Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Jan 17.
Published in final edited form as: Prostate. 2018 May 30;78(13):992–1000. doi: 10.1002/pros.23657

Characterization of novel cell lines derived from a MYC-driven murine model of lethal metastatic adenocarcinoma of the prostate

Mark C Markowski 1, Gretchen K Hubbard 2, Jessica L Hicks 2, Qizhi Zheng 2, Alexia King 2, David Esopi 1, Apurv Rege 3, Srinivasan Yegnasubramanian 1, Charles J Bieberich 3, Angelo M De Marzo 1,2,4
PMCID: PMC9844589  NIHMSID: NIHMS1858880  PMID: 29851094

Abstract

Background:

Loss or mutation of PTEN alleles at 10q23 in combination with 8q24 amplification (encompassing MYC) are common findings in aggressive, human prostate cancer. Our group recently developed a transgenic murine model of prostate cancer involving prostate-specific Pten deletion and forced expression of MYC under the control of the Hoxb13 promoter. MYC overexpression cooperated with Pten loss to recapitulate lethal, human prostate cancer.

Method:

We now report on the generation of two mouse prostate cancer cell lines, BMPC1 and BMPC2, derived from a lymph node, and liver metastasis, respectively.

Results:

Both cell lines demonstrate a phenotype consistent with adenocarcinoma and grew under standard tissue culture conditions. Androgen receptor (AR) protein expression is minimal (BMPC1) or absent (BMPC2) consistent with AR loss observed in the BMPC mouse model of invasive adenocarcinoma. Growth in media containing charcoal-stripped serum resulted in an increase in AR mRNA in BMPC1 cells with no effect on protein expression, unless androgens were added, in which case AR protein was stabilized, and showed nuclear localization. AR expression in BMPC2 cells was not effected by growth media or treatment with androgens. Treatment with an anti-androgen/castration or androgen supplemented media did not affect in vitro or in vivo growth of either cell line, irrespective of nuclear AR detection.

Discussion:

These cell lines are a novel model of androgen-insensitive prostatic adenocarcinoma driven by MYC over-expression and Pten loss.

Keywords: AR indifferent, mouse model, prostate cancer

1 |. BACKGROUND

Prostate cancer is the most common epithelial malignancy in men and second leading cause of cancer-related death.1 The genomic and molecular pathogenesis of prostate cancer is complex, making it difficult to differentiate lethal from more indolent forms of the disease.2–6 Frequent copy number alterations are found during prostate cancer carcinogenesis including loss of chromosome 8p (NKX3.1), amplification of 8q24 (MYC), and deletion of PTEN on chromosome 10q23.7–9 Loss of PTEN occurs in approximately 50% of lethal prostate cancers and has been shown in multiple studies to be linked to disease aggressiveness and prostate cancer specific death.10–15 Similarly, amplification of the MYC locus has been correlated with poor outcomes and disease recurrence after prostatectomy.16–18 Patients whose tumors harbored concurrent MYC amplification and PTEN loss were at increased the risk of prostate cancer specific mortality suggesting that the combination of both genetic events may cooperatively drive aggressive disease.19

The development of mouse models which recapitulate human prostate cancer has been limited due to absence of metastatic disease, atypical histologic features (ie, neuroendocrine or sarcomatoid phenotype), lack of genomic instability, or the use of driver genes rarely altered genetically in human prostate cancer.20,21 In prior studies, loss of both Pten alleles or activation of MYC alone in the mouse prostate resulted in PIN and early invasive carcinoma with rare instances of metastatic disease.20 In the Z-MYC model, prostate-specific overexpression of MYC resulted in low-grade PIN, but invasive carcinomas were observed only upon deletion of one or both Pten alleles suggestive of a potential cooperative effect of Pten loss and MYC activation.22 This genetically engineered model did not result in widespread metastatic disease and genetic instability was not examined.

Recently, our group developed a mouse model (referred to as BMPC) that undergoes forced overexpression of MYC and deletion of both copies of Pten in the mouse prostate using Hoxb13 transcriptional control elements.23 These mice invariably develop lethal metastatic castration resistant prostatic adenocarcinomas that recapitulate key histopathologic and phenotypic (eg, activation of Akt) features of human prostate cancer initiation and progression.23 In BMPC mice, metastatic sites of disease include lymph node involvement, with less frequent lung, and liver dissemination. Although very rare, bone metastases have also been observed, similar to human prostate cancer. Importantly, the prostate cancers that develop in the BMPC mice have widespread genome copy number alterations, a feature that is reminiscent of human disease, and not recapitulated in most other well-studied prostate cancer mouse models.23–27 For instance, one of the only other mouse models demonstrating genomic instability required forced telomere shortening in the context of Tp53 and Pten deletion.28 However, mice with combined Tp53 and Pten deletion commonly develop invasive prostatic tumors with sarcomatoid differentiation rather than adenocarcinoma.20 The primary and metastatic carcinomas in the BMPC mice lack both neuroendocrine and sarcomatoid differentiation, features uncommon in untreated, human prostate cancers. The use of commonly altered driver genes in the human disease, the kinetics of disease initiation and progression, the metastases to relevant physiological sites, and the emergence of genetic instability in this model provide an opportunity to test new therapeutic strategies to prevent and treat lethal forms of human prostate cancer.23

To extend the utility of the BMPC model, in the present study we generated two mouse cell lines (BMPC1 and BMPC2) from metastatic sites of prostate cancer. The BMPC1 cell line was derived from prostate adenocarcinoma identified in a pelvic lymph node of a BMPC mouse. A liver metastasis served as the parental source for the BMPC2 cell line. Herein, we present an initial phenotypic characterization, along with a traditional karyotype and in vitro and in vivo growth conditions, including the influence of androgens, of these novel murine cell lines.

2 |. METHODS

2.1 |. Reagents

BMPC1, BMPC2, and MYC-CaP cells were routinely cultured in Dulbecco modified Eagle medium (DMEM) (Corning Inc., Corning, NY) supplemented with 10% Fetal Bovine Serum (FBS) (Gemini Bio-Products, Sacramento, CA) at 37°C in 5% CO2. PC3 cells were cultured under similar conditions in RPMI media. Ten percent Charcoal-stripped Calf Serum (CCS) (Gemini Bio-Products) supplemented media was used in select experiments. Enzalutamide and R1881 were purchased via Selleck Chemicals (Houston, TX) and Sigma-Aldrich (St. Louis, MO), respectively.

2.2. |. Quantitative reverse transcriptase PCR (RT-PCR)

Total RNA was extracted using a Qiagen RNeasy mini kit, as described in the manufacturers protocol. RNA was treated with DNase I (RNase-free; Ambion, Waltham, MA) and cDNA synthesis was performed using the SuperScript First Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA) following standard protocol for “First-Strand Synthesis Using Random Primers.” Quantitative PCR was performed with SYBR Green Supermix (Bio-Rad, Hercules, CA). Mouse AR primers were purchased (RT2 qPCR Primer Assay, Qiagen, Hilden, Germany). Confirmation of AR RT-PCR results were confirmed with an alternative pair of primers for mouse AR (Forward (5′ to 3′)-GAATTCGGTGGAAGC; Reverse (5′ to 3′)-AGCTGCTCTCAGGGTGGCCCTCGGA). GAPDH was used as a housekeeping gene for normalization (Forward (5′ to 3′) −CGACTTCAACAGCAACTCCCACTCTTCC; Reverse (5′ to 3′)-TGGGTGGTCCAGGGTTTCTTACTCCTT). The fold differences in expression levels of AR in BMPC1 and BMPC2 cells were determined using the ΔΔCt method, relative to GAPDH. Statistical analysis comparing mean fold change (samples run in triplicate) in AR mRNA was performed using a paired, two-tailed t-test. P values <0.05 were considered statistically significant.

2.3 |. Immunohistochemistry

Antigen unmasking was performed by steaming in high-temperature target retrieval solution (Target Retrieval Solution; Dako, Santa Clara, CA) for 50 min (p63, CK5, FOXA2) or in EDTA for 45 min (FOXA1, PTEN, c-MYC, AR, Nkx3.1) or in Citrate for 25 min (CK18). Immunohistochemistry analysis was performed using antibodies that include: rabbit anti-human CK18 antibody (Novus, Littleton, CO, Cat# NB100–91844; 1:400 dilution), rabbit anti-human p63 antibody (Cell Signaling, Danvers, MA, D2K8X XP, Cat# 13109; 1:400 dilution), rabbit anti-human PTEN antibody (Cell Signaling, D4.3 XP, Cat # 9188;1:200 dilution), rabbit anti human CK5 antibody (Covance, Princeton, NJ, Cat # MK5; 1:15000 dilution), rabbit anti-human FOXA2 antibody (Abcam, Cambridge, United Kingdom, Cat #; 1:400 dilution), rabbit anti-human FOXA1 antibody (Abcam, Cat # 23738; 1:600 dilution), rabbit anti-human Vimentin antibody (Cell Signaling, D21H3 XP, Cat #5741; 1:6000), mouse anti-human smooth muscle actin (Agilent, Santa Clara, CA, M085129; 1:4000 dilution), rabbit anti-human c-MYC antibody (Abcam, Cat # 32072; 1:600 dilution), mouse anti-human Chromogranin A (Millipore Sigma, Burlington, MA, Cat # MAB5268; 1:8000 dilution), rabbit anti-human AR antibody (Cell Signaling, D6F11 XP, Cat #: 5153; 1:400 dilution), rabbit anti-mouse Nkx3.1 antibody (generous gift of Charles Bieberich [UMBC]; 1:3,000 dilution).

2.4 |. RNA in situ hybridization

Chromogenic RNA in situ hybridization was performed by using ACD RNAscope 2.0 Brown assays with ACD target probes: Mm-AR (Cat# 316991), or Mm-NKx3–1 (Cat# 472111) or Mm-Hoxb13 (Cat# 434821) or Mm-Terc (Cat# 425201) or Mm-45S (Cat# 417331) or Hs-MYC (Cat# 311761). All hybridization and incubation steps were performed using the complete HybEZ Hybridization System following the manufacturer’s protocol.

2.5 |. Generation of BMPC cell lines

Two BMPC male mice with advanced, metastatic prostate cancer were euthanized. A palpable pelvic lymph node (mouse one) and an ∼5 mm liver metastasis (mouse two) were harvested. After tissue disruption using a Miltenyi gentleMACS dissociator, cells were plated in T75 flasks in Dulbecco’s modified Eagle’s medium (DMEM) plus 20% FBS in the presence of antibiotics. Upon confluence, cells were passaged as a bulk tumor cell population and frozen at each passage. The bulk populations from both the liver and lymph node metastases continued robust growth beyond passage. Cells were then plated to single cell density in 100 mm culture dishes (Corning) in DMEM supplemented with 10% FBS until individual colonies were visualized. Cell media was then aspirated and discarded. Using sterilized, cloning cylinders (Corning) with silicone grease, individual colonies were isolated, and harvested using 0.25% trypsin. Cells were transferred into a six-well plate containing DMEM +10% FBS and subsequently passaged into T75 flasks. This process was carried out for cells derived from both lymph node and liver metastases. Five clones of each BMPC1 and BMPC2 were expanded in cell culture media. MYC/PTEN protein expression as well as Nkx3.1 and AR mRNA were measured and found to be comparable between individual clones. One clone of each cell line was chosen for further analysis. The clonal cell lines were named BMPC1 (lymph node metastasis) and BMPC2 (Liver metastasis). BMPC1 and BMPC2 cells were routinely cultured in 10% FBS supplemented media. Cell growth remained consistent through multiple passages (>60) without senescence. Aliquots of early passage cells were stored in liquid nitrogen for future use. The generation of FFPE cell plugs was as described.29

2.6 |. Cell growth assay

PC3 (500 cells/well), MYC-CaP (1000 cells/well), BMPC1 (500 cells/well), BMPC2 (500 cells/well) were plated in 48-well plates (Corning) containing media supplemented with 10% FBS. After 24 h, the cells were treated as indicated and grown under normal tissue culture conditions. Cell count and confluence was measured using live imaging software (IncuCyte ZOOM Live-Cell Analysis, Essen BioScience).

2.7 |. Western blotting

Cells were plated in T75 flasks to 75% confluence in media containing 10% FBS. Prior to treatment with R1881 (Sigma-Aldrich), the media was replaced with a 10% CCS supplemented media for 48 h. R1881 was added to a final concentration of 1 nM or 10 nM for 24 h. Protein extracts were collected in RIPA buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% [v/v] Triton X-100, 1% [w/v] sodium deoxycholate,. One percent [w/v] Sodium dodecyl sulfate [SDS]) with protease inhibitors (Complete Mini, Roche, Switzerland). Western blot analysis was performed using the following antibodies: rabbit anti-human AR 1:1000 (Cell Signaling), mouse monoclonal anti-human beta-actin 1:1000 (Sigma). Membranes were revealed with HRP-linked goat anti-rabbit IgG 1:2000 (Cell Signaling) or horse anti-mouse IgG 1:2000 (Cell Signaling) using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Waltham, MA).

2.8 |. Allograft/in vivo growth

Twenty five ∼42 days old male homozygous athymic nude mice (Crl: NU[NCr]-FOX1nu) from Charles river (Wilmington, MA) were acquired. The mice were allowed to acclimatize for seven days. PCR-based mouse and human pathogen testing on BMPC1 cells was negative (IMPACT I testing was performed which included: Ectromelia, EDIM, Hantaan, K virus, LCMV, LDEV, MAV1, MAV2, mCMV, MHV, MNV, MPV, MTV, MVM, Mycoplasma pulmonis, Mycoplasma sp., Polyoma, PVM, REO3, Sendai, TMEV. IXEDD Bioresearch, www.idexxbioresearch.com. A total of 100 μL (106 cells) BMPC1 cell suspension in DMEM media was injected on the left flank of each mouse subcutaneously. The allograft tumors were measured every alternate day using digital calipers and allowed to grow to a volume greater than 200 mm3 before being enrolled in the study. An unpaired, two-tailed t-test was used to compare across groups at each time point. P values <0.05 were considered statistically significant

2.9 |. Mouse surgical procedures

To achieve sustained delivery, 5α-dihydrotestosterone (DHT) was loaded into ∼2 cm lengths of sterile medical grade silastic tubing (Corning, O.D. = 3.18 mm) and the tubing was sealed using medical grade adhesive. Mice were anesthetized using intraperitoneal injection with Avertin. Once deep anesthesia had been achieved, a 5 mm incision was made perpendicular to the dorsal midline at the cervico-thoracic junction. Using blunt scissors, the skin and fascia were gently dissected from the underlying muscle to create a ∼2 cm pocket extending posteriorly along the dorsal midline. Using sterile forceps, the silastic tubing was inserted into the subcutaneous pocket, and the incision was closed with 6–0 nylon suture. Animals were placed in a cage on a heating pad and monitored until they were ambulatory. The animals were then returned to the animal facility where they remained till the end of the study.

Twenty-one of the 25 mice injected developed allograft tumors, and the mice with tumors were then randomly assigned to five groups; Control (3), Sham castration (3), Castration (5), test vehicle (5), and test drug (5) (DHT), as their tumors reached the 200 mm3 volume. The test vehicle group was implanted with empty silastic tubing whereas the test drug group was implanted with DHT filled silastic tubing. For castration and sham castration procedures mice were anesthetized using Avertin by intraperitoneal injection. Once deep anesthesia had been achieved the castration procedure was performed as described earlier by Yoo et al.30 For sham castration the same procedure was performed but the testicles were not removed. Animals were placed in a cage on a heating pad and monitored until they were ambulatory. The animals were provided with ibuprofen in drinking water for 48 h for post-operative analgesia.

3 |. RESULTS

Each cell line was initially characterized for phenotype using immunohistochemistry (IHC) and RNA in situ hybridization (RNAish) (Figures 1A and 1B) on cells that were fixed in formalin and embedded into paraffin blocks (formalin fixed and paraffin embedded or FFPE). MYC mRNA and protein was uniformly detected at high levels whereas Pten protein was absent in both cell lines, consistent with the trigenic model. To confirm prostatic origin, we examined the expression of Nkx3.1, Hoxb13, and AR. Both BMPC1 and BPMC2 had detectable levels of Nkx3.1 mRNA and protein as well as Hoxb13 mRNA. AR protein was present at very low levels in both the cytoplasm and nucleus of BMPC1 cells. The weak AR staining observed in the BMPC1 cell line under normal tissue culture conditions did not show predominantly nuclear localization. BMPC2 cells did not have detectable levels of AR protein by IHC. AR mRNA was readily detected in BMPC1 cells (Figure 1A, Figure 2C) and was undetectable in BMPC2 cells. Epithelial markers (ie, keratin 18 and Foxa1) were positive across BMPC1 and BMPC2. Moreover, neuroendocrine markers (Foxa2 and chromogranin A) and stromal elements (vimentin and smooth muscle actin) were negative (Supplementary Figure S1). Also absent from both cell lines was the basal cell marker, P63.

FIGURE 1.

FIGURE 1

Molecular and genetic characterization of murine cell lines, BMPC1 and BMPC2. A, Summary of IHC and RNAish staining results delineating tissue of origin and cell subtype. (− = negative, + = low, ++ = high). B, IHC staining of key proteins involved in prostate carcinogenesis and disease progression. ker 5, keratin 5; ker 18 is keratin 18. C, Standard karyotype of BMPC1 (top) and BMPC2 (bottom). [Color figure can be viewed at wileyonlinelibrary.com]

FIGURE 2.

FIGURE 2

AR mRNA and protein expression in BMPC1 and BMPC2 Cell Lines. A, Left—Western blot analysis of AR protein expression across MYC-CaP, BMPC1, and BMPC2 cell lines. Right—Quantitative mRNA of AR expression in BMPC1 and BMPC2 cell lines. BMPC1 and BMPC2 AR mRNA levels are reported as fold difference relative to the MYC-CaP cell line. B, BMPC1 and BMPC2 cell lines were treated with 1 nM or 10 nM R1881 for 24 h in charcoal stripped media. AR protein expression was measured by Western blot. B-actin levels are shown as a loading control. C, IHC staining and chromogenic RNAish for AR in BMPC1 and BMPC2 formalin fixed paraffin embedded cell plugs following treatment with R1881. [Color figure can be viewed at wileyonlinelibrary.com]

Standard Giemsa stained karyotypes revealed highly abnormal chromosomal copy numbers with a modal number of 72–80 chromosomes and 52–102 chromosomes in the BMPC1 and BMPC2 cell lines, respectively. Numerous chromosomal aberrations including small fragments, chromosomal associations, and deletions were observed, with a higher tendency for such events in the BMPC2 cell line. Representative karyotypes of the BMPC1 and BMPC2 cells are shown in Figure 1C. Additional whole genomic characterizations will be presented separately.

We then further characterized AR expression and androgen responsiveness in both cell lines. Although AR protein was observed in BMPC1 cells at low levels via IHC, a band corresponding to the correct size of AR was not detected by western blot (Figure 2A, Left). We interpret this to indicate that IHC is more sensitive than the Western blotting when using whole cell lysates in the absence of AR enrichment (eg, by prior immunoprecipitation). To further validate that the IHC staining is specific for AR protein, we stained a number of FFPE cell lines and human tissues with known AR status (Supplementary Figure S2). The known AR-negative cell lines PC3 and DU145 showed absence of AR immunoreactivity, while the known AR-positive cell lines LNCaP, VCaP, and CWR-22Rv1 showed strong immunoreactivity. Likewise, normal prostatic luminal, and stromal cells showed the expected strong immunoreactivity for AR. Using quantitative RT-PCR, BMPC1 had detectable levels of AR mRNA, but the levels were ∼35–50x’s fold lower than AR mRNA in the mouse line, MYC-CaP (Figure 2A, Right). Levels of AR mRNA in BMPC1 cells were significantly more than BMPC2, which was barely detectable by quantitative RT-PCR.

As BMPC1 cells expressed AR mRNA yet very little AR protein, which was not concentrated within nuclei, we hypothesized that AR protein in BMPC1 cells may be unstable and rapidly degraded in the absence of ligand. In an effort to stabilize AR protein and induce nuclear translocation, we treated BMPC1 cells with increasing doses of the synthetic androgen, R1881, following serum starvation. By Western blot, AR protein was detectable in the BMPC1 cell line following exposure to androgen (Figure 2B). Using IHC on FFPE cell pellets, we confirmed an R1881-induced increase in AR protein in BMPC1 cells and observed nuclear translocation of the receptor (Figure 2C). At the mRNA level in BMPC1 cells, culture in media containing charcoal-stripped serum resulted in increased AR mRNA compared to full serum with no appreciable change in protein expression in the absence of R1881 (Figure 2C). The expression of Nkx3.1, a known prostate specific AR-responsive gene, was not effected by charcoal stripped media or the presence of R1881 (data not shown). No effect of charcoal stripped serum or addition of R1881 was observed on changes in AR protein or mRNA expression in the BMPC2 cell line.

Given the effect of R1881 on AR protein levels in BMPC1, we examined the effect of both R1881 supplementation and anti-androgen treatment in a series of in vitro growth experiments. We examined the cell growth of both BMPC1 and BMPC2 in the presence and absence of the anti-androgen, enzalutamide (Figure 3A). BMPC1 and BMPC2 cell growth was not affected by the addition of enzalutamide, comparable to the effect on the AR-negative, human prostate cancer cell line, PC3. As AR protein levels were stabilized in the presence of androgen, we sought to determine the growth effect of androgen supplementation. BMPC1 and BMPC2 cells were grown in media supplemented with charcoal stripped serum which reduced the growth of all cell lines tested, including PC3 (Figure 3B). The addition of 10 nM R1881 rescued the growth of the androgen-sensitive, mouse cell line, MYC-CaP, but did not affect the growth of BMPC1, BMPC2, or PC3 cells.

FIGURE 3.

FIGURE 3

Effect of R1881 and enzalutamide on BMPC1 and BMPC2 Cell Growth. Using Incucyte imaging software, cell growth (% confluency) was measured over a time course of up to 200 h following treatment with (A). Enzalutamide 10 μM and (B) 1 nM and 10 nM R1881. Growth of BMPC1 and BMPC2 cell lines were not significantly affected by treatment with an anti-androgen or restoration of androgen. [Color figure can be viewed at wileyonlinelibrary.com]

We next performed in vivo studies assessing the androgen responsiveness of the BMPC1 cell line in allografts in immunocompromised mice, given the in vitro increase of ARprotein levels in the presence of R1881. BMPC1 allografts were allowed to grow in nude mice to a tumor volume of 500 mm3 before initiating treatment. Initially, we evaluated BMPC1 allograft growth following castration. To control for an effect of iatrogenic stress, control animals underwent a sham castration. No significant effect on BMPC1 allograft growth was observed following castration (n = 5) over an 8-day time course compared to the sham control (n = 3) (Figure 4A). Since AR protein was stabilized in the presence of the AR agonist in our in vitro studies, we measured BMPC1 allograft growth after the addition of DHT. Silastic tubing containing DHT (n = 5) or blank tubing (n = 5) was placed subcutaneously in the tumor-bearing mice on Day 0. No significant difference in BMPC1 allograft volume was observed between either group, similar to the results of the castration experiment (Figure 4B). At necropsy, BMPC1 allografts from the DHT and castration experiments were formalin-fixed and paraffin embedded for further study of AR expression. Following castration, AR mRNA levels in the allografts increased relative to both control (no surgery) and sham specimens (Figure 4C). IHC staining for AR protein remained virtually undetectable irrespective of castration status. Mice that harbored DHT-containing or blank silastic tubing (which were not castrated) had AR mRNA levels that did not change in the presence of DHT (Figure 4D). As in the cell lines treated with R1881 in vitro, AR protein was readily detected in BMPC-1 allografts from DHT-treated mice and located in the nucleus. No effect of castration or DHT supplementation was observed on Nkx3.1 expression.

FIGURE 4.

FIGURE 4

In vivo effect of castration and DHT supplementation on BMPC1 allograft growth and AR expression in nude mice. Nude mice were inoculated with BMPC1 and grown to 500cc3. A, Mice underwent sham castration or castration and tumor volume was measured daily until euthanasia. No effect of castration was observed (P > 0.05 across all time points). B, Empty or DHT-containing silastic tubing was placed subcutaneously in BMPC1 bearing nude mice. Tumor volume was measured daily until euthanasia. DHT did not increase allograft growth (P > 0.05 across all time points). C, AR mRNA levels increased following castration. No change in AR protein was observed. D, AR protein levels were increased in the presence of DHT and localized to the nucleus. No change in AR mRNA was detected. [Color figure can be viewed at wileyonlinelibrary.com]

4 |. DISCUSSION

BMPC1 and BMPC2 cell lines were generated in a mouse model reliant on Hoxb13 transcriptional control elements, which direct gene expression in the prostate, and distal large intestine/rectum.31 We confirmed the prostatic origin of both lines via detection of the prostate-specific homeodomain protein, Nkx3.1, as well as AR mRNA. In comparison to MYC-CaP cells, BMPC1 had significantly less AR mRNA and BMPC2 was negative by in situ hybridization, and slightly positive by RT-PCR. Whereas AR protein expression in BMPC2 was absent, BMPC1 make low levels of AR under normal growth conditions, indicating heterogeneity for AR between lines. Similarly, in the BMPC model, AR expression was lost upon the development of invasive carcinoma consistent with the findings in both cell lines.23 The dynamic interplay between AR expression/signaling and Pten loss in murine model of prostate cancer has been well established. Upon Pten loss or inactivation in luminal cells, the resulting activation of the Pi3k signaling pathway has been shown to negatively regulate AR expression and downstream signaling.32,33 Interestingly, Pi3k inhibition did not result in increased AR expression in either BMPC1 or BMPC2 cells (unpublished observations). Loss of AR expression is relatively common in murine models of prostate cancer.20,34

We explored whether manipulating androgen levels would affect AR expression in these cell lines. Media supplemented with charcoal stripped media (ie, androgen depleted) resulted in increased AR mRNA in the BMPC1 cell line suggesting a negative, autoregulation of AR expression. Despite an increase in mRNA, no change in AR protein was observed. AR protein has been shown to be more stable in the presence of ligand prompting further investigation of the role of androgens on the posttranslational regulation of AR protein.35 The addition of a synthetic androgen (R1881) increased the level of AR protein and resulted in nuclear localization in only the BMPC1 Line. We did not measure circulating testosterone levels in the intact, castrated, or DHT-supplemented mice which is an acknowledged weakness of this study. However, we speculate that circulating levels of androgens in the mouse models may not be sufficient to stabilize AR protein contributing to this loss. This hypothesis is supported by our in vivo data, which showed increased/stable AR protein levels in BMPC1 allografts following the implantation of DHT without a corresponding increase in mRNA. Castration of these mice lead to an increase in BMPC1 AR mRNA, but not protein, consistent with the in vitro findings. Testosterone levels in mice are decreased in the presence of disease states such as cancer, suggesting a possible mechanism for diminished AR expression in the BMPC, and other mouse models of prostate cancer.36 In the absence of androgen in hormone sensitive prostate cancer cells (ie, LNCaP), AR protein is unstable leading to decreased levels, which is consistent with the BMPC1 in vitro model.37

Although AR protein can be stabilized and translocated to the nucleus, BMPC1 cell growth was not affected by the presence of R1881 or treatment with an anti-androgen. We also did not observe a change in Nkx3.1 mRNA or protein levels in both the in vitro and in vivo experimental system in the presence of androgens. This suggests that AR, although present, is not transcriptionally active and/or significantly affecting cell growth. The mechanism for this phenomenon is unclear and may be related to the low levels of AR mRNA and protein at baseline. The term “androgen indifferent” prostate cancer has been coined by Aparicio and colleagues to describe a variant of prostate adenocarcinoma. This subtype of prostate cancer is characterized, in part, by absent or low levels of AR protein.38 Such cancers typically have a short duration of response to hormonal therapies and may benefit from platinum based chemotherapy.39 BMPC1 and BMPC2 may model AR-indifferent prostate cancer as demonstrated by a lack of sensitivity to androgen stimulation as well as exposure to an anti-androgen. These cell lines may then serve as an in vitro tool for further study of a lethal subtype of prostate adenocarcinoma.

Supplementary Material

Supp. Image 1
Supp. Image 2

ACKNOWLEDGMENTS

This work was partially supported by the Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins NIH grant P30 CA006973, P50 CA058236, U01 CA196390, R01 CA183965 (SY), the Prostate Cancer Foundation Young Investigator Award (MCM), and Challenge Award (SY), Department of Defense W81XWH-15-1-0432 Postdoctoral Award (MCM), ASCO/CCF Young Investigator Award (MCM), and Department of Defense W81XWH-15-1-0729 Synergistic Idea Development Award (AMD). The Patrick C. Walsh Prostate Cancer Research Fund (AMD and CJB) The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Cancer Institute or the National Institutes of Health.

Funding information

Prostate Cancer Foundation, Grant numbers: Challenge Award, Young Investigator Award; Congressionally Directed Medical Research Programs, Grant numbers: W81XWH-15-1-0432, W81XWH-15-1-0729; American Society of Clinical Oncology, Grant number: Young Investigator Award; National Cancer Institute, Grant numbers: P30 CA006973, P50 CA058236, R01 CA183965, U01 CA196390; Patrick C. Walsh Prostate Cancer Research Fund

Footnotes

CONFLICTS OF INTEREST

All authors have no conflicts of interest to disclose.

SUPPORTING INFORMATION

Additional supporting information may be found online in the Supporting Information section at the end of the article.

REFERENCES

  • 1.Siegel RL, Miller KD, Jemal A. Cancer statistics. CA Cancer J Clin 2016;66:7–30. [DOI] [PubMed] [Google Scholar]
  • 2.Taylor BS, Schultz N, Hieronymus H, et al. Integrative genomic profiling of human prostate cancer. Cancer Cell 2010;18:11–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Grasso CS, Wu YM, Robinson DR, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature 2012;487: 239–243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Berger MF, Lawrence MS, Demichelis F, et al. The genomic complexity of primary human prostate cancer. Nature 2011;470:214–220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Schrecengost R, Knudsen KE. Molecular pathogenesis and progression of prostate cancer. Semin Oncol 2013;40:244–258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cancer genome atlas research N. the molecular taxonomy of primary prostate cancer. Cell 2015;163:1011–1025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wang SI, Parsons R, Ittmann M. Homozygous deletion of the PTEN tumor suppressor gene in a subset of prostate adenocarcinomas. Clin Cancer Res 1998;4:811–815. [PubMed] [Google Scholar]
  • 8.Jenkins RB, Qian J, Lieber MM, Bostwick DG. Detection of c-myc oncogene amplification and chromosomal anomalies in metastatic prostatic carcinoma by fluorescence in situ hybridization. Cancer Res 1997;57:524–531. [PubMed] [Google Scholar]
  • 9.Visakorpi T, Kallioniemi AH, Syvanen AC, et al. Genetic changes in primary and recurrent prostate cancer by comparative genomic hybridization. Cancer Res 1995;55:342–347. [PubMed] [Google Scholar]
  • 10.McMenamin ME, Soung P, Perera S, Kaplan I, Loda M, Sellers WR. Loss of PTEN expression in paraffin-embedded primary prostate cancer correlates with high Gleason score and advanced stage. Cancer Res 1999;59:4291–4296. [PubMed] [Google Scholar]
  • 11.Lotan TL, Gurel B, Sutcliffe S, et al. PTEN protein loss by immunostaining: analytic validation and prognostic indicator for a high risk surgical cohort of prostate cancer patients. Clin Cancer Res 2011;17:6563–6573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yoshimoto M, Cunha IW, Coudry RA, et al. FISH analysis of 107 prostate cancers shows that PTEN genomic deletion is associated with poor clinical outcome. Br J Cancer 2007;97:678–685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Reid AH, Attard G, Ambroisine L, et al. Molecular characterisation of ERG, ETV1 and PTEN gene loci identifies patients at low and high risk of death from prostate cancer. Br J Cancer 2010;102:678–684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cuzick J, Yang ZH, Fisher G, et al. Prognostic value of PTEN loss in men with conservatively managed localised prostate cancer. Br J Cancer 2013;108:2582–2589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ahearn TU, Pettersson A, Ebot EM, et al. Aprospective investigation of PTEN loss and ERG expression in lethal prostate cancer. J Natl Cancer Inst 2016;108:1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fromont G, Godet J, Peyret A, et al. 8q24 amplification is associated with Myc expression and prostate cancer progression and is an independent predictor of recurrence after radical prostatectomy. Hum Pathol 2013;44:1617–1623. [DOI] [PubMed] [Google Scholar]
  • 17.Sato K, Qian J, Slezak JM, et al. Clinical significance of alterations of chromosome 8 in high-grade, advanced, nonmetastatic prostate carcinoma. J Natl Cancer Inst 1999;91:1574–1580. [DOI] [PubMed] [Google Scholar]
  • 18.Ribeiro FR, Henrique R, Martins AT, Jeronimo C, Teixeira MR. Relative copy number gain of MYC in diagnostic needle biopsies is an independent prognostic factor for prostate cancer patients. Eur Urolo 2007;52:116–125. [DOI] [PubMed] [Google Scholar]
  • 19.Liu W, Xie CC, Thomas CY, et al. Genetic markers associated with early cancer-specific mortality following prostatectomy. Cancer 2013;119: 2405–2412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ittmann M, Huang J, Radaelli E, et al. Animal models of human prostate cancer: the consensus report of the New York meeting of the Mouse Models of Human Cancers Consortium Prostate Pathology Committee. Cancer Res 2013;73:2718–2736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Irshad S, Abate-Shen C. Modeling prostate cancer in mice: something old, something new, something premalignant, something metastatic. Cancer Metastasis Rev 2013;32:109–122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kim J, Eltoum IE, Roh M, Wang J, Abdulkadir SA. Interactions between cells with distinct mutations in c-MYC and Pten in prostate cancer. PLoS Genet 2009;5:e1000542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hubbard GK, Mutton LN, Khalili M, et al. Combined MYC activation and pten loss are sufficient to create genomic instability and lethal metastatic prostate cancer. Cancer Res 2016;76: 283–292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Williams JL, Greer PA, Squire JA. Recurrent copy number alterations in prostate cancer: an in silico meta-analysis of publicly available genomic data. Cancer Genet 2014;207:474–488. [DOI] [PubMed] [Google Scholar]
  • 25.Sun J, Liu W, Adams TS, et al. DNA copy number alterations in prostate cancers: a combined analysis of published CGH studies. Prostate 2007;67:692–700. [DOI] [PubMed] [Google Scholar]
  • 26.Hieronymus H, Schultz N, Gopalan A, et al. Copy number alteration burden predicts prostate cancer relapse. Proc Natl Acad Sci USA 2014;111:11139–11144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bianchi-Frias D, Hernandez SA, Coleman R, Wu H, Nelson PS. The landscape of somatic chromosomal copy number aberrations in GEM models of prostate carcinoma. Mol Cancer Res 2015;13:339–347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ding Z, Wu CJ, Jaskelioff M, et al. Telomerase reactivation following telomere dysfunction yields murine prostate tumors with bone metastases. Cell 2012;148:896–907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Holdhoff M, Guner G, Rodriguez FJ, et al. Absence of cytomegalovirus in glioblastoma and other high-grade gliomas by real-time PCR, immunohistochemistry, and In situ hybridization. Clin Cancer Res 2017;23:3150–3157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yoo YE, Ko CP. Dihydrotestosterone ameliorates degeneration in muscle, axons and motoneurons and improves motor function in amyotrophic lateral sclerosis model mice. PLoS ONE 2012;7:e37258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.McMullin RP, Mutton LN, Bieberich CJ. Hoxb13 regulatory elements mediate transgene expression during prostate organogenesis and carcinogenesis. Dev Dyn 2009;238:664–672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Carver BS, Chapinski C, Wongvipat J, et al. Reciprocal feedback regulation of PI3K and androgen receptor signaling in PTEN-deficient prostate cancer. Cancer cell 2011;19:575–586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mulholland DJ, Tran LM, Li Y, et al. Cell autonomous role of PTEN in regulating castration-resistant prostate cancer growth. Cancer Cell 2011;19:792–804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cho H, Herzka T, Zheng W, et al. RapidCaP, a novel GEM model for metastatic prostate cancer analysis and therapy, reveals myc as a driver of Pten-mutant metastasis. Cancer Discov 2014;4: 318–333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhou ZX, Lane MV, Kemppainen JA, French FS, Wilson EM. Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Mol Endocrinol 1995;9:208–218. [DOI] [PubMed] [Google Scholar]
  • 36.Nelson JF, Latham KR, Finch CE. Plasma testosterone levels in C57BL/6J male mice: effects of age and disease. Acta Endocrinol (Copenh) 1975;80:744–752. [DOI] [PubMed] [Google Scholar]
  • 37.Gregory CW, Johnson RT, Jr., Mohler JL, French FS, Wilson EM. Androgen receptor stabilization in recurrent prostate cancer is associated with hypersensitivity to low androgen. Cancer Res 2001; 61:2892–2898. [PubMed] [Google Scholar]
  • 38.Beltran H, Tomlins S, Aparicio A, et al. Aggressive variants of castration-resistant prostate cancer. Clin Cancer Res 2014;20: 2846–2850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Aparicio AM, Harzstark AL, Corn PG, et al. Platinum-based chemotherapy for variant castrate-resistant prostate cancer. Clinical Cancer Res 2013;19:3621–3630. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp. Image 1
Supp. Image 2

RESOURCES