Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2023 Jan 12;13(2):45. doi: 10.1007/s13205-022-03449-z

In vitro and in vivo investigation of chrysin chelated copper complex as biocompatible materials for bone tissue engineering applications

Shikai Zhang 1, Deepa Rani Sadhasivam 2, Sangeetha Soundarajan 3, Priyadarshini Shanmugavel 3, Amutha Raji 4, Min Xu 5,✉
PMCID: PMC9837365  PMID: 36643401

Abstract

Flavonoid metal complexes have interesting properties and are widely explored for bone regeneration owing to their potent biological activity. In the present study, we investigated the biocompatibility and osteogenic properties of the Copper(II)-chrysin complex (C/Cu). The biocompatibility of C/Cu was assessed in vitro with human osteoblastic cells and in vivo using chick embryo and zebrafish models. The C/Cu complex was found to be cytofriendly with good biocompatibility. The osteogenic property of C/Cu was studied at cellular and molecular levels. C/Cu promoted mineralization in osteoblastic cultures by increasing ALP activity. At the molecular level, C/Cu significantly promoted the mRNA levels of osteoblast differentiation marker genes such as runt-related transcription factor 2 (Runx2), Type 1 collagen and ALP. In addition to this, secretory proteins, osteonectin (ON) and osteocalcin (OC) levels were also stimulated. We have also identified that C/Cu exhibited enhanced osteogenic properties and antibacterial activity compared with Chrysin. Thus, C/Cu can be used as an osteogenic agent in bone tissue engineering.

Keywords: Chrysin; Copper(II); Flavonoid metal complex; Osteoblasts, antibacterial property

Introduction

Flavonoids are plant-derived secondary metabolites naturally present in fruit skin, bark, peel and seeds of plants. They are attributed to various biological properties and exert potential health benefits (Mércia Marques et al. 2020; Kumar and Pandey 2013). Flavonoids augment bone formation by increasing bone formation and inhibiting bone resorption to maintain bone health (Jia et al. 2020; Ohyama et al. 2018; Al Mamun et al. 2015; Li et al. 2021; Zeng et al. 2013). Chrysin (5,7-dihydroxyflavone), a naturally occurring flavonoid, is present in high levels in propolis, plants and honey. It exhibits various pharmacological effects including osteogenic, angiogenic, anti-carcinogenic, antiviral and anti-bacterial activities (Song et al. 2020; Spoerlein et al. 2013; Narender et al. 2005; Babu et al. 2006). More specifically, chrysin mediated osteoblast differentiation through the activation of ERK/MAPK signaling (Song et al. 2020). Chrysin treatment increased Runx2, ColA1 and OCN gene expression in pre-osteoblast MC3T3-E1 cells (Xia et al. 2018). In recent past, flavonoid metal complexes are reported for their superior activities over naïve flavonoids counterparts. Flavonoids may cause oxidative injury in the presence of transition metal ions questioning their safety (Kasprzak et al. 2015). The presence of hydroxyl and oxo groups in flavonoids can chelate and coordinate various metal ions to form flavonoid metal complexes (Kasprzak et al. 2015; Kumar et al. 2013; Billiau et al. 1977). In context to bone tissue engineering, flavonoid metal complex holds great promises in enhancing angiogenesis, osteoblast differentiation and mineralization. For instance, silibinin-Cu(II)/Zn(II) complexes stimulated osteoblast differentiation, angiogenesis, and exhibited anti-bacterial properties compared to its uncomplexed flavonoid counterpart. Likewise, quercetin-Cu(II) complex also exhibited an enhanced osteogenic and angiogenic property than quercetin (Vimalraj et al. 2018). Selection of appropriate metal ions for chelation is very crucial in determining the osteogenic property. Copper (Cu) is recently found to maintain bone health and this essential trace mineral is found to maintain bone strength (Rondanelli et al. 2021). In recent years, copper-based biomaterials, orthopaedic and dental implants have been developed to impart anti-infective properties (Degang et al. 2016). Although the role of copper in bone formation is still inconclusive, it is found to activate lysil oxidase for collagen crosslinking (Rucker et al. 1998) and inhibits osteoclastic activity (Li et al. 2007). Copper-enhanced proliferation of osteoblastic cells grown on calcium phosphate cement and elevated the expression of osteocalcin (Ewald et al. 2012). It stimulated two-fold differentiations of MSCs towards osteogenic lineage (Rodríguez et al. 2002). Very recently, Cu coating of titanium implants was found to exhibit bactericidal property and warranted for immediate implant use in infected tooth sockets (Shen et al. 2020). We have also reported silibinin-copper (II) complex and quercetin-copper (II) complex with enhanced biological activities (Rajalakshmi et al. 2018; Vimalraj et al. 2018). Considering these aspects, we have chosen Cu for chelation with chrysin and investigated its osteogenic properties. To assess whether a chrysin metal complex will exhibit better osteogenic properties over chrysin, we investigated the comparative role of chrysin and (C/Cu) towards bone formation in vitro.

Materials and methods

Synthesis of Chrysin-Copper(II) complex

C/Cu complex was synthesized based on previously reported literature (Selvaraj et al. 2011). Briefly, solution A: Chrysin (0.254 g) was dissolved in 5 ml of methanol. Solution B: 0.233 g of Copper(II) acetate dissolved in 20 mL of water. Solution B was added to Solution A slowly and stirred for 4 h at room temperature. The final solution was filtered and washed with distilled water, and dried. The powder was used for further biological experiments. The proposed structure (Scheme 1) of the complex and the physicochemical characterization were adapted from previous literature (Selvaraj et al. 2011).

Scheme 1.

Scheme 1

Open in a new tab

Proposed Chrysin and copper complex structure (Selvaraj et al. 2011)

Biocompatibility assessment

Human MG63 cells were purchased from NCCS, Pune, India and cultured under standard conditions (5% CO2, @ 37 °C) with DMEM and FBS (9:1 ratio). MG63 is a human osteoblast-like cell line derived from a 14-year-old male (Billiau et al. 1977). Equal number of cells was grown in 96 well plates overnight and different concentrations of chrysin and C/Cu. (0–100 μM) was added to respective wells and maintained for 48 h. At the end of the incubation period, a 5 mg/ml MTT solution was added to the wells and incubated for 4 h. MTT solution was removed following incubation and replaced with DMSO. O.D was read at 570 nm. A similar set of experiments was performed and cells were maintained for 72 h. At the completion of the incubation period, a conditioned medium was collected and LDH release was measured based on the assay kit protocol. L.

Alkaline phosphatase (ALP) activity

Different concentrations of chrysin and C/Cu were added to MG63 cells and maintained for 3d. After the treatment period, cells were fixed with 10% neutral buffered formalin followed by ethanol fixation. The fixed cells were incubated with ALP solution for 20 min at 37 °C. ALP solution was prepared based on previous literature (Vimalraj et al. 2020). Finally, p-nitrophenyl phosphate (4 mg/ml) solution was added and ALP activity was measured at 405 nm.

Alizarin red staining

MG63 cells were cultured in 24 wells under osteogenic medium. 50 µM chrysin and C/Cu was treated to cells and osteogenic medium containing chrysin and C/Cu was replenished once in three days. Cells were maintained 7 days and after treatment, it was 1X PBS and fixed 10% formalin for 10 min. Cells were then stained with 2% ethanolic solution of alizarin red reagent (pH 4.2) for 30 min. Cells were washed thrice with distilled water and microscopic images were documented. Quantification was performed following elution in acetic acid and absorbance was measured at 405 nm (Saravanan et al. 2015).

Quantification of osteonectin and osteocalcin

The conditioned medium from Chrysin and C/Cu exposed cells were collected and levels of osteonectin (ON) and osteocalcin (OC) was quantified using ELISA kit as per the manufacturer’s protocol.

Real time RT-PCR analysis

Human MG63 cells were treated with chrysin and C/Cu for 3 and 7 days under osteogenic medium. At the completion of the incubation period, total RNA was isolated using TRIzol and cDNA was synthesized. qPCR analysis was carried out using SYBR green mix (Takara Japan as per the manufacturer’s instruction using specific primers (Table 1). GAPDH was used as a housekeeping gene. ΔΔCt quantification method was used to calculate mRNAs’ fold change (Vimalraj et al. 2014).

Table 1.

List of primer sequences used for real time RT-PCR study

Gene 5′3′ Sequence
Runx2
 Forward GCCTTCAAGGTGGTAGCCC
 Reverse AAGGTGAAACTCTTGCCTCGTC
Type-1 collagen
 Forward TGCGATGACGTGATCTGTGA
 Reverse TTGGTCGGTGGGTGACTCTG
ALP
 Forward ACCATTCCCACG TCTTCACATTT
 Reverse AGACATTCTCTCGTTCACCGCC
GAPDH
 Forward AGAAGGCTGGGGCTCATTTG
 Reverse AGGGGCCATCCACAGTCTTC
Open in a new tab

Alizarin red staining

After treatment, the cells were rinsed with 1X PBS and fixed with 70% ethanol (2 h), and rehydrated with water for 5 min. Then cells were stained with 2% alizarin red reagents (pH 4.2) for 30 min. Cells were washed with distilled water 3 times and images were documented under a microscope. The calcium deposition eluted was measured at 405 nm based on previous literature (Vimalraj et al. 2014).

Antibacterial assay by disc diffusion method

The antibacterial activity of the chrysin and C/Cu complex was tested using disc diffusion method using ATCC strains of Escherichia coli (Gram-negative bacteria) and Staphylococcus aureus (Gram-positive bacteria). Briefly, 100 µl of 1 × 107 CFU/ml of respective strains were spread on the LB agar plates. Equal volumes of Chrysin and C/Cu complexes were loaded onto 10 mm filter paper discs and placed on the agar plates. The plates were maintained at 37 °C incubator for 24 h and zone of growth inhibition was measured and tabulated. Experiment was performed with triplicates.

Minimal inhibitory concentration

MICs for the prepared complex were assessed by broth micro-dilution procedure as reported earlier (Wang et al. 2018). Diluted bacterial cultures of Escherichia coli and Staphylococcus aureus were seeded in 96 well plates at 1X105 CFU/ml and incubated at 37 °C for 24 h under shaking conditions. Chrysin and C/Cu were dissolved and diluted into nutrient broth with 1% final DMSO concentration. After the test period, cell growth was assessed by measuring the OD at 600 nm. MICs of the compound were calculated as least drug concentration in which growth was not observed. Chrysin at equivalent concentration was considered to be a positive control to compare the activity of C/Cu complex.

Protein leakage assessment

To elucidate the antibacterial effect of chrysin and C/Cu complex we used protein leakage assay as reported earlier (Srivastava et al. 2020). MIC levels of chrysin and C/Cu complex were adjusted and treated to S. aureus and E. coli at 106 CFU/ml for 4 h at 37 °C. The samples were then centrifuged at 10,000 g for 20 min at 4 °C and supernatants were estimated for protein content using Bradford assay.

Chick embryo and zebrafish larva toxicity

The chick embryo and zebrafish larva models were employed to analyze the in vivo toxicity of Chrysin and C/Cu complex. The institutional animal ethical committee of Saveetha University in Chennai, India, approved all protocols. Briefly, the fertilized chicken (leghorn) eggs were obtained from Tamil Nadu poultry research center and maintained in standard condition. The toxicity assessed on chick embryos belongs to Hamilton and Hamburger (HH) stages of 1–38. Chrysin and C/Cu complex were injected into the eggs as per the previous protocol (Hamburger and Hamilton 1951; Vimalraj et al. 2022; Kotwani 1998). The analysis was done in replicates (n = 6). For zebrafish larva toxicity, maintenance and breeding of zebrafish were done in standard conditions (Vimalraj et al. 2020; Rubinstein 2006; Bauer et al. 2021). The embryos (4 hpf) were exposed to various concentrations of Chrysin and C/Cu complex for 3 days. Fifty eggs in 100 ml of medium were maintained in petri-plates for each exposure. According to past exploration, which was regarded ideal for the solid improvement of zebrafish incipient organisms and hatchlings, the stacking limits in this and the accompanying tests were picked as no unpredictable advancement issues were observed in the untreated animals during the preliminaries (Vimalraj et al. 2020). After treatment, toxicity was calculated.

Statistical analysis

All experiments were performed in triplicates and data are represented as mean ± SD. Student t -test was used to analyse statistical differences. The p value (p ≤ 0.05) was considered to be statistically significant.

Results and discussion

In vitro and in vivo biocompatibility of Chrysin and Chrysin-Copper(II) complex

Biomaterials intended for bone tissue regeneration should be cytofriendly without exerting cellular toxicity. To be biocompatible, an implant material must be able to perform in vivo without causing any unwanted local or systemic responses. Biomaterials are tested on tissues and animals to ensure their safety and effectiveness before being used in human fracture repair. To assess the biocompatibility of (C/Cu) complex in vitro, we investigated it at two levels (a) metabolic activity and (b) cell membrane integrity. Initially, MG63 cells were treated with chrysin and C/Cu complex at different concentrations (5–100 µM) for 48 h and MTT-based metabolic assessment was performed (Fig. 1). The cells experienced no toxicity till 50 µM but a significant reduction in metabolic activity was observed at 100 µM. A similar trend was observed in both chrysin and C/Cu treated groups. Surprisingly, at 25 and 50 µM C/Cu treated groups showed an increase in the metabolic activity. LDH leakage was quantified (Fig. 2) and results depicted that cells treated with chrysin and C/Cu complex till 50 µM showed no significant increase in LDH leakage compared to control. However, at 100 µM there was a significantly increased level of LDH release from cells indicating the toxicity at higher doses. LDH is an intracellular enzyme that leaks into the conditioned medium when the plasma membrane integrity is compromised. From our observations it is clear that chrysin and C/Cu is found to be physiologically safe till 50 µM with no discernible toxicity. Next, we evaluated the in vivo toxicity of Chrysin and C/Cu complex using a chick embryo model. Chicken embryos exhibit rapid development and allow administration of various substances and facilitate direct visualization. Therefore, this model was utilized to assess the toxicity of the prepared complex. The upsides of utilizing this model are (1) cheap, (2) devours less time and (3) the chick embryo development isn’t affected by the maternal impact which empowers to report the direct poisonous impact of the compound on the undeveloped organism (Veeriah et al. 2015). Three days embryos were treated with various groupings of Chrysin and C/Cu complex and the toxicity impact was analyzed on day 12. After the analysis, the actual physical parameters, for example, heart rate (bpm), hemorhage (rupture blood vessels), weight of heart (mg), micromelia (smallness of one limb), length of animal (cm), polydactyly (extra finger), twisted neck, weight of body (g), microphthalmia (abnormal eyes), omphalocele (organ develop outside), and exencephaly (brain outside skull) were inspected to notice the distinction in development rate among the groups in correlation with untreated organisms (Table 2). The result indicated no harmful impact and disfigurements in the embryos’ development with all the concentrations of chrysin and C/Cu. The results indicated no dose dependent toxicity and have no effect on embryo development.

Fig. 1.

Fig. 1

Open in a new tab

A Biocompatibility assessment of Chrysin and C/Cu. Different concentrations of Chrysin and C/Cu (5–100 μM) were treated to MG63 cells up to 48 h and MTT assay was performed B LDH leakage measurements in the conditioned medium of cells treated with chrysin and C/Cu for 72 h. #–indicates a significant increase compared to control and asterisk (*) indicates a significant decrease compared to control (p ≤ 0.05)

Fig. 2.

Fig. 2

Open in a new tab

A Toxicity assessment of chrysin and C/Cu in zebrafish larvae. A Representative images of zebrafish larvae exposed with Chrysin and C/Cu (100 μM) are shown. B graph indicating the percentage of animals. No statistical significance was observed between concentrations of C/Cu

Table 2.

Toxicity studies of Chrysin and C/Cu using chick embryo model

Group Animal condition Heart rate (Bpm) Weight of body (g) Weight of heart (mg) Length of animal (cm) Twisted neck (%) Hemorhage (rupture blood vessels) (%) Microphthalmia (abnormal eyes) (%) Polydactyly (extra finger) (%) Micromelia (smallness of one limb) (%) Excencephaly (brain outside skull) (%) Omphalocele (organ develop outside) (%)
Control Live 57.4 ± 4.7 4.4 ± 0.9 64 ± 12 5.5 ± 0.7 0 0 0 0 0 0 0
Chrysin (25 µM) Live 56 ± 6.3 4.5 ± 0.6 62 ± 10 5.6 ± 0.5 0 0 0 0 0 0 0
Chrysin (50 µM) Live 55.7 ± 5.6 4.5 ± 0.7 60 ± 10 5.4 ± 0.7 0 0 0 0 0 0 0
Chrysin (100 µM) Live 55 ± 4.3 4.4 ± 1.1 63 ± 8 5.3 ± 1.1 0 0 0 0 0 0 0
Chrysin-Cu(II) (25 µM) Live 57.3 ± 3.8 4.6 ± 0.9 61 ± 11 5.7 ± 1.1 0 0 0 0 0 0 0
Chrysin-Cu(II) (50 µM) Live 55.6 ± 6.7 4.3 ± 1.3 59 ± 15 5.4 ± 0.9 0 0 0 0 0 0 0
Chrysin-Cu(II) (100 µM) Live 55.5 ± 5.5 4.1 ± 1.5 60 ± 6 5.5 ± 1.2 0 0 0 0 0 0 0
Open in a new tab

The percentage mean represented for each group have obtained from three independent experiments ± SD and 50 eggs were used for each treatment groups

Zebrafish embryo is a typical research model, broadly utilized for in vivo toxicity examination because of key benefits of the simplicity of availability, quick early stage development, little in size, solid rearing limit, optically straightforward and solid genome-like comparability with higher mammals. The embryogenesis of zebrafish is accomplished within 72 hpf, distinguishable organs and tissues are shaped by 120 hpf that enabling it to screen the survival rate of any treatment (Horzmann and Freeman 2018). During 3 days, no toxic effects of Chrysin and C/Cu complex exposure on zebrafish embryos were detected, and toxicity was induced by Chrysin and C/Cu is documented in Fig. 2. Representative images are presented in Fig. 2A and the lethality percent is shown in Fig. 2B. The results showed that there was no toxic effect of both Chrysin and C/Cu complex treatment was observed.

Copper ion chelation enhanced the osteogenic differentiation ability of chrysin

Chrysin is known for its osteogenic role and enhanced mineralization in osteoblastic cultures. We speculated that by chelating copper ion with chrysin may enhance the osteogenic property. Initially, MG63 cells were exposed to various concentrations (0–100 µM) of chrysin and C/Cu separately for 3 days and ALP activity was measured (Fig. 3A). ALP belongs to zinc metalloprotein enzymes family and highly found in mineralized tissues. Bone ALP is elevated due to increased osteoblast activity. It is involved in the hydrolysis of inorganic pyrophosphate, a natural inhibitor of bone mineralization (Orimo 2010). Both chrysin and C/Cu showed an increased ALP activity at 25 µM concentration. In addition to this, C/Cu exhibited a significant increase in the ALP activity compared to Chrysin. This clearly indicates that Cu chelation enhances the osteogenic activity of chrysin. An ideal compound/material for bone tissue regeneration would promote osteoblast differentiation and mineralization. Bone mineralization is the extracellular physiological deposition of calcium phosphate. The outcome from the experiment (Fig. 3A) showed significant upregulation of ALP activity by 50 μM of Chrysin and C/Cu complex when compared to control or other concentration of this complex. Therefore, next we examined the level of matrix mineralization by alizarin red staining. Photographic images of alizarin red stained wells of untreated cells and cells treated with chrysin and C/Cu (Fig. 3B) clearly demonstrated that chelation of copper to chrysin significantly enhanced calcium deposition and also observed by the quantification plot (Fig. 3C). We observed an increase in calcium deposition upon chrysin treatment compared to control and this was further enhanced by copper chelation. This property may be attributed to the presence of copper. Cu containing bioactive glass scaffolds promoted osteogenic differentiation (Wu et al. 2013). It serves as cofactor for the enzyme lysyl oxidase which is involved in collagen crosslinking essential for mineralization (Bernhardt et al. 2021). Overall, we corroborate that C/Cu complex outperformed the uncomplexed chrysin in osteogenic differentiation and matrix mineralization at cellular level.

Fig. 3.

Fig. 3

Open in a new tab

A ALP activity measurements of osteoblastic cells stimulated by different concentrations of chrysin and C/Cufor 3 days. # Indicates significant increase compared to control and $- indicates significant increase compared between test compounds. B Representative photographic images of alizarin red stained osteoblasts grown under osteogenic medium supplemented with 50 µM chrysin and C/Cu. C Quantified plots of calcium deposition. #- Indicates significant increase compared to control (p ≤ 0.05)

C/Cu complex elevated the osteogenic differentiation markers at molecular level

To further document the impact of Chrysin and complex/Cu in osteogenesis at the molecular level, human osteoblastic cells were treated with 25 μM of Chrysin and C/Cu for 3 and 7 days. Total RNA was isolated and the mRNA expression profile of osteoblast differentiation marker genes Runx2, Col-I and ALP was assessed (Fig. 4). Runx2 is a bone specific transcription factor essential for osteoblast differentiation and is required for the expression of biomarkers expression like ALP, type 1 collagen, OCN and ON. From the results, it is evident that mRNA expression of Runx2, Col-I and ALP is increased upon chrysin treatment and further enhanced in the presence of C/Cu. Both 3 and 7 days expression follows a similar pattern of increase in response to chrysin and C/Cu exposure. Chrysin is already known to promote osteogenic differentiation by ERK/MAPK activation (Song et al. 2020). Copper is found to be promising for its application in bone implants owing to its stimulatory role on osteogenesis. Osteoblasts cultured on copper containing 316L stainless steel implant exhibited an enhancement in osteogenesis via activation of Akt signaling. Rux2, ALP and Col-I levels were also found to be upregulated (Yuan et al. 2019). Our results are in concordant with these previous reports indicating the positive role of copper. Interlinked type 1 collagen constitutes the organic bone matrix. It contains accessory proteins including osteocalcin and osteonecin which is essential for linking bone mineral to collagen matrix (Termine et al. 1981). It is an important indicator of synthetic activity of osteoblasts. Therefore, we measured the levels of secreted proteins such as OC (Fig. 6A) and ON (Fig. 6B The results (Fig. 6A, B) indicated an increased secretory levels of OC and ON by osteoblasts upon treatment with chrysin and this is further enhanced in cells exposed to C/Cu indicative of its superior property compared to naïve chrysin. Nucleation of mineral phase deposition is mediated by osteonectin collagen complex solid skeletal tissue (Termine et al. 1981). Elevated expression of type 1 collagen and secretions of OC and ON is attributed to the enhanced osteogenic role of C/Cu which is evident by calcium deposition (Figs. 3, 4 and 5) mineralization. Altogether, the cellular and molecular studies revealed that Chrysin enhanced osteoblast differentiation and it was further enhanced it was chelated with copper.

Fig. 4.

Fig. 4

Open in a new tab

Chrysin and C/Cu promotes osteoblast differentiation at molecular level. MG63 cells were exposed with 50 µM chrysin and C/Cu for stipulated time points, and mRNA expression was analyzed by real time RT-PCR analysis. A Runx2, B Col-I and C ALP and GAPDH mRNA used as internal control. *-Significant increase compared to control (p ≤ 0.05)

Fig. 6.

Fig. 6

Open in a new tab

Effect of chrysin and C/Cu on protein leakage in E. coli and S. aureus. Bacterial cells were treated with respective MIC of chrysin and C/Cu for 4 h. Protein levels were estimated by lowry method. #-Indicates a significant increase compared to control/chrysin (p ≤ 0.05)

Fig. 5.

Fig. 5

Open in a new tab

Chrysin and C/Cu increased the secretory levels of osteocalcin and osteonectin. MG63 cells were treated with Chrysin and C/Cu for 7 days and osteocalcin (A) and osteonectin (B) was measured by ELISA. #-Significant increase compared to control (p ≤ 0.05)

Antibacterial activity of Chrysin and Chrysin-Copper(II) complex

Bacterial infection poses serious risk to the implanted material leading to implant failure. It results in reduced efficacy of biomaterials, and tissue implants, in severe cases may end in mortality. Administration of antimicrobial agents to combat implant related infections causes the emergence of multidrug-safe bacterial strains (Özdemir et al. 2016). As a result, there is a desire to impart antibacterial properties to the implanted biomaterial to minimize implant associated infections and administration of antibiotics. Chrysin exhibits antibacterial activity against both gram positive and gram negative bacterial species (Adamczak et al. 2020). The antibacterial effects of Chrysin have been documented in the previous reports (Babu et al. 2006; Adamczak et al. 2020). We were ambitious that chelation of chrysin with copper will further improve its antibacterial property. To assess this, initially, we performed simple disc diffusion method to compare the antibacterial properties of chrysin and C/Cu by measuring the zone of inhibition. Table 3 depicted the diameter of growth inhibition of chrysin was 6.09 ± 0.66 and 6.18 ± 0.93 against S. aureus and E. coli respectively. However, the growth inhibition was further increased to 9.12 ± 0.98 and 10.33 ± 1.13 with C/Cu treatment. The minimal inhibitory concentration assessment revealed that the metal complex showed higher inhibition than naïve chrysin against both S. aureus and E. coli (Table 3).

Table 3.

Antibacterial activity studies of chrysin and C/Cu using zone of inhibition and minimal inhibitory concentration (MIC) method

Zone of inhibition (mm)
Chrysin C/Cu Penicillin
Staphylococcus aureus 6.09 ± 0.66 9.12 ± 0.98 16 ± 1.12
Escherichia coli 6.18 ± 0.93 10.33 ± 1.13 21 ± 1.33
MIC (µg/ml)
Staphylococcus aureus 70 40 –
Escherichia coli 50 30
Open in a new tab

Numerous reports found that flavonoids exert antibacterial activity by (a) inhibition of nucleic acid synthesis, (b) inhibition of biofilm formation, (c) increasing the membrane permeability and decreasing fluidity of cell membrane and binding to vital enzymes such as DNA gyrase (Xie et al. 2015; Górniak et al. 2019; Ohemeng et al. 1993; Lee et al. 2011). Copper is also a well-known antibacterial agent (Salah et al. 2021). Its antibacterial property is attributed through various routes, by damaging DNA, altering protein synthesis and altering membrane integrity (Warnes et al. 2010; Chaturvedi and Henderson 2014; Grass et al. 2011; Vincent et al. 2018; Chandramohan et al. 2021; Vimalraj et al. 2019; Vadivel et al. 2020). Finally, we were interested to check whether the antibacterial effect of the C/Cu is mediated via the alteration in membrane permeability. Both chrysin and Cu are known to disrupt membrane integrity in bacterial cells. The protein leakage assay (Fig. 6) clearly indicated that C/Cu outperforms chrysin or control by significantly disrupting the cell membrane integrity as indicated by higher protein leakage.

Conclusion

C/Cu is found to be cytofriendly and biocompatible both in vitro and in vivo. Chelation of copper with chrysin significantly improved the osteogenic property by increasing osteogenic differentiation and mineralization. The molecular assessment revealed that C/Cu increased the expression of bone specific differentiation marker genes. The biological property of chrysin was outperformed by C/Cu. Finally, it also exhibited antibacterial ability against both gram-positive and gram-negative bacteria. Overall, C/Cu could be a promising agent to improve osteogenesis for bone tissue engineering applications. In critical-sized bone defects employing scaffolds, it could be either as an individual bioactive agent or in combination with various biomaterial constructs to promote osteogenesis and antibacterial functionality. Apart from this, it could be combined with hydrogels and used for bone tissue regeneration. We believe that copper release from the complex and chrysin by itself will aid in effective bone regeneration by its intrinsic osteogenic property and negate implant-associated infections. This research has the potential to be expanded in the future to include the fabrication of bone regenerating matrices and testing in rodents with critical-sized bone defects, as well as in chick embryo and zebrafish models. However, more research and in vivo experiments are needed to warrant their potential applications in bone tissue engineering.

Declarations

Conflict of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Contributor Information

Deepa Rani Sadhasivam, Email: drdeepaarivan@gmail.com.

Min Xu, Email: xumin012@outlook.com.

References

  1. Adamczak A, Ożarowski M, Karpiński TM. Antibacterial activity of some flavonoids and organic acids widely distributed in plants. J Clin Med. 2020;9(1):109. doi: 10.3390/jcm9010109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Al Mamun MA, Hosen MJ, Islam K, Amina Khatun M, Alam M, Al-Bari MAA. Tridax procumbens flavonoids promote osteoblast differentiation and bone formation. Biol Res. 2015;48(1):1–8. doi: 10.1186/s40659-015-0056-1. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  3. Babu KS, Hari Babu T, Srinivas PV, Hara Kishore K, Murthy USN, Madhusudana Rao J. Synthesis and biological evaluation of novel C (7) modified chrysin analogues as antibacterial agents. Bioorg Med Chem Lett. 2006;16(1):221–224. doi: 10.1016/j.bmcl.2005.09.009. [DOI] [PubMed] [Google Scholar]
  4. Bauer B, Mally A, Liedtke D. Zebrafish embryos and larvae as alternative animal models for toxicity testing. Int J Mol Sci. 2021;22(24):13417. doi: 10.3390/ijms222413417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bernhardt A, Bacova J, Gbureck U, Gelinsky M. Influence of Cu2+ on osteoclast formation and activity in vitro. Int J Mol Sci. 2021;22(5):2451. doi: 10.3390/ijms22052451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Billiau A, Edy VG, Heremans H, Van Damme J, Desmyter J, Georgiades JA, et al. Human interferon: mass production in a newly established cell line, MG-63. Antimicrob Agents Che Mother. 1977;12:11–15. doi: 10.1128/aac.12.1.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chandramohan Y, Jeganathan K, Sivanesan S, Koka P, Amritha TMS, Vimalraj S, Dhanasekaran A. Assessment of human ovarian follicular fluid derived mesenchymal stem cells in chitosan/PCL/Zn scaffold for bone tissue regeneration. Life Sci. 2021;1(264):118502. doi: 10.1016/j.lfs.2020.118502. [DOI] [PubMed] [Google Scholar]
  8. Chaturvedi KS, Henderson JP. Pathogenic adaptations to host-derived antibacterial copper. Front Cell Infect Microbiol. 2014;4:3. doi: 10.3389/fcimb.2014.00003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ewald A, Käppel C, Vorndran E, Moseke C, Gelinsky M, Gbureck U. The effect of Cu (II)-loaded brushite scaffolds on growth and activity of osteoblastic cells. J Biomed Mater Res Part A. 2012;100(9):2392–2400. doi: 10.1002/jbm.a.34184. [DOI] [PubMed] [Google Scholar]
  10. Górniak I, Bartoszewski R, Króliczewski J. Comprehensive review of antimicrobial activities of plant flavonoids. Phytochem Rev. 2019;18(1):241–272. [Google Scholar]
  11. Grass G, Rensing C, Solioz M. Metallic copper as an antimicrobial surface. Appl Environ Microbiol. 2011;77(5):1541–1547. doi: 10.1128/AEM.02766-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. J Morphol. 1951;88(1):49–92. [PubMed] [Google Scholar]
  13. Horzmann KA, Freeman JL. Making waves: new developments in toxicology with the zebrafish. Toxicol Sci. 2018;163(1):5–12. doi: 10.1093/toxsci/kfy044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jia L, Shi L, Li J, Zeng Y, Tang S, Liu W, Mo X, Liu X. Total flavonoids from celery suppresses RANKL-induced osteoclast differentiation and bone resorption function via attenuating NF-κB and p38 pathways in RAW264 7 cells. J Funct Foods. 2020;69:103949. [Google Scholar]
  15. Jucá MM, Filho FMSC, de Almeida JC, da Silva Mesquita D, de MoraesBarriga JR, Dias KCF, Barbosa TM, et al. Flavonoids: biological activities and therapeutic potential. Natl Prod Res. 2020;34(5):692–705. doi: 10.1080/14786419.2018.1493588. [DOI] [PubMed] [Google Scholar]
  16. Kasprzak MM, Erxleben A, Ochocki J. Properties and applications of flavonoid metal complexes. RSC Adv. 2015;5(57):45853–45877. [Google Scholar]
  17. Kotwani A. Use of chick embryo in screening for teratogenicity. Indian J Physiol Pharmacol. 1998;42(2):189–204. [PubMed] [Google Scholar]
  18. Kumar S, Pandey AK. Chemistry and biological activities of flavonoids: an overview. Sci World J. 2013;3:379. doi: 10.1155/2013/162750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kumar S, Mishra A, Pandey AK. Antioxidant mediated protective effect of Parthenium hysterophorus against oxidative damage using in vitro models. BMC Complement Altern Med. 2013;13(1):1–9. doi: 10.1186/1472-6882-13-120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lee J-H, Regmi SC, Kim J-A, Cho MH, Yun H, Lee C-S, Lee J. Apple flavonoid phloretin inhibits Escherichia coli O157: H7 biofilm formation and ameliorates colon inflammation in rats. Infect Immun. 2011;79(12):4819–4827. doi: 10.1128/IAI.05580-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li BB, Yu SF. In vitro study of the effects of copper ion on osteoclastic resorption in various dental mineralized tissues. Chin J Stomatol. 2007;42(2):110–113. [PubMed] [Google Scholar]
  22. Li Y, Liu L, Wan P, Zhai Z, Mao Z, Ouyang Z, Yu D, et al. Biodegradable Mg-Cu alloy implants with antibacterial activity for the treatment of osteomyelitis: in vitro and in vivo evaluations. Biomaterials. 2016;106:250–263. doi: 10.1016/j.biomaterials.2016.08.031. [DOI] [PubMed] [Google Scholar]
  23. Li S, Zhou H, Cheng Hu, Yang J, Ye J, Zhou Y, Li Z, Chen L, Zhou Q. Total flavonoids of Rhizoma Drynariae promotes differentiation of osteoblasts and growth of bone graft in induced membrane partly by activating Wnt/β-catenin signaling pathway. Front Pharmacol. 2021;12:1245. doi: 10.3389/fphar.2021.675470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Narender P, Srinivas U, Gangadasu B, Biswas S, Jayathirtha Rao V. Anti-malarial activity of Baylis-Hillman adducts from substituted 2-chloronicotinaldehydes. Bioorg Med Chem Lett. 2005;15(24):5378–5381. doi: 10.1016/j.bmcl.2005.09.008. [DOI] [PubMed] [Google Scholar]
  25. Ohemeng KA, Schwender CF, Fu KP, Barrett JF. DNA gyrase inhibitory and antibacterial activity of some flavones (1) Bioorg Med Chem Lett. 1993;3(2):225–230. [Google Scholar]
  26. Ohyama Y, Ito J, Kitano VJ, Shimada J, Hakeda Y. The polymethoxy flavonoid sudachitin suppresses inflammatory bone destruction by directly inhibiting osteoclastogenesis due to reduced ROS production and MAPK activation in osteoclast precursors. PLoS ONE. 2018;13(1):e0191192. doi: 10.1371/journal.pone.0191192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Orimo H. The mechanism of mineralization and the role of alkaline phosphatase in health and disease. J Nippon Med Sch. 2010;77(1):4–12. doi: 10.1272/jnms.77.4. [DOI] [PubMed] [Google Scholar]
  28. Özdemir BÇ, Kurtiş B, Tüter G, Şengüven B, Yildirim B, Özcan G. Osteocalcin and osteonectin expression after double-application of platelet-rich plasma in rabbits. J Istanbul Univ Fac Dent. 2016;50(2):1–9. doi: 10.17096/jiufd.40536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Rajalakshmi S, Vimalraj S, Saravanan S, Preeth DR, Shairam M, Anuradha D. Synthesis and characterization of silibinin/phenanthroline/neocuproine copper (II) complexes for augmenting bone tissue regeneration: an in vitro analysis. JBIC J Biol Inorg Chem. 2018;23(5):753–762. doi: 10.1007/s00775-018-1566-4. [DOI] [PubMed] [Google Scholar]
  30. Rodríguez JP, Rios S, Gonzalez M. Modulation of the proliferation and differentiation of human mesenchymal stem cells by copper. J Cell Biochem. 2002;85(1):92–100. [PubMed] [Google Scholar]
  31. Rondanelli M, Faliva MA, Infantino V, Gasparri C, Iannello G, Perna S, Riva A, Petrangolini G, Tartara A, Peroni G. Copper as dietary supplement for bone metabolism: a review. Nutrients. 2021;13(7):2246. doi: 10.3390/nu13072246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rubinstein AL. Zebrafish assays for drug toxicity screening. Expert Opin Drug Metab Toxicol. 2006;2(2):231–240. doi: 10.1517/17425255.2.2.231. [DOI] [PubMed] [Google Scholar]
  33. Rucker RB, Kosonen T, Clegg MS, Mitchell AE, Rucker BR, Uriu-Hare JY, Keen CL. Copper, lysyl oxidase, and extracellular matrix protein cross-linking. Am J Clin Nutr. 1998;67(5):996S–1002S. doi: 10.1093/ajcn/67.5.996S. [DOI] [PubMed] [Google Scholar]
  34. Saravanan S, Vimalraj S, Vairamani M, Selvamurugan N. Role of mesoporous wollastonite (calcium silicate) in mesenchymal stem cell proliferation and osteoblast differentiation: a cellular and molecular study. J Biomed Nanotechnol. 2015;11(7):1124–1138. doi: 10.1166/jbn.2015.2057. [DOI] [PubMed] [Google Scholar]
  35. Salah I, Parkin IP, Allan E. Copper as an antimicrobial agent: recent advances. RSC Adv. 2021;11:18179–18186. doi: 10.1039/D1RA02149D. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Selvaraj S, Krishnaswamy S, Devashya V, Sethuraman S, Krishnan UM. Investigations on membrane perturbation by chrysin and its copper complex using self-assembled lipid bilayers. Langmuir. 2011;27(21):13374–13382. doi: 10.1021/la2029356. [DOI] [PubMed] [Google Scholar]
  37. Shen X, Wenjia Hu, Ping L, Liu C, Yao L, Deng Z, Gang Wu. Antibacterial and osteogenic functionalization of titanium with silicon/copper-doped high-energy shot peening-assisted micro-arc oxidation technique. Front Bioeng Biotechnol. 2020;8:1138. doi: 10.3389/fbioe.2020.573464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Song JH, Moon KY, Lee SC, Kim SS. Inhibition of hypoxia-inducible factor-1α and vascular endothelial growth factor by chrysin in a rat model of choroidal neovascularization. Int J Mol Sci. 2020;21(8):2842. doi: 10.3390/ijms21082842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Spoerlein C, Mahal K, Schmidt H, Schobert R. Effects of chrysin, apigenin, genistein and their homoleptic copper (II) complexes on the growth and metastatic potential of cancer cells. J Inorg Biochem. 2013;127:107–115. doi: 10.1016/j.jinorgbio.2013.07.038. [DOI] [PubMed] [Google Scholar]
  40. Srivastava T, Mishra SK, Tiwari OP, Sonkar AK, Tiwari KN, Kumar P, Dixit J, et al. Synthesis, characterization, antimicrobial and cytotoxicity evaluation of quaternary cadmium (II)-quercetin complexes with 1, 10-phenanthroline or 2, 2’-bipyridine ligands. Biotechnol Biotechnol Equip. 2020;34(1):999–1012. [Google Scholar]
  41. Termine JD, Kleinman HK, Whitson SW, Conn KM, McGarvey ML, Martin GR. Osteonectin, a bone-specific protein linking mineral to collagen. Cell. 1981;26(1):99–105. doi: 10.1016/0092-8674(81)90037-4. [DOI] [PubMed] [Google Scholar]
  42. Vadivel S, Vincent P, Sekaran S, VisagaAmbi S, Muralidar S, Selvaraj V, Palaniappan B, Thirumalai D. Inflammation in myocardial injury- stem cells as potential immunomodulators for myocardial regeneration and restoration. Life Sci. 2020;1(250):117582. doi: 10.1016/j.lfs.2020.117582. [DOI] [PubMed] [Google Scholar]
  43. Veeriah V, Saran U, Swaminathan A, Balaguru UM, Thangaraj P, Nagarajan S, Rajendran VK, Chatterjee S. Cadmium-induced embryopathy: nitric oxide rescues teratogenic effects of cadmium. Toxicol Sci. 2015;144(1):90–104. doi: 10.1093/toxsci/kfu258. [DOI] [PubMed] [Google Scholar]
  44. Vimalraj S, Partridge NC, Selvamurugan N. A positive role of microRNA-15b on regulation of osteoblast differentiation. J Cell Physiol. 2014;229(9):1236–1244. doi: 10.1002/jcp.24557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Vimalraj S, Rajalakshmi S, Preeth DR, Kumar SV, Deepak T, Gopinath V, Murugan K, Chatterjee S. Mixed-ligand copper (II) complex of quercetin regulate osteogenesis and angiogenesis. Mater Sci Eng. 2018;83:187–194. doi: 10.1016/j.msec.2017.09.005. [DOI] [PubMed] [Google Scholar]
  46. Vimalraj S, Saravanan S, Anuradha D, Chatterjee S. Models to investigate intussusceptive angiogenesis: a special note on CRISPR/Cas9 based system in zebrafish. Int J Biol Macromol. 2019;15(123):1229–1240. doi: 10.1016/j.ijbiomac.2018.11.164. [DOI] [PubMed] [Google Scholar]
  47. Vimalraj S, Saravanan S, Hariprabu G, Yuvashree R, AjiethKanna SK, Sujoy K, Anjali D. Kaempferol-zinc(II) complex synthesis and evaluation of bone formation using zebrafish model. Life Sci. 2020;256:117993. doi: 10.1016/j.lfs.2020.117993. [DOI] [PubMed] [Google Scholar]
  48. Vimalraj S, Renugaa S, Dhanasekaran A. Chick embryo chorioallantoic membrane: a biomaterial testing platform for tissue engineering applications. Process Biochem. 2022;124:81–91. doi: 10.1016/j.procbio.2022.11.007. [DOI] [Google Scholar]
  49. Vincent M, Duval RE, Hartemann P, Engels-Deutsch M. Contact killing and antimicrobial properties of copper. J Appl Microbiol. 2018;124(5):1032–1046. doi: 10.1111/jam.13681. [DOI] [PubMed] [Google Scholar]
  50. Wang S, Yao J, Zhou Bo, Yang J, Chaudry MT, Wang Mi, Xiao F, Li Y, Yin W. Bacteriostatic effect of quercetin as an antibiotic alternative in vivo and its antibacterial mechanism in vitro. J Food Prot. 2018;81(1):68–78. doi: 10.4315/0362-028X.JFP-17-214. [DOI] [PubMed] [Google Scholar]
  51. Warnes SL, Green SM, Michels HT, Keevil CW. Biocidal efficacy of copper alloys against pathogenic enterococci involves degradation of genomic and plasmid DNAs. Appl Environ Microbiol. 2010;76(16):5390–5401. doi: 10.1128/AEM.03050-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wu C, Zhou Y, Mengchi Xu, Han P, Chen L, Chang J, Xiao Y. Copper-containing mesoporous bioactive glass scaffolds with multifunctional properties of angiogenesis capacity, osteostimulation and antibacterial activity. Biomaterials. 2013;34(2):422–433. doi: 10.1016/j.biomaterials.2012.09.066. [DOI] [PubMed] [Google Scholar]
  53. Xia B, Hong T, He X. Effect of anti-inflammatory flavonoid chrysin on osteogenesis of preosteoblast MC3T3-E1 cells. Shanghai J Stomatol. 2018;27(3):261–264. [PubMed] [Google Scholar]
  54. Xie Y, Yang W, Tang F, Chen X, Ren L. Antibacterial activities of flavonoids: structure-activity relationship and mechanism. Curr Med Chem. 2015;22(1):132–149. doi: 10.2174/0929867321666140916113443. [DOI] [PubMed] [Google Scholar]
  55. Yuan Y, Jin S, Qi X, Chen X, Zhang W, Yang Ke, Zhong H. Osteogenesis stimulation by copper-containing 316L stainless steel via activation of Akt cell signaling pathway and Runx2 upregulation. J Mater Sci Technol. 2019;35(11):2727–2733. [Google Scholar]
  56. Zeng W, Yan Y, Zhang F, Zhang C, Liang W. Chrysin promotes osteogenic differentiation via ERK/MAPK activation. Protein Cell. 2013;4(7):539–547. doi: 10.1007/s13238-013-3003-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES