Abstract
Avian pathogenic Escherichia coli (APEC) and uropathogenic E. coli (UPEC) can cause vast infections in humans and poultry. The present study was conducted to compare the isolates of the APEC and UPEC pathotypes on the basis phenotypic and genotypic features of antibiotic resistance and phylogenetic differences. Total number of 70 identified E. coli strains, including 35 APEC and 35 UPEC isolates, were isolated from avian colibacillosis and human urinary tract infection (UTI), and were subjected to the antimicrobial susceptibility testing, polymerase chain reaction (PCR) detection of the resistance genes, phylogenetic grouping and DNA fingerprinting with enterobacterial repetitive intergenic consensus PCR (ERIC - PCR) to survey the variability of the isolates. The most resistance rates among all E. coli isolates were, respectively, obtained for Ampicillin (84.20%) and sulfamethoxazole-trimethoprim (65.70%). The APEC and UPEC isolates showed the most susceptibility to imipenem and gentamycin, respectively. Among 70 APEC and UPEC isolates 34.20%, 32.80%, 20.00%, and 12.80% belonged to the A, B2, D, and B1 phylogenetic groups, respectively. Analysis of the DNA fingerprinting phylogenetic tree showed 10 specific clusters of APEC and UPEC isolates. According to the results, the most effective antibiotics and the phenotypic and genotypic predominant resistance patterns of the APEC and UPEC isolates were different. Moreover, APECs and UPECs showed various dominant phylogenetic groups. With all descriptions, the APEC isolates still are potential candidates for carrying important resistance genes and can be one of the possible strains related to human infections.
Key Words: E. coli pathotypes, ERIC-PCR, Resistance genes
Introduction
Extraintestinal pathogenic Escherichia coli (ExPEC) strains convey resistance and virulence factors which cause the endurance and growth of the bacterium outside of their host intestine. Among various types of ExPEC, uropathogenic E. coli (UPEC) and avian pathogenic E. coli (APEC) are, respectively, responsible for urinary tract infections (UTIs) in human and avian colibacillosis with vast economic and health adverse effects on society.1 Recent studies about genomic characteristics of the APEC and UPEC, such as antibiotic resistance genes and virulence factors indicated that there were similarities and proximity between these types of E. coli2 which had potential risk of zoonotic and pandemic outbreaks.3 Different antibiotics such as β-lactams, aminoglycosides, sulfonamides and fluoroquinolones are the major choice for avian colibacillosis outbreaks in poultry farms all around the world. The incessant usage of these antibiotics in the cycle of poultry breeding has contributed to the emergence of antimicrobial-resistant E. coli in human infections.4-6 UPEC and APEC possibly will encounter comparable situations in different organs and when launching infection in their hosts, they can share a similar content of resistance and virulence genes and pathogenicity properties which are related to their genotypic features. Therefore, the potential of APEC to function as a source of UPEC and other human ExPEC would need to be investigated.7-9 Some of mobile elements such as plasmid and transposon dependent resistance genes can horizontally transfer in natural microbial communities.10,11 With these explanations, the present study was conducted to assess the potential of APEC to cause human UTI and determination of possible relationships between these E. coli types. Therefore, UPECs and APECs were compared for antibiotic susceptibility, their content of resistance genes, DNA fingerprinting and phylo-genetic groups. Then the results were statistically analyzed to distinguish similarities and diversities between the APEC and UPEC isolates considered in this study.
Materials and Methods
Bacterial isolates and DNA extraction. Samples were collected during summer 2020 from UTI cases referred to laboratories and avian colibacillosis suspected cases with clinical signs referred to the veterinary clinics in Amol city, northern Iran. Sampling was done from total number of 127 cases (including 45 avian colibacillosis infections and 82 UTI cases) using sterile cotton swabs (swabs from respiratory organs, liver and heart of suspected poultry and urine culture for UTI samples). Avian colibacillosis cases were sampled from recently dead animals during autopsy. Samples were cultured immediately on MacConkey and Eosin methylene blue agar (HiMedia Corp., Mumbai, India) and incubated for 24.00 hr at 37.00 ˚C. Suspected colonies were identified by gram staining and biochemical tests according to the standard procedures.12,13 Totally, 70 isolates containing 35 APEC and 35 UPEC were isolated using cultivation and biochemical methods. DNA extraction from E. coli isolates was done using gram negative DNA extraction kit (Sinaclon, Tehran, Iran) according to the manufacturer instructions. The extracted DNA and the identified isolates were stored at – 20.00 ˚C for use in other steps of the study. The E. coli ATCC 25922 was used as reference strain in antibiotic susceptibility test and other bacteriological examinations.
Antibiotic susceptibility test. Antimicrobial susceptibility test of E. coli isolates was done by Kirby-Bauer disc diffusion method according to the standards set by CLSI.14 The following antibiotic disks (PadtanTeb; Tehran, Iran) were used with their particular concentrations: Tetracycline (TET; 30.00 μg), erythro-mycin (ERY; 15.00 μg), trimethoprim (TMP; 5.00 μg), gentamicin (GEN; 10.00 μg), ciprofloxacin (CIP; 5.00 μg), cefoxitin (FOX; 30.00 μg), ceftriaxone (CTR; 30.00 μg), cefepime (FEP; 30.00 μg), imipenem (IMP; 10.00 μg), sulfamethoxazole/trimethoprim (SXT; 1.25/23.75 μg), nalidixic acid (NAL; 30.00 μg) and ampicillin (AMP; 10.00 μg). The plates of Muller Hinton agar (HiMedia Corp.) were incubated at 35.00 ± 2.00 ˚C for 18 hr and diameter of growth inhibition zones was measured and compared to the CLSI standard Tables. As a final point, the rate of multidrug-resistant (MDR) was defined as being resistant to more than three antimicrobial classes.
Detection of antibiotic resistance genes. The isolates were examined for the presence of 12 antibiotic resistance genes in order to determine the potential differences in the presence of the genes in APEC and UPEC isolates (aac related to gentamycin resistance, blaCTX-M-15, blaTEM-1A, blaVEB and blaSHV related to β-lactamases, tetA, tetB and tetC related to tetracycline, sul1 and sul2 related to sulfonamides, dfrA1 related to trimethoprim, ereA for erythromycin and qnrA for quinolones). Polymerase chain reaction (PCR) was performed using specific primers (Table 1) in the final volume of 25.00 μL including 12.50 µL of a PCR master mix (Sinaclon), 1.00 μL (0.50 μM) of both forward and reverse primers and 2.00 µL of DNA samples that reached to 25.00 μL using distilled deionized water. Then the PCR product was evaluated and confirmed using electrophoresis in 1.50% agarose gel with the assistance of a marker of 100 bp (Sinaclon). Different resistance gene patterns were described according to the presence of the genes.
Table 1.
Nucleotide sequences used as primers in PCR for identification of resistance genes and phylogenetic grouping among UPEC and APEC isolates
| Target gene | Sequence (5' to 3') | Annealing temperature (˚C) | PCR product size (bp) | Reference |
|---|---|---|---|---|
| aac(3) | F: CTTCAGGATGGCAAGTTGGT R: TCATCTCGTTCTCCGCTCAT |
55.00 | 286 | |
| bla CTX-M-15 | F: CATGTGCAGYACCAGTAA R: CCGCRATATCRTTGGTGGTG |
42.00 | 542 | |
| bla TEM-1A | F: ATGAGTATTCAACATTTCCG R: CCAATGCTTAATCAGTGAGG |
46.00 | 850 | |
| bla VEB-19 | F: CGACTTCCATTTCCCGATGC R: GGACTCTGCAACAAATACGC |
51.00 | 643 | |
| bla SHV | F: TCGCCTGTGTATTATCTCCC R: CGCAGATAAATCACCACAATG |
52.00 | 768 | |
| tetA | F: GCTACATCCTGCTTGCCTTC R: CATAGATCGCCGTGAAGAGG |
50.00 | 210 | |
| tetB | F: TTGGTTAGGGGCAAGTTTTG R: GTAATGGGCCAATAACACCG |
50.00 | 659 | |
| tetC | F: CCTCTTGCGGGATATCGTCC R: GGTTGAAGGCTCTCAAGGGC |
55.00 | 505 | |
| sul1 | F: TTCGGCATTCTGAATCTCAC R: ATGATCTAACCCTCGGTCTC |
47.00 | 822 | |
| sul2 | F: CGGCATCGTCAACATAACC R: GTGTGCGGATGAAGTCAG |
51.00 | 720 | |
| ereA | F: GCCGGTGCTCATGAACTTGAG R: CGACTCTATTCGATCAGAGGC |
52.00 | 419 | |
| dfrA1 | F: GGAGTGCCAAAGGTGAACAGC R: GAGGCGAAGTCTTGGGTAAAAAC |
45.00 | 367 | |
| qnrA | F: ATTTCTCACGCCAGGATTTG R: GATCGGCAAAGGTTAGGTCA |
50.00 | 516 | |
| chuA | F: GACGAACCAACGGTCAGGAT R: TGCCGCCAGTACCAAAGACA |
52.00 | 279 | |
| YjaA | F: TGAAGTGTCAGGAGACGCTG R: ATGGAGAATGCGTTCCTCAAC |
52.00 | 211 | |
| TspE4C2 | F: GAGTAATGTCGGGGCATTCA R: CGCGCCAACAAAGTATTACG |
50.00 | 152 | |
| ERIC-PCR | ERIC-1: ATGTAAGCTCCTGGGGATTCAC ERIC-2: AAGTAAGTGACTGGGGTGAGCG |
52.00 | Variable |
Phylogenetic group determination. Determination of phylogenetic groups of the APEC and UPEC isolates was done by a multiplex PCR reaction based on the presence of three genetic markers (chuA, yjaA and TspE4.C2) previously described by Clermont et al.: ChuA−, YjaA− /+ and TSPE4.C2− were assigned to group A, ChuA−, YjaA−/+ and TspE4.C2+ were assigned to group B1, chuA+, YjaA+ and TspE4.C2−/+ were assigned to group B2 and ChuA+, YjaA− and TspE4.C2−/+ were assigned to group D.15 Multiplex-PCR reaction was done using specific oligonucleotides listed in Table 1.
DNA fingerprinting and phylogenetic tree. Entero-bacterial repetitive intergenic consensus PCR (ERIC-PCR) was done for DNA fingerprinting comparison of the isolates. ERIC-PCR reactions were performed in final volume of 25.00 μM including 1.50 μL of each primer in final concentration of 2.00 pmol μL-1, 12.50 μL of Master Mix (SinaClon) and 8.50 μL of deionized distilled water. Primer ERIC-1 and primer ERIC-2 were used in ERIC reaction as previously described.16 The images of ERIC reactions were loaded in BioNumerics (version 6; Applied Maths, Kortrijk, Belgium) for analysis. Genetic similarity was calculated using the Pearson correlation in which 2.00% of the optimization tolerance and 4.00% of the position tolerance shift were set. The dendrogram of the isolates was also created by the Dice correlation coefficient and the un-weighted pair group method with arithmetic averages (UPGMA). A cut-off of 80.00% was used to determine final groupings.
Statistical analysis. We tried to find correlations among different variables, therefore, the results of the study were analyzed using SPSS Software (version 22.0; IBM Corp., Armonk, USA). Statistical analyses were carried out by applying the Mann–Whitney, Chi-square and Kolmogorov - Smirnov tests with a statistically significant p - value < 0.05.
Results
Results of antibiotic resistance. Among all of 70 E. coli isolates, the most resistance rates were, respectively, obtained for ampicillin (84.20%), sulfamethoxazole-trimethoprim (65.70%) and cefoxitin (60.00%). APEC isolates demonstrated a high resistance rate to ampicillin (80.00%) and UPEC isolates demonstrated a high resistance rate to ampicillin (88.50%) and sulfametho-xazole-trimethoprim (62.80%). APEC isolates showed the most susceptibility to imipenem and UPEC isolates showed the most susceptibility to gentamycin and ciprofloxacin (Table 2). The percentage of multidrug resistant E. coli isolates from APEC and UPEC isolates were 77.10% (27/35) and 68.50% (24/35), respectively. Statistical analysis revealed significant association between APEC and UPEC isolates and antibiotic resistance against ciprofloxacin and imipenem, respectively (p < 0.05). Phylogenetic group D showed significant correlation with trimethoprim (in UPEC isolates), cefoxitin, ceftriaxone and sulfamethoxazole-trimethoprim (in APEC isolates).
Table 2.
Resistance of the APEC (n =35) and UPEC (n =35) isolates to the different antibiotics
| Isolates | Number of isolates resistant to antibiotics (%) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| TET | ERY | TMP | GEN | CIP | FOX | CTR | FEP | IMP | SXT | AMP | NAL | |
| APEC | 22(62.80) | 20(57.10) | 18(51.40) | 1(2.80) | 5(14.20) | 23(65.70) | 17(48.50) | 6(17.10) | 0(0.00) | 24(68.50) | 28(80.00) | 21(60.00) |
| UPEC | 17(48.50) | 21(60.00) | 12(34.20) | 2(5.70) | 2(5.70) | 19(54.20) | 15(42.80) | 8(22.80) | 4(11.40) | 22(62.80) | 31(88.50) | 15(42.80) |
| Total (%) | 39(55.70) | 41(58.50) | 30(42.80) | 3(4.20) | 7(10.00) | 42(60.00) | 32(45.70) | 14(20.00) | 4(5.70) | 46(65.70) | 59(84.20) | 36(51.40) |
TET: tetracycline, ERY: erythromycin, TMP: trimethoprim, GEN: gentamicin, CIP: ciprofloxacin, FOX: cefoxitin, CTR: ceftriaxone, FEP: cefepime, IMP: imipenem, SXT: sulfamethoxazole/trimethoprim, AMP: ampicillin and NAL: nalidixic acid.
Distribution of resistance genes. Total number of 58 resistance gene patterns were observed among 70 E. coli isolates. The most prevalent patterns were dfrA+/tetA+ and dfrA+/blaCTX-M+ (Table 3). Among all 70 isolates, the most prevalent resistance genes were dfrA (48.50%) and blaTEM (41.40%), respectively. The dfrA (57.10%), tetA (45.70%) and blaCTX-M (45.70%) were the most prevalent resistance genes among APEC isolates and the sul1 (48.50%) was the most prevalent resistance gene among UPEC isolates. Statistical analysis revealed significant difference between APEC and UPEC isolates in association with qnr resistance gene (p < 0.05). In addition, there were remarkable but non-significant differences between APEC and UPEC isolates associated with aac, tetC and blaCTX-M genes (p > 0.05). The most prevalent pattern of the presence of tet genes among tetracycline resistant isolates of APEC and UPEC were tetA+ and tetA+/tetB+, respectively. Among the APEC and UPEC isolates, 65.70% and 51.40% presented ESBL-encoding genes, respectively. blaTEM and blaCTX-M were the most prevalent β-lactamase related genes among UPECs and blaCTX-M was the most prevalent β-lactamase gene among APECs. The sul1 gene was more prevalent among sulfonamide resistant isolates. No significant relationship was observed between the presence of a specific resistance gene and a specific phylogenetic group.
Table 3.
Resistance gene profiles of the APEC and UPEC isolates
| Pattern of resistance genes | Number of isolates | ||
|---|---|---|---|
| APEC | UPEC | Total | |
| Sul2 | 1 | 1 | |
| dfrA | 1 | 1 | |
| tetA | 1 | 1 | 2 |
| tetB | 1 | 1 | |
| bla VEB | 1 | 1 | |
| bla TEM | 1 | 1 | |
| Sul1/dfrA | 2 | 2 | |
| Sul1/ereA | 1 | 1 | |
| Sul2/tetA | 1 | 1 | |
| Sul1/tetB | 1 | 1 | |
| Sul2/bla TEM | 1 | 1 | |
| qnr/bla VEB | 1 | 1 | |
| qnr/bla CTX-M | 2 | 2 | |
| dfrA/tetA | 3 | 1 | 4 |
| dfrA/bla TEM | 1 | 1 | |
| dfrA/bla CTX-M | 3 | 1 | 4 |
| dfrA/bla VEB | 1 | 1 | |
| tetA/tetB | 2 | 2 | |
| tetA/bla TEM | 1 | 1 | |
| tetB/bla TEM | 1 | 1 | |
| tetB/bla CTX-M | 1 | 1 | 2 |
| tetC/bla VEB | 1 | 1 | |
| tetC/bla CTX-M | 1 | 1 | |
| Sul1/sul2/dfrA | 1 | 1 | |
| Sul1/sul2/ereA | 1 | 1 | |
| Sul1/sul2/tetC | 1 | 1 | |
| Sul1/dfrA/tetA | 1 | 1 | |
| Sul1/dfrA/tetB | 1 | 1 | 1 |
| Sul1/dfrA/bla CTX-M | 2 | 2 | |
| Sul2/tetA/bla CTX-M | 1 | 1 | |
| qnr/bla TEM /bla CTX-M | 1 | 1 | |
| dfrA/tetA/bla TEM | 1 | 1 | |
| dfrA/ereA/bla CTX-M | 1 | 1 | |
| dfrA/bla TEM /bla CTX-M | 1 | 1 | |
| tetA/tetB/bla TEM | 1 | 1 | |
| Sul1/sul2/ereA/aac | 1 | 1 | |
| Sul1/sul2/dfrA/bla TEM | 1 | 1 | |
| Sul1/sul2/dfrA/tetC | 1 | 1 | |
| Sul1/sul2/dfrA/tetB | 1 | 1 | |
| Sul1/qnr/tetC/bla CTX-M | 1 | 1 | |
| Sul1/dfrA/tetB/bla CTX-M | 1 | 1 | |
| Sul1/dfrA/aac/bla VEB | 1 | 1 | |
| Sul1/dfrA/tetA/tetB | 1 | 1 | |
| Sul1/dfrA/tetA/bla CTX-M | 1 | 1 | |
| Sul1/qnr/bla TEM /bla CTX-M | 1 | 1 | |
| Sul1/dfrA/bla TEM /bla CTX-M | 1 | 1 | |
| Sul1/ereA/tetA/tetB | 1 | 1 | |
| Sul1/ereA/tetC/bla CTX-M | 1 | 1 | |
| Sul1/tetA/tetB/bla ctx-M | 1 | 1 | |
| Sul2/ereA/tetA/tetB | 1 | 1 | |
| Sul2/tetA/tetB/bla TEM | 1 | 1 | |
| dfrA/tetA/bla TEM /bla ctx-M | 1 | 1 | |
| dfrA/ereA/tetA/tetB | 1 | 1 | |
| dfrA/tetA/tetB/bla ctx-M | 1 | 1 | |
| Sul1/sul2/dfrA/ereA/bla TEM | 1 | 1 | |
| Sul1/dfrA/tetA/tetB/bla TEM | 1 | 1 | |
| qnr/aac/tetA/tetB/bla CTX-M | 1 | 1 | |
| No resistance gene | 1 | 1 | |
Phylogenetic grouping and DNA fingerprinting. According to phylogenetic grouping 34.20% (24 / 70), 32.80% (23 / 70), 20.00% (14 / 70) and 12.80% (9 / 70) of the isolates were belonged to the A, B2, D and B1 groups, respectively (Table 4). The most prevalent phylogenetic groups among APEC and UPEC isolates were B2 and A with the frequency of 17.00 (48.50%) and 15.00 (42.80%), respectively (Fig. 1). The results of the DNA fingerprinting of the isolates using ERIC-PCR are shown in Figure 1 as a dendrogram associated with phylogenetic groups and resistance gene patterns (Fig. 2).
Table 4.
Distribution of resistance genes among phylogenetic groups (phylogroups) of APEC, and UPEC isolates
| Isolates | Phylogroups | No. | Resistance gene distribution (%) | Total | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Sul1 | Sul2 | qnr | dfrA | ereA | aac | tetA | tetB | tetC | bla TEM | bla VEB | bla CTX-M | bla SHV | ||||
| APEC | A | 9 | 1 | 1 | 2 | 4 | 0 | 0 | 4 | 4 | 0 | 0 | 1 | 3 | 0 | 29 |
| B1 | 3 | 1 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | 0 | 2 | 1 | 1 | 0 | 11 | |
| B2 | 17 | 6 | 3 | 2 | 10 | 3 | 1 | 9 | 3 | 2 | 4 | 0 | 8 | 0 | 68 | |
| D | 6 | 2 | 1 | 0 | 4 | 2 | 0 | 3 | 3 | 0 | 1 | 0 | 4 | 0 | 26 | |
| - | 35 | 10 (28.50) |
5 (14.20) |
5 (14.20) |
20 (57.10) |
5 (14.20) |
1 (2.80) |
16 (45.70) |
11 (31.40) |
2 (5.70) |
7 (20.00) |
2 (5.70) |
16 (45.70) |
0 (0.00) |
- | |
| UPEC | A | 15 | 6 | 4 | 1 | 3 | 3 | 0 | 4 | 4 | 2 | 5 | 2 | 2 | 0 | 51 |
| B1 | 6 | 1 | 3 | 0 | 1 | 0 | 1 | 2 | 1 | 0 | 2 | 1 | 0 | 0 | 18 | |
| B2 | 6 | 4 | 1 | 0 | 3 | 1 | 1 | 1 | 2 | 0 | 1 | 0 | 2 | 0 | 22 | |
| D | 8 | 6 | 1 | 1 | 7 | 0 | 0 | 2 | 1 | 2 | 1 | 0 | 5 | 0 | 34 | |
| - | 35 | 17 (48.50) |
9 (25.70) |
2 (5.70) |
14 (40.00) |
4 (11.40) |
2 (5.70) |
9 (25.70) |
9 (25.70) |
4 (11.40) |
9 (25.70) |
3 (8.50) |
9 (25.70) |
0 (0.00) |
- | |
| Total | 70 | 27 (38.50) |
14 (20.00) |
7 (10.00) |
34 (48.50) |
9 (12.80) |
3 (4.20) |
25 (35.70) |
20 (28.50) |
6 (8.50) |
16 (22.80) |
5 (7.10) |
25 (35.70) |
0 (0.00) |
- | |
Fig. 1.
Multiplex PCR patterns specific for E. coli phylogenetic groups. Combination of chuA, yjaA and TSPE4.C2 genes amplification allowed phylogenetic group determination of an E. coli isolate. Lane 1: DNA marker, Lanes 2 and 3: Group B2, Lanes 4 and 5: Group D, Lane 6: Group B1: Lanes 7 and 8: Group A
Fig. 2.
Dendrogram based on ERIC-PCR fingerprinting of APEC and UPEC isolates collected from poultry and human using the UPGMA analysis. ERIC-PCR assay resulted in 10 different clusters
Totally, 10 distinct clusters were obtained from analysis of ERIC-PCR results using BioNumerics software (UPMEGA) named C1 to C10 (SID = 0.191). There was no significant correlation or association between phylo-genetic groups, resistance gene patterns and ERIC-PCR clusters (p > 0.05). The C4, C5 and C9 clusters were observed in particular among APEC isolates, however, C3 and C10 were obtained only in UPEC isolates. The presence of C1 cluster was significant (p < 0.05) in correlation with UPEC isolates with the frequency of 17of 35.
Discussion
One of the important issues in investigating the possible similarities of APEC and UPEC strains is the study of resistance behavior of these bacteria against different antibiotics as well as phylogenetic differences. The first remarkable result of the present study was the similarity between APEC and UPEC isolates in the type of the antibiotic with the highest resistance, ampicillin and sulfamethoxazole-trimethoprim. However, among studied antibiotics, APEC and UPEC isolates showed significant difference in resistance to ciprofloxacin and imipenem, respectively. Use of the different antibiotics in human and poultry associated E. coli infections can be one of the causes of this phenomenon. In poultry farms of some countries such as Iran, fluoroquinolone antibiotics such as enrofloxacin were the first approach to fight against AC,17,18 regardless of the fact that this indiscriminate use could cause resistance to other antibiotics in this drug category such as ciprofloxacin that were used in the treatment of human infections. On the other hand, carbapenems are widely used in gram-negative human infections,19 and more resistance among human isolates is expected. Gentamycin, imipenem and ciprofloxacin had proper antibacterial effect on E. coli isolates in the present study and it was in accordance with other studies that reported high susceptibility of the APEC and UPEC isolates to these agents.5,20,21 However, the prevalence of the MDR isolates did not show significant difference between these two pathotypes of E. coli. This relatively high level of MDR isolates could be feedbacked from the indiscriminate and unsupervised use of antibiotics in veterinary medicine and even self-medications in human infections.22,23
In terms of the presence of resistance genes among APEC and UPEC isolates, high diversity was observed in obtained patterns. Conceivably, the use of diverse antibiotics in human infections and treatment of avian colibacillosis in poultry flocks has led to the survival of resistant strains with various plasmid or / and transposon resistance genes. In addition, according to the results, the number of APEC isolates with at least 4 resistance genes is higher than UPEC isolates. Particularly, CTX-M producing isolates which have been increased during recent decades and plays an important role in β-lactamase resistance.24
In our study, blaCTX-M was found as the predominant gene among ESBL associated genes of E. coli isolates while none of the isolates showed the presence of the blaSHV gene in contradictory to some other.24-26 The investigation of Durmaz et al. showed that the ratio of the blaCTX-M gene as the predominant type of beta-lactamases was very high at 93.00% whereas the blaSHV and blaTEM genes were 65.00% and 49.00%, respectively.27 Kim et al. showed that the sul2, tetA and blaTEM were the most prevalent genes among APEC isolates, respectively, for sulfonamides, tetracycline and beta-lactamases in South Korea.5 Other studies reported the importance of the sul1, blaCTX-M and tetB genes in resistance of the E. coli isolates in accordance with the results of the present study.24,26,28
The dominant phylogenetic group was different among the isolates of APEC and UPEC (B2 for APECs and A for UPECs) in the present study and in examining the ratio of the frequency of resistance genes to the quantity of each phylogenetic group, this ratio in group D was achieved more than other groups. Zenati et al. also showed A type as the predominant phylogenetic group among UPEC isolates,29 while other studies showed the B2 and A as the main phylogenetic groups among UPECs and APECs respectively.30,31 Different studies used ERIC-PCR for fingerprinting E. coli isolates especially obtained from UTI cases in human and presented various numbers of ERIC patterns or clusters representing the variability and heterogeneity of the isolates. Pourakbari et al. in a study on 102 E. coli strains isolated from UTIs in children showed 13 various ERIC clusters.32 In other study, ou of 83 E. coli isolated from hospitalized patients 14 clusters were observed.29 Finally, APEC and UPEC isolates displayed heterogeneous and various antibiotic resistance and some phylogenetic groups of E. coli isolates showed significant resistance to certain antibiotics, however, phylogenetic grouping and ERIC-PCR based fingerprinting did not show obvious differences between isolates obtained from two different sources. In conclusion, APEC and UPEC isolates in this study showed differences and similarities in the occurrence of resistance genes, however, the answer to the question about the potential risk and hazard of APEC strains for the incidence of disease in humans beyond resistance properties depends on the study of virulence genes and related factors in the pathogenicity of these bacteria.
Conflict of interest
The authors have no conflict of interest.
Acknowledgment
This study was supported by Islamic Azad University of Ayatollah Amoli Branch and Amol University of Special Modern Technologies, Amol, Iran.
References
- 1.Mortensen S, Johansen AE, Thøfner I, et al. Infectious potential of human derived uropathogenic Escherichia coli UTI89 in the reproductive tract of laying hens. Vet Microbiol. 2019;239:108445. doi: 10.1016/j.vetmic.2019.108445. [DOI] [PubMed] [Google Scholar]
- 2.Jørgensen SL, Stegger M, Kudirkiene E, et al. Diversity and population overlap between avian and human Escherichia coli belonging to sequence type 95. mSphere. 2019;27: 4: e00333. doi: 10.1128/mSphere.00333-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cunha MPV, Saidenberg AB, Moreno AM, et al. Pandemic extra-intestinal pathogenic Escherichia coli (ExPEC) clonal group O6-B2-ST73 as a cause of avian colibacillosis in Brazil. PLoS One. 2017;12(6):e0178970. doi: 10.1371/journal.pone.0178970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Miles TD, McLaughlin W, Brown PD. Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Vet Res. 2006;2:7. doi: 10.1186/1746-6148-2-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kim YB, Yoon MY, Ha JS, et al. Molecular characterization of avian pathogenic Escherichia coli from broiler chickens with colibacillosis. Poult Sci. 2020;99(2):1088–1095. doi: 10.1016/j.psj.2019.10.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Thomrongsuwannakij T, Blackall PJ, Djordjevic SP, et al. A comparison of virulence genes, antimicrobial resistance profiles and genetic diversity of avian pathogenic Escherichia coli (APEC) isolates from broilers and broiler breeders in Thailand and Australia. Avian Pathol. 2020;49(5):457–466. doi: 10.1080/03079457.2020.1764493. [DOI] [PubMed] [Google Scholar]
- 7.Rodriguez-Siek KE, Giddings CW, Doetkott C, et al. Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiol (Reading) 2005;151(Pt 6):2097–2110. doi: 10.1099/mic.0.27499-0. [DOI] [PubMed] [Google Scholar]
- 8.Bakhshi M, Zandi H, Fatahi-Bafghi M, et al. A survey for phylogenetic relationship; presence of virulence genes and antibiotic resistance patterns of avian pathogenic and uropathogenic Escherichia coli isolated from poultry and humans in Yazd, Iran. Gene Rep. 2020;20(3):100725. [Google Scholar]
- 9.Meena PR, Yadav P, Hemlata H, et al. Poultry‐origin extraintestinal Escherichia coli strains carrying the traits associated with urinary tract infection, sepsis, meningitis and avian colibacillosis in India. J Appl Microbiol. 2021;130(6):2087–2101. doi: 10.1111/jam.14905. [DOI] [PubMed] [Google Scholar]
- 10.Gillings MR, Gaze WH, Pruden A, et al. Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. ISME J. 2015;9(6):1269–1279. doi: 10.1038/ismej.2014.226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Thanh Duy P, Thi Nguyen TN, Vu Thuy D, et al. Commensal Escherichia coli are a reservoir for the transfer of XDR plasmids into epidemic fluoro-quinolone-resistant Shigella sonnei. Nat Microbiol. 2020;5(2):256–264. doi: 10.1038/s41564-019-0645-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Quinn PJ, Markey BK, Leonard FC, et al. Veterinary microbiology and microbial disease. 2nd ed. West Sussex, USA: John Wiley & Sons ; 2011. pp. 263–272. [Google Scholar]
- 13.Forbes BA, Sahm DF, Weissfeld AS, et al. Diagnostic microbiology. 12th ed. Louis, USA: Mosby ; 2007. pp. 324–328. [Google Scholar]
- 14.Wikler MA. Performance standards for antimicrobial susceptibility testing: 30th Information Supplement. Wayne, USA: Clinical and Laboratory Standards Institute 2017; M100-S26. [Accessed Sep 28, 2022]. Available at: https://clsi.org/media/3481/m100ed30_sample.pdf .
- 15.Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol. 2000;66(10):4555–4558. doi: 10.1128/aem.66.10.4555-4558.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 1991;19(24):6823–6831. doi: 10.1093/nar/19.24.6823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Nhung NT, Chansiripornchai N, Carrique-Mas JJ. Antimicrobial resistance in bacterial poultry pathogens: a review. Front Vet Sci. 2017;4:126. doi: 10.3389/fvets.2017.00126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Talebiyan R, Kheradmand M, Khamesipour F, et al. Multiple antimicrobial resistance of Escherichia coli isolated from chickens in Iran. Vet Med Int. 2014;2014:491418. doi: 10.1155/2014/491418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Shirley M. Ceftazidime-avibactam: a review in the treatment of serious gram-negative bacterial infections. Drugs. 2018;78(6):675–692. doi: 10.1007/s40265-018-0902-x. [DOI] [PubMed] [Google Scholar]
- 20.Ghazvini H, Taheri K, Edalati E, et al. Virulence factors and antimicrobial resistance in uropathogenic Escherichia coli strains isolated from cystitis and pyelonephritis. Turk J Med Sci. 2019;49(1):361–367. doi: 10.3906/sag-1805-100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Tajbakhsh E, Ahmadi P, Abedpour-Dehkordi E, et al. Biofilm formation, antimicrobial susceptibility, sero-groups and virulence genes of uropathogenic E. coli isolated from clinical samples in Iran. Antimicrob Resist Infect Control. 2016;5:11 . doi: 10.1186/s13756-016-0109-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Torres NF, Chibi B, Middleton LE, et al. Evidence of factors influencing self-medication with antibiotics in low and middle-income countries: a systematic scoping review. Public Health. 2019;168:92–101. doi: 10.1016/j.puhe.2018.11.018. [DOI] [PubMed] [Google Scholar]
- 23.Dugassa J, Shukuri N. Review on antibiotic resistance and its mechanism of development. J Health Med Nurs. 2017;1(3):1–17. [Google Scholar]
- 24.Hojabri Z, Darabi N, Arab M, et al. Clonal diversity, virulence genes content and subclone status of Escherichia coli sequence type 131: comparative analysis of E coli ST131 and non-ST131 isolates from Iran. BMC Microbiol. 2019;19(1):117 . doi: 10.1186/s12866-019-1493-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Chandran SP, Sarkar S, Diwan V, et al. Detection of virulence genes in ESBL producing, quinolone resistant commensal Escherichia coli from rural Indian children. Infect Dev Ctries. 2017;11(5):387–392. doi: 10.3855/jidc.8574. [DOI] [PubMed] [Google Scholar]
- 26.Shahbazi S, Asadi Karam MR, Habibi M, et al. Distribution of extended-spectrum β-lactam, quinolone and carbapenem resistance genes, and genetic diversity among uropathogenic Escherichia coli isolates in Tehran, Iran. J Glob Antimicrob Resist. 2018;14:118–125. doi: 10.1016/j.jgar.2018.03.006. [DOI] [PubMed] [Google Scholar]
- 27.Durmaz S, Buyukunal Bal EB, Gunaydin M, et al. Detection of β-lactamase genes, ERIC-PCR typing and phylogenetic groups of ESBL producing quinolone resistant clinical Escherichia coli isolates. Biomed Res. 2015;26(1):43–50. [Google Scholar]
- 28.Enany M, Hassan W, Ismail N. Prevalence of antibiotic resistance genes among E coli strains isolated from poultry in Suez Canal area. Suez Canal Vet Med J. 2018;23(1):53–65. [Google Scholar]
- 29.Zenati F, Barguigua A, Nayme K, et al. Characterization of uropathogenic ESBL-producing Escherichia coli isolated from hospitalized patients in western Algeria. J Infect Dev Ctires. 2019;13(4):291–302. doi: 10.3855/jidc.10702. [DOI] [PubMed] [Google Scholar]
- 30.De Souza GM, Neto ERDS, da Silva AM, et al. Comparative study of genetic diversity, virulence genotype, biofilm formation and antimicrobial resistance of uropathogenic Escherichia coli (UPEC) isolated from nosocomial and community acquired urinary tract infections. Infect Drug Resist. 2019;12:3595–3606. doi: 10.2147/IDR.S228612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ghanbarpour R, Salehi M, Oswald E. Virulence genotyping of Escherichia coli isolates from avian cellulitis in relation to phylogeny. Comp Clin Path. 2009;19(2):147–153. [Google Scholar]
- 32.Pourakbari B, Mamishi S, Shokrollahi MR, et al. Molecular characteristics and antibiotic resistance profiles of Escherichia coli strains isolated from urinary tract infections in children admitted to children's referral hospital of Qom, Iran. Ann Ig. 2019;31(3):252–262. doi: 10.7416/ai.2019.2288. [DOI] [PubMed] [Google Scholar]
- 33.Van TT, Chin J, Chapman T, et al. Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int J Food Microbiol. 2008;124(3):217–223. doi: 10.1016/j.ijfoodmicro.2008.03.029. [DOI] [PubMed] [Google Scholar]
- 34.Saladin M, Cao VT, Lambert T, et al. Diversity of CTX-M beta-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbial Lett. 2002;209(2):161–168. doi: 10.1111/j.1574-6968.2002.tb11126.x. [DOI] [PubMed] [Google Scholar]
- 35.Eckert C, Gautier V, Arlet G. DNA sequence analysis of the genetic environment of various blaCTX-M genes. J Antimicrob Chemother. 2006;57(1):14–23. doi: 10.1093/jac/dki398. [DOI] [PubMed] [Google Scholar]
- 36.Naas T, Mikami Y, Imai T, et al. Characterization of In53, a class 1 plasmid- and composite transposon-located integron of Escherichia coli which carries an unusual array of gene cassettes. J Bacteriol. 2001;183(1):235–249. doi: 10.1128/JB.183.1.235-249.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Faldynova M, Pravcova M, Sisak F, et al. Evolution of antibiotic resistance in Salmonella enterica serovar typhimurium strains isolated in the Czech Republic between 1984 and 2002. Antimicrob Agents Chemother. 2003;47(6):2002–2005. doi: 10.1128/AAC.47.6.2002-2005.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Levings RS, Partridge SR, Lightfoot D, et al. New integron-associated gene cassette encoding a 3-N-aminoglycoside acetyltransferase. Antimicrob Agents Chemother. 2005;49(3):1238–1241. doi: 10.1128/AAC.49.3.1238-1241.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Sengeløv G, Agersø Y, Halling-Sørensen B, et al. Bacterial antibiotic resistance levels in Danish farmland as a result of treatment with pig manure slurry. Environ Int. 2003;28(7):587–595. doi: 10.1016/s0160-4120(02)00084-3. [DOI] [PubMed] [Google Scholar]
- 40.Maynard C, Fairbrother JM, Bekal S, et al. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149: K91 isolates obtained over a 23-year period from pigs. Antimicrob Agents Chemother. 2003;47(10):3214–3221. doi: 10.1128/AAC.47.10.3214-3221.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Toro CS, Farfán M, Contreras I, et al. Genetic analysis of antibiotic-resistance determinants in multidrug-resistant Shigella strains isolated from Chilean children. Epidemiol Infect. 2005;133(1):81–86. doi: 10.1017/s0950268804003048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Shams E, Firoozeh F, Moniri R, et al. Prevalence of plasmid-mediated quinolone resistance genes among extended-spectrum β-Lactamase-producing Klebsiellapneumoniae human isolates in Iran. J Pathog. 2015;2015:434391. doi: 10.1155/2015/434391. [DOI] [PMC free article] [PubMed] [Google Scholar]