Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2023 Jan 19;4(1):102037. doi: 10.1016/j.xpro.2022.102037

Protocol to access unknown flanking DNA sequences using Wristwatch-PCR for genome-walking

Lingqin Wang 1,2,5, Mengya Jia 1,2, Zhaoqin Li 3, Xiaohua Liu 1,2, Tianyi Sun 1,2,4, Jinfeng Pei 1,2, Cheng Wei 1,2, Zhiyu Lin 1,2,4, Haixing Li 1,2,6,∗
PMCID: PMC9871321  PMID: 36853735

Summary

Here we describe a protocol for wristwatch PCR, an approach based on wristwatch-like structure formed between walking primers to obtain unknown flanks. We specify the criteria for designing wristwatch primers and gene-specific primers. We detail how to set wristwatch primer permutations to obtain personalized walking outcomes and improve walking efficiency. We describe experimental procedures for isolating a DNA of interest using three rounds of nested wristwatch PCR as well as the subsequent steps for DNA purification, cloning, and sequencing.

For complete details on the use and execution of this protocol, please refer to Wang et al. (2022).1

Subject areas: Genetics, Sequencing, Molecular Biology, Biotechnology and bioengineering

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • •

    Design of a wristwatch primer set to selectively enrich target DNA

  • •

    Parallel use of wristwatch primer permutations to ensure walking efficiency

  • •

    Conduct three successive nested PCRs implemented for genome-walking


Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.


Here we describe a protocol for wristwatch PCR, an approach based on wristwatch-like structure formed between walking primers to obtain unknown flanks. We specify the criteria for designing wristwatch primers and gene-specific primers. We detail how to set wristwatch primer permutations to obtain personalized walking outcomes and improve walking efficiency. We describe experimental procedures for isolating a DNA of interest using three rounds of nested wristwatch PCR as well as the subsequent steps for DNA purification, cloning, and sequencing.

Before you begin

Genome-walking is a group of techniques for capturing unknown genomic regions contiguous to a targeted DNA, which is integral to molecular study of chromosomes and significant genetic elements.2,3 As the advancement of molecular biology, genome-walking relying on PCR has been promising given its simplicity and clarity.4,5 According to the involved rationales, the available genome-walking strategies can generally be classified into three types: 1) inverse PCR6; 2) cleavage-ligation-mediated PCR7,8; and 3) randomly primed PCR.9,10,11

The inverse PCR and cleavage-ligation-mediated PCR have been extensively utilized in acquiring flanking sequences.12 Nevertheless, extra experimental steps, including restriction digestion and ligation, are enforced prior to PCR in these methods. The randomly primed PCRs, like thermal asymmetric interlaced PCR, partially overlapping primer-based PCR, and self-formed adapter PCR, are relatively straightforward strategies.13,14,15 However, the thermal asymmetric interlaced PCR cannot overcome the background arising from random walking primers9; the self-formed adapter PCR is susceptible to the non-universality of walking primers15; and the partially overlapping primer-based PCR requires many walking primers.10,13

In this protocol, we describe wristwatch PCR (WW-PCR), an approach based on wristwatch-like structure formed between walking primers, to obtain unknown flanks. We devise a walking primer set of three primers having a 5′- and 3′-overlap and a middle mismatch. Any two walking primers can form a wristwatch-like structure under sufficiently low temperatures. The walking primer is thus called wristwatch primer (WWP). A WWP set selectively enriches target DNA and simultaneously excludes undesired DNAs, due to the fact that in each round of PCR, the single relaxed-stringency cycle restricts partial annealing of any primer to once only. The feasibility of WW-PCR has been verified by isolating flanks of the glutamate decarboxylase (gadA) locus16,17,18 and hygromycin gene (hyg).13

Design of primers

Inline graphicTiming: half a day

This step describes how to design WWPs and gene-specific primers (GSPs).

  • 1.
    Design of WWPs.
    • a.
      All the WWPs are 25 nt in length and completely random.
    • b.
      All the WWPs possesses identical 5′-parts (12 nt) and 3′-parts (3 nt) and mutually heterologous spacers (10 nt) (Table 1).
    • c.
      A WWP has a high melting temperature (60°C–65°C).
    • d.
      The four bases evenly distribute in a primer, with a 56% GC content.
    • e.
      The annealing temperatures between the WWPs are approximate 40°C.
  • 2.
    Design of GSPs.
    • a.
      Select GSPs according to a known DNA.
    • b.
      A GSP has a high melting temperature (60°C–65°C).
    • c.
      The four bases evenly distribute in a primer, with a 40%–60% GC content.

Inline graphicPause point: Email the designed sequences to the Sangon Biotech Co., Ltd. (Shanghai, China) for synthesis.

Inline graphicCRITICAL: A primer or primer pair avoids forming an obvious dimer or hairpin. A GSP has an equal melting temperature to its paired WWP.

Note: Use the software package Oligo 7 (Molecular Biology Insights, Inc., USA) to design and evaluate a primer.

Note: Heterologous spacers in WWPs are underlined.

Table 1.

Primers used in this protocol

Primer Oligo sequence (5′-3′) Melting temperature (°C) GC content (%)
WWP1 CGTCTCCAGTCTCCATGTGTTCGTC 63.5 56
WWP2 CGTCTCCAGTCTTAGGCACAGTGTC 63.4 56
WWP3 CGTCTCCAGTCTAGTCAGTCAGGTC 62.3 56
gadAGSP1 TCCATACCCTCATCTCCATTTCCAT 60.4 44
gadAGSP2 AACTATCACCCCACAACGTCATCTC 61.4 48
gadAGSP3 ACCGTTCATAGGCGAAATTGTTTGT 60.7 40
hygGSP1 CGGCAATTTCGATGATGCAGCTTGG 64.1 52
hygGSP2 CGGGACTGTCGGGCGTACACAAATC 66.2 60
hygGSP3 GACCGATGGCTGTGTAGAAGTACTC 61.3 52

Preparation of ready-to-use primer solution

Inline graphicTiming: 30 min

This step details how to prepare a ready-to-use primer solution.

  • 3.

    Centrifuge a powdery primer at 4,000 × g for 30 s.

  • 4.

    Carefully open the tube cover.

  • 5.

    Add 1 × TE buffer then fully mix to prepare a 100 μM stock solution of primer.

  • 6.

    Produce ready-to-use primer solution by diluting a portion of the stock ten folds with ddH2O.

  • 7.

    Divide the ready-to-use primer solution into aliquots.

  • 8.

    Store the aliquots and rest stock solution at −20°C.

Note: All the primers, purified with polyacrylamide gel electrophoresis, are provided in the form of freeze-dried powder by the Sangon Biotech Co., Ltd. The concentration of a ready-to-use primer solution is 10 μM.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Bacterial and virus strains

Levilactobacillus brevis Gao et al.16 CD0817
Escherichia coli TAKARA DH5α

Biological samples

Rice genomic DNA Nanchang University Wang et al.1
T-Vector pMD™19 (Simple) TAKARA Cat# 3271

Chemicals, peptides, and recombinant proteins

Tris Solarbio Cat# T8060
Boric acid Solarbio Cat# B8110
Sodium hydroxide Sinopharm Cat# 10019762
Hydrochloric acid Sinopharm Cat# 10011018
EDTA Solarbio Cat# E8040
Agarose Sangon Cat# A620014
Tryptone Angelyeast Cat# FP318
Yeast extract Angelyeast Cat# FM408
Agar powder Aobox Cat# 01023
Sodium chloride Sinopharm Cat# L8290
Luria-Bertani (LB) nutrient agar Solarbio Cat# L8290
LB broth Solarbio Cat# L8291
Ampicillin Solarbio Cat# A8180
1 × TE buffer Sangon Cat# B548106
5 × TBE buffer Sangon Cat# B548102
0.5 M EDTA (pH 8.0) Sangon Cat# B540625
1 M NaOH Yuanye Cat# B28412
100 mg/mL ampicillin Solarbio Cat# A1170
dNTP (dATP, dTTP, dCTP, and dGTP) TAKARA Cat# RR02MQ
LA Taq polymerase (Non-hot-start version) TAKARA Cat# RR02MQ
10 × LA PCR buffer (Mg2+ plus) TAKARA Cat# RR02MQ
6 × Loading buffer TAKARA Cat# 9156
DL 5000 DNA marker TAKARA Cat# 3428Q
GoldView II Nuclear Staining Dyes (5000 ×) Solarbio Cat# G8142

Critical commercial assays

Bacterial Genomic DNA Isolation Kit TIANGEN Cat# DP302-02
MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 TAKARA Cat# 9762
DNA Ligation Kit (Mighty Mix) TAKARA Cat# 6023Q
Sanprep Column Plasmid Mini-Preps Kit Sangon Cat #B518191

Oligonucleotides

WWP1: CGTCTCCAGTCTCCATGTGTTCGTC Sangon Wang et al.1
WWP2: CGTCTCCAGTCTTAGGCACAGTGTC Sangon Wang et al.1
WWP3: CGTCTCCAGTCTAGTCAGTCAGGTC Sangon Wang et al.1
gadAGSP1: TCCATACCCTCATCTCCATTTCCAT Sangon Wang et al.1
gadAGSP2: AACTATCACCCCACAACGTCATCTC Sangon Wang et al.1
gadAGSP3: ACCGTTCATAGGCGAAATTGTTTGT Sangon Wang et al.1
hygGSP1: CGGCAATTTCGATGATGCAGCTTGG Sangon Wang et al.1
hygGSP2: CGGGACTGTCGGGCGTACACAAATC Sangon Wang et al.1
hygGSP3: GACCGATGGCTGTGTAGAAGTACTC Sangon Wang et al.1
M13F: CGCCAGGGTTTTCCCAGTCACGAC Sangon Wang et al.1
M13R: CACACAGGAAACAGCTATGAC Sangon Wang et al.1

Software and algorithms

Oligo 7 Molecular Biology Insights, Inc. www.oligo.net
DNASTAR Lasergene DNASTAR, Inc. www.dnastar.com

Other

Biometra TOne 96G Thermal Cycler Analtytikjena 4109222
ChemiDoc XRS+ Gel Imaging System Bio-Rad 721BR12310
DYY-6C Electrophoresis Apparatus Beijing Liuyi 112-0630

Materials and equipment

Thermal cycler: The Biometra TOne 96G Thermal Cycler is used in this protocol.

Alternatives: Any PCR instruments can be used to complete this protocol.

1 M NaOH

Reagent Final concentration Amount
NaOH 1 M 40 g
ddH2O N/A 1,000 mL
Total N/A 1,000 mL

The 1 M NaOH can be stored at 25°C–30°C for up to 3 months.

Alternatives: Purchase pre-prepared 1 M NaOH (Yuanye, Cat # B28412).

0.5 M EDTA solution (pH 8.0)

Reagent Final concentration Amount
EDTA 0.5 M 18.61 g
ddH2O N/A 100 mL
Total N/A 100 mL

Adjust pH to 8.0 using NaOH.

The 0.5 M EDTA solution can be stored at 25°C–30°C for up to 6 months.

Alternatives: Purchase pre-prepared 0.5 M EDTA (pH 8.0) (Sangon, Cat# B540625).

5 × TBE buffer

Reagent Final concentration Amount
0.5 M EDTA solution 10 mM 20 mL
Tris 0.45 M 54 g
Boric acid 0.45 M 27.5 g
ddH2O N/A 980 mL
Total N/A 1,000 mL

Adjust pH to 8.3.

The 5 × TBE buffer can be stored at 25°C–30°C for up to 3 months.

Alternatives: Purchase pre-prepared 5 × TBE buffer (Sangon, Cat# B548102).

1% agarose gel

Reagent Final concentration Amount
Agarose 1% 1 g
0.5 × TBE buffer 0.5 × 100 mL
GoldView II Nuclear Staining Dyes (5000 ×) 0.5 × 10 μL
Total N/A 100 mL

The 1% agarose gel can be stored at 25°C–30°C for up to 7 days.

LB medium

Reagent Final concentration Amount
Tryptone 10 g/L 10 g
Yeast extract 5 g/L 5 g
NaCl 10 g/L 10 g
ddH2O N/A 1,000 mL
Total N/A 1,000 mL

Adjust pH to 7.0 using 1 M NaOH.

Autoclave the LB broth at 121°C for 20 min. LB agar plate is made by adding 10 g agar to 1 L LB broth, autoclaving at 121°C for 20 min, cooling to 50°C–60°C, pouring into 15 cm plates (15–20 mL/plate), and solidifying at 25°C–30°C. The preparation of LB/Amp agar plate is the same as that of the LB agar, except that ampicillin is added at 100 μg/mL before pouring plates.

Alternatives: Purchase pre-prepared LB broth (Solarbio, Cat# L8291) and LB nutrient agar (Solarbio, Cat# L8290).

100 mg/mL ampicillin

Reagent Final concentration Amount
Ampicillin 100 mg/mL 1 g
ddH2O N/A 10 mL
Total N/A 10 mL

The 100 mg/mL ampicillin can be stored at −20°C for up to 6 months.

Alternatives: Purchase pre-prepared 100 mg/mL ampicillin (Solarbio, Cat# A1170).

Step-by-step method details

PCR procedures

Inline graphicTiming: 9 h

The WW-PCR implements retrieving an unknown DNA using the partial overlap among three WWPs. A WW-PCR comprises three consecutive nested amplification reactions. And parallel WW-PCRs involve permutations of the WWPs. This section details the principle and operations of WW-PCR.

Figure 1 presents the rationale and process of WW-PCR. For convenience and clarity, only employ the permutation WWP1-WWP2-WWP3 to illustrate WW-PCR.

  • 1.

    Permutate the three WWPs into three combinations (Table 2).

Note: A WWP permutation is shown in the same column.

Inline graphicCRITICAL: Each walking experiment includes three parallel sets of WW-PCRs, performed by the three WWP permutations individually pairing with the GSP set. Each WW-PCR set consists of three successive rounds of nested PCRs, executed by the WWPs and GSP in the same row.

  • 2.
    Primary WW-PCR.
    • a.
      Assemble PCR reaction components into a 0.2 mL thin-walled PCR tube on ice.
      Reagent Final concentration Amount
      DNA template 0.2–2 ng/μL, Prokaryotic gDNA; and 2–20 ng/μL, Eukaryotic gDNA 1 μL
      LA Taq polymerase 0.05 U/μL 0.5 μL
      WWP1 0.2 μM 1 μL
      GSP1 0.2 μM 1 μL
      10 × LA PCR buffer II (Mg2+ plus) 1 × 5 μL
      dNTP mixture 0.4 mM each 8 μL
      ddH2O N/A 33.5 μL
      Total N/A 50 μL
      Note: Keep all the involved reagents on ice. Use a genomic DNA as template.
    • b.
      Slightly pipet 2–3 times to mix the contents.
    • c.
      Centrifuge at 4,000 × g for 10 s to gather the mixture at the bottom.
    • d.
      Transfer the tube to the programmed thermal cycler and run PCR.
      PCR cycling conditions
      Steps Temperature Time Cycles
      Initial Denaturation 94°C 3 min 1
      Denaturation 94°C 30 s 5
      Annealing 65°C 30 s
      Extension 72°C 2 min
      Denaturation 94°C 30 s 1
      Annealing 25°C 30 s
      Extension 72°C 2 min
      Denaturation 94°C 30 s 25
      Annealing 65°C 30 s
      Extension 72°C 2 min
      Final extension 72°C 3 min 1
      Hold 4°C forever
    • e.
      Place the reacted solution on ice.
    • f.
      Pipet 1 μL the solution as template of the secondary PCR.
    • g.
      Keep the rest solution at −20°C until agarose gel electrophoresis.
  • 3.
    Secondary PCR.
    • a.
      Assemble PCR reaction components into a 0.2 mL PCR tube on ice.
      Secondary PCR system
      Reagent Final concentration Amount
      Primary PCR product N/A 1 μL
      LA Taq 0.05 U/μL 0.5 μL
      WWP2 0.2 μM 1 μL
      GSP2 0.2 μM 1 μL
      10 × LA PCR buffer II (Mg2+ plus) 1 × 5 μL
      dNTP mixture 0.4 mM each 8 μL
      ddH2O N/A 33.5 μL
      Total N/A 50 μL
      Note: Keep all the involved reagents on ice. Use the primary product as template.
    • b.
      Slightly pipet 2–3 times to mix the contents.
    • c.
      Centrifuge at 4,000 × g for 10 s to gather the mixture at the bottom.
    • d.
      Transfer the tube to the programmed thermal cycler and run PCR.
      Secondary PCR cycling conditions
      Steps Temperature Time Cycles
      Initial Denaturation 94°C 3 min 1
      Denaturation 94°C 30 s 5
      Annealing 65°C 30 s
      Extension 72°C 2 min
      Denaturation 94°C 30 s 1
      Annealing 40°C 30 s
      Extension 72°C 2 min
      Denaturation 94°C 30 s 25
      Annealing 65°C 30 s
      Extension 72°C 2 min
      Final extension 72°C 3 min 1
      Hold 4°C forever
    • e.
      Place the reacted solution on ice.
    • f.
      Pipet 1 μL the solution as template of the tertiary PCR.
    • g.
      Keep the rest solution at −20°C until agarose gel electrophoresis.
  • 4.
    Tertiary PCR.
    • a.
      Assemble PCR reaction components into a 0.2 mL PCR tube on ice.
      Tertiary PCR system
      Reagent Final concentration Amount
      Secondary PCR product N/A 1 μL
      LA Taq 0.05 U/μL 0.5 μL
      WWP3 0.2 μM 1 μL
      GSP3 0.2 μM 1 μL
      10 × LA PCR buffer II (Mg2+ plus) 1 × 5 μL
      dNTP mixture 0.4 mM each 8 μL
      ddH2O N/A 33.5 μL
      Total N/A 50 μL
      Note: Keep all the involved reagents on ice. Use the secondary product as template.
    • b.
      Slightly pipet 2–3 times to mix the contents.
    • c.
      Centrifuge at 4,000 × g for 10 s to gather the mixture at the bottom.
    • d.
      Transfer the solution to the programmed thermal cycler and run PCR.
      Tertiary PCR cycling conditions
      Steps Temperature Time Cycles
      Initial Denaturation 94°C 3 min 1
      Denaturation 94°C 30 s 5
      Annealing 65°C 30 s
      Extension 72°C 2 min
      Denaturation 94°C 30 s 1
      Annealing 40°C 30 s
      Extension 72°C 2 min
      Denaturation 94°C 30 s 25
      Annealing 65°C 30 s
      Extension 72°C 2 min
      Final extension 72°C 3 min 1
      Hold 4°C forever
    • e.
      Keep the solution at −20°C until agarose gel electrophoresis.
      Inline graphicPause point: Store the PCR samples at −20°C if the next step is not immediately followed.

Figure 1.

Figure 1

Overview of wristwatch PCR

GSP1, GSP2, and GSP3: gene-specific primers for primary, secondary, and tertiary PCRs, respectively; WWP1, WWP2, and WWP3: wristwatch primers for primary, secondary, and tertiary PCRs, respectively; thin solid line: known sequence; thin dotted line: unknown sequence; colorful thick line: primer complement; HSC: high-stringency cycle; LSC: low-stringency cycle; and RSC: reduced-stringency cycle. Only WWP permutation WWP1-WWP2-WWP3 is presented here to illustrate wristwatch PCR. This figure is reprinted from our previous publication.1 Copyright of © 2022 Wang, Jia, Li, Liu, Sun, Pei, Wei, Lin and Li.

Table 2.

Pairing of WWP permutations with a GSP set

Round of PCR WWP permutation GSP primer set
Primary WWP1 WWP2 WWP3 GSP1
Secondary WWP2 WWP3 WWP1 GSP2
Tertiary WWP3 WWP1 WWP2 GSP3

Agarose gel electrophoresis and DNA extraction

Inline graphicTiming: Half a day

This step describes how to perform agarose gel electrophoresis and the followed recovery of amplicons.

  • 5.
    Agarose gel electrophoresis.
    • a.
      Mix 5 μL PCR reaction solution with 1 μL 6 × loading buffer.
    • b.
      Load the mixture into agarose gel well.
    • c.
      Set the DYY-6C electrophoresis apparatus with voltage of 5 V/cm (30 cm long).
    • d.
      Carry out electrophoresis for 30 min.
    • e.
      Visualize DNA products by the ChemiDoc XRS+ imaging system.
  • 6.
    PCR product extraction.
    • a.
      Extract PCR product using the TAKARA agarose gel DNA extraction kit Ver. 4.0.
    • b.
      Measure DNA concentration.

Inline graphicPause point: Store the PCR samples at −20°C if the next step is not immediately followed.

T-cloning and sequencing

Inline graphicTiming: 5–6 days

This step describes cloning and sequencing of a recovered amplicon.

  • 7.
    DNA ligation.
    • a.
      Assemble ligation components into a 0.2 mL PCR tube on ice.
      Reagent Final concentration Amount
      T-vector pMD-19 (simple) 5 ng/μL 1 μL
      Ligation mighty mix 1 × 5 μL
      Purified amplicon 1–10 ng/μL 4 μL
      Total N/A 10 μL
      Note: Keep all the involved reagents on ice.
    • b.
      Incubate at 16°C for 30 min.
  • 8.
    DNA transformation.
    • a.
      Add the ligation solution into 100 μL competent cells of E. coli DH5α and gently mix.
    • b.
      Place on ice for 30 min.
    • c.
      Heat shock for 60 s, and immediately place on ice for 90 s.
    • d.
      Add 900 μL antibiotic-free LB broth.
    • e.
      Incubate at 37°C and 50 rpm for 40 min.
    • f.
      Plate 100 μL the broth onto LB agar plate containing 100 μg/mL ampicillin.
    • g.
      Culture at 37°C for 12–16 h.
  • 9.
    Validation with colony PCR.
    • a.
      Assemble master mixture for PCRs on ice.
      Inline graphicCRITICAL: Prepare 220 μL of the master mixture to ensure sufficient volume for 10 PCRs (20 μL/tube).
      PCR reaction mixture
      Reagent Final concentration Amount
      Transformant N/A N/A
      LA Taq 0.05 U/μL 0.2 μL
      M13 forward primer 0.2 μM 0.4 μL
      M13 reverse primer 0.2 μM 0.4 μL
      10 × LA PCR buffer II (Mg2+ plus) 1 × 2 μL
      dNTP mixture 0.4 mM each 3.2 μL
      ddH2O N/A 13.8 μL
      Total N/A 20 μL
    • b.
      Slightly pipet 5–6 times to fully mix the contents.
    • c.
      Centrifuge at 4,000 × g for 10 s to gather the mixture at the bottom.
    • d.
      Add 20 μL aliquots of the master mixture into 10 PCR tubes.
    • e.
      Transfer some cells with a sterile toothpick from a bacterial colony to a PCR tube.
    • f.
      Place the tubes in the programmed thermocycler and run PCR.
      Colony PCR cycling conditions
      Steps Temperature Time Cycles
      Lysis of cells 95°C 5 min 1
      Initial Denaturation 94°C 5 min 1
      Denaturation 94°C 30 s 30
      Annealing 55°C 30 s
      Extension 72°C 2 min
      Final extension 72°C 3 min 1
      Hold 4°C forever
    • g.
      Detect the PCR products with agarose gel electrophoresis.
    • h.
      Select positive transformants.
      Inline graphicPause point: Store the PCR samples at −20°C if the sequencing step is not immediately followed.
  • 10.
    Sequencing.
    • a.
      Inoculate a positive colony to LB broth containing 100 μg/mL ampicillin.
    • b.
      Culture at 37°C and 200 rpm for around 18 h.
    • c.
      Extract plasmids from the culture using the Sangon Sanprep column plasmid mini-preps kit.
    • d.
      Sequence the inserted fragment with the M13 primers.

Inline graphicPause point: Send the plasmids to the Sangon Biotech Co., Ltd. for sequencing.

  • 11.

    Align and analyze the sequences.

Note: Conduct sequence alignment and analysis using the “By Cluster W Method” function of MegAlign tool in the Lasergene software.

Expected outcomes

We herein detail the principle and experimental steps of WW-PCR, a genome-walking protocol completely based on PCR. The walking primers (WWPs) are universal to any genome. A positive outcome will generally release after two rounds of PCRs. To verify the feasibility of WW-PCR, we applied this method to isolate lateral segments of L. brevis CD0817 gadA and rice hyg. Each WW-PCR yielded a positive outcome, suggesting a high success rate of WW-PCR. All the major amplicons are desired products (Figure S1), meaning a high specificity of the proposed protocol. The largest product from each walking was up to 4 kb, demonstrating a high efficiency of WW-PCR. Some WW-PCRs produced multiple DNA bands, resulting from a primary WWP partially annealing to multiple sites on the unknown region in the low-stringency cycle. A DNA band in secondary PCR is slightly larger than the corresponding product in tertiary PCR (Figure 2), given the mutual position relationship between the nest GSPs.

Figure 2.

Figure 2

Validation of wristwatch PCR by walking the selected genes

Genome-walking for gadA of L. brevis CD0817 (A) and hyg of rice (B). I, II, and III represent three sets of WW-PCRs in a walking, individually participated by the three WWP permutations as indicated in Table 2. Lanes P, S, and T represent primary, secondary, and tertiary PCRs, respectively. Bands GS1-GS14 and GT1-GT13 indicate secondary and tertiary PCR products for gadA, respectively; and bands HS1-HS4 and HT1-HT4 indicate secondary and tertiary PCR products for hyg, respectively. M: DL 5000 DNA Marker (5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp). This figure is reprinted from our previous publication.1 Copyright of © 2022 Wang, Jia, Li, Liu, Sun, Pei, Wei, Lin and Li.

Limitations

A possible multiple-band phenomenon challenges WW-PCR. This phenomenon is attributed to two aspects. First, the low-stringency cycle of primary PCR may permit a primary WWP to partially anneal to multiple sites on an unknown region. This partial annealing is the main origin of multiple bands. Second, in the reduced-stringency cycle of secondary/tertiary PCR, in the case that the WWP is well-matched with some site(s) internal to the former WWP locus on the target region, the WWP may anneal to the site(s) and initiate DNA elongation (Figure 1). This internal annealing will generate a shorter target product(s). These two potential multiple-band mechanisms weaken the amplification of a major product(s).

Troubleshooting

Problem 1

Cloning of a PCR product is time-consuming and laborious (steps 7, 8, and 9).

Potential solution

The purified PCR product can also be directly sequenced.

Problem 2

In the reduced-stringency cycle of secondary/tertiary PCR, the WWP may anneal to some site(s) internal to the former WWP locus and initiate DNA elongation, producing some shorter DNA fragment(s) (Figure 1; steps 3 and 4).

Potential solution

In a genome-walking completed by WW-PCR, only the largest amplicon needs to be considered.

Problem 3

Three rounds of nested PCR are time-consuming (Figure 1; steps 2, 3, and 4).

Potential solution

In general, two rounds of nested PCRs suffice to give a positive outcome. Therefore, only two rounds of amplifications are required in an actual use of WW-PCR.

Problem 4

A WWP may partially anneal to more than one site on an unknown region in the low-stringency cycle (25°C) of primary PCR. Finally, multiple clear DNA bands appear (Figure 1; and step 2).

Potential solution

All the major bands are all correct. Only the longest band needs to be analyzed in practice.

Problem 5

What if any of three rounds of PCR steps do not work (steps 2, 3, and 4).

Potential solution

The three parallel WW-PCRs in each walking will ensure that at least one PCR gives a positive outcome. In fact, users can design n (> 3) WWPs so as to perform n parallel sets of WW-PCRs.

Problem 6

What if no E. coli transformants can be obtained (step 9).

Potential solution

In this case, directly sequence the purified PCR product.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Haixing Li (hxli@ncu.edu.cn).

Materials availability

This study did not generate new unique reagents.

Acknowledgments

This work is financially supported by the National Natural Science Foundation of China, China (Grant Nos. 32160014 and 31570070), the State Key Laboratory of Food Science and Technology at Nanchang University, China (Grant No. SKLF-ZZB-202118), and the Jiangxi Provincial Department of Science and Technology, China (Grant No. 20171BCB23019).

Author contributions

Methodology, L.W.; Investigation, L.W.; Writing—Original Draft, L.W.; Investigation, M.J., T.S., C.W.; Data curation, Z.L., J.P.; Resources, X.L.; Software, Z.L.; Funding acquisition, H.L.; Conceptualization, H.L.; Writing—Review & Editing, H.L.

Declaration of interests

The authors declare no competing interests.

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.xpro.2022.102037.

Supplemental information

Document S1. Figure S1.
mmc1.pdf (1.6MB, pdf)

Data and code availability

The datasets presented in this study are available at GenBank: AYM03982.1 and KF206149.

References

  • 1.Wang L., Jia M., Li Z., Liu X., Sun T., Pei J., Wei C., Lin Z. Wristwatch PCR: a versatile and efficient genome walking strategy. Front. Bioeng. Biotech. 2022;10:792848. doi: 10.3389/fbioe.2022.792848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ashrafmansouri S.S., Kamaladini H., Haddadi F., Seidi M. Simple innovative adaptor to improve genome walking with convenient PCR. J. Genet. Eng. Biotechnol. 2020;18:64. doi: 10.1186/s43141-020-00082-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sun T., Jia M., Wang L., Li Z., Lin Z., Wei C., Pei J., Li H. DAR-PCR: a new tool for efficient retrieval of unknown flanking genomic DNA. AMB Express. 2022;12:131. doi: 10.1186/s13568-022-01471-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Myrick K.V., Gelbart W.M. Universal fast walking for direct and versatile determination of flanking sequence. Gene. 2002;284:125–131. doi: 10.1016/s0378-1119(02)00384-0. [DOI] [PubMed] [Google Scholar]
  • 5.Zeng T., Zhang D., Li Y., Li C., Liu X., Shi Y., Song Y., Li Y., Wang T. Identification of genomic insertion and flanking sequences of the transgenic drought-tolerant maize line "SbSNAC1-382" using the single-molecule real-time (SMRT) sequencing method. PLoS One. 2020;15:e0226455. doi: 10.1371/journal.pone.0226455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ochman H., Gerber A.S., Hartl D.L. Genetic applications of an inverse polymerase chain-reaction. Genetics. 1988;120:621–623. doi: 10.1002/btpr.5420050305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Mueller P.R., Wold B. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science. 1989;246:780–786. doi: 10.1126/science.2814500. [DOI] [PubMed] [Google Scholar]
  • 8.Rosenthal A., Jones D.S. Genomic walking and sequencing by oligo-cassette mediated polymerase chain reaction. Nucleic Acids Res. 1990;18:3095–3096. doi: 10.1093/nar/18.10.3095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Liu Y.G., Whittier R.F. Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from PI and YAC clones for chromosome walking. Genomics. 1995;25:674–681. doi: 10.1016/0888-7543(95)80010-j. [DOI] [PubMed] [Google Scholar]
  • 10.Chang K., Wang Q., Shi X., Wang S., Wu H., Nie L., Li H. Stepwise partially overlapping primer-based PCR for genome walking. AMB Express. 2018;8:77. doi: 10.1186/s13568-018-0610-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Pei J., Sun T., Wang L., Pan Z., Guo X., Li H. Fusion primer driven racket PCR: a novel tool for genome walking. Front. Genet. 2022;13:969840. doi: 10.3389/fgene.2022.969840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chen L., Tu Z., Hussain J., Cong L., Yan Y., Jin L., Yang G., He G. Isolation and heterologous transformation analysis of a pollen-specific promoter from wheat (Triticum aestivum L.) Mol. Biol. Rep. 2010;37:737–744. doi: 10.1007/s11033-009-9582-7. [DOI] [PubMed] [Google Scholar]
  • 13.Li H., Ding D., Cao Y., Yu B., Guo L., Liu X. Partially overlapping primer-based PCR for genome walking. PLoS One. 2015;10:e0120139. doi: 10.1371/journal.pone.0120139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tan J., Gong Q., Yu S., Hou Y., Zeng D., Zhu Q., Liu Y.G. A modified high-efficiency thermal asymmetric interlaced PCR method for amplifying long unknown flanking sequences. J. Genet. Genom. 2019;46:363–366. doi: 10.1016/j.jgg.2019.05.002. [DOI] [PubMed] [Google Scholar]
  • 15.Wang S., He J., Cui Z., Li S. Self-formed adaptor PCR: a simple and efficient method for chromosome walking. Appl. Environ. Microbiol. 2007;73:5048–5051. doi: 10.1128/aem.02973-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gao D., Chang K., Ding G., Wu H., Chen Y., Jia M., Liu X., Wang S., Jin Y., Pan H., Li H. Genomic insights into a robust gamma-aminobutyric acid-producer Lactobacillus brevis CD0817. Amb. Express. 2019;9:72. doi: 10.1186/s13568-019-0799-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jia M., Zhu Y., Wang L., Sun T., Pan H., Li H. pH auto-sustain-based fermentation supports efficient gamma-aminobutyric acid production by Lactobacillus brevis CD0817. Fermentation. 2022;8:208. doi: 10.3390/fermentation8050208. [DOI] [Google Scholar]
  • 18.Li H., Sun T., Jia M., Wang L., Wei C., Pei J., Lin Z., Wang S. Production of gamma-aminobutyric acid by Levilactobacillus brevis CD0817 by coupling fermentation with self-buffered whole-cell catalysis. Fermentation. 2022;8:321. doi: 10.3390/fermentation8070321. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Figure S1.
mmc1.pdf (1.6MB, pdf)

Data Availability Statement

The datasets presented in this study are available at GenBank: AYM03982.1 and KF206149.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES