Role of the Nitrogen Metabolism Regulator TAM1 in Regulation of Cellulase Gene Expression in Trichoderma reesei

ABSTRACT

The filamentous fungus Trichoderma reesei is one of the most prolific cellulase producers and has been established as a model microorganism for investigating mechanisms modulating eukaryotic gene expression. Identification and functional characterization of transcriptional regulators involved in complex and stringent regulation of cellulase genes are, however, not yet complete. Here, a Zn(II)₂Cys₆-type transcriptional factor TAM1 that is homologous to Aspergillus nidulans TamA involved in nitrogen metabolism, was found not only to regulate ammonium utilization but also to control cellulase gene expression in T. reesei. Whereas Δtam1 cultivated with peptone as a nitrogen source did not exhibit a growth defect that was observed on ammonium, it was still significantly compromised in cellulase biosynthesis. The absence of TAM1 almost fully abrogated the rapid cellulase gene induction in a resting-cell-inducing system. Overexpression of gdh1 encoding the key ammonium assimilatory enzyme in Δtam1 rescued the growth defect on ammonium but not the defect in cellulase gene expression. Of note, mutation of the Zn(II)₂Cys₆ DNA-binding motif of TAM1 hardly affected cellulase gene expression, while a truncated ARE1 mutant lacking the C-terminal 12 amino acids that are required for the interaction with TAM1 interfered with cellulase biosynthesis. The defect in cellulase induction of Δtam1 was rescued by overexpression of the key transactivator for cellulase gene, XYR1. Our results thus identify a nitrogen metabolism regulator as a new modulator participating in the regulation of induced cellulase gene expression.

IMPORTANCE Transcriptional regulators are able to integrate extracellular nutrient signals and exert a combinatorial control over various metabolic genes. A plethora of such factors therefore constitute a complex regulatory network ensuring rapid and accurate cellular response to acquire and utilize nutrients. Despite the in-depth mechanistic studies of functions of the Zn(II)₂Cys₆-type transcriptional regulator TamA and its orthologues in nitrogen utilization, their involvement in additional physiological processes remains unknown. In this study, we demonstrated that TAM1 exerts a dual regulatory role in mediating ammonium utilization and induced cellulase production in the well known cellulolytic fungus Trichoderma reesei, suggesting a potentially converged regulatory node between nitrogen utilization and cellulase biosynthesis. This study not only contributes to unveiling the intricate regulatory network underlying cellulase gene expression in cellulolytic fungus but also helps expand our knowledge of fungal strategies to achieve efficient and coordinated nutrient acquisition for rapid propagation.

INTRODUCTION

Fungi occupy various environment niches where they constantly face many challenges, including dealing with nutrient limitation. Efficient and coordinated assimilation of specific carbon and nitrogen sources is of great importance for fungal colonization and development, which require stringent and complex regulation of genes involved in metabolism. Transcriptional activators or coactivators could integrate different extracellular nutrient signals and exert a combinatorial control over various metabolic genes and therefore constitute important players in ensuring rapid and accurate cellular response to acquire and utilize nutrients.

While fungi can utilize a wide variety of compounds as sources of nitrogen and/or carbon, ammonium is the preferred inorganic nitrogen source for a vast majority of fungal species. The primary route for ammonium assimilation is mediated by the NADP-dependent glutamate dehydrogenase (NADP-GDH), which catalyzes the synthesis of glutamate from externally absorbed ammonium and α-oxoglutarate, an intermediate of the Krebs cycle $\left({\text{NH}}_4^{+}+\alpha \text{-ketoglutarate\hspace{0.17em}\hspace{0.17em}}+\text{\hspace{0.17em}\hspace{0.17em}NADPH}\stackrel{\mathit{GDH}}{\iff }\text{l-glutamate\hspace{0.17em}\hspace{0.17em}}+{\text{NADP}}^{+}\right)$ (1). Disruption of gdh caused a significantly poor growth of fungi on ammonium as the sole nitrogen source (2–6). As the key ammonium assimilatory enzyme, expression of gdh are regulated by quite a few transcription factors (TFs). In Aspergillus nidulans, both the well known global nitrogen regulator AreA and LeuB, an orthologue of the yeast branched-chain amino acid biosynthetic pathway regulator Leu3, have been found to participate in the high-level expression of gdhA during growth on ammonium (7–9).

A. nidulans AreA is a GATA transcription factor conserved across fungi and has been established as a key regulator involved in regulating alternative nitrogen source utilization in response to ammonium limitation (10–13). The Zn(II)₂Cys₆-type transcription factor TamA was later revealed to act as a coactivator for AreA in regulating relevant nitrogen metabolic genes upon ammonium deprivation (14, 15). Similar to AreA, TamA has been also found to regulate gdhA expression. When grown on ammonium, A. nidulans tamA mutants show poor growth and a marked reduction in gdhA transcription (4, 16). These defects caused by tamA deletion were even more severe than those brought by areA deletion, implicating a major role for TamA in regulating gdhA expression on ammonium (9). On the other hand, no evidence exists supporting that Dal81, the TamA counterpart in Saccharomyces cerevisiae, is also involved in the regulation of gdh expression (17–21). Moreover, unlike its DNA-binding domain (DBD)-independent action as a coactivator for alternative nitrogen metabolic genes, TamA activates gdhA largely depending on its Zn(II)₂Cys₆-type DBD (14, 15, 22, 23). These results suggest that functional differentiation may occur between TamA orthologues. Whether TamA orthologues exert regulatory functions in physiological processes other than nitrogen catabolism remains unknown.

Cellulose represents the most abundant carbon polymer in nature that can be efficiently degraded by quite a few native cellulolytic microorganisms as the sole carbon source. Among others, the filamentous fungus Trichoderma reesei is a prominent representative and has been widely used for industrial application due to its superior capacity to secrete a large quantity of (hemi)cellulases (24). T. reesei has been also established as a model microorganism for investigating mechanisms underlying eukaryotic gene expression (25, 26). Multiple transcriptional regulators have been thus identified to constitute an intricate regulatory network to achieve the stringent control of cellulase gene expression (25, 27–31). XYR1 (xylanase regulator 1) is the most essential transcriptional activator. While deletion of xyr1 abolished almost all cellulase gene expression (32), overexpression of XYR1 markedly increased cellulase production upon cellulose and also caused a significant alleviation of the catabolite repression on cellulase synthesis (33–41). Despite the progress made in deciphering the regulation of cellulase gene expression, the list of involved transcriptional factors is believed to be far from complete. Notably, T. reesei ARE1, an orthologue of the global nitrogen regulator AreA, has been shown to not only regulate extracellular protease production, as seen in A. nidulans and Neurospora crassa (12, 42), but also be involved in the modulation of cellulase gene expression, implying a potential link between nitrogen metabolism and induced cellulase biosynthesis (43).

In this study, we screened several T. reesei mutants with deletion or knockdown of putative TF-encoding genes that are upregulated during cultivation on Avicel cellulose and found that deletion of tam1 caused a reduction in cellulase formation. The compromised cellulase gene expression in the absence of tam1 was independent of the mycelial growth defect resultant from reduced gdh1 expression. Gdh1 overexpression in Δtam1 was able to rescue the growth defect on ammonium but failed to recover the cellulase gene expression. Mutation of the Zn(II)₂Cys₆ motif of TAM1 that is essential for DNA binding hardly affected its regulatory function in cellulase gene expression, while disruption of the interaction between TAM1 and ARE1 interfered with cellulase biosynthesis. Overexpression of the key transactivator-encoding gene xyr1 in Δtam1 fully restored cellulase gene expression.

RESULTS

Identification of TAM1 that is involved in cellulase production in T. reesei.

In order to identify TFs that are involved in cellulase production, five putative TF-encoding genes (Tr_4885, Tr_52438, Tr_55272, Tr_73417, and Tr_121471; jgi|Trire2) were selected as candidates for screening, all of which showed upregulated expression on Avicel compared to that on glucose in T. reesei based on transcriptome analyses (44) (Fig. S1). Individual gene deletion or gene knockdown via promoter replacement (34, 45) was performed, and the resulting mutants were evaluated for their performance on cellulase biosynthesis. In contrast to the other four mutants, the Tr_4885 deletion mutant showed a markedly compromised extracellular cellobiohydrolase activity (Fig. S2). To verify the effect of Tr_4885 deletion, QM9414 and the mutant strain were simultaneously cultivated on Avicel for up to 9 days. Deletion of Tr_4885 caused significant reductions not only in extracellular cellobiohydrolase activity, but also in β-glucosidase and filter paper hydrolytic activities (Fig. 1A to C). SDS-PAGE analysis of the extracellularly secreted proteins verified that cellulase production in ΔTr_4885 was significantly impaired (Fig. 1D). The defect in cellulase production was largely corrected when the expression of Tr_4885 under the control of the constitutive A. nidulans gpdA promoter was introduced back into the deletion mutant (yielding the complementary strain Retam1) (Fig. S3). These results indicated that Tr_4885 might be involved in regulating cellulase biosynthesis in T. reesei.

FIG 1.

Deletion of Tr_4885 (tam1) compromised cellulase production on Avicel. (A to C) Extracellular 4-nitrophenyl β-d-cellobioside (pNPC) (A), 4-nitrophenyl β-d-glucopyranoside (pNPG) (B), and filter paper (C) hydrolytic activities of the culture supernatant of T. reesei QM9414 and Δtam1. (D) SDS-PAGE analysis of the culture supernatant from T. reesei QM9414 and Δtam1. The strains were cultured with 0.14% (wt/vol) ammonium sulfate as the nitrogen source and 1% (wt/vol) Avicel as the carbon source. Equal amounts of culture supernatant at the indicated time points were subject to SDS-PAGE. The values are the means of three biological replicates. The error bars are the standard deviations (SDs) from these replicates. Significant differences (t test) were observed in extracellular cellulase activities between QM9414 and Δtam1. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Sequence analysis of Tr_4885 revealed that it encodes a putative Zn(II)₂Cys₆-type fungal transcription factor. Amino acid sequence comparison showed that this putative TF shares relatively high sequence similarity (56%) and identity (40%) with A. nidulans TamA (9, 14, 22) (Fig. S4). Tr_4885 was here named tam1. Phylogenetic analysis revealed that orthologues of TAM1 are widely distributed in filamentous fungi (Fig. 2), including Trichoderma, Penicillium, Aspergillus, Neurospora, Thermothelomyces, and Chaetomium. However, except for A. nidulans TamA, none of these orthologues, especially in cellulase-producing fungi, has been characterized.

FIG 2.

Phylogenetic analysis of TAM1 and its fungal orthologues. TAM1 is indicated with an asterisk. The entry numbers of these sequences within NCBI database are included in brackets. Amino acid sequence alignment was performed using ClustalW (56). Phylogenetic analysis was performed with MEGA7.0 (57) using the neighbor-joining method with 1,000 bootstraps.

TAM1 participates in ammonium utilization.

Considering that A. nidulans orthologue of TAM1, TamA, has been well characterized to act as a transcriptional activator for NADP-GDH-encoding gene gdhA (9, 15, 16, 22), we tested the role of TAM1 in nitrogen assimilation. While hyphal growth of Δtam1 on agar plate containing peptone as a nitrogen source was quite similar to that of QM9414 strain regardless of the carbon source used (Fig. 3A and B), Δtam1 exhibited a remarkable growth defect on agar plates with ammonium, glutamate, or glutamine as the sole nitrogen source (Fig. 3C and D). The most severe growth defect was observed with ammonium. Such a growth defect of Δtam1 was also observed in liquid medium with ammonium but not peptone as the sole nitrogen source, as demonstrated by a reduction in the biomass accumulation during 36-h cultivation, although the final biomass yield of Δtam1 is comparable with that of QM9414 strain (Fig. 3E and F). Consistent with growth defects, transcriptional expression of T. reesei NADP-GDH-encoding gene gdh1 in Δtam1 was dramatically reduced by up to ~80% compared with that of the QM9414 strain when cultured on ammonium (Fig. 3G). The complementary strain Retam1 displayed partially recovered gdh1 expression and a comparable growth to QM9414 on agar plate containing ammonium sulfate (Fig. 3D and G). These results indicate that, in agreement with the function of its counterpart TamA in A. nidulans, TAM1 participates in NADP-GDH-mediated ammonium assimilation in T. reesei.

FIG 3.

Deletion of tam1 resulted in a growth defect with ammonium as the nitrogen source. (A) Growth of T. reesei QM9414, Δtam1, and REtam1 on agar plates at 30°C for 3 days with glucose, glycerol, lactose, or cellobiose as the carbon source and peptone as the nitrogen source. (B) Determination of diameters of colonies as shown in panel A. (C) Growth of T. reesei QM9414, Δtam1, and REtam1 on agar plates at 30°C for 3 days with glucose as the carbon source and with ammonium, glutamine, glutamate, or peptone as the nitrogen source. (D) Determination of diameters of colonies as shown in panel C. (E) Determination of biomass accumulation in liquid medium containing 0.14% (wt/vol) ammonium as the nitrogen source and 1% (wt/vol) glucose as the carbon source. (F) Determination of biomass accumulation in liquid medium containing 0.14% (wt/vol) peptone as the nitrogen source and 1% (wt/vol) glucose as the carbon source. (G) Quantitative reverse transcription (RT)-PCR analyses of the relative transcription of gdh1 in T. reesei QM9414, Δtam1, and REtam1 cultured in liquid medium containing 0.14% (wt/vol) ammonium as the nitrogen source and 1% (wt/vol) glucose as the carbon source. The values are the means of three biological replicates. The error bars are the SDs from these replicates. Significant differences (t test) were observed in growth with ammonium, glutamine, or glutamate as the nitrogen source and gdh1 transcription between QM9414 and Δtam1. *, P < 0.05; **, P < 0.01. No significant differences (n.s.) were detected in growth with peptone as the nitrogen source between QM9414 and Δtam1.

Deletion of tam1 affects cellulase gene expression at a transcriptional level.

To test the effect of tam1 deletion on expression of cellulase genes, quantitative reverse transcription (RT)-PCR analyses were performed. The results indicated that the relative transcriptional expression of the main cellulase genes, including cbh1, eg1, and bgl1, as well as the transactivator XYR1-encoding gene, was dramatically decreased in Δtam1 (Fig. 4A to D), demonstrating that the defective cellulase production caused by tam1 deletion occurred at the transcriptional level. To exclude the possibility that the observed deficiency in cellulase induction was resultant from the growth defect on ammonium due to the impaired gdh1 transcription without TAM1 (Fig. 4E), Δtam1 and QM9414 strains were incubated in a resting system without any nitrogen source but supplemented with sophorose as a potent cellulase inducer (46), wherein cellulase gene induction was made completely independent of vegetative growth. As shown in Fig. 5, tam1 deletion severely compromised the rapid induced transcription of cellulase genes, as well as the xyr1 gene in the resting system. Moreover, a significant defect in cellulase production was still observed in Δtam1 cultivated with peptone as the nitrogen source (Fig. 6), wherein hardly any difference in biomass accumulation was observed between the deletion strain and QM9414. Taken together, the above results indicate that TAM1 is positively involved in regulating cellulase gene expression.

FIG 4.

Deletion of tam1 affected cellulase gene expression at a transcriptional level. (A to E) Quantitative RT-PCR analyses of the relative transcription of cbh1 (A), eg1 (B), bgl1 (C), xyr1 (D), and gdh1 (E) in QM9414 and Δtam1 cultured with 0.14% (wt/vol) ammonium sulfate as the nitrogen source and with 1% (wt/vol) Avicel as the carbon source. The values are the means of three biological replicates. The error bars are the SDs from these replicates. Significant differences (t test) were observed in xyr1, gdh1, and cellulase genes expression between QM9414 and Δtam1. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

FIG 5.

Deletion of tam1 significantly compromised rapid induction of cellulase genes and xyr1 in a resting-cell system. (A to D) Quantitative RT-PCR analyses of the relative transcription of cbh1 (A), eg1 (B), bgl1 (C), and xyr1 (D) in QM9414 and Δtam1 strains. The values are the means of three biological replicates. The error bars are the SD from these replicates. Significant differences (t test) were observed in cellulase genes and xyr1 expression between QM9414 and Δtam1. **, P < 0.01; ***, P < 0.001.

FIG 6.

The Δtam1 strain still showed a defect in cellulase production with peptone as the sole nitrogen source. Extracellular pNPC (A) and pNPG (B) hydrolytic activities of the culture supernatant of T. reesei QM9414 and Δtam1 cultivated with 0.14% (wt/vol) peptone as the nitrogen source and 1% (wt/vol) Avicel as the carbon source. The values are the means of three biological replicates. The error bars are the SDs from these replicates. Significant differences (t test) were observed in the pNPC and pNPG hydrolytic activities between QM9414 and Δtam1. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Overexpression of gdh1 fully corrected the defect in ammonium utilization but not in cellulase gene expression in Δtam1.

Considering that the absence of TAM1 caused a significant reduction in gdh1 transcription and a growth defect on ammonium, the gdh1 gene was therefore overexpressed in Δtam1 using the tcu1 promoter from T. reesei (34), resulting in the Δtam1OEgdh1 strain. As expected, gdh1 overexpression fully corrected the growth defect of Δtam1 on ammonium compared with that of the QM9414 strain (Fig. 7A and B). In contrast, gdh1 overexpression failed to fully restore cellulase production to a QM9414 level, and Δtam1OEgdh1 exhibited 30% to 50% lower cellobiohydrolase activity than QM9414, which was verified by SDS-PAGE analysis of the extracellular protein products (Fig. 7C to E). Both the recovered growth and the partially restored cellulase production as shown by Δtam1OEgdh1 was largely reversed by copper addition to repress the tcu1 promoter activity, verifying that the relevant phenotypes as shown by Δtam1OEgdh1 were brought by gdh1 overexpression. Further quantitative RT-PCR analyses demonstrated that, similar to Δtam1, the relative transcriptional levels of the main cellulase genes in Δtam1OEgdh1 were significantly lower than those in the QM9414 strain (Fig. 7F to H). Similarly, when using soluble lactose as the cellulase inducer (47), gdh1 overexpression fully rescued the growth defect of Δtam1 but not its cellulase formation (Fig. 8). Altogether, the data indicate that TAM1 indeed participates in modulating cellulase gene expression, most probably in a manner independent of its role in regulating gdh1-mediated ammonium assimilation.

FIG 7.

Overexpression of gdh1 fully corrected the defect in ammonium utilization in Δtam1 but not in cellulase gene expression. (A) Relative transcriptional levels of gdh1 in T. reesei QM9414, Δtam1, and Δtam1OEgdh1 cultivated with 0.14% (wt/vol) ammonium sulfate as the nitrogen source and with 1% (wt/vol) glucose as the carbon source for 36 h. (B) Determination of biomass accumulation of QM9414, Δtam1, and Δtam1OEgdh1 in liquid medium with 0.14% (wt/vol) ammonium sulfate as the nitrogen source and with 1% (wt/vol) glucose as the carbon source. (C, D) Extracellular pNPC (C) and pNPG (D) hydrolytic activities of the culture supernatant of QM9414, Δtam1, and Δtam1OEgdh1. (E) SDS-PAGE analysis of the culture supernatant from QM9414, Δtam1, and Δtam1OEgdh1. Equal amounts of culture supernatant at the indicated time points were subject to SDS-PAGE. (F to H) Quantitative RT-PCR analyses of the relative transcription of cbh1 (F), eg1 (G), and bgl1 (H) in QM9414, Δtam1, and Δtam1OEgdh1. For panels C to H, the strains were cultured with 0.14% (wt/vol) ammonium sulfate as the nitrogen source and 1% (wt/vol) Avicel as the carbon source. The values are the means of three biological replicates. The error bars are the SD from these replicates. Significant differences (t test) were observed in gdh1 expression between Δtam1OEgdh1 and QM9414 or Δtam1. ***, P < 0.001. Significant differences (t test) were also observed in biomass accumulation between Δtam1 and QM9414 or Δtam1OEgdh1, and between Δtam1OEgdh1 cultured with copper (20 nM) and that without copper, but no significant differences (n.s.) were observed between QM9414 and Δtam1OEgdh1. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Significant differences (t test) were also observed in pNPC or pNPG hydrolytic activity between QM9414, Δtam1, and Δtam1OEgdh1, and in relative transcriptional levels of cellulase genes between QM9414 and Δtam1 or Δtam1OEgdh1. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

FIG 8.

Overexpression of gdh1 fully recovered the growth defect in Δtam1 but not its cellulase formation with soluble lactose as the carbon source. (A) Determination of biomass accumulation of QM9414, Δtam1, and Δtam1OEgdh1. (B, C) Extracellular pNPC (B) and pNPG (C) hydrolytic activities of the culture supernatant of QM9414, Δtam1, and Δtam1OEgdh1. The strains were cultivated with 0.14% (wt/vol) ammonium as the nitrogen source and 1% (wt/vol) lactose as the carbon source. Δtam1OEgdh1 was cultivated with or without 20 nM copper. The values are the means of three biological replicates. The error bars are the SD from these replicates. Significant differences (t test) were observed in biomass accumulation between Δtam1 and QM9414 or Δtam1OEgdh1, but no significant differences (n.s.) were observed between QM9414 and Δtam1OEgdh1. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Significant differences were also observed in pNPC or pNPG hydrolytic activity between QM9414 and Δtam1 or Δtam1OEgdh1, but no significant differences (n.s.) were observed between Δtam1 and Δtam1OEgdh1.

TAM1 DNA-binding motif is dispensable for regulating cellulase gene expression.

It has been previously reported that the Zn(II)₂Cys₆ DNA-binding motif of A. nidulans TamA and S. cerevisiae Dal81, two characterized counterparts of TAM1, is somehow dispensable for their functions in regulating target genes (10, 21). Sequence alignment demonstrated that all six zinc-coordinating cysteines of the Zn(II)₂Cys₆ motif are conserved between TAM1 and its counterparts (Fig. S4). Replacement of Cys83, the fourth cysteine within the Zn(II)₂Cys₆ motif, with leucine expected to abolish zinc coordination and thus DNA-binding capacity (22) was therefore performed. The resultant C83L mutant was expressed in Δtam1 under the gpdA promoter. Determination of extracellular cellulase activity demonstrated that mutation of Cys83 hardly affected cellulase production (Fig. 9), suggesting that TAM1 probably regulates cellulase gene expression in a DNA binding-independent manner.

FIG 9.

Mutation of Cys83 within the Zn(II)₂Cys₆ motif of TAM1 hardly affected cellulase production. (A, B) Extracellular pNPC (A) and pNPG (B) hydrolytic activities of the culture supernatant of REtam1 and REtam1C83L cultured with 0.14% (wt/vol) peptone as the nitrogen source and 1% (wt/vol) Avicel as the carbon source. No significant differences (n.s.) were observed between REtam1 and REtam1C83L.

Disruption of interaction between TAM1 and ARE1 compromised cellulase biosynthesis.

Previous studies have shown that A. nidulans TamA acts to activate gene expression in an AreA-dependent manner requiring an intact AreA C terminus (14, 15). Moreover, both AreA and its T. reesei homologue ARE1 have been found to play positive roles in regulation of cellulase gene expression (43, 48). To probe into the possibility that potential interaction exists between T. reesei TAM1 and ARE1, yeast two-hybrid assays were performed, and the results indicated that T. reesei TAM1 has an obvious interaction with ARE1, which was completely lost when the ARE1 C-terminal 12 amino acids (aa) that are identical to those of AreA were eliminated (Fig. 10A). To further investigate the potential link between TAM1 and ARE1 in the process of cellulase gene regulation, we first tried to complement the Δtam1 mutant with overexpressed ARE1, but it failed to recover cellulase biosynthesis (Fig. S5). The ARE1 mutant lacking its C-terminal 12 aa was then expressed in QM9414. In contrast with the control strain expressing intact wild-type ARE1, expression of the truncated ARE1 caused a marked growth defect on ammonium (Fig. 10B), indicating a dominant-negative role for the truncated ARE1 in ammonium assimilation. As seen with Δtam1, although the growth defect was fully restored when ammonium was replaced with peptone (Fig. 10C), the truncated ARE1, but not intact ARE1, markedly compromised cellulase production on peptone (Fig. 10D). Together, these results suggest that TAM1 may directly interact with ARE1 and act together to contribute to the efficient cellulase gene expression.

FIG 10.

Disruption of interaction between TAM1 and ARE1 compromised cellulase biosynthesis. (A) Yeast two-hybrid analyses of interactions between TAM1 and ARE1 or ARE1ΔC. Serial dilutions of yeast transformant cells harboring the indicated plasmids were spotted on double dropout medium (DDO, SD/–Leu/–Trp) and quadruple dropout medium (QDO, SD/–Ade/–His/–Leu/–Trp) plates containing AbA, respectively, and were allowed to grow at 30°C for 3 days. Yeast cells containing pGADT7-T and pGBKT7-p53 were set as positive controls, and cells carrying pGBKT7 plus pGADT7-are1 or those with pGBKT7-tam1 plus pGADT7 were set as negative controls. (B, C) Determination of biomass accumulation of QM9414, OEare1, and OEare1ΔC cultivated in liquid medium with 0.14% (wt/vol) ammonium sulfate (B) or with 0.14% (wt/vol) peptone (C) as the nitrogen source. Glucose (1%, wt/vol) was used as the carbon source. (D, E) Extracellular pNPC (D) and pNPG (E) hydrolytic activities of the culture supernatant of QM9414, OEare1, and OEare1ΔC cultured with 0.14% (wt/vol) peptone as the nitrogen source and 1% (wt/vol) Avicel as the carbon source. The values are the means of three biological replicates. Error bars are the SD from these replicates. Significant differences (t test) were observed in biomass accumulation on ammonium and extracellular pNPC or pNPG hydrolytic activities between OEare1ΔC and QM9414 or OEare1. *, P < 0.05; **, P < 0.01; ***, P < 0.001. No significant differences were observed in biomass accumulation on peptone between OEare1ΔC and QM9414 or OEare1.

Overexpression of XYR1 in Δtam1 rescued cellulase induction deficiency but not growth defect on ammonium.

Given that transcription of the xyr1 gene encoding the key transactivator was compromised in the absence of TAM1 (Fig. 4D), we therefore tested the possibility of whether replenishing xyr1 expression would suffice to rescue the cellulase induction defect in Δtam1. The results showed that XYR1 overexpression led to full cellulase gene expression and extracellular cellulase production in Δtam1, which was significantly higher than those of the QM9414 strain (Fig. 11A to G). In contrast, XYR1 overexpression hardly contributed to rescuing the mycelial growth defect of Δtam1 on ammonium (Fig. 11H). These results indicate that TAM1 is probably involved in a regulatory process dictated by XYR1 but independent of its regulatory effect on ammonium assimilation.

FIG 11.

Overexpression of XYR1 in Δtam1 fully rescued cellulase induction deficiency but not ammonium utilization defect. (A) Overexpression of xyr1 in Δtam1OExyr1 using the copper-responsive promoter tcu1 from T. reesei. The relative expression of xyr1 were measured from T. reesei cells cultivated with 0.14% (wt/vol) ammonium sulfate as the nitrogen source and with 1% (wt/vol) Avicel as the carbon source. (B to D) Quantitative RT-PCR analyses of the relative transcription of cbh1 (B), eg1 (C), and bgl1 (D) in QM9414, Δtam1, and Δtam1OExyr1 strains. (E to G) Extracellular pNPC (E), pNPG (F), and filter paper (G) hydrolytic activities of the culture supernatant of QM9414, Δtam1, and Δtam1OExyr1. T. reesei strains were cultured in modified Mandels-Andreotti (MMA) liquid medium containing 0.14% (wt/vol) ammonium and supplemented with 1% (wt/vol) Avicel. (H) Determination of biomass accumulation of QM9414, Δtam1, and Δtam1OExyr1 in MMA liquid medium containing 0.14% (wt/vol) ammonium and supplemented with 1% (wt/vol) glucose. The values are the means of three biological replicates. The error bars are the SDs from these replicates. Significant differences (t test) were observed in xyr1 and cellulase gene transcription between Δtam1OExyr1 and QM9414 or Δtam1 and in cellulase activities between QM9414 and Δtam1 and Δtam1OExyr1. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Significant differences (t test) were also observed in biomass accumulation between QM9414 and Δtam1 or Δtam1OExyr1, but no significant differences were detected between Δtam1 and Δtam1OExyr1. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

DISCUSSION

Despite the in-depth mechanistic studies of TamA functions in nitrogen utilization (9, 14, 15, 22, 49), there are hardly any reports regarding its involvement in regulating additional physiological processes. This study provided evidence that TAM1 not only plays regulatory roles in ammonium assimilation as TamA does but also contributes to promoting the induced cellulase gene expression in T. reesei. Several lines of evidence strongly support a role of TAM1 in cellulase gene expression independent of its effect on ammonium assimilation. First, the marked defect in cellulase production was still observed for Δtam1 when the mutant was cultured with peptone as nitrogen source, a condition under which the growth of Δtam1 was hardly compromised during the whole cultivation phase. Second, when incubated in a resting-cell-inducing system, wherein no vegetative growth was allowed, Δtam1 was incapable of initiating the rapidly induced expression of cellulase genes. Last, overexpression of gdh1 in Δtam1 completely corrected the growth defect on ammonium but was unable to restore the full cellulase gene expression. Altogether, these results unveiled a regulatory function of TAM1 in cellulase gene expression. It should also be noted that although Δtam1OEgdh1 showed increased extracellular cellulase production compared to Δtam1, the relative transcriptional level of cellulase genes was quite similar to that of Δtam1 (Fig. 7F to H). These results indicate that the observed enhancement in extracellular cellulase activities most likely resulted from biomass replenishment along with the restored gdh1 expression, but not from enhanced cellulase gene expression. Given that TAM1/TamA orthologues are widely distributed in (hemi)cellulolytic filamentous fungus (Fig. 1), whether the observed regulatory role of TAM1/TamA exists in other cellulolytic fungi awaits further investigation.

Although at present it is not clear precisely how TAM1 works to regulate cellulase gene expression, our results suggested that TAM1 probably adopts a mechanism independent of its DNA-binding ability, since mutation of one conserved zinc-coordinating cysteine within the Zn(II)₂Cys₆ motif believed to be essential for DNA binding did not compromise cellulase synthesis. This may explain our failure to detect apparent TAM1-binding activity to cellulase gene or xyr1 promoters using chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift (EMSA) assays (data not shown). This DNA binding-independent mode of action has been also illustrated for A. nidulans TamA and S. cerevisiae Dal81, two characterized orthologues of TAM1. Given that TamA acts as coactivator in a DNA-binding-independent manner to be recruited by AreA (14) and that both AreA and T. reesei ARE1 have been found to regulate cellulase gene expression (43, 48), we therefore speculated that a potential link might be present between TAM1 and ARE1 in the regulation of cellulase genes. An apparent interaction between TAM1 and ARE1 was revealed by yeast two-hybrid assay, and expression of an ARE1 mutant lacking its C-terminal 12 aa, which are required for its interaction with TAM1, significantly interfered with cellulase synthesis in T. reesei. Together, these results indicate that it is quite possible that TAM1 and ARE1 somehow work together to promote rapid and high-level cellulase gene expression.

In contrast with ARE1 overexpression, overexpression of XYR1 fully rescued the defect in cellulase production in Δtam1. Therefore, it is likely that TAM1 may act (or together with ARE1) as an XYR1-associated transcriptional component on cellulase gene (e.g., cel7a) promoters to facilitate gene expression. The possibility also exists that TAM1 together with ARE1 might exert an effect on xyr1 expression, since disruption of tam1 also resulted in a decrease in the transcriptional level of xyr1. Whereas putative Are1-binding sequences could be found with the cbh1 and xyr1 promoters, ablation of the consensus binding motif of A. nidulans AreA present in cbh1 promoter did not cause a significant change in cbh1 expression on Avicel as that displayed by Δtam1 (Fig. S6), implying that ARE1/TAM1 may act without directly binding to DNA. The possibilities cannot be excluded that the reported binding characteristics of AreA do not completely fits ARE1 and that additional regulatory mechanisms may exist, considering that overexpression of ARE1 did not restore cellulase synthesis in Δtam1. Since the complex regulatory network controlling cellulase gene expression comprises multiple activators and coactivators besides ARE1 and XYR1, other as-yet-unknown partners for TAM1 are also possible. Further identification of those protein factors interacting with TAM1 would help figure out the precise mechanism by which ARE1/TAM1 exerts regulatory effects on cellulase gene expression.

MATERIALS AND METHODS

Strains and culture conditions.

T. reesei QM9414 (ATCC 26921) was used as the wild-type strain. The uridine-auxotrophic strain QM9414-Δpyr4 (50) that shows the same behaviors in growth and cellulase production with QM9414 was used as the parent strain. T. reesei strains were maintained on malt extract agar. For cellulase production and gene transcription analyses, T. reesei strains were precultured in a modified Mandels-Andreotti (MMA) medium [containing 17.907 g Na₂HPO₄·12H₂O, 2 g K₂HPO₄, 1.4 g (NH₄)₂SO₄, 0.15 g MgSO₄·7H₂O, 0.15 g CaCl₂, 0.005 g FeSO₄·7H₂O, 0.0016 g MnSO₄·H₂O, 0.0014 g ZnSO₄·7H₂O, 0.002 g CoCl₂·2H₂O, and 0.5 mL Tween 80 per liter, pH 5.0] supplemented with 1% glycerol (vol/vol) as carbon source at 30°C for 48 h. After being harvested and washed twice with MMA medium without any carbon source, an equal amount of wet mycelia was transferred to fresh MMA medium with 1% (wt/vol) Avicel or 1% (wt/vol) lactose as the sole carbon source. To test the cellulase production on peptone-containing medium, an equal amount of precultured mycelia was transferred to fresh MMA medium without ammonium sulfate but with 0.14% (wt/vol) peptone as the sole nitrogen source and supplemented with 1% (wt/vol) glucose, 1% (wt/vol) Avicel or 1% (wt/vol) lactose as the sole carbon source. Uridine at a final concentration of 10 mM or hygromycin B at a final concentration of 120 μg/mL was added into medium for T. reesei strain cultivation if necessary. Copper ions with a final concentration of 20 nM were added when necessary to repress the tcu1 promoter activity.

S. cerevisiae Y2H Gold cells (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ, LYS2::GAL1_UAS-Gal1_TATA-His3, GAL2_UAS-Gal2_TATA-Ade2 URA3::MEL1_UAS-Mel1_TATA AUR1-C MEL1) were used for yeast two-hybrid assay. S. cerevisiae Y2H Gold cells were cultured in YPD medium at 30°C. Yeast transformants were cultivated in synthetic complete (SC) medium with appropriate amino acids used for auxotroph selection. Aureobasidin A (AbA) at a final concentration of 100 ng/mL were added when necessary. Escherichia coli DH5α cells were used for routine plasmids construction. E. coli strains were cultured in lysogeny broth on a rotary shaker (200 rpm) at 37°C. All the strains used were listed in Table 1.

TABLE 1.

Strains used in this study

Strain	Description	Source
T. reesei QM9414	Wild type	ATCC 26921
QM9414-Δpyr4	Deleting the uridine trophic marker gene pyr4 in QM9414	Laboratory stock (58)
ΔTr_4885 (Δtam1)	Deleting tam1 in QM9414-Δpyr4	This study
ΔTr_121471	Deleting Tr_121471 in QM9414-Δpyr4	This study
ΔTr_52438	Deleting Tr_52438 in QM9414-Δpyr4	This study
Ptcu1-Tr_55272	Replacing the promoter of Tr_55272 in QM9414-Δpyr4 with copper-responsive tcu1 promoter	This study
Ptcu1-Tr_73417	Replacing the promoter of Tr_73417 in QM9414-Δpyr4 with tcu1 promoter	This study
REtam1	Expressing tam1 with gpdA promoter in Δtam1	This study
REtam1C83L	Expressing tam1 carrying a mutation corresponding to Cys83Leu in Δtam1 using the gpdA promoter	This study
Δtam1OEgdh1	Overexpressing gdh1 in Δtam1 using tcu1 promoter	This study
Δtam1OExyr1	Overexpressing xyr1 in Δtam1 using tcu1 promoter	This study
OEare1	Overexpressing are1 in QM9414 using tcu1 promoter	This study
OEare1ΔC	Overexpressing are1 lacking a nucleotide sequence encoding C-terminal 12 amino acids in QM9414 using tcu1 promoter	This study
E. coli DH5α	F– Φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rK– mK+) phoA supE44 λ– thi-1 gyrA96 relA1	Laboratory stock
S. cerevisiae Y2H Gold	MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ, LYS2::GAL1UAS-Gal1TATA-His3, GAL2UAS-Gal2TATA-Ade2 URA3::MEL1UAS-Mel1TATA AUR1-C MEL1

Construction of plasmids and recombinant T. reesei strains.

To delete Tr_4885 (jgi|Trire2), Tr_121471 (jgi|Trire2), or Tr_52438 (jgi|Trire2), the upstream and downstream noncoding sequences of the respective genes corresponding to about 2 kb were amplified from T. reesei QM9414 genomic DNA and inserted into the HindIII/PmeI and EcoRI/BamHI sites of pUC19-pyr4 (51), respectively. To silence Tr_55272 (jgi|Trire2) or Tr_73417 (jgi|Trire2) via promoter replacement with the copper-responsive tcu1 promoter, the upstream and open reading frame sequences of Tr_55272 or Tr_73417 were amplified from T. reesei QM9414 genomic DNA and inserted into the HindIII/AscI and NotI/SpeI sites of pMDP_tcu1-pyr4 (52), respectively. After being linearized with SspI, these constructed plasmids were transformed into T. reesei QM9414-Δpyr4, resulting in three gene deletion mutants, including ΔTr_4885 (Δtam1), ΔTr_121471, and ΔTr_52438, and two promoter-replaced mutants, including P_tcu1-Tr_55272 and P_tcu1-Tr_73417, respectively. To complement the tam1 deletion, the full-length sequence of tam1 was amplified from T. reesei QM9414 genomic DNA and inserted into P_gpd-T_trpC-hph (51), and the resultant plasmid was transformed into Δtam1 to generate the complemented strain REtam1. Similarly, the tam1 fragment carrying a mutation corresponding to C83L at the amino acid level was inserted into P_gpd-T_trpC-hph, and the resultant plasmid was transformed into Δtam1 to generate the complemented strain REtam1C83L. To overexpress gdh1 or xyr1 in Δtam1 strain, the full-length gdh1 or xyr1 sequence was amplified from T. reesei QM9414 genomic DNA and ligated to the P_tcu1-T_cbh2-hph plasmid (52). The resultant plasmids were transformed into the Δtam1 strain to obtain Δtam1OEgdh1 and Δtam1OExyr1, respectively. To overexpress an intact ARE1 or an ARE1 mutant lacking C-terminal 12 aa (ARE1ΔC) in QM9414, the corresponding nucleotide sequences were amplified from QM9414 genomic DNA and ligated to P_tcu1-T_cbh2-hph, and the resultant plasmids were transformed into QM9414 to generate OEare1 and OEare1ΔC, respectively. The resultant plasmid for expression of intact ARE1 was also introduced into Δtam1 to yield Δtam1OEare1. Transformation of T. reesei strains was performed as previously described (51). Transformants were selected on minimal medium either for uridine prototroph or for resistance to hygromycin B (120 μg/mL). All the primers used are listed in Table 2.

TABLE 2.

Primers used in this study^a

Primer	Sequence (5′ to 3′)	Application
4885 up F	TATGACCATGATTACGCCAAGCTTGGGCCCAACAAAATAAGAACGAGTAGAGT	Used for plasmid construction for Tr_4885 (tam1) deletion
4885 up R	AGACACAGATCCGTTGACGTTTAAACAAGGTAGTAGGTAACCAGTAGAA
4885 up R	AGACACAGATCCGTTGACGTTTAAACAAGGTAGTAGGTAACCAGTAGAA
4885 down F	GTTTGGATGCAGTTGTCGACCGTGGGAGGTGGTAGAGCAGATA
4885 down R	TTGTAAAACGACGGCCAGTGAATTCAAGGTTTTCAGAATGGTTCGGAC
4885 in F	GATGTTTAATTTGCTGTGTTTTT
4885 in R	TAGCCGAATGTTGGTGGGTAGTC
121471 up F	TATGACCATGATTACGCCAAGCTTGGGCCCGTGTCCGTGTCCAGAAGTCCAG	Used for plasmid construction for Tr_121471 deletion
121471 up R	AGACACAGATCCGTTGACGTTTAAACCCACCTCCAAGGCTGAAACCAA
121471 down F	GTTTGGATGCAGTTGTCGACATCAGGTTATTCATTCACTCAC
121471 down R	TTGTAAAACGACGGCCAGTGAATTCTAGACACTGTAGACAACTTTTA
121471 in F	CCCATCCCTCTCTATCTATCTT
121471 in R	TGGGGCAGTCCGTAGATGAAGG
52438 up F	TATGACCATGATTACGCCAAGCTTGGGCCCCCCAGACACATCACGAAAGAAT	Used for plasmid construction for Tr_52438 deletion
52438 up R	AGACACAGATCCGTTGACGTTTAAACCCTGAAGTCCAGCGGCAAAAGA
52438 down F	GTTTGGATGCAGTTGTCGACTTTTCTTGGAGTGAGGCGTTGG
52438 down R	TTGTAAAACGACGGCCAGTGAATTCATCAAGAACGAGGTCGCACAGC
52438 in F	ATTCACCCAACAAACCAACAGAC
52438 in R	ACGCCAGACCATTATCCTACCC
55272 ORF F	CTGGTTGATACGACAGCGGCCGCATGGAAGCGGGTGACGTTGG	Used for plasmid construction for Tr_55272 silencing
55272 ORF R	ATCTTCCAGAGATTGGACTAGTCTCGGGCTTAGGGCGTAATGAC
55272 up F	CGTTCGACGATTCCCAAGCTTAAGGTATCGGTATTCCGTTCAG	Used for plasmid construction for Tr_73417 silencing
55272 up R	CAAAAGACACAGATCCGGCGCGCCGGCTATGTATAAATGATGATGC
55272 in F	TTCCCGCTCTGCCCATTCATTC
73417 ORF F	CTGGTTGATACGACAGCGGCCGCATGTCCATCGACAACAAGCC
73417 ORF R	ATCTTCCAGAGATTGGACTAGTCGGACGCGCCCGCCCTACTAAG
73417 up F	CGTTCGACGATTCCCAAGCTTTCCGTATGAGGAGACCGAACA
73417 up R	CAAAAGACACAGATCCGGCGCGCCCCGAGGAAACGTAAGAAAAACA
73417 in F	CTGCCGAACGCCTATCTCTGCC
Ppgd-tam1 F	CCCGCTTGAGCAGACATCACCATGGCCCATGACGCTCCTACTATC	Used for plasmid construction for generating REtam1 and REtam1C83L strains
Ppgd-tam1 R	AGCCCGGTCACGAAAGCCACTAGTTCACATGGGCGTCGCGTAATC
tam1 C83L F	GAGGATGACGATGGCCTGATGCCCTGTCAGCTCA
tam1 C83L R	TGAGCTGACAGGGCATCAGGCCATCGTCATCCTC
Ptcu1-gdh1 F	GATACGACAGATATCATGTCTCACCTCCCTTC	Used for plasmid construction for generating strains, including Δtam1OEgdh1, Δtam1OExyr1, Δtam1OEare1, OEare1 and OEare1ΔC
Ptcu1-gdh1 R	ACGAAAGCCACTAGTACACCTCCCATACACCCA
Ptcu1-xyr1 F	GATACGACAGATATCATGTTGTCCAATCCTCTC
Ptcu1-xyr1 R	ACGAAAGCCACTAGTTTAGAGGGCCAGACCGGTTC
Ptcu1-are1 F	GATACGACAGATATCATGGCAGCTGTCGGACCG
Ptcu1-are1 R	ACGAAAGCCACTAGTTCATGACGAGCCACCGGC
Ptcu1-are1ΔC R	ACGAAAGCCACTAGTTCAAAGACTCATAGTCAAC
actin qF	TGAGAGCGGTGGTATCCACG	Used for quantitative RT-PCR analyses
actin qR	GGTACCACCAGACATGACAATGTTG
cbh1 qF	CTTGGCAACGAGTTCTCTT
cbh1 qR	TGTTGGTGGGATACTTGCT
eg1 qF	CGGCTACAAAAGCTACTACG
eg1 qR	CTGGTACTTGCGGGTGAT
bgl1 qF	AGTGACAGCTTCAGCGAG
bgl1 qR	GGAGAGGCGTGAGTAGTTG
xyr1 qF	CCATCAACCTTCTAGACGAC
xyr1 qR	AACCCTGCAGGAGATAGAC
gdh1 qF	CACCGTCGTGTCGCTGT
gdh1 qR	TCGCCGTAGGCAAAGTC
PGBK-tam1 F	CTCAGAGGAGGACCTGCATATGATGGCCCATGACGCTCC	Used for construction of plasmids pGBK7-tam1 and pGAD7-are1
PGBK-tam1 R	GGCCGCTGCAGGTCGACTTAGGATCCTCACTTGGAGCTGACCGACAG
tam1 overlap F	CGAGAGTGTCAAGAGAGGCTCCCCCGGTATTGCCAG
tam1 overlap R	CTGGCAATACCGGGGGAGCCTCTCTTGACACTCTCG
pGAD-are1 F	ACGTACCAGATTACGCTCATATGATGGCAGCTGTCGGACCGCTTG
pGAD-are1 R	TGCAGCTCGAGCTCGATTTAGGATCCTCAAAGACTCATAGTCAAC
pGAD-are1ΔC R	TGCAGCTCGAGCTCGATTTAGGATCCTCAAAGACTCATAGTCAAC
are1 overlap F1	GCAGAAGACGCACAACAGTCAACCACAAAACGCTCC
are1 overlap R1	GGAGCGTTTTGTGGTTGACTGTTGTGCGTCTTCTGC
are1 overlap F2	AGTATAGACGACCGCCGGACGAGGAAACGGCCTGCC
are1 overlap R2	GGCAGGCCGTTTCCTCGTCCGGCGGTCGTCTATACT

^aNote: restriction enzyme sites are underlined. F, forward; ORF, open reading frame; R, reverse; RT, reverse transcription.

Vegetative growth analyses.

To analyze mycelial growth on agar plates, T. reesei cells were precultured on minimal media agar plate with 2% (wt/vol) glucose as the sole carbon source and 0.5% (wt/vol) ammonium sulfate as the sole nitrogen source for 2 days, and then a slice of same-size circle area (about 1 cm²) covered with mycelia of corresponding strain was taken and inoculated on minimal media agar plate with different carbon sources at a final concentration of 1% (wt/vol) or different nitrogen sources at a final concentration of 0.14% (wt/vol). Colony diameter was measured after the plates were incubated at 30°C for 3 days. To analyze biomass accumulation in liquid medium with ammonium as the sole carbon source, the cells were precultured in MMA medium containing 1% glycerol for 36 h and then filtered by G1 Schott Duran and washed twice by MMA medium without any carbon source. Equal amount of wet mycelia was transferred to fresh MMA medium with 1% (wt/vol) glucose or 1% (wt/vol) lactose as the sole carbon source and 0.14% (wt/vol) ammonium sulfate as the sole nitrogen source. To analyze biomass accumulation on peptone, precultured mycelia in MMA medium containing 1% glycerol as carbon source for 36 h were transferred to 1% (wt/vol) glucose-containing MMA medium in which the ammonium sulfate was replaced with peptone (0.14%, wt/vol). The mycelia were collected at growth intervals and dried at 80°C for 48 h and then weighed for mycelial dry weight.

Enzymatic activity and protein analysis.

Extracellular cellobiohydrolase and β-glucosidase activities were analyzed with 4-nitrophenyl β-d-cellobioside (pNPC; Sigma-Aldrich) and 4-nitrophenyl β-d-glucopyranoside (pNPG; Sigma-Aldrich), respectively, as the substrates by measuring the released p-nitrophenyl amount. The reaction was performed in 160 μL of reaction mixture with 80 μL of 50 mM sodium acetate buffer (pH 4.8), 40 μL of substrate, and 40 μL of diluted culture supernatant. The mixture was then incubated at 50°C for 30 min, and the reaction was stopped by addition of 40 μL of 10% Na₂CO₃ (wt/vol). The amount of p-nitrophenyl is determined by measuring the absorbance at 420 nm. One unit (U) of pNPC or pNPG activity is defined as the amount of enzyme releasing 1 μmol of p-nitrophenyl per minute. The filter paper hydrolytic activities (FPAase) were determined by measuring the released glucose using Whatman No. 1 quantitative filter paper as the substrate. Briefly, the assay was performed in 120 μL of reaction mixture including 60 μL of 50 mM sodium acetate buffer (pH 4.8) and 60 μL of diluted culture supernatant, and the mixture was then incubated at 50°C for 30 min. The reducing sugar released in the mixture was determined by the 3,5-dinitrosalicylic acid method (53) with glucose as the standard. One unit (U) of FPAase activity is defined as the amount of enzyme releasing 1 μmol of reducing sugar per minute. SDS-PAGE was performed according to standard protocols as previously described (54) with a 5% stacking gel and an 8% separating gel running at 150 V for 90 min. Equal amounts of culture supernatant were loaded for SDS-PAGE analysis of the extracellular proteins.

Quantitative RT-PCR.

Total RNAs were extracted using the RNA-easy isolation reagent (Vazyme, Nanjing, China) and purified using the TURBO DNA-free kit (Amibon, Austin, TX, USA) to remove genomic DNA contamination. Reverse transcription was performed using HiScript Q RT SuperMix for quantitative PCR (qPCR) (Vazyme, Nanjing, China) according to the user protocol. Quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on a Roche LightCycler 96 thermocycler (Roche). Data analysis was performed using the relative quantitation/comparative CT (ΔΔCT) method and were normalized to an endogenous control (actin), with the expression level on glycerol as the reference sample. Three biological replicates were performed for each analysis, and the results and error bars are the means and SD, respectively, from the replicates. Statistical analysis was performed using Student’s t test analysis.

Resting-cell-inducing system assay.

Resting-cell-inducing system assay was performed as previously described (51). Briefly, the strains were precultured on MMA medium with 1% glycerol and then filtered by G1 Schott Duran and washed twice by MMA medium without any carbon source. All the mycelia were transferred to fresh medium with no carbon source and cultured for 1 h on a rotary shaker (200 rpm) at 30°C to deplete the carbon and nitrogen source accumulated earlier. The mycelia were collected again and washed twice with 20 mM sodium citrate (pH 5.0); then an equal amount of wet-weight mycelia was transferred to 250 mL of 20 mM sodium citrate supplemented with sophorose at a final concentration of 500 μM. The mycelia were collected at growth intervals for quantitative RT-PCR assays.

Yeast two-hybrid (Y2H) assay.

All Y2H assay were performed according to the manufacturer’s manual (Clontech-TaKaRa Bio). To analyze the interaction between TAM1 and ARE1, the cDNA sequences of tam1 and are1 were obtained by fusion of their respective exons amplified from T. reesei genomic DNA using overlap-extension PCR (55) and were inserted into the EcoRI/BamHI sites of pGBKT7 and pGADT7, respectively, resulting in pGBKT7-tam1, pGADT7-are1. The are1 fragment lacking nucleotide sequence encoding the C-terminal 12 aa was ligated into pGADT7 to result in pGADT7-are1ΔC. The specific plasmids were subsequently cotransformed into the S. cerevisiae Y2H Gold cells. The yeast cells containing pGBKT7-p53/pGADT7-T were set as a positive control (31), and those cells carrying pGADT7/pGBKT7-tam1 or pGADT7-are1/pGBKT7 were used as negative controls.

Sequence analysis.

Amino acid sequence of T. reesei TFs were obtained from the JGI database. The sequences of the TAM1 orthologues were obtained from the NCBI database. Amino acid sequence alignment was performed using ClustalW (56). Phylogenetic analysis was performed with MEGA7.0 using the neighbor-joining method with 1,000 bootstraps (57). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method and are given in units of the number of amino acid substitutions per site.