Pestalotioid Species Associated with Medicinal Plants in Southwest China and Thailand

Y R Sun; R S Jayawardena; J E Sun; Y Wang

doi:10.1128/spectrum.03987-22

. 2023 Jan 10;11(1):e03987-22. doi: 10.1128/spectrum.03987-22

Pestalotioid Species Associated with Medicinal Plants in Southwest China and Thailand

Y R Sun ^a,^b,^c, R S Jayawardena ^b,^c, J E Sun ^a, Y Wang ^a,^✉

Editor: Florian M Freimoser^d

Reviewed by: Ishara Manawasinghe^e

PMCID: PMC9927317 PMID: 36625649

ABSTRACT

In this paper, a total of 26 pestalotioid isolates associated with different medicinal plants from southwest China and Thailand were studied. Based on morphological examinations and multigene analyses of three gene loci (ITS, tef1-α, and tub2), these 26 isolates represent 17 species distributed in three genera, including seven new species and eight new records. The concatenated three loci tree was used to infer the occurrence of sexual recombination within each pestalotioid genus through the pairwise homoplasy index (PHI) test implemented in SplitsTree. Further, simplifying the description of pestalotioid species is discussed, and a checklist for pestalotioid species associated with medicinal plants worldwide is provided.

IMPORTANCE Pestalotioid species are an important fungal group, occurring commonly as plant pathogens, endophytes, and saprophytes. The study of pestalotioid species associated with medicinal plants is significant for agriculture, industry, and pharmaceutical industry but remains poorly studied. In this study, we report 17 pestalotioid species related to medicinal plants based on morphology and molecular analyses. Our study significantly enriches the species richness of pestalotioids and provides a basis for follow-up studies.

KEYWORDS: 7 new species, 8 new records, diversity, endophytes, plant pathogens, phylogeny, saprophytes, taxonomy

INTRODUCTION

Medicinal plants play a crucial role in the development of human cultures and are a rich source of natural products with both biological and chemical properties. Medicinal plants are used in health care, serve as treatments for various diseases, and have been used since prehistoric times across the world (1, 2). It is estimated that more than 70% of the world’s population relies on medicinal plants (3). Microfungi can affect the growth and quality of medicinal plants. Some endophytes isolated from medicinal plants have broad developmental prospects (4, 5). Microfungi associated with medicinal plants are research hot spots (6 –9).

Pestalotioid species are a very common group of fungi that form important associations with different plants as pathogens, endophytes, or saprophytes and are widely distributed in tropical and temperate regions (10 –17). Traditional taxonomy of pestalotioid species mainly depend on their hosts and color intensities of the median conidial cell (10, 18 –21). With the development of DNA-based phylogenetic analysis, the traditional classification system based on hosts and conidial colors is controversial. The use of molecular data in resolving pestalotioid species was revisited by Maharachchikumbura et al. (13), who separated this group into three genera, viz. Neopestalotiopsis, Pestalotiopsis, and Pseudopestalotiopsis. Neopestalotiopsis differs from Pseudopestalotiopsis and Pestalotiopsis by its versicolorous (two upper median cells darker than the lowest median cell) median cells and indistinct conidiophores, while Pseudopestalotiopsis can be easily distinguished from Pestalotiopsis by darker-colored concolorous (for those possessing equally pigmented median cells) median cells (13).

As important plant pathogens, pestalotioid species are almost ubiquitous in agricultural and noncultivated ecosystems, causing multiple diseases and huge economic losses (22 –30). For example, gray blight disease of tea plants is caused by Pseudopestalotiopsis spp. and Pestalotiopsis spp. and accounts for at least 17% production damage in southern India (31) and 10 to 20% yield loss in Japan (32). Neopestalotiopsis clavispora caused the leaf blight of Elettaria cardamomum in India (33) and leaf spot of Taxus chinensis in China (34). Diogo et al. (22) reported that pestalotioid fungi caused stem girdling and dieback in young eucalyptus plants in Portugal. Li et al. (35) identified five new pestalotioid species associated with symptomatic leaves of Camellia oleifera in China. Thus, it is necessary to study the pathogenic pestalotioid species related to medicinal plants, which could provide the research foundation for the prevention and treatment of diseases and reduce economic losses.

The study of endophytic fungi in medicinal plants is of great significance for elucidating their distribution, growth and developmental characteristics, and resource regeneration (6, 7, 9, 36, 37). Many pestalotioid fungi have been found as endophytes from different medicinal plants with rich secondary metabolites (5, 36, 38 –41). For example, the endophytic fungus Pestalotiopsis versicolor was isolated from the healthy leaves of Taxus cuspidata, and it is an excellent candidate for an alternate source of Paclitaxel supply (42). Therefore, the study of endophytic pestalotioid species related to medicinal plants could be of great importance to pharmaceuticals and therapeutic medicine.

This study aims to identify the pestalotioid fungi associated with medicinal plants in southwest China and Thailand based on morphology and molecular analyses. This paper describes, illustrates, and compares seven new species and eight new records with allied species. In addition, we provide a checklist for pestalotioid species associated with medicinal plants worldwide.

RESULTS

Neopestalotiopsis Maharachch., K.D. Hyde, and Crous, Stud. Mycol. 79:135 (2014).

(i) Phylogenetic analyses. The combined data sets consist of 100 Neopestalotiopsis strains along with the outgroup Pestalotiopsis diversiseta (MFLUCC 12–0287) and P. spathulata (CBS 356.86), which were analyzed to infer the interspecific relationships within Neopestalotiopsis. The aligned sequence matrix comprised internal transcribed spacers (ITS; 1 to 485), translation elongation factor 1 (tef1-α; 486 to 982), and partial β-tubulin region (tub2; 983 to 1,423), sequence data for a total of 1,423 sites, including coded alignment gaps. Similar tree topologies were obtained by maximum likelihood (ML) and Bayesian posterior probability (BYPP) methods, and the most likely tree (−ln = 7671.251111) is presented in Fig. 1. The phylogenetic tree, which analyzed the 15 Neopestalotiopsis isolates from medicinal plants, indicated four novel species and three new records.

FIG 1 — Maximum likelihood (RAxML) tree for *Neopestalotiopsis* based on the analysis of a combined data set of *ITS*, *tef1-α*, and *tub2* sequence data. The tree is rooted with *Pestalotiopsis diversiseta* (MFLUCC 12-0287) and *P. spathulata* (CBS 356.86). Bootstrap support values for ML greater than 75% and Bayesian posterior probabilities greater than 0.95 are given near nodes, respectively. The new isolates are in red, and ex-type strains are in bold.

(ii) Genealogical concordance phylogenetic species recognition analysis. The pairwise homoplasy index (PHI) test revealed that there is no significant recombination (Фw = 0.06), between N. amomi and its closely related taxa N. eucalypticola (CBS 264.37), N. magna (MFLUCC 12-0652), and N. zingiberis (GUCC 21001) (Fig. 2a). Additionally, based on the PHI test results, there is no significant recombination (Фw = 0.11) between N. hyperici and its closely related taxa N. acrostichi (MFLUCC 17–1754), N. lusitanica (MEAN 1320), N. protearum (CBS 114178), N. rhododendricola (KUN-HKAS 123204), and N. rhododendri (GUCC 21504) (Fig. 2b). Similar result also occurred in N. photiniae (Фw = 1.0) (Fig. 2c) and N. suphanburiensis (Фw = 1.0) (Fig. 2d), indicating there is no significant recombination between them and their closely related taxa.

FIG 2 — (a, b, c and d) Split graphs showing the results of a PHI test of new *Neopestalotiopsis* species with their most closely related species using Log-Det transformation and splits decomposition options. The new taxon in each graph is shown in red font.

(iii) Taxonomy. (a) Neopestalotiopsis amomi Y.R. Sun and Yong Wang bis, sp. nov. Fungal names number: FN 571230; Facesoffungi number: FoF 12912 (Fig. 3).

Etymology: refers to the name of the host plant from which the fungus was isolated.

Holotype: HKAS 124563.

Associated with leaf blight of Amomum villosum. Symptoms: irregular shape, pale to brown, slightly sunken spots appear on the leaves of Amomum villosum, which later expand outward. Sexual morph: not observed. Asexual morph: conidiomata solitary, subglobose to globose, unilocular, brown, semi-immersed on leaves. Conidiophores 3 to 5 μm long, often reduced to conidiogenous cells. Conidiogenous cells 1 to 2 μm wide, subcylindrical, ampulliform, hyaline. Conidia 18 to 30 × 4 to 7 μm ( $\bar{x}$ = 25 × 6 μm, n = 40), length/width (L/W) ratio of 4.2, fusiform, straight to slightly curved, 4 septate; basal cell obconic with a truncate base, hyaline, smooth walled, 3 to 7 μm long; three median cells 12 to 19 μm long ( $\bar{x}$ = 16 μm, n = 40), pale brown to brown, concolorous, wall rugose, septa darker than the rest of the cell; second cell from base pale brown to brown, 3 to 8 μm long; third cell pale brown to brown, 3 to 7 μm long; fourth cell pale brown to brown, 3 to 7 μm long; apical cell 2 to 5 μm long, hyaline, conic to acute; with 2 to 3 tubular appendages on the apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 7 to 17 μm long; single basal appendage, unbranched, tubular, centric, 2 to 5 μm long.

Culture characteristics: conidia germinated on potato dextrose agar (PDA) within 12 h from single-spore isolation. Colony diameter reached 8 cm after 2 weeks at 25°C on PDA medium and appeared circular, with a flat, rough surface and was white from above and below.

Material examined: China, Guizhou Province, Qiannan Bouyei and Miao Autonomous Prefecture, Luodian District, leaf blight of Amomum villosum (Zingiberaceae), 3 September 2021, Y.R. Sun, L8 (HKAS 124563, holotype); ibid., on leaf blight of Amomum villosum, 3 September 2021, Y.R. Sun, L8-1 (HKAS 124564).

Notes: Neopestalotiopsis amomi was isolated from the diseased leaves of Amomum villosum in China. Two collections HKAS 124563 and HKAS 124564 clustered together with good support (ML-BS = 100%, BYPP = 1) and formed a sister clade to N. zingiberis (GUCC 21001), which was also isolated from a Zingiberaceae plant (43). The former differs in producing thinner conidia (4 to 7 μm in N. amomi versus 6 to 9.5 μm in N. zingiberis) and shorter conidiophores (3 to 5 μm in N. amomi versus 12 to 25 μm in N. zingiberis). In addition, there are 4 bp different between HKAS 124563 and GUCC 21001 in the ITS gene and 10 bp different in the tef1-α gene. Neopestalotiopsis amomi also differs by smaller conidia (18 to 30 × 4 to 7 μm versus 42 to 46 × 9.5 to 12 μm) from N. magna. The PHI test on N. amomi indicated that there is no significant recombination (Фw = 0.06) between N. amomi and its closely related taxa. Thus, we introduce N. amomi as a new species.

(b) Neopestalotiopsis hyperici Y.R. Sun and Yong Wang bis, sp. nov. Fungal names number: FN 571228; Facesoffungi number: FoF 12913 (Fig. 4).

Etymology: the specific epithet is referring to Hypericum, the host plant that the fungus was isolated from.

Holotype: HKAS 124561.

Associated with leaf spots of Hypericum monogynum. Symptoms: irregular shape, pale to brown, slightly sunken spots appear on the leaves of Hypericum sp., which later expand outward. Sexual morph: not observed. Asexual morph: conidiomata solitary, unilocular, dark. Conidiophores often reduced to conidiogenous cells. Conidiogenous cells indistinct. Conidia 17 to 22 (to 24) × 5 to 8 μm ( $\bar{x}$ = 19 × 7 μm, n = 30), L/W ratio of 2.8, fusoid, subcylindrical, straight to slightly curved, 4 septate; basal cell conic to obconic with a truncate base, hyaline to subhyaline, 2 to 4 μm long; three median cells 10 to 14 (to 17) μm long ( $\bar{x}$ = 12 μm, n = 30), wall rugose, concolorous; second cell from base pale brown to brown, 3 to 5 μm long; third cell pale brown to brown, 3 to 6 μm long; fourth cell pale brown to brown, 2 to 6 μm long; apical cell 1 to 4 μm long, hyaline, rugose and thin walled; with 2 to 3 tubular apical appendages, arising from the apical crest, unbranched, filiform, 11 to 23 μm long; single basal appendage 4 to 7 μm long, unbranched, tubular, centric.

Culture characteristics: colonies on PDA reached up to 10 cm after 2 weeks, dense mycelium was on the surface, and colonies appeared white from above and below. Fruiting bodies were observed after 14 days.

Material examined: China, Guizhou Province, Guiyang City, Baiyun District, Changpoling National Forest Park, leaf spot of Hypericum monogynum (Clusiaceae), 20 August 2021, Y.R. Sun, CL5-1 (HKAS 124561, holotype); ex-type culture, KUNCC 22-12597 = GUCC 21-0812; ibid., on leaf spots of Hypericum monogynum, 20 August 2021, Y.R. Sun, CL5-1-1, living culture KUNCC 22-12598 = GUCC 21-0811.

Notes: Neopestalotiopsis hyperici is related to N. rhododendri and N. protearum in the phylogenetic analysis (Fig. 1), but they can be distinct from concolorous conidia and the size of their median cells (10 to 14 μm in N. hyperici versus 14 to 20 μm in N. rhododendri versus 16 to 17 μm in N. protearum) (13, 44). In addition, there are 13 bp different between N. hyperici and N. rhododendri and 10 bp different between N. hyperici and N. protearum in the tef1-α region. Moreover, the PHI test on N. hyperici indicated that there is no significant recombination (Фw = 0.11) between N. hyperici and its closely related taxa (Fig. 2b). Thus, we introduce N. hyperici as a new species.

(c) Neopestalotiopsis photiniae Y.R. Sun and Yong Wang bis, sp. nov. Fungal names number: FN 571231; Facesoffungi number: FoF 12914 (Fig. 5).

Etymology: referring to the host plant from which the fungus was isolated.

Holotype: HKAS 125895.

Associated with leaf spots of Photinia serratifolia. Symptoms: irregular shape, pale to brown, slightly sunken spots appear on the leaves of Photinia serratifolia, which later expand outward. Small spots gradually enlarged, changing to brown circular ring spots with a dark brown border. Sexual morph: not observed. Asexual morph: conidiomata solitary, subglobose to globose, unilocular, dark brown, semi-immersed on leaves. Conidiophores indistinct, often reduced to conidiogenous cells. Conidiogenous cells 1 to 3 × 2 to 4 μm, subcylindrical, ampulliform, hyaline. Conidia 20 to 29 × 5 to 12 μm ( $\bar{x}$ = 23 × 9 μm, n = 40), L/W ratio of 2.6, broadly fusiform, straight to slightly curved, 4 septate; basal cell obconic with a truncate base, hyaline to pale brown, 1 to 5 μm long; three median cells 13 to 19 μm long ( $\bar{x}$ = 16 μm, n = 40), brown to dark, wall rugose, versicolorous; second cell from base pale brown to brown, 4 to 6 μm long; the third and fourth cells, dark brown to black, are not easily distinguished, septate indistinct, 10 to 13 μm long; apical cell 2 to 4 μm long, hyaline, conic to acute; with 2 to 3 tubular appendages on the apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 17 to 33 μm long; single basal appendage, unbranched, tubular, centric, 1 to 6 μm long.

Culture characteristics: conidia germinated on PDA within 12 h at 25°C from single-spore isolation. Apical cells produced germ tubes. Colony diameter reached 80 mm after 3 weeks at 25°C on PDA medium, were circular with a rough, flat surface, and appeared white from above and below.

Material examined: China, Guizhou Province, Guiyang City, Nanming District, Xiaochehe Road, Guiyang Ahahu National Wetland Park, on leaf spots of Photinia serratifolia (Rosaceae), 21 September 2019, Y.R. Sun, AH9 (HKAS 125895, holotype); ex-type culture, MFLUCC 22-0129; ibid., on leaf spots of Photinia sp. (Rosaceae), 21 September 2019, Y.R. Sun, AH9-1, living culture, GUCC 21-0820.

Notes: Neopestalotiopsis photiniae is phylogenetically sister to N. sichuanensis and N. vheenae (Fig. 1). Neopestalotiopsis photiniae differs by its thinner conidia (L/W ratio = 2.6 versus L/W ratio = 4.1) from N. sichuanensis (45). Neopestalotiopsis photiniae is morphologically distinguishable from N. vheenae in shorter conidiogenous cells (1 to 3 × 2 to 4 μm versus 5 to 10 × 3 to 5 μm) (23). The result of the PHI test showed that there is no obvious recombination (Фw = 1.0) between N. photiniae and its closely related taxa (Fig. 2c). Therefore, N. photiniae is introduced as a new species.

(d) Neopestalotiopsis suphanburiensis Y.R. Sun and Yong Wang bis, sp. nov. Fungal names number: FN 571232; Facesoffungi number: FoF 12916 (Fig. 6).

Etymology: refers to the province where the fungus was collected, Suphan Buri Province.

Holotype: Mae Fah Luang University (MFLU) 22-0168.

Saprobic on stems of an unidentified plant. Sexual morph: not observed. Asexual morph: conidiomata solitary, subglobose to globose, unilocular, brown to dark, immersed on stems. Conidiophores indistinct, often reduced to conidiogenous cells. Conidiogenous cells subcylindrical, ampulliform, hyaline. Conidia 19 to 29 × 4 to 7 μm ( $\bar{x}$ = 25 × 5 μm, n = 40), L/W ratio = 4.9, fusiform, straight to slightly curved, 4 septate; basal cell obconic with a truncate base, hyaline, smooth walled, 3 to 7 μm long; three median cells 12 to 19 μm long ( $\bar{x}$ = 16 μm, n = 40), pale brown to brown, wall rugose, concolor, septa darker than the rest of the cell, versicolorous; second cell from base pale brown to brown, 3 to 7 μm long; third cell pale brown to brown, 3 to 6 μm long; fourth cell pale brown to brown, 4 to 6 μm long; apical cell 3 to 6 μm long, hyaline, conic to acute; with 2 to 3 tubular appendages on the apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 9 to 21 μm long; single basal appendage, unbranched, tubular, centric, 2 to 11 μm long.

Culture characteristics: colony diameter reached 8 cm after 2 weeks at 25°C on PDA medium. Colonies were circular with a rough, flat surface and appeared white from above and white to pale gray from below.

Material examined: Thailand, Suphan Buri Province, dead stem of an unidentified plant, 5 September 2020, S Wang, TN01 (MFLU 22-0168, holotype); ex-type culture, MFLUCC 22-0126.

Notes: Neopestalotiopsis suphanburiensis is phylogenetically sister to N. eucalyptorum, which was isolated from leaves and stems of Eucalyptus globulus (Fig. 1). In morphology, N. suphanburiensis differs from N. eucalyptorum in having thinner conidia (4 to 7 μm versus 7.6 to 8.1 μm). In addition, there are 10 bp different (without gap, 445 bp) in the tef1-α region. The PHI test on N. suphanburiensis also indicated that there is no significant recombination (Фw = 1.0) between N. suphanburiensis and its closely related taxa (Fig. 2d). We thus introduce N. suphanburiensis as a new species.

(e) Neopestalotiopsis sp. 1. Associated with leaf spot of Cyrtomium fortunei, Lithocarpus sp., and Smilax scobinicaulis (Fig. 7). Symptoms: irregular shape, pale brown, small spots gradually enlarged, changing to brown circular ring spots with a dark brown border. Sexual morph: not observed. Asexual morph: conidiomata solitary, subglobose to globose, unilocular, dark brown, semi-immersed on leaves. Conidiophores indistinct, often reduced to conidiogenous cells. Conidiogenous cells subcylindrical or ampulliform, hyaline. Conidia 21 to 31 × 4 to 7 μm ( $\bar{x}$ = 26 × 6 μm, n = 30), L/W ratio of 4.4, fusiform, straight to slightly curved, 4 septate; basal cell obconic with a truncate base, hyaline, 3 to 7 μm long; three median cells doliiform to cylindrical, 11 to 18 μm long ( $\bar{x}$ = 15 μm, n = 30), yellow to brown, concolorous, septa darker than the rest of the cell; second cell from base yellow to brown, 3 to 6 μm long; third cell yellow to brown, 3 to 7 μm long; fourth cell yellow to brown, 4 to 7 μm long; apical cell 2 to 6 μm long, hyaline, conic to acute; with 1 to 4 tubular appendages on apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 13 to 26 μm long; single basal appendage, unbranched, tubular, centric, 2 to 7 μm long.

Culture characteristics: conidia germinated on PDA within 12 h at 25°C from single-spore isolation. Apical cells produced germ tubes. Colony diameter reached 80 mm after 2 weeks at 25°C on PDA medium. Colonies were circular with a rough, flat surface and appeared white from above and yellow from below.

Material examined: China, Guizhou Province, Tongren City, Jiangkou District, Yamugou Parkland, leaf spot of Lithocarpus sp. (Fagaceae), 20 May 2022, Y.R. Sun, JK15-2 (HKAS 124565); living culture, KUNCC 22-12592 = GUCC 21-0808; China, Guizhou Province, Qiannan Bouyei and Miao Autonomous Prefecture, Libo District, leaf spot of Smilax china (Liliaceae), 12 March 2022, Y.R. Sun, bb1 (HKAS 124560); China, Guizhou Province, Guiyang City, Baiyun District, Changpoling National Forest Park, leaf spot of Dryopteris crassirhizoma (Dryopteridaceae), 20 August 2021, Y.R. Sun, CL1-2, living culture, GUCC 21-0813.

Notes: three strains (KUNCC 22-12592, HKAS 124560, and GUCC 21–0813) have identical ITS, tef1-α, and tub2 sequences as isolates CFCC-54337 and ZX12-1, which were previously provided by Jiang et al. (45). However, they did not introduce it as a new species due to lack of distinguished characters from close clades. In this study, these five strains clustered together and formed a distinct clade in the tree. We keep these five strains as Neopestalotiopsis sp.1 for the same reasons as before. We speculate that Neopestalotiopsis sp.1 could be a common phytopathogen, as it has been found in leaf spots on different plants.

(f) Neopestalotiopsis sp. 2. Saprobic on Ceiba pentandra leaves and endophytic from Pinellia ternata (Fig. 8). Sexual morph: not observed. Asexual morph: conidiomata solitary, unilocular, dark, immersed on stems. Conidiophores indistinct, often reduced to conidiogenous cells. Conidiogenous cells indistinct. Conidia 19 to 25 × 6 to 8 μm ( $\bar{x}$ = 22 × 7 μm, n = 30), L/W ratio of 3.1, fusoid, ellipsoid to subcylindrical, straight to slightly curved, 4 septate; basal cell conic to obconic with a truncate base, hyaline to subhyaline, 3 to 6 μm long; three median cells 13 to 15 μm long ( $\bar{x}$ = 14 μm, n = 30), wall rugose, versicolorous, septa darker than the rest of the cell; second cell from base pale brown to brown, 3 to 5 μm long; third cell brown, 3 to 6 μm long; fourth cell brown, 3 to 6 μm long; apical cell 2 to 4 μm long, hyaline, rugose and thin walled; with 2 (seldom 3) tubular apical appendages, arising from the apical crest, unbranched, filiform, 11 and 20 μm long; single basal appendage 2 to 5 μm long, unbranched, tubular, centric.

Culture characteristics: colonies on PDA reached up to 8 cm in 2 weeks, with dense aerial mycelium on the surface with undulate edge; white. Fruiting bodies were observed after 14 days.

Material examined: Thailand, Chiang Rai Province, dead leaves of Ceiba pentandra (Bombacaceae), 16 Jan 2021, Y.R. Sun, CR20 (MFLU 22-0170); living culture, MFLUCC 22-0131; China, Guizhou Province, Guiyang City, Nanming District, Guiyang Medicinal Botanical Garden, on healthy leaves of Pinellia ternata (Araceae), 1 May 2022, Y.R. Sun, E2, living culture KUNCC 22-12596 = GUCC 21-0805.

Notes: our isolates KUNCC 22-12596 and MFLUCC 22-0170 clustered together with Neopestalotiopsis sp. 2 (CFCC 54340 and ZX22B), and these four isolates formed a distinct clade in the phylogenetic tree (Fig. 1). Four isolates have similar characteristics. We keep these four strains as Neopestalotiopsis sp. 2 as explained above. Interestingly, KUNCC 22-12596, MFLUCC 22-0170, ZX22B, and CFCC 54340 have different habitats. KUNCC 22-12596 was endophytic in healthy leaves of Pinellia ternata, MFLUCC 22-0170 was saprobic on decaying leaves of Ceiba pentandra, and CFCC 54340 and ZX22B were isolated from leaf spots of Castanea mollissima.

(g) Neopestalotiopsis formicarum Maharachch., K.D. Hyde, and Crous. Material examined: China, Guizhou Province, Guiyang City, Nanming District, Xiaochehe Road, Guiyang Ahahu National Wetland Park, on leaf spots of Photinia serrulate (Rosaceae), 21 September 2019, Y.R. Sun, AH11, living culture, GUCC 21-0809.

Notes: Neopestalotiopsis formicarum was introduced by Maharachchikumbura et al. (13) as a saprobic species isolated from dead ants in Ghana and plant debris from Cuba. Later, many studies have proven that N. formicarum is a serious phytopathogen, which can cause leaf fall disease in rubber trees in Thailand (46), leaf spot pathogens of the guarana plant in Brazil (47), and leaf brown blight of jabuticaba in Taiwan province, China (48). In this study, a new N. formicarum taxon was isolated from leaf spots of Photinia serrulate in China.

(h) Neopestalotiopsis rhapidis Qi Yang and Yong Wang bis. Material examined: China, Guizhou Province, Qiannan Bouyei and Miao Autonomous Prefecture, Libo District, leaf spots of Podocarpus macrophyllus (Podocarpaceae), 12 March 2022, Y.R. Sun, ML3 (HKAS 124559); living culture, KUNCC 22-12590 = GUCC 21-0806.

Notes: Neopestalotiopsis rhapidis was introduced by Yang et al. (44) from leaf spot of Rhapis excelsa (Arecaceae) in China. Our isolate KUNCC 22-12590 clustered together with N. rhapidis (GUCC 21501) in the phylogenetic tree. These two species have overlapping conidial measurements (17 to 25 × 5 to 8 μm for KUNCC 22 to 12590 versus (22 to) 25.5 × 4 (to 6) μm for GUCC 21501) (44). Both isolates were associated with leaf spots in China. Therefore, we identify KUNCC 22-12590 and GUCC 21501 to be conspecific species, and KUNCC 22-12590 represents a new host record.

(i) Neopestalotiopsis rhododendri Qi Yang and Yong Wang bis. Material examined: Thailand, Chiang Mai Province, Mae Taeng District, Mushroom Research Center, leaf spots of Dracaena fragrans (Liliaceae), 15 September 2020, S Wang, LD1, living culture, MFLUCC 22-0130.

Notes: Neopestalotiopsis rhododendri was introduced by Yang et al. (44) from the diseased leaf of Rhododendron simsii (Ericaceae) in China. Based on our phylogenetic analysis of combined ITS, tef1-α, and tub2 sequence data, our isolate MFLUCC 22-0130 clustered with the type species N. rhododendri (GUCC 21504) with good support (ML-BS = 99% and BYPP = 0.99). Our collection also shares similar morphological features with the holotype of N. rhododendri (GUCC 21504). Both isolates were associated with leaf spots. Therefore, we identify our collection as N. rhododendri, which represents a new host and geographical record.

Pestalotiopsis Steyaert, Bull. Jard. bot. État Brux. 19:300 (1949).

(i) Phylogenetic analyses. The phylogenetic tree (Pestalotiopsis) comprised 120 ingroups and two outgroups, Neopestalotiopsis protearum (CBS 114178), and N. cubana (CBS 600.96). A total of 1,496 characters including gaps (543 for ITS, 516 for tef1-α, and 437 for tub2) were included in the phylogenetic analysis. Similar tree topologies were obtained by ML and BYPP methods, and the most likely tree (−ln = 12,403.616855) is presented (Fig. 9). The phylogenetic tree analyzed 10 Pestalotiopsis taxa isolated from medicinal plants and revealed three novel species and three new records of Pestalotiopsis.

FIG 9 — Maximum likelihood (RAxML) tree for *Pestalotiopsis* based on analysis of a combined data set of *ITS*, *tef1-α*, and *tub2* sequence data. The tree is rooted with *Neopestalotiopsis protearum* (CBS 114178) and *N. cubana* (CBS 600.96). Bootstrap support values for ML greater than 75% and Bayesian posterior probabilities greater than 0.95 are given near nodes, respectively. The new isolates are in red, and the ex-type strains are in bold.

(ii) Genealogical concordance phylogenetic species recognition analysis. The PHI test revealed that there is no significant recombination (Фw = 0.26) between P. chiangmaiensis and its closely related taxa P. smilacicola (MFLUCC 22-0125), P. dracontomelon (MFLUCC 10-0149), and P. rhizophorae (MFLUCC 17-0416) (Fig. 10a). The P. loeiana (MFLUCC 22-0123)-based PHI test confirmed that there is no significant recombination (Фw = 0.13) between P. loeiana and its closely related taxa P. chiangmaiensis (MFLUCC 22-0127), P. nanningensis (CSUFTCC10), P. rhizophorae (MFLUCC 17-0416), and P. thailandica (MFLUCC 17-1616) (Fig. 10b).

FIG 10 — (a and b) Split graphs showing the results of the PHI test of new *Pestalotiopsis* species with their most closely related species using Log-Det transformation and split decomposition options. The new taxon in each graph is shown in red font.

(iii) Taxonomy. (a) Pestalotiopsis chiangmaiensis Y.R. Sun and Yong Wang bis, sp. nov. Fungal names number: FN 571225; Facesoffungi number: FoF 04525 (Fig. 11).

Etymology: refers to the location where the fungus was encountered.

Holotype: MFLU 22-0164.

Associated with leaf strips of Phyllostachys edulis. Sexual morph: not observed. Asexual morph: conidiomata on PDA pycnidial, subglobose to globose, solitary or aggregated, dark, semi-immersed or partly erumpent; exuding black conidial masses. Conidiophores hyaline, smooth, simple, reduced to conidiogenous cells. Conidiogenous cells 5 to 11 × 1 to 3 μm, cylindrical to subcylindrical or ampulliform to lageniform, hyaline, smooth. Conidia pale brown, fusiform, straight to slightly curved, (3 to) 4 septate, 16 to 26 × 4 to 7 μm ( $\bar{x}$ = 21 × 5 μm, n = 40), L/W ratio of 4.2; basal cell obconic with a truncate base, hyaline or sometimes pale brown, smooth walled, 2 to 6 μm long; three median cells 10 to 16 μm long ( $\bar{x}$ = 14 μm, n = 40), pale brown, concolorous, wall rugose, septa darker than the rest of the cell, somewhat constricted at the septa; second cell from base pale brown, 3 to 6 μm long; third cell brown, 3 to 6 μm long; fourth cell brown, 3 to 6 μm long; apical cell 2 to 5 μm long, hyaline, conic to acute; with 2 (to 3) tubular appendages on the apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 8 to 13 μm long; single basal appendage 2 to 7 μm, unbranched, tubular, centric.

Culture characteristics: colonies on PDA reached 5 to 6 cm in diameter after 7 days at 25°C, colonies were filamentous to circular, medium dense, aerial mycelium on surface flat or raised, with filiform (curled) margin, fluffy, white from above and below; fruiting bodies black.

Material examined: Thailand, Chiang Mai Province, Mae Taeng District, Mushroom Research Center, leaf strip of Phyllostachys edulis (Poaceae), 15 July 2020, Y.R. Sun, M18 (MFLU 22-0164, holotype); ex-type culture, MFLUCC 22-0127.

Notes: Pestalotiopsis chiangmaiensis formed a distinct lineage and was sister to P. smilacicola and P. dracontomelon in the phylogenetic tree (Fig. 11). It differs by longer conidiogenous cells (5 to 11 μm versus 1 to 4 μm) than P. smilacicola and shorter apical appendages (8 to 13 μm versus 10 to 22 μm) than P. dracontomelon. In addition, there are 14 bp different (without gap, 474 bp) in the tef1-α region between P. chiangmaiensis (MFLUCC 22-0127) and P. smilacicola (MFLUCC 22-0125) and 15 bp different (without gap, 464 bp) between P. chiangmaiensis (MFLUCC 22-0127) and P. dracontomelon (MFLUCC 10-0149). The PHI test on P. chiangmaiensis also showed that there is no significant recombination (Фw = 0.26) between P. chiangmaiensis and its closely related taxa (Fig. 10a). Therefore, we introduce P. chiangmaiensis as a new species.

(b) Pestalotiopsis loeiana Y.R. Sun and Yong Wang bis, sp. nov. Fungal names number: FN 571226; Facesoffungi number: FoF 12919 (Fig. 12).

Etymology: refers to the collected site, Loei Province.

Holotype: MFLU 22-0167.

Saprobic on dead leaves. Sexual morph: not observed. Asexual morph: conidiomata solitary, black, semi-immersed on leaves. Conidiophores indistinct and conidiogenous cells indistinct. Conidia 17 and 22 × 4 and 6 μm ( $\bar{x}$ = 19 × 5 μm, n = 40), L/W ratio of 3.7, fusiform, straight to slightly curved, 4 septate; basal cell obconic with a truncate base, hyaline or sometimes pale brown, rugose walled, 3 to 6 μm long, with 1 to 3 basal appendages, unbranched, tubular, centric, 3 to 13 μm long ( $\bar{x}$ = 9 μm); three median cells 10 to 14 μm ( $\bar{x}$ = 12, n = 40), doliiform to cylindrical, brown, concolorous, wall rugose, septa darker than the rest of the cell, somewhat constricted at the septa; second cell from base brown, 3 to 6 μm long; third cell brown, 3 to 5 μm long; fourth cell brown, 2 to 5 μm long; apical cell 3 to 5 μm long, hyaline, conic to acute; with 1 to 3 tubular appendages on the apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 13 to 24 μm long.

Culture characteristics: colonies on PDA reached 8 cm in diameter after 2 weeks at 25°C, colonies filamentous to circular, medium dense, mycelium on surface flat or raised, with filiform margin, fluffy, yellow circle in the middle surrounded by white mycelium from above, light yellow to pale brown from the reverse.

Material examined: Thailand, Loei Province, dead leaves of an identified plant, 27 February 2020, J.Y. Zhang, JY1 (MFLU 22-0167, holotype); ex-type culture, MFLUCC 22-0123.

Notes: Pestalotiopsis loeiana (MFLUCC 22-0123) is phylogenetically sister to P. rhizophorae and P. thailandica, which were isolated from leaf spots of mangroves (Fig. 11). Morphologically, P. loeiana is distinguishable by its more than one basal appendage and smaller conidia (17 to 22 × 4 to 6 μm in P. loeiana versus 21 to 27 × 6. 5 to 7. 5 μm in P. rhizophorae versus 21 to 25 × 6 to 7 in P. thailandica). The result of the PHI test (Фw = 0.13) also showed that there is no significant recombination between P. loeiana and its closely related taxa (Fig. 10b). Therefore, we introduce P. loeiana as a new species.

(c) Pestalotiopsis smilacicola Y.R. Sun and Yong Wang bis, sp. nov. Fungal names number: FN 571227; Facesoffungi number: FoF 12921 (Fig. 13).

Etymology: refers to the host plant from which the fungus was isolated.

Holotype: MFLU 22-0165.

Associated with leaf spots of Smilax sp. Symptoms subcircular to irregular shape, brown, slightly sunken spots appear on the leaves of Smilax china, which later expand outward. Small auburn spots appeared initially and then gradually enlarged. Sexual morph: not observed. Asexual morph: conidiomata solitary, subglobose, unilocular, black, semi-immersed on leaves. Conidiomatal wall 7 to 10 μm wide, thin walled, pale brown. Conidiophores indistinct. Conidiogenous cells 1 to 4 × 1 to 3 μm, subcylindrical to ampulliform, hyaline, smooth. Conidia 18 to 22 × 4 to 7 μm ( $\bar{x}$ = 20 × 5 μm, n = 40), L/W ratio of 3.8, fusiform, straight to slightly curved, 4 septate; basal cell obconic with a truncate base, hyaline or sometimes pale brown, smooth walled, 3 to 5 μm long; three median cells 9 to 15 μm long ( $\bar{x}$ = 12 μm, n = 40), pale brown to brown, concolorous, wall rugose, septa darker than the rest of the cell, somewhat constricted at the septa; second cell from base pale brown to brown, 3 to 5 μm long; third cell brown, 2 to 5 μm long; fourth cell brown, 3 to 5 μm long; apical cell 2 to 5 μm long, hyaline, conic to acute; with 2 to 3 tubular appendages on the apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 6 to 14 μm long; single basal appendage, unbranched, tubular, centric, 2 to 6 μm long.

Culture characteristics: colonies on PDA reached 10 cm in diameter after 2 weeks at 25°C, colonies filamentous to circular, medium dense, aerial mycelium on surface flat or raised, with filiform margin, fluffy, white from above and reverse.

Material examined: Thailand, Chiang Mai Province, Mae Taeng District, Mushroom Research Center, leaf spots of Smilax sp. (Liliaceae), 16 July 2020, Y.R. Sun, M26 (MFLU 22-0165, holotype), ex-type culture, MFLUCC 22-0125. ibid., leaf spots of Smilax china (Liliaceae), 15 July 2020, Y.R. Sun, M13 living culture, MFLUCC 22-0124.

Notes: two isolates MFLUCC 22-0125 and MFLUCC 22-0124 share similar morphology. These two isolates clustered together and formed a sister clade to P. dracontomelon (MFLUCC 10-0149) in the phylogenetic tree. There is only 1 bp different in tef1-α and tub2 genes and 3 bp different in the ITS gene between these two isolates. For the differences between P. smilacicola and its related species see the notes of P. chiangmaiensis (this study). Therefore, these two isolates are identified as conspecific, representing a new species.

(d) Pestalotiopsis chamaeropis Maharachch., K.D. Hyde, and Crous. Material examined: China, Guizhou Province, Guiyang City, Nanming District, Guiyang Medicinal Botanical Garden, on healthy leaves of Peristrophe japonica (Acanthaceae), 1 May 2022, Y.R. Sun, E33, living culture KUNCC 22-12591 = GUCC 21-0800.

Notes: Pestalotiopsis chamaeropis was originally reported on leaves of Chamaerops humilis in Italy by Maharachchikumbura et al. (13). Subsequently, many studies have proven that P. chamaeropis is a serious phytopathogen, which can cause diseases of Camellia sinensis and Camellia oleifera and Eurya nitida (in China), Erica arborea (in Tunisia), Japanese andromeda (in Japan), and Prostanthera rotundifolia (in Australia) (34, 49 –56). Park et al. (57) reported P. chamaeropis as an endophyte from the leaves of woody plants in Korea. In this study, our strain KUNCC 22-12591 is phylogenetically clustered with P. chamaeropis CBS 186.71 with good support (ML-BS = 100% and BYPP = 0.95), and it has overlapping characteristics with P. chamaeropis (CBS 186.71). Thus, we identify KUNCC 22-12591 as P. chamaeropis, representing a new host record.

(e) Pestalotiopsis dracontomelon Maharachch and K.D. Hyde. Material examined: Thailand, Chiang Rai Province, Mae Fah Luang University, leaf spots of Podocarpus sp. (Podocarpaceae), 15 January 2019, Y.R. Sun, S18 (MFLU 22-0166); living culture, MFLUCC 22-0122.

Notes: Pestalotiopsis dracontomelon was isolated from diseased leaves of Dracontomelon mangifera (Anacardiaceae) in Thailand (58). Our isolate MFLUCC 22-0122 was grouped with P. dracontomelon (MFLUCC 10-0149) in the phylogenetic tree. Morphologically, they have overlapping conidial measurements (19 to 26 × 5.5 to 8 μm for MFLUCC 22-0122 versus 18 to 23 × 5.5 to 7.5 μm for MFLUCC 10-0149). Therefore, we identify MFLUCC 22-0122 as the new host record of P. dracontomelon.

(f) Pestalotiopsis hispanica F. Liu, L. Cai, and Crous. Material examined: China, Guizhou Province, Guiyang City, Nanming District, Guiyang Medicinal Botanical Garden, on healthy leaves of Peristrophe japonica (Acanthaceae), 1 May 2022, Y.R. Sun, E53, living culture KUNCC 22-12595 = GUCC 21-0803; ibid., on healthy leaves of Peristrophe japonica, 1 May 2022, Y.R. Sun, E55, living culture KUNCC 22-12593 = GUCC 21-0802; ibid., on healthy leaves of Peristrophe japonica, 1 May 2022, Y.R. Sun, E52, living culture KUNCC 22-12594 = GUCC 21-0804.

Notes: Pestalotiopsis hispanica was originally reported on Proteaceae plants in Spain by Liu et al. (59). In this study, three strains were obtained from healthy leaves of Peristrophe japonica in China. These three strains grouped with P. hispanica (CBS 115391) with maximum support (ML-BS = 100% and BYPP = 1), and it has overlapping characteristics with P. hispanica (CBS 115391). Thus, we identify KUNCC 22-12594, KUNCC 22-12595, and KUNCC 22-12593 as P. hispanica, representing a new record.

(g) Pestalotiopsis hydei Huanraluek and Jayaward. Material examined: China, Guizhou Province, Qiannan Bouyei and Miao Autonomous Prefecture, Libo District, on dead twigs, 12 March 2022, J.E. Sun, L19-1, living culture, GUCC 21-0819.

Notes: Pestalotiopsis hydei was isolated from the leaf spots of Litsea petiolate in Thailand (60). Our isolate GUCC 21-0819 clustered together with P. hydei (MFLUCC 20-0135) in the phylogenetic tree. GUCC 21-0819 also has a similar conidial measurement to MFLUCC 20-0135 (19 to 26 × 4 to 6 μm in GUCC 21-0819, 18 to 35 × 3 to 6 μm in MFLUCC 20-0135). Additionally, there are only 3 bp different in the ITS and tef1-α genes. Therefore, we identify GUCC 21-0819 as a new geographical record of P. hydei.

Pseudopestalotiopsis Maharachch., K.D. Hyde, and Crous, Stud. Mycol. 79: 180 (2014).

(i) Phylogenetic analyses. The sequence data sets for ITS, tef1-α, and tub2 were analyzed in combination to infer the interspecific relationships within Pseudopestalotiopsis. The aligned sequence matrix consisted of 27 sequences, including two outgroups Pestalotiopsis trachycarpicola (IFRDCC 2240) and P. linearis (MFLUCC 12-0271). Similar tree topologies were obtained by ML and BYPP methods, and the most likely tree (−ln = 66,531.894) is presented (Fig. 14). Our collection is clustered with the type species of Pseudopestalotiopsis, P. theae, in the phylogenetic tree (Fig. 14).

FIG 14 — Maximum likelihood (RAxML) tree for *Pseudopestalotiopsis* based on analysis of a combined data set of *ITS*, *tef1-α*, and *tub2* and sequence data. The tree is rooted with *P. trachycarpicola* (IFRDCC 2240) and *P. linearis* (MFLUCC 12-0271). Bootstrap support values for ML greater than 75% and Bayesian posterior probabilities greater than 0.95 are given near nodes, respectively. The new isolates are in red, and the ex-type strains are in bold.

(ii) Taxonomy. (a) Pseudopestalotiopsis theae (Sawada) Maharachch., K.D. Hyde, and Crous. Material examined: Thailand, Suphan Buri Province, dead leaf of Ceriops tagal (Rhizophoraceae), 5 September 2020, S Wang, TN07 (MFLU 22-0169); living culture, MFLUCC 22-0128.

Notes: our isolate MFLUCC 22-0128 is phylogenetically grouped with the type species of Pseudopestalotiopsis, Ps. theae. Morphologically, our new collection MFLU 22-0169 resembles Ps. theae (MFLUCC 12-0055) in color and size of the conidiogenous cells, conidia, and appendages. Therefore, we report this isolate as a new host record of Ps. theae from Ceriops tagal.

DISCUSSION

During research of microfungi on medicinal plants in southwest China and Thailand, 26 pestalotioid strains representing 17 species were isolated from 16 medicinal plants. Four new Neopestalotiopsis species, namely, N. amomi, N. photiniae, N. suphanburiensis, and N. hyperici, three new Pestalotiopsis species, namely, P. chiangmaiensis, P. loeiana, and P. smilacicola, and eight new records are introduced. Among them, 10 species are related to leaf diseases of medicinal plants, 3 species are saprobes, 2 species are endophytes, and 1 species has various lifestyles. A worldwide checklist of pestalotioid species associated with medicinal plants is provided (Table 1). Among them, most are related to diseases of medicinal plants, and 47 (a total of 79) were found in China and Thailand. The analysis showed that the majority of pestalotioid species are associated with dicotyledonous medicinal plants (Fig. 15).

TABLE 1.

Checklist of pestalotioid species associated with medicinal plants

Species^a	Life mode^b	Disease (if any)	Host^c	Location	Reference
Neopestalotiopsis acrostichi	P	Leaf spot	Acrostichum aureum (F)	Thailand	67
Neopestalotiopsis alpapicalis	E		Rhyzophora mucronate (D)	Thailand	96
Neopestalotiopsis amomi	P	Leaf spot	Amomum villosum (M)	China	This study
Neopestalotiopsis brachiata	P	Leaf spot	Rhizophora apiculate (D)	Thailand	67
Neopestalotiopsis clavispora	P	Leaf spot, branch blight	Dendrobium officinale, Taxus×media (M/G)	China	97, 98
Neopestalotiopsis cubana	P	Leaf blight	Ixora chinensis (D)	Malaysia	99
Neopestalotiopsis dendrobii	E		Dendrobium cariniferum (M)	Thailand	41
Neopestalotiopsis ellipsospor	Unknown		Ardisia crenata (D)	Hong Kong, China	13
Neopestalotiopsis eucalypticola	Unknown		Eucalyptus globulus (D)	Unknown	13
Neopestalotiopsis eucalyptorum	P	Leaf necrosis, stem basal cankers	Eucalyptus globulus (D)	Fundão/Guarda/Portugal	22
Neopestalotiopsis formicarum	P	Leaf spot	Photinia serratifolia	China	This study
Neopestalotiopsis haikouensis	P	Leaf spot	Ilex chinensis (D)	China	17
Neopestalotiopsis hispanica	P	Leaves and stem necrosis	Eucalyptus globulus (D)	Fundão/Guarda/Spain	22
Neopestalotiopsis hydeana	P	Leaf spot	Alpinia malaccensis (M)	Thailand	60
Neopestalotiopsis hyperici	P	Leaf spot	Hypericum monogynum (D)	China	This study
Neopestalotiopsis iberica	P	Leaves and stem necrosis	Eucalyptus globulus (D)	Pegões/Portugal/Spain	22
Neopestalotiopsis longiappendiculata	P	Leaves and stem necrosis	Eucalyptus globulus/E. nitens (D)	Furadouro/Portugal	22
Neopestalotiopsis lusitanica	P	Leaves and stem necrosis	Eucalyptus globulus (D)	Pegões/Portugal	22
Neopestalotiopsis pernambucana	Unknown		Vismia guianensis (D)	Brazil	100
Neopestalotiopsis petila	P	Leaf spot	Rhizophora mucronate (D)	Thailand	67
Neopestalotiopsis photiniae	P	Leaf spot	Photinia serrulate (D)	China	This study
Neopestalotiopsis rhapidis	P	Leaf spot	Podocarpus macrophyllus (G)	China	This study
Neopestalotiopsis rhizophorae	P	Leaf spot	Rhizophora mucronate (D)	Thailand	67
Neopestalotiopsis rhododendri	P	Leaf spot	Dracaena fragrans (M)	Thailand	This study
Neopestalotiopsis rosae	Unknown		Paeonia suffruticosa (D)	United States	13
Neopestalotiopsis rosicola	P*	Stem canker	Rosa chinensis (D)	China	63
Neopestalotiopsis saprophytica	S		Litsea rotundifolia (D)	Hong Kong, China	13
Neopestalotiopsis surinamensis	E		Scurrula atropurpurea (D)	Indonesia	101, 102
Neopestalotiopsis thailandica	P	Leaf spot	Rhizophora mucronate (D)	Thailand	67
Pestalotiopsis adusta	E, P*	Leaf spot	Clerodendrum canescens/Sinopodophyllum hexandrum/Rubus idaeus (D)	China	103 – 105
Pestalotiopsis affinis	P	Leaf spot	Taxus chinensis (G)	China	106
Pestalotiopsis alpiniae	P	Leaf spot	Alpinia galanga (M)	China	106
Pestalotiopsis antiaris	P	Leaf spot	Antiaris toxicaria (M)	China	106
Pestalotiopsis bicilia	S		Viburnum opulus (D)	Canada	13
Pestalotiopsis biciliata	P*	Stem canker	Pistacia lentiscus (D)	Tunisia	107
Pestalotiopsis bicolor	S		Smilax sp. (M)	United States	108
Pestalotiopsis bruguierae	Unknown		Bruguiera gymnorhiza (D)	India	109
Pestalotiopsis bulbophylli	S		Bulbophyllum thouars (M)	China	110
Pestalotiopsis chamaeropis	E, P*	Leaf spot	Eurya nitida, Peristrophe japonica (D)	China	55, this study
Pestalotiopsis chiangmaiensis	P	Leaf strip	Bamboo (M)	Thailand	This study
Pestalotiopsis cruenta	Unknown		Polygonum lasianthum (D)	Japan	Index Fungorum (2022)
Pestalotiopsis digitalis	P	Leaf spot	Digitalis purpurea (D)	New Zealand	58
Pestalotiopsis dilleniae	P	Leaf spot	Dillenia turbinate (M)	China	106
Pestalotiopsis diploclisiae	Unknown		Diploclisia glaucescens (D)	Hong Kong, China	13
Pestalotiopsis dracaenae	S		Dracaena fragrans (M)	China	111
Pestalotiopsis ellipsospora	P*	Stem canker	Acanthopanax divaricatus (D)	Korea	112
Pestalotiopsis gibbosa	S		Gaultheria shallon (D)	United States	113
Pestalotiopsis heucherae	Unknown		Heuchera parviflora	United States	114
Pestalotiopsis hispanica	E		Peristrophe japonica	China	This study
Pestalotiopsis hughesii	Unknown		Cyperus articulates (M)	Ghana	115
Pestalotiopsis japonica	Unknown		Cedrela sinensis (D)	Japan	19
Pestalotiopsis jinchanghensis	E		Vaccinium dunalianum (D)	China	116
Pestalotiopsis kenyana	P*	Leaf spot	Zanthoxylum schinifolium (D)	China	117
Pestalotiopsis kunmingensis	E		Podocarpus macrophyllus (G)	China	68
Pestalotiopsis kwangsiensis	P	Leaf spot	Sinopimelodendron kuwangsiensis (D)	China	106
Pestalotiopsis lespedezae	Unknown		Lespedeza bicolor (D)	Japan	118
Pestalotiopsis linearis	E		Trachelospermum sp. (D)	China	24
Pestalotiopsis lushanensis	P*	Brown leaf spot, leaf blight	Sarcandra glabra, Podocarpus macrophyllus (G)	China	119
Pestalotiopsis microspora	S		Hedera helix (D)	Argentina	120
Pestalotiopsis moluccensis	Unknown		Xylocarpus moluccensis (D)	India	109
Pestalotiopsis neolitseae	P*	Leaf spot	Neolitsea villosa (D)	Taiwan, China	51
Pestalotiopsis oenotherae	Unknown		Oenothera laciniata (D)	United States	121
Pestalotiopsis pandani	Unknown		Pandanus odoratissimus (M)	Taiwan, China	108
Pestalotiopsis paraguariensis	Unknown		Ilex paraguariensis (D)	Brazil	122
Pestalotiopsis pestalozzioides	Unknown		Clematis ligusticifolia (D)	New Mexico	11
Pestalotiopsis pipericola	Unknown		Piper nigrum (D)	India	123
Pestalotiopsis quadriciliata	Unknown		Vitis vulpine (D)	Canada	124
Pestalotiopsis rhodomyrtus	Unknown		Rhodomyrtus tomentosa (D)	China	125
Pestalotiopsis smilacicola	P	Leaf spot	Smilax china, Dioscorea sp. (M)	Thailand	This study
Pestalotiopsis sinensis	Unknown		Ginkgo biloba (G)	China	126
Pestalotiopsis tecomicola	Unknown		Tecoma radicans (D)	United States	11
Pestalotiopsis thailandica	P	Leaf spot	Rhizophora apiculate (D)	Thailand	67
Pseudopestalotiopsisis ampullace	E		Magnolia candolli (D)	China	76
Pseudopestalotiopsis curvatispora	P	Leaf spot	Rhizophora mucronate (D)	Thailand	67
Pseudopestalotiopsis gilvanii	P*	Leaf spot	Paullinia cupana (D)	Brazil	47
Pseudopestalotiopsis indica	Unknown		Hibiscus rosa-sinensis (D)	India	13
Pseudopestalotiopsis simitheae	S, E		Pandanus odoratissimus/Magnolia candolli (M/D)	Thailand/China	76, 127
Pseudopestalotiopsis thailandica	P	Leaf spot	Rhizophora mucronate (D)	Thailand	67
Pseudoestalotiopsis theae	S		Ceriops tagal (D)	Thailand	This study

Open in a new tab

The checklist includes species names, life modes, disease names (if any), hosts, locations, and references. The current name is used according to Index Fungorum (2022).

The mode of life is given as endophyte (E), pathogen (P), and saprobe (S). For the species, those with confirmed pathogenicity data are marked with an asterisk (*).

The taxonomic status of the host is given as dicotyledons (D), ferns (F), gymnosperms (G), and monocotyledons (M).

FIG 15 — Distribution of pestalotioid species in different medicinal plants.

In this study, Neopestalotiopsis sp. 1 was isolated from healthy leaves of Pinellia ternata and dead leaves of Ceiba pentandra, and it was previously isolated from the leaf spots of Castanea mollissima (45). Pestalotiopsis chamaeropis was found as an endophyte from an important medicinal plant here. However, it was reported as a serious phytopathogen in different countries (34, 49 –51, 53 –56). Pestalotiopsis photiniae was reported as an endophytic fungus on the branches of Roystonea regia, and it also has been isolated from the diseased leaves of blueberries (61, 62). These seem to indicate that one fungus can be endophytic, pathogenic, or saprophytic in different (or the same) plants or organs. Understanding the external factors that influence the fungal lifestyle could have major implications for agriculture, industrial development, and human health.

It is worth noting that two Neopestalotiopsis species, N. amomi and N. hyperici introduced in this paper, do not match the characteristics of versicolorous median cells described in Neopestalotiopsis (13). This phenomenon was also mentioned by Liu et al. (27). The reason for this phenomenon probably could be the type of medium or the time of cultivation. However, there are not enough data to explain this phenomenon.

Neopestalotiopsis and Pseudopestalotiopsis were separated from Pestalotiopsis by Maharachchikumbura et al. (13) based on phylogenetic analyses and conidial color. After that, the number of species in Neopestalotiopsis increased from 24 to 73, and the number of species in Pseudopestalotiopsis increased from 3 to 23 (http://www.indexfungorum.org/, 10 Nov 2022). In recent years, there have been more reports on diseases caused by Neopestalotiopsis; for example, N. vitis caused grapevine leaf spots in China, N. rosicola caused stem canker of Rosa chinensis in China, N. clavispora caused leaf spots and fruit rot of strawberry in India, N. maddoxii caused flower diseases of Macadamia integrifolia in Australia, N. eucalyptorum was associated with disease of Eucalyptus plants in Portugal, and N. siciliana caused stem lesion and dieback on avocado plants in Italy (22, 23, 26, 29, 30, 63). However, only six Pseudopestalotiopsis species were reported as plant pathogens (47, 64 –67). In this study, there are nine Neopestalotiopsis species, and only one Pseudopestalotiopsis species was encountered. This seems to indicate that Neopestalotiopsis has richer species diversity, and the Neopestalotiopsis species are more likely to infect the plant and cause disease than Pseudopestalotiopsis. Comparing the differences between the two genera through whole-genome sequence analysis and finding related disease-causing genes would probably explain this phenomenon.

The interspecific morphological differences of pestalotioid species have been unclear. In their attempt to find a reliable criterion for interspecific differences, taxonomists have complicated the description of pestalotioid species (11, 13, 60, 68). In the past, the conidia were divided into apical cells, basal cells, and the three median cells when describing them. The three median cells were divided into the second cells from the base, third cells, and fourth cells, and every cell is measured. Obviously, the length of the three median cells is the sum length of the second, third, and fourth cells. Therefore, the descriptions are repeated. In addition, the characteristics of each cell were not treated as criteria for interspecies differences (11, 26, 27, 69). Therefore, we suggest removing the measurement for each cell to simplify the descriptions.

MATERIALS AND METHODS

Collection, examination, and isolation.

Fresh healthy leaves, diseased leaves, and twigs of different medicinal plants were collected from terrestrial habitats in southwest China and Thailand from 2019 to 2022. Samples were brought to the laboratory in Ziploc plastic bags or paper envelopes for examination. The fruiting bodies on natural substrates were observed and photographed using a stereomicroscope (SteREO Discovery, V12, Carl Zeiss Microscopy GmBH, Germany; VHX-7000, Keyence, Japan). Morphological characteristics were observed using a Nikon Eclipse Ni compound microscope (Nikon, Japan) and photographed with a Nikon DS-Ri2 digital camera (Nikon, Japan) or using a Carl Zeiss compound microscope (Carl Zeiss AG, Germany) and an Axiocam 208 color digital camera (Carl Zeiss AG, Germany). The photo plates were made with Adobe Photoshop CS6 Extended v. 13.0 software. Measurements were obtained with the Tarosoft (R) Image Frame Work software.

For endophytes, materials were washed under running tap water and immersed in 70% ethanol for 1 min, followed by soaking in 4% NaOCl for 1 min, rinsing three times in sterile distilled water, and drying on sterile filter paper. For the control, the final sterile water rinse was plated and observed during the postincubation period. The absence of any fungal (microbial) growth indicated that the leaf surface was sterile (70). The sterilized materials were cut into 2- to 5-mm² segments and placed on PDA containing 50 μg/mL penicillin and 50 μg/mL streptomycin (71). The plates were observed daily, and the mycelial growth on the edge of the fungal colonies was transferred to fresh PDA dishes to obtain pure cultures. For other samples, single-spore isolations were used to obtain pure cultures following the methods described by Senanayake et al. (72). Germinated conidia were transferred to fresh PDA plates and incubated at 25°C for 4 weeks. The pure cultures were deposited in Mae Fah Luang University Culture Collection (MFLUCC), Chiang Rai, Thailand, the Culture Collection of Kunming Institute of Botany, the Chinese Academy of Sciences (KUNCC), Kunming, China, and the Culture Collection of the Department of Plant Pathology, Agriculture College, Guizhou University (GUCC), Guiyang, China. Specimens were deposited in the herbarium of Mae Fah Luang University (MFLU) Chiang Rai, Thailand, and the Herbarium of Cryptogams, Kunming Institute of Botany, Academia Sinica (HKAS), Kunming, China. Facesoffungi (FoF) numbers were acquired as described by Jayasiri et al. (73). Taxonomic descriptions and nomenclature were deposited at Fungal Names (https://nmdc.cn/fungalnames/registe) following the description in reference 74.

DNA extraction, PCR amplification, and sequencing.

A Biomiga fungus genomic DNA extraction kit (Biomiga, USA) was used to extract DNA from fresh fungal mycelia, which were grown on PDA medium for 4 weeks at 25°C. PrepMan ultra sample preparation reagent (Thermo Fisher Scientific, Japan) was used to extract DNA directly from fruiting bodies. Three genes were selected in this study: the internal transcribed spacers (ITS), the translation elongation factor 1 (tef1-α), and the partial β-tubulin region (tub2). PCR was carried out in a 20-μL reaction volume, which contained 10 μL of 2× PCR master mix, 7 μL of double-distilled water (ddH₂O), 1 μL of each primer, and 1 μL of template DNA. The PCR thermal cycle program and primers are given in Table 2. Purification and sequencing of PCR products were carried out at SinoGenoMax (Beijing) Co., China.

TABLE 2.

Primers and PCR procedures used in this study

Locus	Primers		PCR procedures	Reference
Locus	Name	Sequence (5′ to 3′)	PCR procedures	Reference
ITS	ITS5	GGAAGTAAAAGTCGTAACAAGG	94°C 3 min; 94°C 30 s; 52°C 30 s; 72°C 1 min; repeat 2 to 4 for 35 cycles; 72°C 8 min; 4°C on hold	128
	ITS4	TCCTCCGCTTATTGATATGC
tef1-α	EF1-728F	CAT CGA GAA GTT CGA GAA GG	94°C 5 min; 94°C 30 s; 52°C 30 s; 72 °C 1 min; repeat 2 to 4 for 40 cycles; 72°C 8 min; 4°C on hold	129, 130
tef1-α	EF2	GGA RGT ACC AGT SAT CAT GTT		129, 130
tub2	T1	AACATGCGTGAGATTGTAAGT	95°C 3 min; 94°C 30 s; 55°C 50 s; 72°C 1 min; repeat 2 to 4 for 40 cycles; 72°C 8 min; 4°C on hold	131, 132
tub2	Bt2b	ACCCTCAGTGTAGTGACCCTTGGC		131, 132

Open in a new tab

Phylogenetic analyses.

Phylogenetic analyses and the preparatory work were carried out according to the method described in Dissanayake et al. (75). The sequences were compared against the NCBI GenBank nucleotide database using BLASTn to evaluate the closest phylogenetic matches. All sequences used in this study were downloaded from GenBank referring to previous studies (16, 23, 27, 30, 44, 65, 67, 76 –79) (Table 3). The single-gene sequences were checked with BioEdit v. 7.0.9.0 (80). Alignments for each locus were generated using MAFFT v.7 (https://mafft.cbrc.jp/alignment/server/) and were manually improved using AliView (81). The final single-gene alignments were combined by SequenceMatrix 1.7.8 (82). For the final alignment, see Data S1 in the supplemental material.

TABLE 3.

