykcB is proposed to act cooperatively with ykcC, another glycosyltransferase, and yngA, a flippase on the plasma membrane (17). According to the model proposed by a previous study, after YkcC produces the lipid phosphate carrier C55-P-glucose from UDP-glucose on the cytoplasmic side of the plasma membrane, C55-P-glucose is flipped to the outer surface of the plasma membrane by the function of YngA, and finally, YkcB transfers glucose from C55-P-glucose to some cell surface components (17). Here, we report that ykcB deficiency induces structural changes in the cell surface, such as a decreased amount of lipoteichoic acid, in a ykcC-dependent manner, leading to reduced susceptibility to vancomycin.

RESULTS

Knockout of ykcB changes antibiotic susceptibility and increases virulence in silkworms.

We searched for vancomycin-tolerant strains among 3,967 strains of the B. subtilis gene deletion library (21) and identified 23 strains with lower susceptibility to vancomycin than the parent strain (Table 1). Among the vancomycin-tolerant strains, the ykcB-knockout mutant (ΔykcB) exhibited the lowest susceptibility to vancomycin (Fig. 1A). The vancomycin MIC was 0.4 μg/mL for the parental strain versus 0.8 μg/mL for ΔykcB. To confirm that the reduced vancomycin susceptibility was conferred by the ykcB knockout, we examined whether ykcB complementation at an ectopic locus restores the vancomycin tolerance of ΔykcB. Introduction of ykcB with a selection marker gene into the amyE locus decreased vancomycin susceptibility in ΔykcB, whereas the introduction of the selection marker gene alone into the amyE locus did not affect vancomycin susceptibility (Fig. 1B). These results suggest that loss of ykcB function leads to reduced vancomycin susceptibility in B. subtilis.

TABLE 1.

Gene knockout mutants tolerant to vancomycin

ID	Gene	Product
BKE09500	yhdK	Probable anti-sigma-M factor YhdK
BKE10520	glcP	Glucose/mannose transporter GlcP
BKE10930	yitB	Adenosine 5′-phosphosulfate reductase 2
BKE10950	yitD	Phosphosulfolactate synthase
BKE12880	ykcB	Putative mannosyltransferase YkcB
BKE13610	mtnB	Methylthioribulose-1-phosphate dehydratase
BKE13750	queF	NADPH-dependent 7-cyano-7-deazaguanine reductase
BKE00250	xpaC	Anti-sigma-G factor Gin
BKE13950	mcpC	Methyl-accepting chemotaxis protein McpC
BKE17050	mutL	DNA mismatch repair protein MutL
BKE00850	mcsB	Protein-arginine kinase
BKE23830	yqjL	Uncharacterized protein YqjL
BKE24770	mgsR	Regulatory protein MgsR
BKE01570	ybaN	Probable polysaccharide deacetylase PdaB
BKE26610	yrkA	UPF0053 protein YrkA
BKE30190	bioI	Biotin biosynthesis cytochrome P450
BKE30500	ytpB	Tetraprenyl-beta-curcumene synthase
BKE31290	yugT	Probable oligo-1,6-glucosidase 3
BKE32840	fadN	Probable 3-hydroxyacyl-CoA dehydrogenase
BKE33222	rsoA	Sigma-O factor regulatory protein RsoA
BKE37200	ywjD	UV DNA damage endonuclease
BKE02860	adcC	High-affinity zinc uptake system ATP-binding protein ZnuC
BKE35910	rbsR	Ribose operon repressor

FIG 1.

Knockout of ykcB alters sensitivity to antibiotics and increases silkworm killing activity. (A) Overnight cultures of the parent strain (Parent) and ykcB knockout mutant (ΔykcB) were serially diluted 10-fold and spotted onto LB plates supplemented with or without vancomycin (0.3 μg/mL). The plates were incubated overnight at 37°C. Vancomycin MICs in LB broth are given in the right side of the agar plate image. (B) The parent strain transformed with empty vector (Parent/amyE::spec-P_spank) and the ykcB knockout mutant transformed with empty vector (ΔykcB/amyE::spec-P_spank) or a vector encoding ykcB (ΔykcB/amyE::spec-P_spank-ykcB) were aerobically cultured overnight in the presence of 1 mM IPTG. The overnight cultures were serially diluted 10-fold and spotted onto LB plates supplemented with 1 mM IPTG and vancomycin or 1 mM IPTG alone. The plates were incubated overnight at 37°C. (C) Overnight cultures of the parent strain (Parent) and the ykcB knockout mutant (ΔykcB) were serially diluted 10-fold and spotted onto LB plates supplemented with or without ampicillin, oxacillin, ceftazidime, levofloxacin, chloramphenicol, or tetracycline. The plates were incubated overnight at 37°C. (D) The silkworm killing activity of the parent strain (Parent) and ykcB knockout mutant (ΔykcB) was examined. Silkworms (n = 20) were injected with B. subtilis cells (8 × 10⁶ CFU) and silkworm survival was monitored. *, P < 0.05, using log-rank test. (E) The parent strain (Parent) and ykcB knockout mutant (ΔykcB) were aerobically cultured in LB broth and the OD₆₀₀ values of the cultures were measured.

Acquisition of vancomycin resistance is known to alter susceptibility to other antibiotics, including β-lactams (22, 23). We thus examined the sensitivity of ΔykcB to antibiotics other than vancomycin. ΔykcB became sensitive to the cell wall synthesis inhibitors ampicillin, oxacillin, and ceftazidime and the DNA synthesis inhibitor levofloxacin (Fig. 1C). On the other hand, ΔykcB became tolerant to the protein synthesis inhibitor chloramphenicol and showed no change in sensitivity to tetracycline (Fig. 1C). These results indicate that ykcB deficiency alters the susceptibility to various antibiotics.

As vancomycin-resistant S. aureus strains are known to have attenuated pathogenicity (12–14), we investigated the pathogenicity of ΔykcB using the silkworm infection model. Contrary to our expectation, silkworms injected with ΔykcB died earlier than the parent strain, indicating increased virulence of ΔykcB (Fig. 1D). ΔykcB showed the same growth rate as the parent strain in the nutrient medium (Fig. 1E), ruling out the possibility that the change in pathogenicity against silkworms depends on the bacterial growth rate.

Vancomycin tolerance in ΔykcB is abolished by knockout of ykcC.

To reveal more details of the mechanism of vancomycin tolerance by ykcB knockout, we deleted the chromosomal region around the ykcB gene because ykcB and ykcC form an operon and are thought to be functionally related (24, 25). Knockout of mhqA and ykcC, which, respectively, locate upstream and downstream of ykcB, did not lead to vancomycin tolerance (Fig. 2A and B). Deletions of the intergenic region between mhqA and ykcB (delA and delB) caused slightly higher vancomycin tolerance than that of the parent strain but lower than that of ΔykcB (Fig. 2A and C). Deletions in the ykcB coding region (delC, delD, delE, and delF) caused vancomycin tolerance comparable to that of ΔykcB (Fig. 2A and C). Deletion of the region spanning ykcB and ykcC (ΔykcBC) did not confer vancomycin tolerance, suggesting that vancomycin tolerance in ΔykcB depends on ykcC expression (Fig. 2A and C). To confirm whether vancomycin tolerance in ΔykcB depends on ykcC expression, we introduced a stop codon mutation in the ykcB gene by homologous recombination using erythromycin-resistant gene in delA as a selection marker (delA/ykcBstop). The delA/ykcBstop showed a vancomycin-tolerant phenotype to the same extent as ΔykcB, but the introduction of a stop codon mutation into both the ykcB and ykcC genes in the delA background (delA/ykcBstop/ykcCstop) did not exhibit a vancomycin-tolerant phenotype, indicating that ykcC knockout abolished the effect of ykcB knockout (Fig. 2A and C). These findings suggest that ykcB deficiency confers vancomycin tolerance to B. subtilis in the presence of ykcC.

FIG 2.

Knockout of ykcB leads to reduced vancomycin susceptibility in a ykcC-dependent manner. (A) Schematic representation of the ykcB flanking region is shown. The magenta box represents the chromosome region replaced with the erythromycin resistance gene in the gene knockout mutants or the chromosomal deletion mutants. Black arrowheads indicate the position at which the stop codon mutation was introduced. (B) Overnight cultures of the parent strain (Parent), ykcB knockout mutant (ΔykcB), mhqA knockout mutant (ΔmhqA), and ykcC knockout mutant (ΔykcC) were serially diluted 10-fold and spotted onto LB plates supplemented with or without vancomycin. The plates were incubated overnight at 37°C. (C) Overnight cultures of the parent strain (Parent), chromosomal deletion mutants, ykcBC knockout mutant (ΔykcBC), and stop codon mutants were serially diluted 10-fold and spotted onto LB plates supplemented with or without vancomycin. The plates were incubated overnight at 37°C.

Knockout of ykcB decreases the amount of lipoteichoic acid and attenuates biofilm-forming ability.

According to the UniProt database, YkcB is predicted to be a glycosyltransferase with 14 transmembrane domains that belongs to the glycosyltransferase 39 family. Furthermore, YkcB is presumed to play a similar function as YfhO, which is a glycosyltransferase involved in lipoteichoic acid glycosylation (17, 18, 20). We then detected lipoteichoic acid in the mutants lacking ykcB and/or ykcC. ΔykcB and the delA/ykcBstop mutants had significantly decreased amounts of lipoteichoic acid (Fig. 3A and B). On the other hand, ΔykcC and the delA/ykcBstop/ykcCstop mutants did not have a decreased amount of lipoteichoic acid (Fig. 3A and B). Thus, the ykcB knockout decreases the amount of lipoteichoic acids in the ykcC-dependent manner. In addition, a previous study on YfhO function showed that the LTA antibody has a higher affinity to nonglycosylated lipoteichoic acid than to glycosylated lipoteichoic acid (18). The decreased Western blot signal of lipoteichoic acid in the ykcB-knockout mutants suggests that YkcB is not involved in lipoteichoic acid glycosylation.

FIG 3.

Knockout of ykcB decreases the amount of lipoteichoic acid in a ykcC-dependent manner. (A) The B. subtilis parent strain (Parent), ykcB knockout mutant (ΔykcB), ykcC knockout mutant (ΔykcC), delA mutant (delA), delA/ykcBstop mutant (delA/ykcBstop), and delA/ykcBstop/ykcCstop mutant (delA/ykcBstop/ykcCstop) were cultured for 24 h, and the lipoteichoic acids were extracted. Lipoteichoic acids were detected by Western blotting using anti-lipoteichoic acid antibody (α-LTA). (B) The band intensities of lipoteichoic acids in A were measured. Data are presented as means ± SD from five independent experiments. The mean value of the parent strain was set to 1. *, P < 0.05, significant difference from the parent strain, using Dunnett’s multiple-comparison test.

Next, we assessed biofilm formation ability in the ykcB and/or the ykcC knockout mutants because a decreased amount of lipoteichoic acid leads to decreased biofilm formation in S. aureus (26). ΔykcB and the delA/ykcBstop mutants formed less biofilm than the parent strain and the delA mutant, respectively (Fig. 4A and B). The delA/ykcBstop/ykcCstop mutant did not show decreased biofilm formation (Fig. 4A and B). These results suggest that the ykcB knockout decreases the biofilm formation in the ykcC-dependent manner.

FIG 4.

Knockout of ykcB decreases biofilm formation in a ykcC-dependent manner. (A) The B. subtilis parent strain (Parent), ykcB knockout mutant (ΔykcB), ykcC knockout mutant (ΔykcC), delA mutant (delA), delA/ykcBstop mutant (delA/ykcBstop), and delA/ykcBstop/ykcCstop mutant (delA/ykcBstop/ykcCstop) were cultured for 2 days in glass tubes without shaking. The water surface areas were photographed. (B) The amount of biofilm in panel A was measured. Data are presented as means ± SD from 8 independent experiments. *, P < 0.05; **, P < 0.01, significant difference from the parent strain, using Tukey’s multiple-comparison test.

Knockout of ykcB increases the amount of diglucosyl diacylglycerol.

To understand the mechanism underlying a decreased amount of lipoteichoic acid in the ykcB knockout mutants, we examined the amount of diglucosyl diacylglycerol, which is a glycolipid contained in B. subtilis and functions as a membrane anchor for lipoteichoic acid. ΔykcB and the delA/ykcBstop mutants had increased amounts of diglucosyl diacylglycerol compared with the parent strain, indicating that the ykcB knockout increases the amount of diglucosyl diacylglycerol (Fig. 5A and B). In contrast, the ykcC knockout and the delA/ykcBstop/ykcCstop mutants did not have increased amounts of diglucosyl diacylglycerol (Fig. 5A and B), indicating that the ykcB knockout increases the amount of diglucosyl diacylglycerol in a ykcC-dependent manner. A decreased amount of lipoteichoic acid in the ykcB knockout mutants may increase the amount of free diglucosyl diacylglycerol that is not used as a membrane anchor for lipoteichoic acid.

FIG 5.

Knockout of ykcB leads to the accumulation of diglucosyl diacylglycerol in a ykcC-dependent manner. (A) The B. subtilis parent strain (Parent), ykcB knockout mutant (ΔykcB), ykcC knockout mutant (ΔykcC), delA mutant (delA), delA/ykcBstop mutant (delA/ykcBstop), and delA/ykcBstop/ykcCstop mutant (delA/ykcBstop/ykcCstop) were cultured for 24 h and total lipids were extracted. Diglucosyl diacylglycerol was analyzed by thin-layer chromatography. (B) The signal intensities of diglucosyl diacylglycerol (Glc₂-DAG) in A were measured. Data are presented as means ± SD from 5 independent experiments. The mean value of the parent strain was set to 1. *, P < 0.05, significant difference, using Dunnett’s multiple comparisons. (C) The B. subtilis parent strain (Parent), ykcB knockout mutant (ΔykcB), and ugtP knockout mutant (ΔugtP) were cultured for 24 h and total lipids were extracted. Diglucosyl diacylglycerol was analyzed by thin-layer chromatography. (D) Overnight bacterial cultures used in panel C were serially diluted 10-fold and spotted onto LB plates supplemented with or without vancomycin. The plates were incubated overnight at 37°C.

To determine whether diglucosyl diacylglycerol contributes to vancomycin tolerance in B. subtilis, we examined the effect of knocking out the ugtP gene, which encodes a diglucosyl diacylglycerol synthetase. As expected, the ugtP knockout mutant did not produce diglucosyl diacylglycerol (Fig. 5C). The ugtP knockout mutant showed vancomycin sensitivity indistinguishable from that of the parent strain (Fig. 5D). Therefore, diglucosyl diacylglycerol does not contribute to vancomycin tolerance.

Overexpression of ykcC increases vancomycin tolerance.

Because ykcC knockout abolished the vancomycin tolerance caused by ykcB knockout, expression of ykcC is hypothesized to have a positive role in vancomycin tolerance. To evaluate this hypothesis, we transformed the parent and ΔykcB strains with a multicopy plasmid encoding FLAG-tagged ykcC under the ykcBC native promoter. Western blot analysis revealed that FLAG-tagged ykcC was more highly expressed in ΔykcB than in the parent strain (Fig. 6A), suggesting that there exists a feedback loop that senses the production of YkcB metabolite and upregulates the ykcBC promoter. The parent strain and ΔykcB transformed with FLAG-tagged ykcC exhibited lower vancomycin susceptibility than those transformed with an empty vector (Fig. 6B). In addition, ΔykcB transformed with FLAG-tagged ykcC exhibited slightly lower vancomycin susceptibility than the parent strain transformed with FLAG-tagged ykcC (Fig. 6B). These findings suggest that ykcC confers vancomycin tolerance to B. subtilis in an expression-dependent manner.

FIG 6.

Overexpression of ykcC enhances vancomycin tolerance in B. subtilis. (A) The B. subtilis parent strain or the ykcB knockout mutant transformed with an empty vector (pHY) or a plasmid encoding FLAG-tagged ykcC (pHY-YkcC-FLAG) were subjected to Western blot analysis using the anti-FLAG antibody. The membrane was stained with Coomassie brilliant blue (CBB) and shown as a loading control. (B) Overnight bacterial cultures used in panel A were serially diluted 10-fold and spotted onto LB plates supplemented with or without vancomycin. The plates were incubated overnight at 37°C.

DISCUSSION

The findings of the present study revealed that knockout of ykcB, a putative glycosyltransferase gene, confers B. subtilis tolerance against vancomycin in a ykcC-dependent manner. Knockout of ykcB also leads to bacterial sensitivity to β-lactams, decreases the amount of lipoteichoic acids, attenuates biofilm formation, and increases silkworm-killing activity. This study is the first to reveal that knockout of a specific gene leads to vancomycin tolerance in B. subtilis.

The ykcC knockout mutant did not exhibit the same phenotypes as the ykcB knockout mutant, even though both genes are predicted to act in the same biological pathway (17). In addition, in the ykcC-stop codon mutant background, the stop codon mutation of ykcB led to no phenotypic changes. Therefore, the ykcC gene is required for the phenotypic changes triggered by ykcB knockout. Furthermore, overexpression of ykcC decreases vancomycin susceptibility in the B. subtilis parent strain and the ykcB knockout strain. The higher expression of ykcC from the ykcBC native promoter in ΔykcB than in the parent strain suggests the existence of a feedback loop that senses the enzymatic products of YkcB and upregulates the ykcBC promoter. These findings suggest that upregulation of ykcC a major factor contributing to vancomycin tolerance (Fig. 7).

FIG 7.

Model of vancomycin tolerance induced by the ykcB knockout. Knockout of ykcB disrupts C55-P recycling, leading to the accumulation of C55-P-glucose and the depletion of C55-P. This might cause decreased lipoteichoic acid and altered peptidoglycan structure, the latter of which could lead to vancomycin tolerance. In contrast, in the ykcBstop/ykcCstop mutant, the depletion of C55-P does not occur because it is not converted to C55-P-glucose. This might explain no phenotypic changes in cell surface structure.

A previous study predicted that YkcC converts UDP-glucose and C55-P to C55-P-glucose and YkcB transfers glucose from C55-P-glucose to some cell surface molecule (17) (Fig. 7). After the transglycosylation step, undecaprenyl pyrophosphate (C55-PP) is released and recycled, followed by subsequent conversion to C55-P. Considering this prediction and the findings of the present study, C55-P-glucose might accumulate in the ykcB-knockout mutant (Fig. 7). Furthermore, ykcB knockout and/or ykcC upregulation might disrupt C55-P recycling and cause accumulation of C55-P-glucose and depletion of C55-P at the same time (Fig. 7). As C55-P acts as a sugar acceptor to synthesize a variety of other cell wall polysaccharide components, including lipoteichoic acids, wall teichoic acid, and peptidoglycan (27), disruption of C55-P recycling would result in pleiotropic phenotypes on cell wall composition (Fig. 7). Consequently, altered peptidoglycan structure may confer vancomycin tolerance in the ykcB-knockout mutant.

The ykcB-knockout mutant was tolerant to vancomycin but sensitive to β-lactams. In VISA, the vancomycin resistance phenotype is accompanied by increased susceptibility to β-lactams, cell wall synthesis inhibitors (28, 29). This is referred to as a “seesaw phenomenon” (22, 23). Thus, the β-lactam sensitivity of the ykcB-knockout mutant of B. subtilis is consistent with that of VISA. The cell wall thickening is well conserved among various VISA strains (30) and is thought to contribute to vancomycin tolerance in VISA. Although the molecular mechanisms for the β-lactam sensitivity in VISA are not clear, the amounts of penicillin-binding protein 2 or phosphatidylglycerols are proposed to contribute to the β-lactam sensitivity of VISA (31, 32). Further investigation is needed to examine structural changes in peptidoglycan, the amount of penicillin-binding protein 2, and phosphatidylglycerols in the ykcB-knockout B. subtilis mutant. In relation, the absence of lipoteichoic acid in the LTA-synthetase mutant affects peptidoglycan structure in S. aureus (33). The decreased amount of lipoteichoic acid in the ykcB knockout strain might affect peptidoglycan structure.

This study demonstrated that the ykcB-knockout mutant has increased silkworm-killing activity. In our previous study, Escherichia coli mutant strains tolerant to vancomycin also showed tolerance to antimicrobial peptides and increased silkworm-killing activity (34–36). The B. subtilis ykcB-knockout mutant might have resistance against silkworm antimicrobial peptides. In addition, a lipoteichoic acid synthetase gene knockout mutation in S. aureus exhibits increased virulence against Drosophila melanogaster (37), leading to the proposal that lipoteichoic acid is a target molecule of Draper-dependent phagocytosis and lipoteichoic-deficient mutant bacteria escape the phagocytosis (37). The ykcB-knockout mutant might escape phagocytosis by silkworm immune cells because the ykcB-knockout mutant has little lipoteichoic acid.

In conclusion, this study identified that knockout of ykcB leads to reduced vancomycin susceptibility in B. subtilis. The ykcB-knockout mutant exhibited increased virulence in silkworms, in contrast to VISA. Molecular investigation of vancomycin resistance using B. subtilis, a model Gram-positive bacterium, is important to understand the conserved mechanism of vancomycin resistance between bacterial species.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

B. subtilis 168 trpC2 and its mutant strains were aerobically cultured in lysogeny broth (LB) broth at 37°C. B. subtilis mutant strains carrying an erythromycin resistance gene were grown on LB plates containing erythromycin (1 μg/mL), and the colonies were aerobically cultured in LB broth without antibiotics at 37°C. B. subtilis strains transformed with pHY300PLK or pDR110 were cultured in LB broth containing tetracycline (30 μg/mL) or spectinomycin (50 μg/mL). Bacterial strains and plasmids used in this study are listed in Table 2.

TABLE 2.

List of bacterial strains and plasmids used^a

Strain or plasmid	Genotypes or characteristics	Source or reference
Strains
B. subtilis
168	trpC2	BGSC
BKE12880	trpC2 ΔykcB; Ermr	NBRP (21)
BKE12870	trpC2 ΔmhqA; Ermr	NBRP (21)
BKE12890	trpC2 ΔykcC; Ermr	NBRP (21)
BKE21920	trpC2 ΔugtP; Ermr	NBRP (21)
delA	trpC2 delA; Ermr	This study
delB	trpC2 delB; Ermr	This study
delC	trpC2 delC; Ermr	This study
delD	trpC2 delD; Ermr	This study
delE	trpC2 delE; Ermr	This study
delF	trpC2 delF; Ermr	This study
DELP0900	trpC2 ΔykcBC; Ermr	This study
DELP1000	trpC2 delA; Ermr, ykcB Y71Stop	This study
DELP1001	trpC2 delA; Ermr, ykcB Y71Stop, ykcC L55Stop	This study
E. coli
JM109	Host strain for cloning	Takara Bio
Plasmids
pHY300PLK	A shuttle plasmid, Ampr, Tetr	Takara Bio
pHY300PLK-ykcC-FLAG	pHY300PLK with FLAG-tagged ykcC	This study
pGEM-3Z	Cloning vector, Ampr	Promega
pDR110	An integration vector, Ampr, Spcr	BGSC
pDR110-ykcB	pDR110 with ykcB, Ampr, Spcr	This study

^aErm, erythromycin; Amp, ampicillin; Tet, tetracyclin; Spc, spectinomycin.

Screening of vancomycin-tolerant strains.

The BKE library (21) was cultured in LB broth using a 96-well microplate at 37°C, and the bacterial culture was spotted onto LB plates with or without vancomycin (0.45 μg/mL) using a replicator. The plates were incubated overnight at 37°C, and mutant strains whose colonies appeared on vancomycin-containing plates were searched. The experiments were repeated and the strains were judged as vancomycin tolerant when they formed colonies on vancomycin-containing plates in two experiments.

Silkworm killing assay.

Third instar silkworms were purchased from Ehime Sansyu (Ehime, Japan) and raised to fifth instar larvae by feeding them an artificial diet (Silkmate 2S; Nihon Nosan Kogyo Co., Kanagawa, Japan) at 27°C (38–40). The fifth instar hatched silkworms were fed an antibiotic-free artificial diet (Sysmex Co., Hyogo, Japan) for 1 day and used for infection experiments. B. subtilis overnight culture was diluted 5-fold with 0.9% saline, and 0.05 mL was injected into the silkworm hemolymph using a tuberculin syringe equipped with a 27-gauge needle. The optical density at 600 nm (OD₆₀₀) values of B. subtilis overnight cultures were measured to confirm that the injected bacterial numbers were the same between strains.

Genetic manipulation.

(i) Construction of pDR110-ykcB. Genomic DNA of B. subtilis 168 trpC2 was isolated using a QIAamp DNA blood minikit (Qiagen). A DNA fragment containing the ykcB gene was amplified by PCR using a 168 trpC2 genomic DNA as a template and oligonucleotide primers (Table 3). The amplified DNA fragments were inserted into SphI and SalI sites in pDR110, resulting in pDR110-ykcB. Double crossover recombination of pDR110 or pDR110-ykcB at the amyE locus was confirmed by PCR using oligonucleotide primers (Table 3) and template genomic DNA from a spectinomycin-resistant colony.

TABLE 3.

Primers used in this study

Primers	Sequence
Primers to construct pDR110-ykcB
ykcB_compl_F_SalI	GGAGTCGACGGGACATAAGGAGGAACTACTATGGAAAAGAAAAAACGCGAGCT
ykcB_compl_R	GCAGCATGCTATTCATCAGCATGTAGTTCGTATAATGTT
Primers to construct chromosomal deletion mutants
Ab-F	GCAGGCGAGAAAGGAGAGGAGGGAGGAAAGGCAGGA
Ab-R	CGAGGCTCCTGTCACTGCCGCCGTATCTGTGCTCTC
ykcB-F2-SalI	GTCGTCGACGCTGACAGGATGTGAAGCAA
UP1-mhqA-ykcB-inter-R	CTCTCCTTTCTCGCCTGCCCATTTCTCCCAATCAGCAT
UP4-mhqA-ykcB-inter-F	GCAGTGACAGGAGCCTCGGGGTGATTGGTATGGAATGG
ykcB-F2-SalI	GTCGTCGACGCTGACAGGATGTGAAGCAA
3pR-BglII	AGAAGATCTGGCAAACTTCGGTGATTCAT
5pR-BglII	AGAAGATCTGGACAGGGGGTTTGAGGTTA
UP4-mhqA-ykcB-inter-F2	GCAGTGACAGGAGCCTCGTCAAAGTTAGACAAAAAGGAGTGAAA
UP4-ykcB-int-F4	GCAGTGACAGGAGCCTCGTCGTCCTCCTCCTCATTTTG
UP4-ykcB-int-F3	GCAGTGACAGGAGCCTCGTTATGCTTCGTTCGATGCTG
UP4-ykcB-int-F2	GCAGTGACAGGAGCCTCGTCAGGCACTTGCTGGTGTAG
ykcB-int-R	CAGCATCGAACGAAGCATAA
UP1-ykcB-int-R	CTCTCCTTTCTCGCCTGCCAGCATCGAACGAAGCATAA
Primers to introduce stop codon mutation
YkcB-Stop-F	GTAGATAAACCGCCTGTTACATAACAAATCCAAACGATCAGCGCA
YkcB-Stop-R	TGCGCTGATCGTTTGGATTTGTTATGTAACAGGCGGTTTATCTAC
YkcC-Stop-F	AAAGACCGCAGTATTGAGATTTAAAGAGAGCACAGCCTGATCGA
YkcC-Stop-R	TCGATCAGGCTGTGCTCTCTTTAAATCTCAATACTGCGGTCTTT
Primers to construct pHY300PLK-ykcC
ykcBCProHdIII-F	AAAACGCTTTGCCCAAGCTTCGTTTCATGCGGGAACAAAC
ykcBCPro-R	TCATCAGCATGTAGTTTTTGTCTAACTTTGAAA
ykcC-F	ACTACATGCTGATGAATAGGAGGCAAAAACATG
ykcCFLEcI-R	TTTTTTTATAACAGGAATTCTTACTTGTCATCGTCGTCCTTGTAGTCTGACATATGCTGGTCTC
Primers to confirm the replacement of amyE locus
amyE-F	TACAGCACCGTCGATCAAAA
amyE-R	CTCGGTCCTCGTTACACCAT

(ii) Construction of pHY300PLK-ykcC-FLAG. Two DNA fragments containing the promoter region of the ykcBC and ykcC ORF were amplified by PCR using oligonucleotide primers (Table 3) and the template genomic DNA of 168 trpC2. The two DNA fragments were connected by recombinant PCR and inserted into HindIII and EcoRI sites of pHY300PLK, resulting in pHY300PLK-ykcC-FLAG.

(iii) Transformation by electroporation. Because the ykcB mutant did not have natural competency, we performed an electroporation to transform the ykcB mutant. B. subtilis overnight culture (1 mL) was inoculated into 100 mL of LB broth and aerobically cultured at 37°C until the OD₆₀₀ reached 1.5. The culture was cooled on ice for 10 min and centrifuged at 3,000 × g for 10 min at 4°C. The bacterial pellet was suspended in ice-cold water. The washing procedure using ice-cold water was repeated three times and the bacterial pellet was suspended in 1 mL of 30% polyethylene glycol 6000. The bacterial suspension was frozen in liquid nitrogen and stored at −80°C. The frozen cells (100 μL) were thawed and mixed with plasmid DNA (200 ng). Electroporation (25 μF, 2,500 V, 400 Ω) was performed in a 2-mm cuvette using the Gene Pulser Xcell Electroporation System (Bio-Rad, CA, USA). After electroporation, the cells were immediately mixed with 2 mL SOC medium and incubated at 37°C for 90 min. The cells were spread onto LB plates containing appropriate selective antibiotics and incubated overnight at 37°C.

(iv) Construction of chromosome deletion mutant by natural transformation. Targeting cassettes were constructed according to the previously described method (21) with minor modification. A DNA fragment containing the erythromycin resistance marker was amplified by PCR using oligonucleotide primers (Table 3) and a template genomic DNA from the ykcB mutant (BKE12880). The upstream and downstream DNA regions of the targeting chromosome locus were amplified by PCR using oligonucleotide primers (Table 3 and Table 4) and a template genomic DNA from 168 trpC2. The three DNA fragments comprising the upstream and downstream regions and the erythromycin-resistance gene were mixed in an equal molar ratio and connected by PCR overlap extension using KOD FXneo DNA polymerase (Toyobo, Osaka, Japan). The connected DNA fragment was used for transformation without purification.

TABLE 4.

Primer sets used for constructing chromosomal deletion mutants

Strain	Primers
delA	ykcB-F2-SalI, UP1-mhqA-ykcB-inter-R, UP4-mhqA-ykcB-inter-F, 3pR-BglII
delB	ykcB-F2-SalI, UP1-mhqA-ykcB-inter-R, UP4-mhqA-ykcB-inter-F2, 3pR-BglII
delC	ykcB-F2-SalI, UP1-mhqA-ykcB-inter-R, UP4-ykcB-int-F4, 3pR-BglII
delD	ykcB-F2-SalI, UP1-mhqA-ykcB-inter-R, UP4-ykcB-int-F3, 3pR-BglII
delE	ykcB-F2-SalI, UP1-mhqA-ykcB-inter-R, UP4-ykcB-int-F2, 3pR-BglII
delF	ykcB-F2-SalI, UP1-ykcB-int-R, UP4-ykcB-int-F2, 3pR-BglII
DELP0900 (ΔykcBC)	ykcB-F2-SalI, UP1-ykcB-int-R, UP4-ykcC-int-F, 3pR-BglII

Competent cells for natural transformation were prepared according to the previous method (41) with minor modification. B. subtilis 168 trpC2 overnight culture (50 μL) was inoculated into 5 mL of SPI medium (0.2% ammonium sulfate, 1.4% dipotassium hydrogen phosphate, 0.6% potassium dihydrogen phosphate, 0.1% trisodium citrate dihydrate, 0.02% magnesium sulfate heptahydrate, 0.5% glucose, 0.02% Casamino Acids, 0.1% yeast extract, 50 μg/mL l-leucine, and 50 μg/mL l-methionine) and aerobically cultured at 37°C for 4.5 h. Glycerol was added to the bacterial culture to a final concentration of 12.5%, frozen in a liquid nitrogen, and stored in a −80°C freezer. The frozen cells were thawed in a 37°C water bath and a 7.5-fold amount of SPII medium (0.2% ammonium sulfate, 1.4% dipotassium hydrogen phosphate, 0.6% potassium dihydrogen phosphate, 0.1% trisodium citrate dihydrate, 0.02% magnesium sulfate heptahydrate, 0.5% glucose, 5 mM magnesium chloride, 0.02% yeast extract, 5 μg/mL l-leucine, and 5 μg/mL l-methionine) was added, and then the cells were aerobically cultured at 37°C for 90 min. A 50-μL amount of the cells was mixed with a targeting cassette and incubated at 37°C for 30 min. After addition of 100 μL of LB broth to the cells, they were further incubated at 37°C for 60 min. The cells were spread onto LB plates containing 1 μg/mL erythromycin and incubated overnight at 37°C. The desired chromosomal deletion was confirmed by PCR.

(v) Construction of mutant strains carrying the stop codon mutation. A DNA fragment carrying the mhqA-ykcBC region and the erythromycin resistance gene was amplified by PCR using primer pairs (Table 3, ykcB-F2-SalI, 5pR-BglII) and template genomic DNA from the delA mutant. The DNA fragment was inserted into SalI and BglII sites of pGEM-3Z. Using the plasmid as a template, a thermal cycling reaction was performed using oligonucleotide primers to introduce the ykcB stop codon (Table 3). The reaction solution was digested with DpnI and then used to transform the E. coli JM109 strain. A plasmid carrying the ykcB stop codon was purified from the E. coli colonies. Using the plasmid as a template, a thermal cycling reaction was performed using oligonucleotide primers to introduce the ykcC stop codon (Table 3), and the reaction solution was processed as described above. Plasmids carrying the ykcB stop codon and the ykcC stop codon were purified from the E. coli colonies. These two plasmids were digested with SalI and BglII and used for the transformation of 168 trpC2. After transformation, genomic DNA was isolated from the erythromycin-resistant colonies and the desired stop codon mutations were confirmed by Sanger sequencing.

Evaluation of antibiotic resistance.

MIC assay was performed according to a previous study (8) with a minor modification. B. subtilis overnight cultures were diluted 10,000-fold with LB broth and incubated at 37°C for 24 h in the presence of vancomycin (0.2, 0.4, 0.8, and 1.6 μg/mL) with a 96-well microplate (Watson Bio Lab, Tokyo, Japan).

For antibiotic resistance evaluation on an agar plate, autoclaved LB agar medium was mixed with antibiotic solutions and poured into a square dish (Eiken Chemical, Tokyo, Japan). B. subtilis overnight cultures were serially diluted 10-fold with LB broth in a 96-well microplate and 5 μL of the diluted bacterial solutions were spotted onto LB plates with or without antibiotics using an 8-channel Pipetman. The plates were incubated overnight at 37°C and photographed using a digital camera.

Biofilm forming assay.

B. subtilis overnight culture (20 μL) was inoculated into 2 mL of LB broth containing 1 M NaCl in a glass tube and incubated for 2 days at 37°C. The bacterial culture containing biofilms was poured onto a Kimwipe placed on a Kimtowel (Nippon Paper Cresia, Tokyo, Japan). MilliQ water (2 mL) was added to the KimWipe, which was vortexed to detach the biofilms. The OD₆₀₀ value of the solution was measured.

Lipid extraction and thin-layer chromatography assay.

B. subtilis overnight culture (1 mL) was added to 100 mL of LB broth and aerobically cultured at 37°C for 24 h; then, 40 mL of the bacterial culture was centrifuged at 10,400 × g for 10 min at 4°C. The bacterial pellet was suspended with 1 mL of milliQ water, and the lipids were extracted using the Bligh and Dyer method (42). The lipid fraction was evaporated by a centrifuge evaporator and the lipids were dissolved with 500 μL of chloroform:methanol (1:1 vol/vol). The sample was spotted onto thin-layer chromatography (TLC) Silica gel 60 F₂₅₄ (Merck), and the plate was developed in chloroform:methanol:water (65:25:4 vol/vol). Sugars were visualized by spraying a coloring agent (10.5 mL 15% 1-naphthol in ethanol, 40.5 mL ethanol, 6.5 mL sulfuric acid, and 4 mL water) and heating at 115°C.

Western blot analysis.

FLAG-tagged YkcC was detected according to a previous method (36) with minor modifications. B. subtilis overnight cultures was centrifuged at 21,400 × g for 2 min and the bacterial pellet was frozen in liquid nitrogen. The bacterial pellet was thawed in buffer (50 mM Tris-HCl pH 7.8, 2 mM EDTA, 0.5 mM dithiothreitol, and 0.4 mg/mL lysozyme) and subjected to freeze-thawing two times. TritonX-100 was added to the sample to produce a final concentration of 0.1% and the sample was incubated at 37°C for 30 min. An equal volume of 2× Laemmli sample buffer with 350 mM dithiothreitol was added to the sample, and the sample was heated at 95°C for 3 min. The sample was centrifuged at 21,500 × g for 15 min, and the supernatant was electrophoresed in a 12% sodium dodecyl sulfate-polyacrylamide gel. Anti-DYKDDDDK (anti-FLAG) antibody (Wako, Japan) diluted 1:3,000 in Canget signal solution 1 (Toyobo, Osaka, Japan) was used as the first antibody solution. Anti-mouse IgG conjugated with horseradish peroxidase (HRP; Promega, Japan) diluted 1:3,000 in Canget signal solution 2 (Toyobo) was used as a second antibody solution.

For the detection of lipoteichoic acid, a previously described method (43) was used with modifications. B. subtilis overnight culture (50 μL) was inoculated to 5 mL of LB broth and aerobically cultured at 37°C for 24 h. The culture was centrifuged at 10,400 × g for 10 min and the bacterial pellet was suspended in a 1.5× Laemmli sample buffer. The sample was boiled for 40 min and centrifuged at 10,400 × g for 10 min. The supernatants were electrophoresed in a 15% polyacrylamide gel and transferred to a nitrocellulose membrane (0.2 μm; Trans-Blot Transfer Medium; Bio-Rad). The membrane was treated with 1:1,000 anti-lipoteichoic acid antibody (clone 55; Hycult Biotech, Uden, The Netherlands) and washed three times with phosphate-buffered saline. The membrane was treated with anti-mouse IgG HRP conjugate (Promega, WI, USA) and washed 3 times with phosphate-buffered saline. The membrane was reacted with HRP substrate (Western Lightning; Perkin Elmer, MA, USA) and the signals were detected using ImageQuant LAS 4000 (Fujifilm, Tokyo, Japan). The band intensity was measured by ImageJ software (44).

Statistical analysis.

Survival curves of silkworms were analyzed by the log-rank test. The amounts of lipoteichoic acid and diglucosyl diacylglycerol were analyzed by Dunnett’s multiple-comparison test. The amount of biofilm was analyzed by Tukey’s multiple-comparison test. The statistical analysis was performed using Prism 9 (GraphPad Software).