Taxa of the three genera Neopestalotiopsis, Pestalotiopsis, and Pseudopestalotiopsis used in the phylogenetic analysis with the corresponding GenBank accession numbers

Taxa^a	Strain/voucher no.	tef1-α ^b	tub2 ^b	ITS ^b
*Neopestalotiopsis acrostichi*	MFLUCC 17-1754	MK764316	MK764338	MK764272
*N. alpapicalis*	MFLUCC 17-2544	MK463547	MK463545	MK357772
*N. amomi*	HKAS 124563	OP653489	OP752133	OP498012
*N. amomi*	HKAS 124564	OP753382	OP765913	OP498013
*N. aotearoa*	CBS 367.54	KM199526	KM199454	KM199369
*N. asiatica*	MFLUCC 12-0286	JX399049	JX399018	JX398983
*N. australis*	CBS 114159	KM199537	KM199432	KM199348
*N. brachiata*	MFLUCC 17-1555	MK764318	MK764340	MK764274
*N. brasiliensis*	COAD 2166	MG692402	MG692400	MG686469
*N. camelliae-oleiferae*	CSUFTCC81	OK507955	OK562360	OK493585
N. camelliae-oleiferae	CSUFTCC82	OK507956	OK562361	OK493586
*N. cavernicola*	KUMCC 20-0269	MW550735	MW557596	MW545802
N. cavernicola	KUMCC 20-0332	MW590327	MW590328	MW581238
*N. chiangmaiensis*	MFLUCC 18-0113	MH388404	MH412725	NA
*N. chrysea*	MFLUCC 12-0261	JX399051	JX399020	JX398985
*N. clavispora*	MFLUCC 12-0281	JX399045	JX399014	JX398979
*N. cocoes*	MFLUCC 15-0152	KX789689	NA	NR_156312
*N. coffea-arabicae*	HGUP4015	KF412644	KF412641	KF412647
N. coffea-arabicae	HGUP4109	KF412646	KF412643	KF412649
*N. cubana*	CBS 600.96	KM199521	KM199438	KM199347
*N. dendrobii*	MFLUCC 14-0106	MK975829	MK975835	MK993571
N. dendrobii	MFLUCC 14-0132	MK975830	NA	MK993572
N. drenthii	BRIP 72264a	MZ344172	MZ312680	MZ303787
N. drenthii	BRIP 72263a	MZ344171	MZ312679	MZ303786
*N. ellipsospora*	MFLUCC 12-0283	JX399047	JX399016	JX398980
*N. egyptiaca*	CBS 140162	KP943748	KP943746	KP943747
*N. eucalypticola*	CBS 264.37	KM199551	KM199431	KM199376
N. eucalyptorum	PE194	MW805398	MW802831	MW794098
*N. eucalyptorum*	CBS 147684	MW805397	MW802841	MW794108
*N. foedans*	CGMCC 3.9123	JX399053	JX399022	JX398987
*N. formicarum*	CBS 362.72	KM199517	KM199455	KM199358
N. formicarum	CBS 115.83	KM199519	KM199444	KM199344
N. formicarum	GUCC 21-0809	OP753367	OP752132	OP498007
*N. guajavae*	FMB0026	MH460868	MH460871	MF783085
*N. guajavicola*	FMB0129	MH460870	MH460873	MH209245
*N. haikouensis*	SAUCC212271	OK104877	OK104870	OK087294
N. haikouensis	SAUCC212272	OK104878	OK104871	OK087295
N. hadrolaeliae	VIC 47180	MK465122	MK465120	MK454709
*N. hispanica*	CBS 147686	MW805399	MW802840	MW794107
*N. honoluluana*	CBS 114495	KM199548	KM199457	NR_145245
*N. hydeana*	MFLUCC 20-0132	MW251129	MW251119	MW266069
*N. hypericin*	KUNCC 22-12597	OP713768	OP765908	OP498010
N. hypericin	KUNCC 22-12598	OP737880	OP737883	OP498009
*N. iberica*	CBS 147688	MW805402	MW802844	MW794111
*N. iraniensis*	CBS 137768	KM074051	KM074057	KM074048
*N. javaensis*	CBS 257 31	KM199543	KM199437	NR_145241
*N. keteleeria*	MFLUCC 13-0915	KJ503822	KJ503821	KJ503820
*N. longiappendiculata*	MEAN 1315	MW805404	MW802845	MW794112
N. lusitanica	MEAN 1317	MW805406	MW802843	MW794110
N. lusitanica	MEAN 1320	MW805409	MW802830	MW794097
*N. macadamiae*	BRIP 63737c	KX186627	KX186654	NR_161002
*N. maddoxii*	BRIP 72266a	MZ344167	MZ312675	MZ303782
*N. magna*	MFLUCC 12-0652	KF582791	KF582793	KF582795
*N. mesopotamica*	CBS 336.86	KM199555	KM199441	KM199362
*N. musae*	MFLUCC 15-0776	KX789685	KX789686	NR_156311
*N. natalensis*	CBS 138.41	KM199552	KM199466	NR_156288
*N. nebuloides*	BRIP 66617	MK977633	MK977632	MK966338
*N. olumideae*	BRIP 72273a	MZ344175	MZ312683	MZ303790
*N. pandanicola*	KUMCC 17-0175	MH388389	MH412720	NA
*N. pernambucana*	GS 2014-RV01	KU306739	NA	KJ792466
*N. petila*	MFLUCC 17-1738	MK764319	MK764341	MK764275
*N. phangngaensis*	MFLUCC 18-0119	MH388390	MH412721	MH388354
*N. photiniae*	MFLUCC 22-0129	OP753368	OP752131	OP498008
N. photiniae	GUCC 21-0820	OP828691	OP896200	OP806524
N. perukae	FMB0127	MH523647	MH460876	MH209077
*N. piceana*	CBS 394.48	KM199527	KM199453	KM199368
*N. protearum*	CBS 114178	KM199542	KM199463	JN712498
*N. psidii*	FMB0028	MH460874	MH477870	MF783082
*N. rhapidis*	GUCC21501	MW980442	MW980441	MW931620
N. rhapidis	KUNCC 22-12590	OP753369	OP752134	OP498004
*N. rhizophorae*	MFLUCC 17-1550	MK764321	MK764343	MK764277
*N. rhododendri*	GUCC 21504	MW980444	MW980443	MW979577
N. rhododendri	MFLUCC 22-0130	OP753370	OP762671	OP497995
*N. rhododendricola*	KUN-HKAS-123204	OK274148	OK274147	OK283069
*N. rosae*	CBS 101057	KM199523	KM199429	KM199359
*N. rosicola*	CFCC 51992	KY885243	KY885245	KY885239
*N. samarangensis*	MFLUCC 12-0233	JQ968611	JQ968610	JQ968609
*N. saprophytica*	MFLUCC 12-0282	KM199538	KM199433	KM199345
N. saprophytica	GUCC 21506	MW980449	MW980447	MW979578
*N. sichuanensis*	CFCC 54338	MW199750	MW218524	MW166231
N. sichuanensis	SM15-1C	MW199751	MW218525	MW166232
*N. siciliana*	CBS 149117	ON107273	ON209162	ON117813
*N. sonneratae*	MFLUCC 17-1745	MK764323	MK764345	MK764279
*N. steyaertii*	IMI 192475	KF582792	KF582794	KF582796
*N. suphanburiensis*	MFLUCC 22-0126-	OP753372	OP752135	OP497994
*N. surinamensis*	CBS 450.74	KM199518	KM199465	KM199351
*N. thailandica*	MFLUCC 17-1730	MK764325	MK764347	MK764281
*N. umbrinospora*	MFLUCC 12-0285	JX399050	JX399019	JX398984
*N. vheenae*	BRIP 72293a	MZ344177	MZ312685	MZ303792
*N. vitis*	MFLUCC 15-1265	KU140676	KU140685	KU140694
N. zakeelii	BRIP 72282a	MZ344174	MZ312682	MZ303789
*N. zimbabwana*	CBS 111495	KM199545	KM199456	MH554855
Neopestalotiopsis sp. 1	CFCC 54337	MW199752	MW218526	MW166233
Neopestalotiopsis sp. 1	ZX12-1	MW199753	NA	MW166234
Neopestalotiopsis sp. 1	HKAS 124560	OP753364	OP752138	OP498005
Neopestalotiopsis sp. 1	KUNCC 22-12592	OP753365	OP752140	OP498006
Neopestalotiopsis sp. 1	GUCC 21-0808	OP753366	OP752139	OP498011
Neopestalotiopsis sp. 2	CFCC 54340	MW199754	MW218528	MW166235
Neopestalotiopsis sp. 2	ZX22B	MW199755	MW218529	MW166236
Neopestalotiopsis sp. 2	MFLUCC 22-0131	OP753371	OP752141	OP497996
Neopestalotiopsis sp. 2	KUNCC 22-12596	OP797834	OP752142	OP498003
*Pestalotiopsis adusta*	ICMP 6088	JX399070	JX399037	JX399006
P. adusta	MFLUCC 10-0146	JX399071	JX399038	JX399007
*P. aggestorum*	LC6301	KX895234	KX895348	KX895015
*P. anacardiacearum*	IFRDCC 2397	KC247156	KC247155	KC247154
*P. arceuthobii*	CBS 434.65	KM199516	KM199427	KM199341
*P. appendiculata*	CGMCC 3.23550	OP185509	OP185516	OP082431
*P. arengae*	CBS 331.92	KM199515	KM199426	KM199340
*P. australasiae*	CBS 114126	KM199499	KM199409	KM199297
P. australasiae	CBS 11141	KM199501	KM199410	KM199298
*P. australis*	CBS 114193	KM199475	KM199383	KM199332
*P. biciliata*	CBS 124463	KM199505	KM199399	KM199308
P. biciliata	CAA1011	MW959090	MW934601	MW969738
*P. brachiata*	LC2988	KX895150	KX895265	KX894933
P. brachiata	LC8189	KY464153	KY464163	KY464143
*P. brassicae*	CBS 170.26	KM199558	NA	KM199379
*P. camelliae*	MFLUCC 12-0277	JX399074	JX399041	JX399010
*P. camelliae-oleiferae*	CSUFTCC08	OK507963	OK562368	OK493593
P. camelliae-oleiferae	CSUFTCC09	OK507964	OK562369	OK493594
*P. cangshanensis*	CGMCC 3.23544	OP185510	OP185517	OP082426
*P. chamaeropis*	CBS 186.71	KM199473	KM199391	KM199326
P. chamaeropis	KUNCC 22-12591	OP753373	OP752130	OP497998
*P. chiangmaiensis*	MFLUCC 22-0127	OP753374	OP752137	OP497990
P. chiaroscuro	BRIP 72970	OK423753	OK423752	OK422510
*P. chinensis*	MFLUCC 12-0273	NA	NA	NR_111786
*P. clavata*	MFLUCC 12-0268	JX399056	JX399025	JX398990
*P. colombiensis*	CBS 118553	KM199488	KM199421	KM199307
*P. daliensis*	CGMCC 3.23548	OP185511	OP185518	OP082429
*P. digitalis*	ICMP 5434	NA	KP781883	KP781879
*P. diploclisiae*	CBS 115587	KM199486	KM199419	KM199320
*P. dilucida*	LC3232	KX895178	KX895293	KX894961
*P. diversiseta*	MFLUCC 12-0287	JX399073	JX399040	NR_120187
*P. dracaenae*	HGUP4037	MT598644	MT598645	NA
*P. dracaenicola*	MFLUCC 18-0913	MN962732	MN962733	MN962731
*P. dracontomelon*	MFUCC 10-0149	KP781880	NA	KP781877
P. dracontomelon	MFLUCC 22-0122	OP753375	OP762672	NA
P. endophytica	MFLUCC 18-0932	MW417119	NA	NR_172439
*P. ericacearum*	IFRDCC 2439	KC537814	KC537821	KC537807
P. etonensis	BRIP 66615	MK977635	MK977634	MK966339
*P. formosana*	NTUCC 17-009	MH809389	MH809385	MH809381
*P. furcata*	MFLUCC 12-0054	JQ683740	JQ683708	JQ683724
*P. fusoidea*	CGMCC 3.23545	OP185512	OP185519	OP082427
*P. gaultheria*	IFRD 411.014	KC537812	KC537819	KC537805
*P. gibbosa*	NOF 3175	LC311591	LC311590	LC311589
*P. grevilleae*	CBS 114127	KM199504	KM199407	KM199300
*P. hawaiiensis*	CBS 114491	KM199514	KM199428	KM199339
*P. hispanica*	CBS 115391	MH554399	MH554640	MH553981
P. peristrophes	KUNCC 22-12595	OP753381	OP765910	OP498001
P. peristrophes	KUNCC 22-12593	OP753378	OP737882	OP498000
P. peristrophes	KUNCC 22-12594	OP753380	OP765912	OP498002
*P. hydei*	MFLUCC 20-0135	MW251113	MW251112	NR_172003
P. hydei	GUCC 21-0816	OP753383	OP765909	OP753660
*P. hollandica*	CBS 265.33	KM199481	KM199388	KM199328
P. hollandica	MEAN 1091	MT374691	MT374703	MT374678
*P. humus*	CBS 336.97	KM199484	KM199420	KM199317
*P. hunanensis*	CSUFTCC15	OK507969	OK562374	OK493599
P. hunanensis	CSUFTCC18	OK507970	OK562375	OK493600
*P. iberica*	CAA1006	MW759039	MW759036	MW732249
*P. inflexa*	MFLUCC 12-0270	JX399072	JX399039	JX399008
*P. intermedia*	MFLUCC 12-0259	JX399059	JX399028	JX398993
*P. italiana*	MFLUCC 12-0657	KP781881	KP781882	KP781878
*P. jesteri*	CBS 109350	KM199554	KM199468	KM199380
*P. jiangxiensis*	LC4399	KX895227	KX895341	KX895009
*P. jinchanghensis*	LC6636	KX895247	KX895361	KX895028
*P. kandelicola*	NCYU 19-0355	MT563101	MT563099	MT560722
*P. kaki*	KNU-PT-1804	LC553555	LC552954	LC552953
*P. kenyana*	CBS 442.67	KM199502	KM199395	KM199302
P. kenyana	CBS 911.96	KM199503	KM199396	KM199303
*P. knightiae*	CBS 114138	KM199497	KM199408	KM199310
P. knightiae	CBS 111963	KM199495	KM199406	KM199311
*P. licualacola*	HGUP4057	KC481684	KC481683	KC492509
*P. linearis*	MFLUCC 12-0271	JX399058	JX399027	JX398992
*P. loeiana*	MFLUCC 22-0123	OP737881	OP713769	OP497988
*P. longiappendiculata*	LC3013	KX895156	KX895271	KX894939
*P. lushanensis*	LC4344	KX895223	KX895337	KX895005
P. lushanensis	LC8182	KY464146	KY464156	KY464136
*P. macadamiae*	BRIP 63738B	KX186621	KX186680	KX186588
*P. malayana*	CBS 102220	KM199482	KM199411	KM199306
*P. monochaeta*	CBS 144.97	KM199479	KM199386	KM199327
P. monochaeta	CBS 440.83	KM199480	KM199387	KM199329
*P. montellica*	MFLUCC 12-0279	JX399076	JX399043	JX399012
*P. nanjingensis*	CSUFTCC16	OK507972	OK562377	OK493602
P. nanjingensis	CSUFTCC20	OK507973	OK562378	OK493603
*P. nanningensis*	CSUFTCC10	OK507966	OK562371	OK493596
P. nanningensis	CSUFTCC11	OK507967	OK562372	OK493597
*P. neolitseae*	NTUCC 17-011	MH809391	MH809387	MH809383
*P. novae-hollandiae*	CBS 130973	KM199511	KM199425	KM199337
*P. oryzae*	CBS 353.69	KM199496	KM199398	KM199299
P. oryzae	CL107	MN022941	MN015425	MK156295
*P. papuana*	CBS 331.96	KM199491	KM199413	KM199321
P. papuana	MFLU 19-2764	MW192204	MW296942	MW114337
*P. parva*	CBS 265.37	KM199508	KM199404	KM199312
*P. pallidotheae*	MAFF 240993	LC311585	LC311584	NR_111022
*P. photinicola*	GZCC 16-0028	KY047662	KY047663	KY092404
*P. pinisp*	CBS 146841	MT374694	MT374706	MT374681
*P. portugalica*	CBS 393.48	KM199510	KM199422	KM199335
*P. rhizophorae*	MFLUCC 17-0416	MK764327	MK764349	MK764283
P. rhizophorae	MFLUCC 17-0417	MK764328	MK764350	MK764284
*P. rhododendri*	IFRDCC 2399	KC537811	KC537818	NR_120265
*P. rhodomyrtus*	HGUP4230	KF412645	KF412642	KF412648
P. rhodomyrtus	MG7	MZ126725	MZ126718	MZ089458
*P. rosarioides*	CGMCC 3.23549	OP185513	OP185520	OP082430
*P. rosea*	MFLUCC 12-0258	JX399069	JX399036	JX399005
*P. scoparia*	CBS 176.25	KM199478	KM199393	KM199330
*P. sequoiae*	MFLUCC 13-0399	NA	NA	NR_153271
*P. shandogensis*	JZB340038	MN626740	MN626729	MN625275
*P. shorea*	MFLUCC 12-0314	KJ503817	KJ503814	KJ503811
P. smilacicola	MFLUCC 22-0124	OP737879	OP762674	OP497989
*P. smilacicola*	MFLUCC 22-0125	OP753376	OP762673	OP497991
*P. spathulata*	CBS 356.86	KM199513	KM199423	KM199338
*P. spathuliappendiculata*	CBS 144035	MH554607	MH554845	MH554172
*P. suae*	CGMCC 3.23546	OP185514	OP185521	OP082428
*P. telopeae*	CBS 114161	KM199500	KM199403	KM199296
P. telopeae	CBS 114137	KM199559	KM199469	KM199301
*P. thailandica*	MFLUCC 17-1616	MK764329	MK764351	MK764285
P. thailandica	MFLUCC 17-1617	MK764329	MK764351	MK764285
*P. trachycarpicola*	IFRDCC 2240	JQ845946	JQ845945	NR_120109
*P. unicolor*	MFLUCC 12-0276	NA	JX399030	JX398999
*P. verruculosa*	MFLUCC 12-0274	JX399061	NA	JX398996
*P. yanglingensis*	LC4553	KX895231	KX895345	KX895012
Pestalotiopsis sp.	LC3637	KX895210	KX895324	KX894993
*Pseudopestalotiopsis ampullacea*	LC6618	KX895244	KX895358	KX895025
*Ps. annellata*	NTUCC 17-030	MT321988	MT321889	MT322087
*Ps. avicenniae*	MFLUCC 17-0434	MK764331	MK764353	MK764287
*Ps. camelliae-sinesis*	LC3490	KX895202	KX895316	KX894985
*Ps. chinensis*	LC3011	KX895154	KX895269	KX894937
*Ps. curvatispora*	MFLUCC 17-1722	MK764332	MK764354	MK764288
*Ps. cocos*	CBS 272.29	KM199553	KM199467	KM199378
*Ps. dawaina*	MM14 F0015	LC324752	LC324751	LC324750
*Ps. gilvanii*	INPA 2913	MN385957	MN385954	MN385951
Ps. gilvanii	INPA 2914	MN385958	MN385955	MN385952
*Ps. ignota*	NN 42909	KU500016	NA	KU500020
*Ps. indica*	CBS 459.78	KM199560	KM199470	KM199381
*Ps. ixorae*	NTUCC 17-001.1	MG816336	MG816326	MG816316
*Ps. kawthaungina*	MM14 F0083	LC324755	LC324754	LC324753
*Ps. kubahensis*	UMAS-KUB-P20	NA	NA	KT006749
*Ps. myanmarina*	NBRC 112264	LC114065	LC114045	LC114025
*Ps. rhizophorae*	MFLUCC 17-1560	MK764335	MK764357	MK764291
*Ps. simitheae*	MFLUCC 12-0121	KJ503818	KJ503815	KJ503812
*Ps. solicola*	CBS 386.97	MH554474	MH554715	NR_161086
*Ps. taiwanensis*	NTUCC 17-002.1	MG816339	MG816329	MG816319
*Ps. thailandica*	MFLUCC 17-1724	MK764336	MK764358	MK764292
*Ps. theae*	MFLUCC 12-0055	JQ683743	JQ683711	JQ683727
Ps. theae	NTUCC 18-067	MT321987	MT321888	MT322086
Ps. theae	MFLUCC 22-0128	OP753377	OP752136	OP497993
*Ps. vietnamensis*	NBRC 112252	LC114074	LC114054	LC114034

Open in a new tab

Ex-type strains are in bold, and the newly generated strains are indicated with underlining.

NA, not available.

The maximum likelihood (ML) analyses were carried out using IQ-TREE (83, 84) on the IQ-TREE web server (http://iqtree.cibiv.univie.ac.at, 1 Nov 2022) under partitioned models. The best-fit substitution models (Table 4) were determined by WIQ-TREE (85). Ultrafast bootstrap (BS) analyses were implemented with 1,000 replicates (86, 87).

TABLE 4.

The best-fit evolutionary models used in our phylogenetic analyses

Data set	Method	Model
Data set	Method	tef1-α	tub2	ITS
Neopestalotiopsis	ML	HKY+F+G4	TNe+I+G4	TIM2+F+I+G4
Neopestalotiopsis	BYPP	GTR+I+G	GTR+I+G	GTR+I+G
Pestalotiopsis	ML	TN+F+I+G4	K2P+I+G4	TPM3u+F+I+G4
Pestalotiopsis	BYPP	GTR+I+G	GTR+I+G	GTR+I+G
Pseudopestalotiopsis	ML	TIM+F+I+G4	GTR+F+I+G4	TIM2+I+G4
Pseudopestalotiopsis	BYPP	GTR+I+G	GTR+I+G	GTR+I+G

Open in a new tab

The Bayesian posterior probability (BYPP) analyses were performed in CIPRES (88) with MrBayes on XSEDE 3.2.7a (89). MrModeltest 2.2 (90) was used to evaluate the best nucleotide substitution models (Table 4) for the data. The Markov chain Monte Carlo (MCMC) sampling approach was used to calculate posterior probabilities (PP) (91). Six simultaneous Markov chains were run for 10 million generations, and trees were sampled every 1,000th generation. The first 20% of trees, representing the burn-in phase of the analyses, were discarded, and the remaining trees were used for calculating posterior probabilities in the majority rule consensus tree.

The final phylogenetic trees were viewed with FigTree v1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/) and were modified in Microsoft Office PowerPoint 2010.

Genealogical concordance phylogenetic species recognition analysis.

Genealogical concordance phylogenetic species recognition was used to analyze the new species, their species boundaries, and their most closely related taxa, as described by Quaedvlieg et al. (92). The pairwise homoplasy index (PHI) test (93) was performed in SplitsTree4 (94, 95). If the PHI is above 0.05 threshold (Фw > 0.05), it indicates that there is no significant recombination present in the data set. The relationships between closely related species were visualized in splits graphs with both the Log-Det transformation and splits decomposition options.

Data availability.

The sequences generated in this study can be found in GenBank. The accession numbers of the sequences deposited in GenBank are listed in Table 3.

Supplementary Material

Reviewer comments

reviewer-comments.pdf^{(8.2MB, pdf)}

ACKNOWLEDGMENTS

We thank Shaun Pennycook for checking the nomenclature. We thank Abhaya Balasuriya, the Onsite Visiting Scholars for World Class Research Collaboration Program under the Reinventing University System Project sponsored by Ministry of Higher Education, Science, Research and Innovation, Thailand. Y.R.S. thanks Mae Fah Luang University for the award of a fee-less scholarship. Y.R.S. also thanks Jing-Yi Zhang and Song Wang for collecting the samples. The study was funded by Guizhou Science Technology Department International Cooperation Basic Project ([2018]5806), National Natural Science Foundation of China (31972222 and 31560489), Program of Introducing Talents of Discipline to Universities of China (111 Program, D20023), and Talent project of Guizhou Science and Technology Cooperation Platform ([2017]57885, [2019]5641, and [2020]5001).

We declare no conflicts of interest.

Footnotes

Supplemental material is available online only.

Supplemental file 1

Supplemental material. Download spectrum.03987-22-s0001.pdf, PDF file, 0.5 MB^{(479.9KB, pdf)}

Contributor Information

Y. Wang, Email: yongwangbis@aliyun.com.

Florian M. Freimoser, Agroscope

Ishara Manawasinghe, Zhongkai University of Agriculture and Engineering.

REFERENCES

1.Rasool-Hassan BA. 2012. Medicinal plants (importance and uses). Pharm Anal Acta 3:2153–2435. doi: 10.4172/2153-2435.1000e139. [DOI] [Google Scholar]
2.Rasool A, Bhat KM, Sheikh AA, Jan A, Hassan S. 2020. Medicinal plants: role, distribution and future. J Pharmacogn Phytochem 9:2111–2114. [Google Scholar]
3.David B, Wolfender JL, Dias DA. 2015. The pharmaceutical industry and natural products: historical status and new trends. Phytochem Rev 14:299–315. doi: 10.1007/s11101-014-9367-z. [DOI] [Google Scholar]
4.Guo SX. 2016. Endophytic fungi biology of medicinal plant. Science Press, Beijing, China. [Google Scholar]
5.Jia M, Chen L, Xin HL, Zheng CJ, Rahman K, Han T, Qin LP. 2016. A friendly relationship between endophytic fungi and medicinal plants: a systematic review. Front Microbiol 7:906. doi: 10.3389/fmicb.2016.00906. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Weber D, Sterner O, Anke T, Gorzalczancy S, Martino V, Acevedo C. 2004. Phomol, a new antiinflammatory metabolite from an endophyte of the medicinal plant Erythrina crista-galli. J Antibiot (Tokyo) 57:559–563. doi: 10.7164/antibiotics.57.559. [DOI] [PubMed] [Google Scholar]
7.Sun J, Guo L, Zang W, Ping W, Chi D. 2008. Diversity and ecological distribution of endophytic fungi associated with medicinal plants. Sci China C Life Sci 51:751–759. doi: 10.1007/s11427-008-0091-z. [DOI] [PubMed] [Google Scholar]
8.Abtahi F, Nourani SL. 2017. The most important fungal diseases associated with some useful medicinal plants, p 279–293. In Ghorbanpour M, Varma A (ed), Medicinal plants and environmental challenges. Springer International Publishing, Cham, Switzerland. doi: 10.1007/978-3-319-68717-9_16. [DOI] [Google Scholar]
9.Keshri PK, Rai N, Verma A, Kamble SC, Barik S, Mishra P, Singh SK, Salvi P, Gautam V. 2021. Biological potential of bioactive metabolites derived from fungal endophytes associated with medicinal plants. Mycol Progress 20:577–594. doi: 10.1007/s11557-021-01695-8. [DOI] [Google Scholar]
10.Guba EF. 1961. Monograph of Pestalotia and Monochaetia. Harvard University Press, Cambridge, MA. [Google Scholar]
11.Nag Raj TR. 1993. Coelomycetous anamorphs with appendage-bearing conidia. Mycologue Publications, Waterloo, ON. [Google Scholar]
12.Hyde KD, Nilsson RH, Alias SA, Ariyawansa HA, Blair JE, Cai L, de Cock AWAM, Dissanayake AJ, Glockling SL, Goonasekara ID, Gorczak M, Hahn M, Jayawardena RS, van Kan JAL, Laurence MH, Lévesque CA, Li XH, Liu JK, Maharachchikumbura SSN, Manamgoda DS, Martin FN, McKenzie EHC, McTaggart AR, Mortimer PE, Nair PVR, Pawłowska J, Rintoul TL, Shivas RG, Spies CFJ, Summerell BA, Taylor PWJ, Terhem RB, Udayanga D, Vaghefi N, Walther G, Wilk M, Wrzosek M, Xu JC, Yan JY, Zhou N. 2014. One stop shop: backbones trees for important phytopathogenic genera: I (2014). Fungal Divers 67:21–125. doi: 10.1007/s13225-014-0298-1. [DOI] [Google Scholar]
13.Maharachchikumbura SSN, Hyde KD, Groenewald JZ, Xu J, Crous PW. 2014. Pestalotiopsis revisited. Stud Mycol 79:121–186. doi: 10.1016/j.simyco.2014.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Jayawardena RS, Hyde KD, McKenzie EHC, Jeewon R, Phillips AJL, Perera RH, de Silva NI, Maharachchikumburua SSN, Samarakoon MC, Ekanayake AH, Tennakoon DS, Dissanayake AJ, Norphanphoun C, Lin C, Manawasinghe IS, Tian Q, Brahmanage R, Chomnunti P, Hongsanan S, Jayasiri SC, Halleen F, Bhunjun CS, Karunarathna A, Wang Y. 2019. One stop shop III: taxonomic update with molecular phylogeny for important phytopathogenic genera: 51–75 (2019). Fungal Divers 98:77–160. doi: 10.1007/s13225-019-00433-6. [DOI] [Google Scholar]
15.Jayawardena RS, Hyde KD, de Farias ARG, Bhunjun CS, Ferdinandez HS, Manamgoda DS, Udayanga D, Herath IS, Thambugala KM, Manawasinghe IS, Gajanayake AJ, Samarakoon BC, Bundhun D, Gomdola D, Huanraluek N, Sun YR, Tang X, Promputtha I, Thines M. 2021. What is a species in fungal plant pathogens? Fungal Divers 109:239–266. doi: 10.1007/s13225-021-00484-8. [DOI] [Google Scholar]
16.Gu R, Bao DF, Shen HW, Su XJ, Li YX, Luo ZL. 2022. Endophytic Pestalotiopsis species associated with Rhododendron in Cangshan Mountain, Yunnan Province. Front Microbiol 13:1016782. doi: 10.3389/fmicb.2022.1016782. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Zhang Z, Liu R, Liu S, Mu T, Zhang X, Xia J. 2022. Morphological and phylogenetic analyses reveal two new species of Sporocadaceae from Hainan, China. MycoKeys 88:171–192. doi: 10.3897/mycokeys.88.82229. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Moreau C. 1949. Micomycetes africains. I. Revue de Mycologie, Suppliment Colonial (Paris) 14:15–22. [Google Scholar]
19.Steyaert RL. 1949. Contribution à l’étude monographique de Pestalotia de Not. et Monochaetia Sacc. (Truncatella gen. nov. et Pestalotiopsis gen. nov.). Bulletin du Jardin botanique de l'État a Bruxelles 19:285–354. [Google Scholar]
20.Guba EF. 1956. Monochaetia and Pestalotia vs. Truncatella, Pestalotiopsis and Pestalotia. Ann Microbiol 7:74–76. [Google Scholar]
21.Sutton BC. 1980. The Coelomycetes. Fungi imperfecti with pycnidia, acervuli and stromata. Commonwealth Mycological Institute, Kew, Surrey, UK. [Google Scholar]
22.Diogo E, Gonçalves CI, Silva AC, Valente C, Bragança H, Phillips AJL. 2021. Five new species of Neopestalotiopsis associated with diseased Eucalyptus spp. in Portugal. Mycol Progress 20:1441–1456. doi: 10.1007/s11557-021-01741-5. [DOI] [Google Scholar]
23.Prasannath K, Shivas RG, Galea VJ, Akinsanmi OA. 2021. Neopestalotiopsis species associated with flower diseases of Macadamia integrifolia in Australia. J Fungi 7:771. doi: 10.3390/jof7090771. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Zhang YM, Maharachchikumbura SSN, Mckenzie EHC, Hyde KD. 2012. A novel species of Pestalotiopsis causing leaf spots of Trachycarpus fortunei. Cryptogam Mycol 33:311–318. doi: 10.7872/crym.v33.iss3.2012.311. [DOI] [Google Scholar]
25.Maharachchikumbura SSN, Guo LD, Chukeatirote E, McKenzie EHC, Hyde KD. 2013. A destructive new disease of Syzygium samarangense in Thailand caused by the new species Pestalotiopsis samarangensis. Trop Plant Pathol 38:227–235. doi: 10.1590/S1982-56762013005000002. [DOI] [Google Scholar]
26.Jayawardena RS, Liu M, Maharachchikumbura SSN, Zhang W, Xing QK, Hyde KD, Nilthong S, Li XH, Yan JY. 2016. Neopestalotiopsis vitis sp. nov. causing grapevine leaf spot in China. Phytotaxa 258:63–74. doi: 10.11646/phytotaxa.258.1.4. [DOI] [Google Scholar]
27.Liu F, Hou LW, Raza M, Cai L. 2017. Pestalotiopsis and allied genera from Camellia, with description of 11 new species from China. Sci Rep 7:866. doi: 10.1038/s41598-017-00972-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Yang LN, Miao XY, Bai QR, Wang MQ, Gu ML, Zhao TC. 2017. Neopestalotiopsis clavispora causing leaf spot on Phedimus aizoon var. latifolius, a new disease in China. Plant Dis 101:1952. doi: 10.1094/PDIS-03-17-0422-PDN. [DOI] [Google Scholar]
29.Mahapatra S, Banerjee J, Kumar K, Pramanik S, Pramanik K, Islam S, Das S. 2018. Leaf spot and fruit rot of strawberry caused by Neopestalotiopsis clavispora in Indo-Gangetic plains of India. Indian Phytopathol 71:279–283. doi: 10.1007/s42360-018-0043-x. [DOI] [Google Scholar]
30.Fiorenza A, Gusella G, Aiello D, Polizzi G, Voglmayr H. 2022. Neopestalotiopsis siciliana sp. nov. and N. rosae causing stem lesion and dieback on avocado plants in Italy. J Fungi 8:562. doi: 10.3390/jof8060562. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Joshi SD, Sanjay R, Baby UI, Mandal A. 2009. Molecular characterization of Pestalotiopsis spp. associated with tea (Camellia sinensis) in southern India using RAPD and ISSR markers. Indian J Biotechnol 8:377–383. [Google Scholar]
32.Horikawa T. 1986. Yield loss of new tea shoots due to grey blight caused by Pestalotia longiseta Spegazzini. Bull Shizuoka Tea Exp Stn 12:1–8. [Google Scholar]
33.Biju CN, Peeran MF, Gowri R. 2018. Identification and characterization of Neopestalotiopsis clavispora associated with leaf blight of small cardamom (Elettaria cardamomum Maton). J Phytopathol 166:532–546. doi: 10.1111/jph.12715. [DOI] [Google Scholar]
34.Wang RB, Chen SZ, Zheng BW, Liu PQ, Li B, Weng QY, Chen QH. 2019. Occurrence of leaf spot disease caused by Neopestalotiopsis clavispora on Taxus chinensis in China. For Path 49:e12540. doi: 10.1111/efp.12540. [DOI] [Google Scholar]
35.Li L, Yang Q, Li H. 2021. Morphology, phylogeny, and pathogenicity of pestalotioid species on Camellia oleifera in China. J Fungi 7:1080. doi: 10.3390/jof7121080. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Huang WY, Cai YZ, Hyde KD, Corke H, Sun M. 2008. Biodiversity of endophytic fungi associated with 29 traditional Chinese medicinal plants. Fungal Divers 33:61–75. [Google Scholar]
37.Schafhauser T, Jahn L, Kirchner N, Kulik A, Flor L, Lang A, Caradec T, Fewer DP, Sivonen K, van Berkel WJH, Jacques P, Weber T, Gross H, van Pée K-H, Wohlleben W, Ludwig-Müller J. 2019. Antitumor astins originate from the fungal endophyte Cyanodermella asteris living within the medicinal plant Aster tataricus. Proc Natl Acad Sci USA 116:26909–26917. doi: 10.1073/pnas.1910527116. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Xu J, Ebada SS, Proksch P. 2010. Pestalotiopsis a highly creative genus: chemistry and bioactivity of secondary metabolites. Fungal Divers 44:15–31. doi: 10.1007/s13225-010-0055-z. [DOI] [Google Scholar]
39.Xu J, Yang XB, Lin Q. 2014. Chemistry and biology of Pestalotiopsis-derived natural products. Fungal Divers 66:37–68. doi: 10.1007/s13225-014-0288-3. [DOI] [Google Scholar]
40.Reddy MS, Murali T, Suryanarayanan TS, Rajulu MBG, Thirunavukkarasu N. 2016. Pestalotiopsis species occur as generalist endophytes in trees of Western Ghats forests of southern India. Fungal Ecol 24:70–75. doi: 10.1016/j.funeco.2016.09.002. [DOI] [Google Scholar]
41.Ma XY, Maharachchikumbura SSN, Chen BW, Hyde KD, Mckenzie EHC, Chomnunti P, Kang JC. 2019. Endophytic pestalotiod taxa in Dendrobium orchids. Phytotaxa 419:268–286. doi: 10.11646/phytotaxa.419.3.2. [DOI] [Google Scholar]
42.Kumaran RS, Kim HJ, Hur BK. 2010. Taxol promising fungal endophyte, Pestalotiopsis species isolated from Taxus cuspidata. J Biosci Bioeng 110:541–546. doi: 10.1016/j.jbiosc.2010.06.007. [DOI] [PubMed] [Google Scholar]
43.He YK, Yang Q, Sun YR, Zeng XY, Jayawardena RS, Hyde KD, Wang Y. 2022. Additions to Neopestalotiopsis (Amphisphaeriales, Sporocadaceae) fungi: two new species and one new host record from China. Biodivers Data J 10:e90709. doi: 10.3897/BDJ.10.e90709. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Yang Q, Zeng XY, Yuan J, Zhang Q, He YK, Wang Y. 2021. Two new species of Neopestalotiopsis from southern China. Biodivers Data J 9:e70446. doi: 10.3897/BDJ.9.e70446. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Jiang N, Fan XL, Tian CM. 2021. Identification and characterization of leaf-inhabiting fungi from Castanea plantations in China. J Fungi 7:64. doi: 10.3390/jof7010064. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Pornsuriya C, Chairin T, Thaochan N, Sunpapao A. 2020. Identification and characterization of Neopestalotiopsis fungi associated with a novel leaf fall disease of rubber trees (Hevea brasiliensis) in Thailand. J Phytopathol 168:416–427. doi: 10.1111/jph.12906. [DOI] [Google Scholar]
47.Gualberto GF, Catarino A, Sousa TF, da Cruz J, Hanada RE, Caniato FF, da Silva G. 2021. Pseudopestalotiopsis gilvanii sp. nov. and Neopestalotiopsis formicarum leaves spot pathogens from guarana plant: a new threat to global tropical hosts. Phytotaxa 489:121–139. doi: 10.11646/phytotaxa.489.2.2. [DOI] [Google Scholar]
48.Lin YZ, Chang TD, Wen CJ, Tsai SH, Lin YH. 2022. First report of leaf brown blight caused by Neopestalotiopsis formicarum on jabuticaba in Taiwan. Plant Dis 106:2527. doi: 10.1094/PDIS-07-21-1414-PDN. [DOI] [PubMed] [Google Scholar]
49.Moslemi A, Taylor PWJ. 2015. Pestalotiopsis chamaeropis causing leaf spot disease of round leaf mint-bush (Prostanthera rotundifolia) in Australia. Australas Plant Dis Notes 10:29. doi: 10.1007/s13314-015-0179-9. [DOI] [Google Scholar]
50.Jiang YL, Zhou YK, Ma KZ, Mao YL, Yu XT, Liu Y, Hou CL. 2017. Identification of several strains of Pestalotiopsis-like fungi from Camellia oleifera. J Anhui Agric Univ 44:609–616. [Google Scholar]
51.Ariyawansa HA, Hyde KD. 2018. Additions to Pestalotiopsis in Taiwan. Mycosphere 9:999–1013. doi: 10.5943/mycosphere/9/5/4. [DOI] [Google Scholar]
52.Hlaiem S, Zouaoui-Boutiti M, Ben Jemâa ML, Rocca GD, Barberini S, Danti R. 2018. Identification and pathogenicity of Pestalotiopsis chamaeropis, causal agent of white heather (Erica arborea) dieback, and in vitro biocontrol with the antagonist Trichoderma sp. Tunis J Plant Prot 13:49–60. [Google Scholar]
53.Nozawa S, Seto Y, Watanabe K. 2019. First report of leaf blight caused by Pestalotiopsis chamaeropis and Neopestalotiopsis sp. in Japanese andromeda. J Gen Plant Pathol 85:449–452. doi: 10.1007/s10327-019-00868-4. [DOI] [Google Scholar]
54.Chen YJ, Wan YH, Zeng L, Meng Q, Yuan LY, Tong HR. 2021. Characterization of Pestalotiopsis chamaeropis causing gray blight disease on tea leaves (Camellia sinensis) in Chongqing, China. Can J Plant Pathol 43:413–420. doi: 10.1080/07060661.2020.1816582. [DOI] [Google Scholar]
55.Qiu L, Liu J, Kuang W, Zhang K, Ma J. 2022. First report of Pestalotiopsis chamaeropis causing leaf spot on Eurya nitida in China. Plant Dis 106:329. doi: 10.1094/PDIS-06-21-1170-PDN. [DOI] [PubMed] [Google Scholar]
56.Santos J, Hilário S, Pinto G, Alves A. 2022. Diversity and pathogenicity of pestalotioid fungi associated with blueberry plants in Portugal, with description of three novel species of Neopestalotiopsis. Eur J Plant Pathol 162:539–555. doi: 10.1007/s10658-021-02419-0. [DOI] [Google Scholar]
57.Park H, Shim JS, Kim JS, Choi HS, Eom AH. 2017. Five previously unreported endophytic fungi isolated from the leaves of woody plants in Korea. Kor J Mycol 45:345–354. [Google Scholar]
58.Liu JK, Hyde KD, Jones EBG, Ariyawansa HA, Bhat DJ, Boonmee S, Maharachchikumbura SSN, McKenzie EHC, Phookamsak R, Phukhamsakda C, Shenoy BD, Abdel-Wahab MA, Buyck B, Chen J, Chethana KWT, Singtripop C, Dai DQ, Dai YC, Daranagama DA, Dissanayake AJ, Doilom M, D’Souza MJ, Fan XL, Goonasekara ID, Hirayama K, Hongsanan S, Jayasiri SC, Jayawardena RS, Karunarathna SC, Li WJ, Mapook A, Norphanphoun C, Pang KL, Perera RH, Peršoh D, Pinruan U, Senanayake IC, Somrithipol S, Suetrong S, Tanaka K, Thambugala KM, Tian Q, Tibpromma S, Udayanga D, Wijayawardene NN, Wanasinghe D, Wisitrassameewong K, Zeng XY, Abdel-Aziz FA, Adamčík S, et al. 2015. Fungal diversity notes 1–110: taxonomic and phylogenetic contributions to fungal species. Fungal Divers 72:1–197. doi: 10.1007/s13225-015-0324-y. [DOI] [Google Scholar]
59.Liu F, Bonthond G, Groenewald JZ, Cai L, Crous PW. 2019. Sporocadaceae, a family of coelomycetous fungi with appendage-bearing conidia. Stud Mycol 92:287–415. doi: 10.1016/j.simyco.2018.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Huanaluek N, Jayawardena RS, Maharachchikumbura SS, Harishchandra DL. 2021. Additions to pestalotioid fungi in Thailand: Neopestalotiopsis hydeana sp. nov. and Pestalotiopsis hydei sp. nov. Phytotaxa 479:23–43. doi: 10.11646/phytotaxa.479.1.2. [DOI] [Google Scholar]
61.Chen CQ, Zhang B, Yang L, Gao J. 2011. Identification and biological characteristics of round leaf spot on blueberry caused by Pestalotiopsis photiniae. J Northeast for Univ 39:95–98. [Google Scholar]
62.Ding G, Qi Y, Liu S, Guo L, Chen X. 2012. Photipyrones A and B, new pyrone derivatives from the plant endophytic fungus Pestalotiopsis photiniae. J Antibiot 65:271–273. doi: 10.1038/ja.2012.14. [DOI] [PubMed] [Google Scholar]
63.Jiang N, Bonthond G, Fan XL, Tian CM. 2018. Neopestalotiopsis rosicola sp. nov. causing stem canker of Rosa chinensis in China. Mycotaxon 133:271–283. doi: 10.5248/133.271. [DOI] [Google Scholar]
64.Maharachchikumbura SSN, Guo LD, Liu ZY, Hyde KD. 2016. Pseudopestalotiopsis ignota and Ps. camelliae spp. nov. associated with grey blight disease of tea in China. Mycol Prog 15:22. doi: 10.1007/s11557-016-1162-3. [DOI] [Google Scholar]
65.Nozawa S, Yamaguchi K, Hoang Yen LT, Van Hop D, Phay N, Ando K, Watanabe K. 2017. Identification of two new species and a sexual morph from the genus Pseudopestalotiopsis. Mycoscience 58:328–337. doi: 10.1016/j.myc.2017.02.008. [DOI] [Google Scholar]
66.Nozawa S, Ando K, Phay N, Watanabe K. 2018. Pseudopestalotiopsis dawaina sp. nov. and Ps. kawthaungina sp. nov.: two new species from Myanmar. Mycol Progress 17:865–870. doi: 10.1007/s11557-018-1398-1. [DOI] [Google Scholar]
67.Norphanphoun C, Jayawardena RS, Chen Y, Wen TC, Meepol W, Hyde KD. 2019. Morphological and phylogenetic characterization of novel pestalotioid species associated with mangroves in Thailand. Mycosphere 10:531–578. doi: 10.5943/mycosphere/10/1/9. [DOI] [Google Scholar]
68.Wei JG, Xu T. 2004. Pestalotiopsis kunmingensis sp. nov., an endophyte from Podocarpus macrophyllus. Fungal Divers 15:247–254. [Google Scholar]
69.Maharachchikumbura SSN, Guo LD, Cai L, Chukeatirote E, Wu WP, Sun X, Crous PW, Bhat DJ, McKenzie EHC, Bahkali AH, Hyde KD. 2012. A multi-locus backbone tree for Pestalotiopsis, with a polyphasic characterization of 14 new species. Fungal Divers 56:95–129. doi: 10.1007/s13225-012-0198-1. [DOI] [Google Scholar]
70.Kjer J, Debbab A, Aly AH, Proksch P. 2010. Methods for isolation of marine-derived endophytic fungi and their bioactive secondary products. Nat Protoc 5:479–490. doi: 10.1038/nprot.2009.233. [DOI] [PubMed] [Google Scholar]
71.Otero JT, Ackerman JD, Bayman P. 2002. Diversity and host specificity of endophytic Rhizoctonia—like fungi from tropical orchids. Am J Bot 89:1852–1858. doi: 10.3732/ajb.89.11.1852. [DOI] [PubMed] [Google Scholar]
72.Senanayake IC, Rathnayake AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Jayawardena RS, Wanasinghe DN, Jeewon R, Bhat DJ, Xiang MM. 2020. Morphological approaches in studying fungi: collection, examination, isolation, sporulation and preservation. Mycosphere 11:2678–2754. doi: 10.5943/mycosphere/11/1/20. [DOI] [Google Scholar]
73.Jayasiri SC, Hyde KD, Ariyawansa HA, Bhat J, Buyck B, Cai L, Dai YC, Abd-Elsalam KA, Ertz D, Hidayat I, Jeewon R, Jones EBG, Bahkali AH, Karunarathna SC, Liu JK, Luangsa-Ard JJ, Lumbsch HT, Maharachchikumbura SSN, McKenzie EHC, Moncalvo JM, Ghobad-Nejhad M, Nilsson H, Pang KL, Pereira OL, Phillips AJL, Raspé O, Rollins AW, Romero AI, Etayo J, Selçuk F, Stephenson SL, Suetrong S, Taylor JE, Tsui CKM, Vizzini A, Abdel-Wahab MA, Wen TC, Boonmee S, Dai DQ, Daranagama DA, Dissanayake AJ, Ekanayaka AH, Fryar SC, Hongsanan S, Jayawardena RS, Li WJ, Perera RH, Phookamsak R, de Silva NI, Thambugala KM, et al. 2015. The Faces of Fungi database: fungal names linked with morphology, phylogeny and human impacts. Fungal Divers 74:3–18. doi: 10.1007/s13225-015-0351-8. [DOI] [Google Scholar]
74.Wang F, Wang K, Cai L, Zhao MJ, Kirk PM, Fan GM, Sun QL, Li B, Wang S, Yu ZF. 2022. Fungal names: a comprehensive nomenclatural repository and knowledge base for fungal taxonomy. Nucleic Acids Res doi: 10.1093/nar/gkac926. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Dissanayake AJ, Bhunjun CS, Maharachchikumbura SSN, Liu JK. 2020. Applied aspects of methods to infer phylogenetic relationships amongst fungi. Mycosphere 11:2652–2676. doi: 10.5943/mycosphere/11/1/18. [DOI] [Google Scholar]
76.de Silva N, Maharachchikumbura SSN, Thambugala KM, Bhat DJ, Karunarathna SC, Tennakoon DS, Phookamsak R, Jayawardena RS, Lumyong S, Hyde KD. 2021. Morpho-molecular taxonomic studies reveal a high number of endophytic fungi from Magnolia candolli and M. garrettii in China and Thailand. Mycosphere 12:163–237. doi: 10.5943/mycosphere/12/1/3. [DOI] [Google Scholar]
77.Maharachchikumbura SSN, Larignon P, Hyde KD, Al-Sadi AM, Liu ZY. 2016. Characterization of Neopestalotiopsis, Pestalotiopsis and Truncatella species associated with grapevine trunk diseases in France. Phytopathol Mediterr 55:380–390. doi: 10.14601/Phytopathol_Mediterr-18298. [DOI] [Google Scholar]
78.Chaiwan N, Jeewon R, Pem D, Jayawardena RS, Nazurally N, Mapook A, Promputtha I, Hyde KD. 2022. Fungal species from Rhododendron sp.: Discosia rhododendricola sp. nov, Neopestalotiopsis rhododendricola sp. nov. and Diaporthe nobilis as a new host record. J Fungi 8:907. doi: 10.3390/jof8090907. [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Crous PW, Boers J, Holdom D, Steinrucken TV, Tan YP, Vitelli JS, Shivas RG, Barrett M, Boxshall AG, Broadbridge J, Larsson E, Lebel T, Pinruan U, Sommai S, Alvarado P, Bonito G, Decock CA, De La Peña-Lastra S, Delgado G, Houbraken J, Maciá-Vicente JG, Raja H, Rigueiro-Rodríguez A, Rodríguez A, Wingfield MJ, Adams SJ, Akulov A, Al-Hidmi T, Antonín V, Arauzo S, Arenas F, Armada F, Aylward J, Bellanger JM, Berraf-Tebbal A, Bidaud A, Boccardo F, Cabero J, Calledda F, Corriol G, Crane JL, Dearnaley JDW, Dima B, Dovana F, Eichmeier A, Esteve-Raventós F, Fine M, Ganzert L, García D, Torres-Garcia D, et al. 2022. Fungal planet description sheets:1383–1435. Persoonia 48:261–371. doi: 10.3767/persoonia.2022.48.08. [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser (Oxf) 41:95–98. [Google Scholar]
81.Larsson A. 2014. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30:3276–3278. doi: 10.1093/bioinformatics/btu531. [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Vaidya G, Lohman DJ, Meier R. 2011. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27:171–180. doi: 10.1111/j.1096-0031.2010.00329.x. [DOI] [PubMed] [Google Scholar]
83.Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32:268–274. doi: 10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ. 2016. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res 44:W232–W235. doi: 10.1093/nar/gkw256. [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Chernomor O, von Haeseler A, Minh BQ. 2016. Terrace aware data structure for phylogenomic inference from supermatrices. Syst Biol 65:997–1008. doi: 10.1093/sysbio/syw037. [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Minh BQ, Nguyen MAT, von Haeseler A. 2013. Ultrafast approximation for phylogenetic bootstrap. Mol Biol Evol 30:1188–1195. doi: 10.1093/molbev/mst024. [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS. 2018. UFBoot2: improving the ultrafast bootstrap approximation. Mol Biol Evol 35:518–522. doi: 10.1093/molbev/msx281. [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees, p 1–8. In Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010. IEEE, New Orleans, LA. [Google Scholar]
89.Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Nylander JAA. 2004. MrModeltest v2.2 Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden. [Google Scholar]
91.Rannala B, Yang ZH. 1996. Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. J Mol Evol 43:304–311. doi: 10.1007/BF02338839. [DOI] [PubMed] [Google Scholar]
92.Quaedvlieg W, Binder M, Groenewald JZ, Summerell BA, Carnegie AJ, Burgess TI, Crous PW. 2014. Introducing the consolidated species concept to resolve species in the Teratosphaeriaceae. Persoonia 33:1–40. doi: 10.3767/003158514X681981. [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Bruen TC, Philippe H, Bryant D. 2006. A simple and robust statistical test for detecting the presence of recombination. Genetics 172:2665–2681. doi: 10.1534/genetics.105.048975. [DOI] [PMC free article] [PubMed] [Google Scholar]
94.Huson DH. 1998. Splits Tree: analyzing and visualizing evolutionary data. Bioinformatics 14:68–73. doi: 10.1093/bioinformatics/14.1.68. [DOI] [PubMed] [Google Scholar]
95.Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23:254–267. doi: 10.1093/molbev/msj030. [DOI] [PubMed] [Google Scholar]
96.Kumar V, Cheewangkoon R, Gentekaki E, Maharachchikumbura SSN, Brahmanage RS, Hyde KD. 2019. Neopestalotiopsis alpapicalis sp. nov. a new endophyte from tropical mangrove trees in Krabi Province (Thailand). Phytotaxa 393:251–262. doi: 10.11646/phytotaxa.393.3.2. [DOI] [Google Scholar]
97.Cao P, Fang YH, Zheng ZK, Han X, Zou HX, Yan XF. 2022. Occurrence of Neopestalotiopsis clavispora causing leaf spot on Dendrobium officinale in China. Plant Dis doi: 10.1094/PDIS-11-21-2432-PDN. [DOI] [PubMed] [Google Scholar]
98.Li Y, Zhang S, Wang T, Zhou S, Wu Y, Huang X, Lin H, Su X. 2022. First report of Taxus media branch blight caused by Neopestalotiopsis clavispora in China. Plant Dis doi: 10.1094/PDIS-12-21-2840-PDN. [DOI] [PubMed] [Google Scholar]
99.Khoo YW, Tan HT, Khaw YS, Li S, Chong KP. 2022. First report of Neopestalotiopsis cubana causing leaf blight on Ixora chinensis in Malaysia. Plant Dis doi: 10.1094/PDIS-02-22-0277-PDN. [DOI] [PubMed] [Google Scholar]
100.Silvério ML, Calvacanti M, Silva G, Oliveira R, Bezerra JL. 2016. A new epifoliar species of Neopestalotiopsis from Brazil. Agrotropica 28:151–158. doi: 10.21757/0103-3816.2016v28n2p151-158. [DOI] [Google Scholar]
101.Elfita E, Muharni M, Mardiyanto M, Fitrya F, Fera F, Widjajanti H. 2020. Antibacterial activity of traditional medicine Scurrula atropurpurea (BL) DANS and their endophytic fungi. Key Eng Mater 840:205–213. doi: 10.4028/www.scientific.net/KEM.840.205. [DOI] [Google Scholar]
102.Elfita E, Muharni M, Mardiyanto M, Fitrya F, Nurmawati E, Widjajanti H. 2020. Triacylglycerols produced by biomass of endophytic fungus Neopestalotiopsis surinamensis from the Scurrula atropurpurea. IJFAC 5:95–100. doi: 10.24845/ijfac.v5.i3.95. [DOI] [Google Scholar]
103.Xu MF, Jia OY, Wang SJ, Zhu Q. 2016. A new bioactive diterpenoid from Pestalotiopsis adusta, an endophytic fungus from Clerodendrum canescens. Nat Prod Res 30:2642–2647. doi: 10.1080/14786419.2016.1138297. [DOI] [PubMed] [Google Scholar]
104.Xiao J, Lin LB, Hu JY, Duan DZ, Shi W, Zhang Q, Han WB, Wang L, Wang XL. 2018. Pestalustaines A and B, unprecedented sesquiterpene and coumarin derivatives from endophytic fungus Pestalotiopsis adusta. Tetrahedron Lett 59:1772–1775. doi: 10.1016/j.tetlet.2018.03.078. [DOI] [Google Scholar]
105.Yan X, Meng T, Qi Y, Fei N, Liu C, Dai H. 2019. First report of Pestalotiopsis adusta causing leaf spot on raspberry in China. Plant Dis 103:2688–2688. doi: 10.1094/PDIS-07-18-1135-PDN. [DOI] [Google Scholar]
106.Chen YX, Wei G, Chen WP. 2002. New species of Pestalotiopsis. Mycosystema 21:316–323. [Google Scholar]
107.Hlaiem S, Yangui I, Rocca GD, Barberini S, Danti R, Jamâa MLB. 2022. First report of Pestalotiopsis biciliata causing dieback on Quercus coccifera and Pistacia lentiscus in Tunisia. Can J Plant Pathol 44:534–541. doi: 10.1080/07060661.2022.2032831. [DOI] [Google Scholar]
108.Liu AR, Wu XP, Xu T, Guo LD, Wei JG. 2006. Notes on endophytic Pestalotiopsis from Hainan, China. Mycosystema 25:389–397. [Google Scholar]
109.Purkayastha RP, Pal AK. 1996. New foliicolous fungi from Indian mangroves (Sunderbans). Indian Phytopathol 49:9–21. [Google Scholar]
110.Wang Y, Ran SF, Maharachchikumbura SSN, Al-Sadi AM, Hyde KD, Wang HL, Wang T, Wang YX. 2017. A novel Pestalotiopsis species isolated from Bulbophyllum thouars in Guangxi province, China. Phytotaxa 306:96–100. doi: 10.11646/phytotaxa.306.1.9. [DOI] [Google Scholar]
111.Ariyawansa HA, Hyde KD, Jayasiri SC, Buyck B, Chethana KWT, Dai DQ, Dai YC, Daranagama DA, Jayawardena RS, Lücking R, Ghobad-Nejhad M, Niskanen T, Thambugala KM, Voigt K, Zhao RL, Li GJ, Doilom M, Boonmee S, Yang ZL, Cai Q, Cui YY, Bahkali AH, Chen J, Cui BK, Chen JJ, Dayarathne MC, Dissanayake AJ, Ekanayaka AH, Hashimoto A, Hongsanan S, Jones EBG, Larsson E, Li WJ, Li QR, Liu JK, Luo ZL, Maharachchikumbura SSN, Mapook A, McKenzie EHC, Norphanphoun C, Konta S, Pang KL, Perera RH, Phookamsak R, Phukhamsakda C, Pinruan U, Randrianjohany E, Singtripop C, Tanaka K, Tian CM, et al. 2015. Fungal diversity notes 111–252—taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers 75:27–274. doi: 10.1007/s13225-015-0346-5. [DOI] [Google Scholar]
112.Yun YH, Ahn GR, Kim SH. 2015. First report and characterization of Pestalotiopsis ellipsospora causing canker on Acanthopanax divaricatus. Mycobiology 4:366−370. doi: 10.5941/MYCO.2015.43.3.366. [DOI] [PMC free article] [PubMed] [Google Scholar]
113.Watanabe K, Nozawa S, Hsiang T, Callan B. 2018. The cup fungus Pestalopezia brunneopruinosa is Pestalotiopsis gibbosa and belongs to Sordariomycetes. PLoS One 13:e0197025. doi: 10.1371/journal.pone.0197025. [DOI] [PMC free article] [PubMed] [Google Scholar]
114.Kobayashi T, de Guzman ED. 1988. Monograph of tree diseases in the Philippines with taxonomic notes on their associated microorganisms. Forestry and Forest Products Research Institute Ibaraki, Tokyo, Japan. [Google Scholar]
115.Steyaert R. 1953. Pestalotiopsis from the Gold Coast and Togoland. Trans Br Mycol Soc 36:235–242. doi: 10.1016/S0007-1536(53)80008-2. [DOI] [Google Scholar]
116.Fan M, Chen X, Luo X, Zhang H, Liu Y, Zhang Y, Wu J, Zhao C, Zhao P. 2020. Diversity of endophytic fungi from the leaves of Vaccinium dunalianum. Lett Appl Microbiol 71:479–489. doi: 10.1111/lam.13345. [DOI] [PubMed] [Google Scholar]
117.Liu C, Luo F, Zhu T, Han S, Li S. 2021. Leaf spot disease caused by Pestalotiopsis kenyana on Zanthoxylum schinifolium in Sichuan Province, China. Plant Dis 105:3747. doi: 10.1094/PDIS-10-20-2247-PDN. [DOI] [PubMed] [Google Scholar]
118.Bilgrami KS. 1963. Leaf spot diseases of some common ornamental plants. Proc Natl Acad Sci USA 33:429. [Google Scholar]
119.Zhang GJ, Cheng XR, Ding HX, Liang S, Li Z. 2021. First report of Pestalotiopsis lushanensis causing brown leaf spot on Sarcandra glabra in China. Plant Dis 105:1219. doi: 10.1094/PDIS-08-20-1855-PDN. [DOI] [PubMed] [Google Scholar]
120.Zhao GC, Li N. 1995. Thirty-four species of Pestalotiopsis in Yunnan. J Northeast for Univ 23:4–33. [Google Scholar]
121.Venkatasubbaiah P, Grand L, van Dyke CG. 1991. A new species of Pestalotiopsis on Oenothera. Mycologia 83:511–513. doi: 10.1080/00275514.1991.12026042. [DOI] [Google Scholar]
122.Chen YX, Wei G. 1993. New combinations of Pestalotiopsis from China. J Guangxi Agric Univ 12:23–35. [Google Scholar]
123.Chen YX, Wei G. 1997. New combinations of Pestalotiopsis from China (III). J Guangxi Agric Univ 16:7. [Google Scholar]
124.Bissett J. 1982. Pestalotiopsis menezesiana on greenhouse plantings of Cissus rhombifolia with notes on related fungi occurring on Vitaceae. Can J Bot 60:2570–2574. doi: 10.1139/b82-312. [DOI] [Google Scholar]
125.Song Y, Geng K, Hyde KD, Zhao WS, Wei JG, Kang JC, Wang Y. 2013. Two new species of Pestalotiopsis from Southern China. Phytotaxa 126:22–32. doi: 10.11646/phytotaxa.126.1.2. [DOI] [Google Scholar]
126.Zhu PL, Ge QX, Xu T. 1991. Seven new combinations of Pestalotiopsis from China. Acta Mycol Sinica 10:273–279. [Google Scholar]
127.Song Y, Tangthirasunun N, Maharachchikumbura SSN, Jiang YL, Xu JJ, Hyde KD, Wang Y. 2014. Novel Pestalotiopsis species from Thailand point to the rich undiscovered diversity of this chemically creative genus. Cryptogam Mycol 35:139–149. doi: 10.7872/crym.v35.iss2.2014.139. [DOI] [Google Scholar]
128.White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p 315–322. In Gelfand DH, Sninsky JJ, White TJ (ed), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA. [Google Scholar]
129.Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91:553–556. doi: 10.1080/00275514.1999.12061051. [DOI] [Google Scholar]
130.O'Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc Natl Acad Sci USA 95:2044–2049. doi: 10.1073/pnas.95.5.2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
131.Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61:1323–1330. doi: 10.1128/aem.61.4.1323-1330.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
132.O'Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol 7:103–116. doi: 10.1006/mpev.1996.0376. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Reviewer comments

reviewer-comments.pdf^{(8.2MB, pdf)}

Supplemental file 1

Supplemental material. Download spectrum.03987-22-s0001.pdf, PDF file, 0.5 MB^{(479.9KB, pdf)}

Data Availability Statement

The sequences generated in this study can be found in GenBank. The accession numbers of the sequences deposited in GenBank are listed in Table 3.

[B1] 1.Rasool-Hassan BA. 2012. Medicinal plants (importance and uses). Pharm Anal Acta 3:2153–2435. doi: 10.4172/2153-2435.1000e139. [DOI] [Google Scholar]

[B2] 2.Rasool A, Bhat KM, Sheikh AA, Jan A, Hassan S. 2020. Medicinal plants: role, distribution and future. J Pharmacogn Phytochem 9:2111–2114. [Google Scholar]

[B3] 3.David B, Wolfender JL, Dias DA. 2015. The pharmaceutical industry and natural products: historical status and new trends. Phytochem Rev 14:299–315. doi: 10.1007/s11101-014-9367-z. [DOI] [Google Scholar]

[B4] 4.Guo SX. 2016. Endophytic fungi biology of medicinal plant. Science Press, Beijing, China. [Google Scholar]

[B5] 5.Jia M, Chen L, Xin HL, Zheng CJ, Rahman K, Han T, Qin LP. 2016. A friendly relationship between endophytic fungi and medicinal plants: a systematic review. Front Microbiol 7:906. doi: 10.3389/fmicb.2016.00906. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6.Weber D, Sterner O, Anke T, Gorzalczancy S, Martino V, Acevedo C. 2004. Phomol, a new antiinflammatory metabolite from an endophyte of the medicinal plant Erythrina crista-galli. J Antibiot (Tokyo) 57:559–563. doi: 10.7164/antibiotics.57.559. [DOI] [PubMed] [Google Scholar]

[B7] 7.Sun J, Guo L, Zang W, Ping W, Chi D. 2008. Diversity and ecological distribution of endophytic fungi associated with medicinal plants. Sci China C Life Sci 51:751–759. doi: 10.1007/s11427-008-0091-z. [DOI] [PubMed] [Google Scholar]

[B8] 8.Abtahi F, Nourani SL. 2017. The most important fungal diseases associated with some useful medicinal plants, p 279–293. In Ghorbanpour M, Varma A (ed), Medicinal plants and environmental challenges. Springer International Publishing, Cham, Switzerland. doi: 10.1007/978-3-319-68717-9_16. [DOI] [Google Scholar]

[B9] 9.Keshri PK, Rai N, Verma A, Kamble SC, Barik S, Mishra P, Singh SK, Salvi P, Gautam V. 2021. Biological potential of bioactive metabolites derived from fungal endophytes associated with medicinal plants. Mycol Progress 20:577–594. doi: 10.1007/s11557-021-01695-8. [DOI] [Google Scholar]

[B10] 10.Guba EF. 1961. Monograph of Pestalotia and Monochaetia. Harvard University Press, Cambridge, MA. [Google Scholar]

[B11] 11.Nag Raj TR. 1993. Coelomycetous anamorphs with appendage-bearing conidia. Mycologue Publications, Waterloo, ON. [Google Scholar]

[B12] 12.Hyde KD, Nilsson RH, Alias SA, Ariyawansa HA, Blair JE, Cai L, de Cock AWAM, Dissanayake AJ, Glockling SL, Goonasekara ID, Gorczak M, Hahn M, Jayawardena RS, van Kan JAL, Laurence MH, Lévesque CA, Li XH, Liu JK, Maharachchikumbura SSN, Manamgoda DS, Martin FN, McKenzie EHC, McTaggart AR, Mortimer PE, Nair PVR, Pawłowska J, Rintoul TL, Shivas RG, Spies CFJ, Summerell BA, Taylor PWJ, Terhem RB, Udayanga D, Vaghefi N, Walther G, Wilk M, Wrzosek M, Xu JC, Yan JY, Zhou N. 2014. One stop shop: backbones trees for important phytopathogenic genera: I (2014). Fungal Divers 67:21–125. doi: 10.1007/s13225-014-0298-1. [DOI] [Google Scholar]

[B13] 13.Maharachchikumbura SSN, Hyde KD, Groenewald JZ, Xu J, Crous PW. 2014. Pestalotiopsis revisited. Stud Mycol 79:121–186. doi: 10.1016/j.simyco.2014.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14.Jayawardena RS, Hyde KD, McKenzie EHC, Jeewon R, Phillips AJL, Perera RH, de Silva NI, Maharachchikumburua SSN, Samarakoon MC, Ekanayake AH, Tennakoon DS, Dissanayake AJ, Norphanphoun C, Lin C, Manawasinghe IS, Tian Q, Brahmanage R, Chomnunti P, Hongsanan S, Jayasiri SC, Halleen F, Bhunjun CS, Karunarathna A, Wang Y. 2019. One stop shop III: taxonomic update with molecular phylogeny for important phytopathogenic genera: 51–75 (2019). Fungal Divers 98:77–160. doi: 10.1007/s13225-019-00433-6. [DOI] [Google Scholar]

[B15] 15.Jayawardena RS, Hyde KD, de Farias ARG, Bhunjun CS, Ferdinandez HS, Manamgoda DS, Udayanga D, Herath IS, Thambugala KM, Manawasinghe IS, Gajanayake AJ, Samarakoon BC, Bundhun D, Gomdola D, Huanraluek N, Sun YR, Tang X, Promputtha I, Thines M. 2021. What is a species in fungal plant pathogens? Fungal Divers 109:239–266. doi: 10.1007/s13225-021-00484-8. [DOI] [Google Scholar]

[B16] 16.Gu R, Bao DF, Shen HW, Su XJ, Li YX, Luo ZL. 2022. Endophytic Pestalotiopsis species associated with Rhododendron in Cangshan Mountain, Yunnan Province. Front Microbiol 13:1016782. doi: 10.3389/fmicb.2022.1016782. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17.Zhang Z, Liu R, Liu S, Mu T, Zhang X, Xia J. 2022. Morphological and phylogenetic analyses reveal two new species of Sporocadaceae from Hainan, China. MycoKeys 88:171–192. doi: 10.3897/mycokeys.88.82229. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18.Moreau C. 1949. Micomycetes africains. I. Revue de Mycologie, Suppliment Colonial (Paris) 14:15–22. [Google Scholar]

[B19] 19.Steyaert RL. 1949. Contribution à l’étude monographique de Pestalotia de Not. et Monochaetia Sacc. (Truncatella gen. nov. et Pestalotiopsis gen. nov.). Bulletin du Jardin botanique de l'État a Bruxelles 19:285–354. [Google Scholar]

[B20] 20.Guba EF. 1956. Monochaetia and Pestalotia vs. Truncatella, Pestalotiopsis and Pestalotia. Ann Microbiol 7:74–76. [Google Scholar]

[B21] 21.Sutton BC. 1980. The Coelomycetes. Fungi imperfecti with pycnidia, acervuli and stromata. Commonwealth Mycological Institute, Kew, Surrey, UK. [Google Scholar]

[B22] 22.Diogo E, Gonçalves CI, Silva AC, Valente C, Bragança H, Phillips AJL. 2021. Five new species of Neopestalotiopsis associated with diseased Eucalyptus spp. in Portugal. Mycol Progress 20:1441–1456. doi: 10.1007/s11557-021-01741-5. [DOI] [Google Scholar]

[B23] 23.Prasannath K, Shivas RG, Galea VJ, Akinsanmi OA. 2021. Neopestalotiopsis species associated with flower diseases of Macadamia integrifolia in Australia. J Fungi 7:771. doi: 10.3390/jof7090771. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24.Zhang YM, Maharachchikumbura SSN, Mckenzie EHC, Hyde KD. 2012. A novel species of Pestalotiopsis causing leaf spots of Trachycarpus fortunei. Cryptogam Mycol 33:311–318. doi: 10.7872/crym.v33.iss3.2012.311. [DOI] [Google Scholar]

[B25] 25.Maharachchikumbura SSN, Guo LD, Chukeatirote E, McKenzie EHC, Hyde KD. 2013. A destructive new disease of Syzygium samarangense in Thailand caused by the new species Pestalotiopsis samarangensis. Trop Plant Pathol 38:227–235. doi: 10.1590/S1982-56762013005000002. [DOI] [Google Scholar]

[B26] 26.Jayawardena RS, Liu M, Maharachchikumbura SSN, Zhang W, Xing QK, Hyde KD, Nilthong S, Li XH, Yan JY. 2016. Neopestalotiopsis vitis sp. nov. causing grapevine leaf spot in China. Phytotaxa 258:63–74. doi: 10.11646/phytotaxa.258.1.4. [DOI] [Google Scholar]

[B27] 27.Liu F, Hou LW, Raza M, Cai L. 2017. Pestalotiopsis and allied genera from Camellia, with description of 11 new species from China. Sci Rep 7:866. doi: 10.1038/s41598-017-00972-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28.Yang LN, Miao XY, Bai QR, Wang MQ, Gu ML, Zhao TC. 2017. Neopestalotiopsis clavispora causing leaf spot on Phedimus aizoon var. latifolius, a new disease in China. Plant Dis 101:1952. doi: 10.1094/PDIS-03-17-0422-PDN. [DOI] [Google Scholar]

[B29] 29.Mahapatra S, Banerjee J, Kumar K, Pramanik S, Pramanik K, Islam S, Das S. 2018. Leaf spot and fruit rot of strawberry caused by Neopestalotiopsis clavispora in Indo-Gangetic plains of India. Indian Phytopathol 71:279–283. doi: 10.1007/s42360-018-0043-x. [DOI] [Google Scholar]

[B30] 30.Fiorenza A, Gusella G, Aiello D, Polizzi G, Voglmayr H. 2022. Neopestalotiopsis siciliana sp. nov. and N. rosae causing stem lesion and dieback on avocado plants in Italy. J Fungi 8:562. doi: 10.3390/jof8060562. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31.Joshi SD, Sanjay R, Baby UI, Mandal A. 2009. Molecular characterization of Pestalotiopsis spp. associated with tea (Camellia sinensis) in southern India using RAPD and ISSR markers. Indian J Biotechnol 8:377–383. [Google Scholar]

[B32] 32.Horikawa T. 1986. Yield loss of new tea shoots due to grey blight caused by Pestalotia longiseta Spegazzini. Bull Shizuoka Tea Exp Stn 12:1–8. [Google Scholar]

[B33] 33.Biju CN, Peeran MF, Gowri R. 2018. Identification and characterization of Neopestalotiopsis clavispora associated with leaf blight of small cardamom (Elettaria cardamomum Maton). J Phytopathol 166:532–546. doi: 10.1111/jph.12715. [DOI] [Google Scholar]

[B34] 34.Wang RB, Chen SZ, Zheng BW, Liu PQ, Li B, Weng QY, Chen QH. 2019. Occurrence of leaf spot disease caused by Neopestalotiopsis clavispora on Taxus chinensis in China. For Path 49:e12540. doi: 10.1111/efp.12540. [DOI] [Google Scholar]

[B35] 35.Li L, Yang Q, Li H. 2021. Morphology, phylogeny, and pathogenicity of pestalotioid species on Camellia oleifera in China. J Fungi 7:1080. doi: 10.3390/jof7121080. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36.Huang WY, Cai YZ, Hyde KD, Corke H, Sun M. 2008. Biodiversity of endophytic fungi associated with 29 traditional Chinese medicinal plants. Fungal Divers 33:61–75. [Google Scholar]

[B37] 37.Schafhauser T, Jahn L, Kirchner N, Kulik A, Flor L, Lang A, Caradec T, Fewer DP, Sivonen K, van Berkel WJH, Jacques P, Weber T, Gross H, van Pée K-H, Wohlleben W, Ludwig-Müller J. 2019. Antitumor astins originate from the fungal endophyte Cyanodermella asteris living within the medicinal plant Aster tataricus. Proc Natl Acad Sci USA 116:26909–26917. doi: 10.1073/pnas.1910527116. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38.Xu J, Ebada SS, Proksch P. 2010. Pestalotiopsis a highly creative genus: chemistry and bioactivity of secondary metabolites. Fungal Divers 44:15–31. doi: 10.1007/s13225-010-0055-z. [DOI] [Google Scholar]

[B39] 39.Xu J, Yang XB, Lin Q. 2014. Chemistry and biology of Pestalotiopsis-derived natural products. Fungal Divers 66:37–68. doi: 10.1007/s13225-014-0288-3. [DOI] [Google Scholar]

[B40] 40.Reddy MS, Murali T, Suryanarayanan TS, Rajulu MBG, Thirunavukkarasu N. 2016. Pestalotiopsis species occur as generalist endophytes in trees of Western Ghats forests of southern India. Fungal Ecol 24:70–75. doi: 10.1016/j.funeco.2016.09.002. [DOI] [Google Scholar]

[B41] 41.Ma XY, Maharachchikumbura SSN, Chen BW, Hyde KD, Mckenzie EHC, Chomnunti P, Kang JC. 2019. Endophytic pestalotiod taxa in Dendrobium orchids. Phytotaxa 419:268–286. doi: 10.11646/phytotaxa.419.3.2. [DOI] [Google Scholar]

[B42] 42.Kumaran RS, Kim HJ, Hur BK. 2010. Taxol promising fungal endophyte, Pestalotiopsis species isolated from Taxus cuspidata. J Biosci Bioeng 110:541–546. doi: 10.1016/j.jbiosc.2010.06.007. [DOI] [PubMed] [Google Scholar]

[B43] 43.He YK, Yang Q, Sun YR, Zeng XY, Jayawardena RS, Hyde KD, Wang Y. 2022. Additions to Neopestalotiopsis (Amphisphaeriales, Sporocadaceae) fungi: two new species and one new host record from China. Biodivers Data J 10:e90709. doi: 10.3897/BDJ.10.e90709. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44.Yang Q, Zeng XY, Yuan J, Zhang Q, He YK, Wang Y. 2021. Two new species of Neopestalotiopsis from southern China. Biodivers Data J 9:e70446. doi: 10.3897/BDJ.9.e70446. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45.Jiang N, Fan XL, Tian CM. 2021. Identification and characterization of leaf-inhabiting fungi from Castanea plantations in China. J Fungi 7:64. doi: 10.3390/jof7010064. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46.Pornsuriya C, Chairin T, Thaochan N, Sunpapao A. 2020. Identification and characterization of Neopestalotiopsis fungi associated with a novel leaf fall disease of rubber trees (Hevea brasiliensis) in Thailand. J Phytopathol 168:416–427. doi: 10.1111/jph.12906. [DOI] [Google Scholar]

[B47] 47.Gualberto GF, Catarino A, Sousa TF, da Cruz J, Hanada RE, Caniato FF, da Silva G. 2021. Pseudopestalotiopsis gilvanii sp. nov. and Neopestalotiopsis formicarum leaves spot pathogens from guarana plant: a new threat to global tropical hosts. Phytotaxa 489:121–139. doi: 10.11646/phytotaxa.489.2.2. [DOI] [Google Scholar]

[B48] 48.Lin YZ, Chang TD, Wen CJ, Tsai SH, Lin YH. 2022. First report of leaf brown blight caused by Neopestalotiopsis formicarum on jabuticaba in Taiwan. Plant Dis 106:2527. doi: 10.1094/PDIS-07-21-1414-PDN. [DOI] [PubMed] [Google Scholar]

[B49] 49.Moslemi A, Taylor PWJ. 2015. Pestalotiopsis chamaeropis causing leaf spot disease of round leaf mint-bush (Prostanthera rotundifolia) in Australia. Australas Plant Dis Notes 10:29. doi: 10.1007/s13314-015-0179-9. [DOI] [Google Scholar]

[B50] 50.Jiang YL, Zhou YK, Ma KZ, Mao YL, Yu XT, Liu Y, Hou CL. 2017. Identification of several strains of Pestalotiopsis-like fungi from Camellia oleifera. J Anhui Agric Univ 44:609–616. [Google Scholar]

[B51] 51.Ariyawansa HA, Hyde KD. 2018. Additions to Pestalotiopsis in Taiwan. Mycosphere 9:999–1013. doi: 10.5943/mycosphere/9/5/4. [DOI] [Google Scholar]

[B52] 52.Hlaiem S, Zouaoui-Boutiti M, Ben Jemâa ML, Rocca GD, Barberini S, Danti R. 2018. Identification and pathogenicity of Pestalotiopsis chamaeropis, causal agent of white heather (Erica arborea) dieback, and in vitro biocontrol with the antagonist Trichoderma sp. Tunis J Plant Prot 13:49–60. [Google Scholar]

[B53] 53.Nozawa S, Seto Y, Watanabe K. 2019. First report of leaf blight caused by Pestalotiopsis chamaeropis and Neopestalotiopsis sp. in Japanese andromeda. J Gen Plant Pathol 85:449–452. doi: 10.1007/s10327-019-00868-4. [DOI] [Google Scholar]

[B54] 54.Chen YJ, Wan YH, Zeng L, Meng Q, Yuan LY, Tong HR. 2021. Characterization of Pestalotiopsis chamaeropis causing gray blight disease on tea leaves (Camellia sinensis) in Chongqing, China. Can J Plant Pathol 43:413–420. doi: 10.1080/07060661.2020.1816582. [DOI] [Google Scholar]

[B55] 55.Qiu L, Liu J, Kuang W, Zhang K, Ma J. 2022. First report of Pestalotiopsis chamaeropis causing leaf spot on Eurya nitida in China. Plant Dis 106:329. doi: 10.1094/PDIS-06-21-1170-PDN. [DOI] [PubMed] [Google Scholar]

[B56] 56.Santos J, Hilário S, Pinto G, Alves A. 2022. Diversity and pathogenicity of pestalotioid fungi associated with blueberry plants in Portugal, with description of three novel species of Neopestalotiopsis. Eur J Plant Pathol 162:539–555. doi: 10.1007/s10658-021-02419-0. [DOI] [Google Scholar]

[B57] 57.Park H, Shim JS, Kim JS, Choi HS, Eom AH. 2017. Five previously unreported endophytic fungi isolated from the leaves of woody plants in Korea. Kor J Mycol 45:345–354. [Google Scholar]

[B58] 58.Liu JK, Hyde KD, Jones EBG, Ariyawansa HA, Bhat DJ, Boonmee S, Maharachchikumbura SSN, McKenzie EHC, Phookamsak R, Phukhamsakda C, Shenoy BD, Abdel-Wahab MA, Buyck B, Chen J, Chethana KWT, Singtripop C, Dai DQ, Dai YC, Daranagama DA, Dissanayake AJ, Doilom M, D’Souza MJ, Fan XL, Goonasekara ID, Hirayama K, Hongsanan S, Jayasiri SC, Jayawardena RS, Karunarathna SC, Li WJ, Mapook A, Norphanphoun C, Pang KL, Perera RH, Peršoh D, Pinruan U, Senanayake IC, Somrithipol S, Suetrong S, Tanaka K, Thambugala KM, Tian Q, Tibpromma S, Udayanga D, Wijayawardene NN, Wanasinghe D, Wisitrassameewong K, Zeng XY, Abdel-Aziz FA, Adamčík S, et al. 2015. Fungal diversity notes 1–110: taxonomic and phylogenetic contributions to fungal species. Fungal Divers 72:1–197. doi: 10.1007/s13225-015-0324-y. [DOI] [Google Scholar]

[B59] 59.Liu F, Bonthond G, Groenewald JZ, Cai L, Crous PW. 2019. Sporocadaceae, a family of coelomycetous fungi with appendage-bearing conidia. Stud Mycol 92:287–415. doi: 10.1016/j.simyco.2018.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60.Huanaluek N, Jayawardena RS, Maharachchikumbura SS, Harishchandra DL. 2021. Additions to pestalotioid fungi in Thailand: Neopestalotiopsis hydeana sp. nov. and Pestalotiopsis hydei sp. nov. Phytotaxa 479:23–43. doi: 10.11646/phytotaxa.479.1.2. [DOI] [Google Scholar]

[B61] 61.Chen CQ, Zhang B, Yang L, Gao J. 2011. Identification and biological characteristics of round leaf spot on blueberry caused by Pestalotiopsis photiniae. J Northeast for Univ 39:95–98. [Google Scholar]

[B62] 62.Ding G, Qi Y, Liu S, Guo L, Chen X. 2012. Photipyrones A and B, new pyrone derivatives from the plant endophytic fungus Pestalotiopsis photiniae. J Antibiot 65:271–273. doi: 10.1038/ja.2012.14. [DOI] [PubMed] [Google Scholar]

[B63] 63.Jiang N, Bonthond G, Fan XL, Tian CM. 2018. Neopestalotiopsis rosicola sp. nov. causing stem canker of Rosa chinensis in China. Mycotaxon 133:271–283. doi: 10.5248/133.271. [DOI] [Google Scholar]

[B64] 64.Maharachchikumbura SSN, Guo LD, Liu ZY, Hyde KD. 2016. Pseudopestalotiopsis ignota and Ps. camelliae spp. nov. associated with grey blight disease of tea in China. Mycol Prog 15:22. doi: 10.1007/s11557-016-1162-3. [DOI] [Google Scholar]

[B65] 65.Nozawa S, Yamaguchi K, Hoang Yen LT, Van Hop D, Phay N, Ando K, Watanabe K. 2017. Identification of two new species and a sexual morph from the genus Pseudopestalotiopsis. Mycoscience 58:328–337. doi: 10.1016/j.myc.2017.02.008. [DOI] [Google Scholar]

[B66] 66.Nozawa S, Ando K, Phay N, Watanabe K. 2018. Pseudopestalotiopsis dawaina sp. nov. and Ps. kawthaungina sp. nov.: two new species from Myanmar. Mycol Progress 17:865–870. doi: 10.1007/s11557-018-1398-1. [DOI] [Google Scholar]

[B67] 67.Norphanphoun C, Jayawardena RS, Chen Y, Wen TC, Meepol W, Hyde KD. 2019. Morphological and phylogenetic characterization of novel pestalotioid species associated with mangroves in Thailand. Mycosphere 10:531–578. doi: 10.5943/mycosphere/10/1/9. [DOI] [Google Scholar]

[B68] 68.Wei JG, Xu T. 2004. Pestalotiopsis kunmingensis sp. nov., an endophyte from Podocarpus macrophyllus. Fungal Divers 15:247–254. [Google Scholar]

[B69] 69.Maharachchikumbura SSN, Guo LD, Cai L, Chukeatirote E, Wu WP, Sun X, Crous PW, Bhat DJ, McKenzie EHC, Bahkali AH, Hyde KD. 2012. A multi-locus backbone tree for Pestalotiopsis, with a polyphasic characterization of 14 new species. Fungal Divers 56:95–129. doi: 10.1007/s13225-012-0198-1. [DOI] [Google Scholar]

[B70] 70.Kjer J, Debbab A, Aly AH, Proksch P. 2010. Methods for isolation of marine-derived endophytic fungi and their bioactive secondary products. Nat Protoc 5:479–490. doi: 10.1038/nprot.2009.233. [DOI] [PubMed] [Google Scholar]

[B71] 71.Otero JT, Ackerman JD, Bayman P. 2002. Diversity and host specificity of endophytic Rhizoctonia—like fungi from tropical orchids. Am J Bot 89:1852–1858. doi: 10.3732/ajb.89.11.1852. [DOI] [PubMed] [Google Scholar]

[B72] 72.Senanayake IC, Rathnayake AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Jayawardena RS, Wanasinghe DN, Jeewon R, Bhat DJ, Xiang MM. 2020. Morphological approaches in studying fungi: collection, examination, isolation, sporulation and preservation. Mycosphere 11:2678–2754. doi: 10.5943/mycosphere/11/1/20. [DOI] [Google Scholar]

[B73] 73.Jayasiri SC, Hyde KD, Ariyawansa HA, Bhat J, Buyck B, Cai L, Dai YC, Abd-Elsalam KA, Ertz D, Hidayat I, Jeewon R, Jones EBG, Bahkali AH, Karunarathna SC, Liu JK, Luangsa-Ard JJ, Lumbsch HT, Maharachchikumbura SSN, McKenzie EHC, Moncalvo JM, Ghobad-Nejhad M, Nilsson H, Pang KL, Pereira OL, Phillips AJL, Raspé O, Rollins AW, Romero AI, Etayo J, Selçuk F, Stephenson SL, Suetrong S, Taylor JE, Tsui CKM, Vizzini A, Abdel-Wahab MA, Wen TC, Boonmee S, Dai DQ, Daranagama DA, Dissanayake AJ, Ekanayaka AH, Fryar SC, Hongsanan S, Jayawardena RS, Li WJ, Perera RH, Phookamsak R, de Silva NI, Thambugala KM, et al. 2015. The Faces of Fungi database: fungal names linked with morphology, phylogeny and human impacts. Fungal Divers 74:3–18. doi: 10.1007/s13225-015-0351-8. [DOI] [Google Scholar]

[B74] 74.Wang F, Wang K, Cai L, Zhao MJ, Kirk PM, Fan GM, Sun QL, Li B, Wang S, Yu ZF. 2022. Fungal names: a comprehensive nomenclatural repository and knowledge base for fungal taxonomy. Nucleic Acids Res doi: 10.1093/nar/gkac926. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B75] 75.Dissanayake AJ, Bhunjun CS, Maharachchikumbura SSN, Liu JK. 2020. Applied aspects of methods to infer phylogenetic relationships amongst fungi. Mycosphere 11:2652–2676. doi: 10.5943/mycosphere/11/1/18. [DOI] [Google Scholar]

[B76] 76.de Silva N, Maharachchikumbura SSN, Thambugala KM, Bhat DJ, Karunarathna SC, Tennakoon DS, Phookamsak R, Jayawardena RS, Lumyong S, Hyde KD. 2021. Morpho-molecular taxonomic studies reveal a high number of endophytic fungi from Magnolia candolli and M. garrettii in China and Thailand. Mycosphere 12:163–237. doi: 10.5943/mycosphere/12/1/3. [DOI] [Google Scholar]

[B77] 77.Maharachchikumbura SSN, Larignon P, Hyde KD, Al-Sadi AM, Liu ZY. 2016. Characterization of Neopestalotiopsis, Pestalotiopsis and Truncatella species associated with grapevine trunk diseases in France. Phytopathol Mediterr 55:380–390. doi: 10.14601/Phytopathol_Mediterr-18298. [DOI] [Google Scholar]

[B78] 78.Chaiwan N, Jeewon R, Pem D, Jayawardena RS, Nazurally N, Mapook A, Promputtha I, Hyde KD. 2022. Fungal species from Rhododendron sp.: Discosia rhododendricola sp. nov, Neopestalotiopsis rhododendricola sp. nov. and Diaporthe nobilis as a new host record. J Fungi 8:907. doi: 10.3390/jof8090907. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B79] 79.Crous PW, Boers J, Holdom D, Steinrucken TV, Tan YP, Vitelli JS, Shivas RG, Barrett M, Boxshall AG, Broadbridge J, Larsson E, Lebel T, Pinruan U, Sommai S, Alvarado P, Bonito G, Decock CA, De La Peña-Lastra S, Delgado G, Houbraken J, Maciá-Vicente JG, Raja H, Rigueiro-Rodríguez A, Rodríguez A, Wingfield MJ, Adams SJ, Akulov A, Al-Hidmi T, Antonín V, Arauzo S, Arenas F, Armada F, Aylward J, Bellanger JM, Berraf-Tebbal A, Bidaud A, Boccardo F, Cabero J, Calledda F, Corriol G, Crane JL, Dearnaley JDW, Dima B, Dovana F, Eichmeier A, Esteve-Raventós F, Fine M, Ganzert L, García D, Torres-Garcia D, et al. 2022. Fungal planet description sheets:1383–1435. Persoonia 48:261–371. doi: 10.3767/persoonia.2022.48.08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B80] 80.Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser (Oxf) 41:95–98. [Google Scholar]

[B81] 81.Larsson A. 2014. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30:3276–3278. doi: 10.1093/bioinformatics/btu531. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B82] 82.Vaidya G, Lohman DJ, Meier R. 2011. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27:171–180. doi: 10.1111/j.1096-0031.2010.00329.x. [DOI] [PubMed] [Google Scholar]

[B83] 83.Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32:268–274. doi: 10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B84] 84.Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ. 2016. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res 44:W232–W235. doi: 10.1093/nar/gkw256. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B85] 85.Chernomor O, von Haeseler A, Minh BQ. 2016. Terrace aware data structure for phylogenomic inference from supermatrices. Syst Biol 65:997–1008. doi: 10.1093/sysbio/syw037. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B86] 86.Minh BQ, Nguyen MAT, von Haeseler A. 2013. Ultrafast approximation for phylogenetic bootstrap. Mol Biol Evol 30:1188–1195. doi: 10.1093/molbev/mst024. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B87] 87.Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS. 2018. UFBoot2: improving the ultrafast bootstrap approximation. Mol Biol Evol 35:518–522. doi: 10.1093/molbev/msx281. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B88] 88.Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees, p 1–8. In Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010. IEEE, New Orleans, LA. [Google Scholar]

[B89] 89.Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B90] 90.Nylander JAA. 2004. MrModeltest v2.2 Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden. [Google Scholar]

[B91] 91.Rannala B, Yang ZH. 1996. Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. J Mol Evol 43:304–311. doi: 10.1007/BF02338839. [DOI] [PubMed] [Google Scholar]

[B92] 92.Quaedvlieg W, Binder M, Groenewald JZ, Summerell BA, Carnegie AJ, Burgess TI, Crous PW. 2014. Introducing the consolidated species concept to resolve species in the Teratosphaeriaceae. Persoonia 33:1–40. doi: 10.3767/003158514X681981. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B93] 93.Bruen TC, Philippe H, Bryant D. 2006. A simple and robust statistical test for detecting the presence of recombination. Genetics 172:2665–2681. doi: 10.1534/genetics.105.048975. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B94] 94.Huson DH. 1998. Splits Tree: analyzing and visualizing evolutionary data. Bioinformatics 14:68–73. doi: 10.1093/bioinformatics/14.1.68. [DOI] [PubMed] [Google Scholar]

[B95] 95.Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23:254–267. doi: 10.1093/molbev/msj030. [DOI] [PubMed] [Google Scholar]

[B96] 96.Kumar V, Cheewangkoon R, Gentekaki E, Maharachchikumbura SSN, Brahmanage RS, Hyde KD. 2019. Neopestalotiopsis alpapicalis sp. nov. a new endophyte from tropical mangrove trees in Krabi Province (Thailand). Phytotaxa 393:251–262. doi: 10.11646/phytotaxa.393.3.2. [DOI] [Google Scholar]

[B97] 97.Cao P, Fang YH, Zheng ZK, Han X, Zou HX, Yan XF. 2022. Occurrence of Neopestalotiopsis clavispora causing leaf spot on Dendrobium officinale in China. Plant Dis doi: 10.1094/PDIS-11-21-2432-PDN. [DOI] [PubMed] [Google Scholar]

[B98] 98.Li Y, Zhang S, Wang T, Zhou S, Wu Y, Huang X, Lin H, Su X. 2022. First report of Taxus media branch blight caused by Neopestalotiopsis clavispora in China. Plant Dis doi: 10.1094/PDIS-12-21-2840-PDN. [DOI] [PubMed] [Google Scholar]

[B99] 99.Khoo YW, Tan HT, Khaw YS, Li S, Chong KP. 2022. First report of Neopestalotiopsis cubana causing leaf blight on Ixora chinensis in Malaysia. Plant Dis doi: 10.1094/PDIS-02-22-0277-PDN. [DOI] [PubMed] [Google Scholar]

[B100] 100.Silvério ML, Calvacanti M, Silva G, Oliveira R, Bezerra JL. 2016. A new epifoliar species of Neopestalotiopsis from Brazil. Agrotropica 28:151–158. doi: 10.21757/0103-3816.2016v28n2p151-158. [DOI] [Google Scholar]

[B101] 101.Elfita E, Muharni M, Mardiyanto M, Fitrya F, Fera F, Widjajanti H. 2020. Antibacterial activity of traditional medicine Scurrula atropurpurea (BL) DANS and their endophytic fungi. Key Eng Mater 840:205–213. doi: 10.4028/www.scientific.net/KEM.840.205. [DOI] [Google Scholar]

[B102] 102.Elfita E, Muharni M, Mardiyanto M, Fitrya F, Nurmawati E, Widjajanti H. 2020. Triacylglycerols produced by biomass of endophytic fungus Neopestalotiopsis surinamensis from the Scurrula atropurpurea. IJFAC 5:95–100. doi: 10.24845/ijfac.v5.i3.95. [DOI] [Google Scholar]

[B103] 103.Xu MF, Jia OY, Wang SJ, Zhu Q. 2016. A new bioactive diterpenoid from Pestalotiopsis adusta, an endophytic fungus from Clerodendrum canescens. Nat Prod Res 30:2642–2647. doi: 10.1080/14786419.2016.1138297. [DOI] [PubMed] [Google Scholar]

[B104] 104.Xiao J, Lin LB, Hu JY, Duan DZ, Shi W, Zhang Q, Han WB, Wang L, Wang XL. 2018. Pestalustaines A and B, unprecedented sesquiterpene and coumarin derivatives from endophytic fungus Pestalotiopsis adusta. Tetrahedron Lett 59:1772–1775. doi: 10.1016/j.tetlet.2018.03.078. [DOI] [Google Scholar]

[B105] 105.Yan X, Meng T, Qi Y, Fei N, Liu C, Dai H. 2019. First report of Pestalotiopsis adusta causing leaf spot on raspberry in China. Plant Dis 103:2688–2688. doi: 10.1094/PDIS-07-18-1135-PDN. [DOI] [Google Scholar]

[B106] 106.Chen YX, Wei G, Chen WP. 2002. New species of Pestalotiopsis. Mycosystema 21:316–323. [Google Scholar]

[B107] 107.Hlaiem S, Yangui I, Rocca GD, Barberini S, Danti R, Jamâa MLB. 2022. First report of Pestalotiopsis biciliata causing dieback on Quercus coccifera and Pistacia lentiscus in Tunisia. Can J Plant Pathol 44:534–541. doi: 10.1080/07060661.2022.2032831. [DOI] [Google Scholar]

[B108] 108.Liu AR, Wu XP, Xu T, Guo LD, Wei JG. 2006. Notes on endophytic Pestalotiopsis from Hainan, China. Mycosystema 25:389–397. [Google Scholar]

[B109] 109.Purkayastha RP, Pal AK. 1996. New foliicolous fungi from Indian mangroves (Sunderbans). Indian Phytopathol 49:9–21. [Google Scholar]

[B110] 110.Wang Y, Ran SF, Maharachchikumbura SSN, Al-Sadi AM, Hyde KD, Wang HL, Wang T, Wang YX. 2017. A novel Pestalotiopsis species isolated from Bulbophyllum thouars in Guangxi province, China. Phytotaxa 306:96–100. doi: 10.11646/phytotaxa.306.1.9. [DOI] [Google Scholar]

[B111] 111.Ariyawansa HA, Hyde KD, Jayasiri SC, Buyck B, Chethana KWT, Dai DQ, Dai YC, Daranagama DA, Jayawardena RS, Lücking R, Ghobad-Nejhad M, Niskanen T, Thambugala KM, Voigt K, Zhao RL, Li GJ, Doilom M, Boonmee S, Yang ZL, Cai Q, Cui YY, Bahkali AH, Chen J, Cui BK, Chen JJ, Dayarathne MC, Dissanayake AJ, Ekanayaka AH, Hashimoto A, Hongsanan S, Jones EBG, Larsson E, Li WJ, Li QR, Liu JK, Luo ZL, Maharachchikumbura SSN, Mapook A, McKenzie EHC, Norphanphoun C, Konta S, Pang KL, Perera RH, Phookamsak R, Phukhamsakda C, Pinruan U, Randrianjohany E, Singtripop C, Tanaka K, Tian CM, et al. 2015. Fungal diversity notes 111–252—taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers 75:27–274. doi: 10.1007/s13225-015-0346-5. [DOI] [Google Scholar]

[B112] 112.Yun YH, Ahn GR, Kim SH. 2015. First report and characterization of Pestalotiopsis ellipsospora causing canker on Acanthopanax divaricatus. Mycobiology 4:366−370. doi: 10.5941/MYCO.2015.43.3.366. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B113] 113.Watanabe K, Nozawa S, Hsiang T, Callan B. 2018. The cup fungus Pestalopezia brunneopruinosa is Pestalotiopsis gibbosa and belongs to Sordariomycetes. PLoS One 13:e0197025. doi: 10.1371/journal.pone.0197025. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B114] 114.Kobayashi T, de Guzman ED. 1988. Monograph of tree diseases in the Philippines with taxonomic notes on their associated microorganisms. Forestry and Forest Products Research Institute Ibaraki, Tokyo, Japan. [Google Scholar]

[B115] 115.Steyaert R. 1953. Pestalotiopsis from the Gold Coast and Togoland. Trans Br Mycol Soc 36:235–242. doi: 10.1016/S0007-1536(53)80008-2. [DOI] [Google Scholar]

[B116] 116.Fan M, Chen X, Luo X, Zhang H, Liu Y, Zhang Y, Wu J, Zhao C, Zhao P. 2020. Diversity of endophytic fungi from the leaves of Vaccinium dunalianum. Lett Appl Microbiol 71:479–489. doi: 10.1111/lam.13345. [DOI] [PubMed] [Google Scholar]

[B117] 117.Liu C, Luo F, Zhu T, Han S, Li S. 2021. Leaf spot disease caused by Pestalotiopsis kenyana on Zanthoxylum schinifolium in Sichuan Province, China. Plant Dis 105:3747. doi: 10.1094/PDIS-10-20-2247-PDN. [DOI] [PubMed] [Google Scholar]

[B118] 118.Bilgrami KS. 1963. Leaf spot diseases of some common ornamental plants. Proc Natl Acad Sci USA 33:429. [Google Scholar]

[B119] 119.Zhang GJ, Cheng XR, Ding HX, Liang S, Li Z. 2021. First report of Pestalotiopsis lushanensis causing brown leaf spot on Sarcandra glabra in China. Plant Dis 105:1219. doi: 10.1094/PDIS-08-20-1855-PDN. [DOI] [PubMed] [Google Scholar]

[B120] 120.Zhao GC, Li N. 1995. Thirty-four species of Pestalotiopsis in Yunnan. J Northeast for Univ 23:4–33. [Google Scholar]

[B121] 121.Venkatasubbaiah P, Grand L, van Dyke CG. 1991. A new species of Pestalotiopsis on Oenothera. Mycologia 83:511–513. doi: 10.1080/00275514.1991.12026042. [DOI] [Google Scholar]

[B122] 122.Chen YX, Wei G. 1993. New combinations of Pestalotiopsis from China. J Guangxi Agric Univ 12:23–35. [Google Scholar]

[B123] 123.Chen YX, Wei G. 1997. New combinations of Pestalotiopsis from China (III). J Guangxi Agric Univ 16:7. [Google Scholar]

[B124] 124.Bissett J. 1982. Pestalotiopsis menezesiana on greenhouse plantings of Cissus rhombifolia with notes on related fungi occurring on Vitaceae. Can J Bot 60:2570–2574. doi: 10.1139/b82-312. [DOI] [Google Scholar]

[B125] 125.Song Y, Geng K, Hyde KD, Zhao WS, Wei JG, Kang JC, Wang Y. 2013. Two new species of Pestalotiopsis from Southern China. Phytotaxa 126:22–32. doi: 10.11646/phytotaxa.126.1.2. [DOI] [Google Scholar]

[B126] 126.Zhu PL, Ge QX, Xu T. 1991. Seven new combinations of Pestalotiopsis from China. Acta Mycol Sinica 10:273–279. [Google Scholar]

[B127] 127.Song Y, Tangthirasunun N, Maharachchikumbura SSN, Jiang YL, Xu JJ, Hyde KD, Wang Y. 2014. Novel Pestalotiopsis species from Thailand point to the rich undiscovered diversity of this chemically creative genus. Cryptogam Mycol 35:139–149. doi: 10.7872/crym.v35.iss2.2014.139. [DOI] [Google Scholar]

[B128] 128.White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p 315–322. In Gelfand DH, Sninsky JJ, White TJ (ed), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA. [Google Scholar]

[B129] 129.Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91:553–556. doi: 10.1080/00275514.1999.12061051. [DOI] [Google Scholar]

[B130] 130.O'Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc Natl Acad Sci USA 95:2044–2049. doi: 10.1073/pnas.95.5.2044. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B131] 131.Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61:1323–1330. doi: 10.1128/aem.61.4.1323-1330.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B132] 132.O'Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol 7:103–116. doi: 10.1006/mpev.1996.0376. [DOI] [PubMed] [Google Scholar]

PERMALINK

Pestalotioid Species Associated with Medicinal Plants in Southwest China and Thailand

Y R Sun

R S Jayawardena

J E Sun

Y Wang

Roles

ABSTRACT

INTRODUCTION

RESULTS

Neopestalotiopsis Maharachch., K.D. Hyde, and Crous, Stud. Mycol. 79:135 (2014).

FIG 1.

FIG 2.

FIG 3.

FIG 4.

FIG 5.

FIG 6.

FIG 7.

FIG 8.

Pestalotiopsis Steyaert, Bull. Jard. bot. État Brux. 19:300 (1949).

FIG 9.

FIG 10.

FIG 11.

FIG 12.

FIG 13.

Pseudopestalotiopsis Maharachch., K.D. Hyde, and Crous, Stud. Mycol. 79: 180 (2014).

FIG 14.

DISCUSSION

TABLE 1.

FIG 15.

MATERIALS AND METHODS

Collection, examination, and isolation.

DNA extraction, PCR amplification, and sequencing.

TABLE 2.

Phylogenetic analyses.

TABLE 3.

TABLE 4.

Genealogical concordance phylogenetic species recognition analysis.

Data availability.

Supplementary Material

ACKNOWLEDGMENTS

Footnotes

Contributor Information

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases