Abstract
Obesity is a main risk factor for diabetes and cardiovascular disorders and is closely linked to preadipocyte differentiation or adipogenesis. Peroxisome proliferator-activated receptor γ (PPARγ) is an indispensable transcription factor in adipogenesis. A newly identified long noncoding RNA, Acart, exerts a protective effect against cardiomyocyte injury by transactivating PPARγ signaling. However, the function of Acart in preadipocyte differentiation is unclear. To investigate the function of Acart in adipogenesis, a well-established preadipocyte, the 3T3-L1 cell line, was induced to differentiate, and Acart level was assessed during differentiation using quantitative real-time PCR. The biological role of Acart in adipogenesis was analyzed by assessing lipid droplet accumulation, PPARγ and CCAAT/enhancer-binding protein α (C/EBPα) expression, and 3T3-L1 cell proliferation and apoptosis after Acart silencing. We found that Acart level was promptly increased during preadipocyte differentiation in vitro. Acart was also significantly upregulated in obese mouse-derived subcutaneous, perirenal, and epididymal fat tissues compared with nonobese mouse-derived adipose tissues. Functionally, Acart depletion inhibited preadipocyte differentiation, as evidenced by a significant decrease in lipid accumulation and PPARγ and C/EBPα expression levels. Acart silencing also inhibited 3T3-L1 cell proliferation, whereas Acart overexpression accelerated 3T3-L1 cell proliferation and decreased cell apoptosis. Taken together, the current results reveal a novel function of Acart in regulating preadipocyte proliferation and differentiation.
Keywords: lncRNA, Acart, adipogenesis, PPARγ, C/EBPα
1. Introduction
Epidemiological studies show that obesity has become a public health challenge worldwide, as there are approximately 2 billion obese people [1,2]. Obesity is closely correlated with an increased risk in multiple serious disorders, including diabetes, cardiovascular disorders, and cancers [3,4], and is closely associated with preadipocyte differentiation or adipogenesis [5]. Adipogenesis is pivotal to adipose tissue mass accumulation and obesity occurrence [6,7]. Although adipogenesis is a complex process involving many proteins and noncoding RNAs (ncRNAs), it is well known that peroxisome proliferator-activated receptor γ (PPARγ) and C/EBPα are two critical factors in adipogenesis [8,9].
Long noncoding RNAs (lncRNAs) are large and diverse noncoding transcripts that are >200 nucleotides in length and do not have protein-coding potential [10]. Over the past decade, lncRNA has attracted widespread attention from all fields of biology, such as chromatin remodeling, cell differentiation, cancer biology, and metabolism [11,12]. With the advancements of next-generation sequencing and microarrays, great progress has been made in identifying differentially expressed lncRNAs during adipogenesis. The results from RNA-sequencing analysis revealed that 175 lncRNAs are significantly dysregulated more than 2-fold during adipocyte differentiation [13]. Zhao et al. identified 21 lncRNAs enriched in brown adipose tissue that are upregulated during brown adipocyte differentiation through a microarray analysis that covered 31,423 annotated lncRNAs [14]. They further demonstrated that the overexpression of lncRNA-Blnc1 accelerates brown adipocyte differentiation. Lo et al. showed that 68 lncRNAs are dysregulated in high-fat diet (HFD)-fed obese mice and that lncRNA-Leptin accelerates adipogenesis by maintaining leptin expression [15].
Emerging studies have demonstrated that many lncRNAs control adipogenesis by regulating PPARγ signaling, which is a critical factor for adipogenesis. For instance, the overexpression of lncRNA-Plnc1 accelerates preadipocyte differentiation by activating PPAR-γ signaling [16]. lncRNA-U90926 expression is reduced during preadipocyte differentiation. Forced expression of lncRNA-U90926 suppresses adipogenesis by inhibiting PPAR-γ transactivation [9]. lncRNA-Acart (hereafter named Acart) is a newly identified lncRNA in fibrotic cardiac tissue that attenuates cardiomyocyte injury by activating PPARγ signaling [17]. Based on the above findings, the biological role of Acart in adipogenesis was investigated.
2. Materials and methods
2.1. Animal model and adipose tissues
Adult male C57BL/6 mice were purchased from the Shanghai Experimental Animal Center, housed at an optimal temperature and humidity, and given free access to water and food. The animal work was performed in accordance with the guidelines and regulations of the CCCA and the approval of the Animal Ethics Committee of Shanghai Shuguang Hospital (No. PZSHUTCM220124012). Obesity was achieved by feeding the mice an HFD (catalog number: D12492, Research Diets, NJ, USA) for 7 weeks (n = 5) [18]. Normal mice (n = 5) were fed a basal diet (BD, catalog number: D12450B, Research Diets). Mice were euthanized via isoflurane inhalation, and then, subcutaneous, perirenal, and epididymal fat was collected when the difference in body weight between the two groups was 30% [9].
Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by Animal Ethics Committee of Shanghai Shuguang Hospital (No. PZSHUTCM220124012).
2.2. Cell culture
A murine preadipocyte cell line, 3T3-L1, was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). These cells were maintained in complete medium (Dulbecco’s modified eagle’s medium supplemented with 10% fetal bovine serum; Product number: SLM-243-B; Sigma-Aldrich, MO, USA) in an incubator with 5% CO2 at 37°C, as described previously [19]. Two days after complete fusion, 3T3-L1 cells were induced to differentiate (Day 0, D0) using a previously described standard cocktail regimen: 0.5 mM IBMX (Product number: 15879; Sigma-Aldrich), 10−6 M dexamethasone (Product number: D4902; Sigma-Aldrich), and 5 µg/mL insulin (Product number: 12643; Sigma-Aldrich) (designated as MDI) [20]. Two days after this induction, the medium was replaced with complete medium supplemented with insulin (5 µg/mL) for 48 h. Finally, the cells were maintained in complete medium without any inducer.
2.3. RNA interference (RNAi) and overexpression
Oligomers for sh-Acart (forward, GATCCCCAGAAUCCCACACGUCAATTGCAATTGACGTGTGGGATTCTGGTTTTTT; reverse, CTAGAAAAAACCAGAAUCCCACACGUCAATTgcAATTGACGTGTGGGATTCTGGG) or shNegative Control (sh-NC) were synthesized from Sangon Biotech (Shanghai, Chain) and cloned into a pGE1 vector. Oligomers for sh-NC were as follows: forward, GATCCTTCTCCGAACGTGTCACGTTTGCAAACGTGACACGTTCGGAGAATTTTTT; reverse, CTAGAAAAAATTCTCCGAACGTGTCACGTTTGCAAACGTGACACGTTCGGAGAAG. sh-Acart and sh-NC were synthesized and cloned into pLKO.1 vector (Product number: 1.8787; Addgene, USA) to construct recombinant plasmids pLKO.1-sh-Acart and pLKO.1-sh-NC, respectively. pLKO.1-sh-Acart and pLKO.1-sh-NC were transfected into 3T3-L1 cells using lipofectamine 3000 (Product number: L300001; Invitrogen, CA, USA), and the interference efficiency was validated using quantitative real-time PCR (qRT-PCR) after 48 h. The recombinant plasmid of pcDNA-Acart was constructed to overexpress Acart in 3T3-L1 cells.
2.4. Oil Red O staining
After treatment with the specified reagents, 3T3-L1 cells (2 × 105 cells per well in six-well plates) were fixed with 4% PFA (Product number: P1110; Solarbio, Shanghai, China) and stained with Oil Red O (Product number: 08010-5; Solarbio) to assess lipid accumulation, as previously described [21]. After staining, cells were visualized and photographed using a microscope (Olympus, Tokyo, Japan).
2.5. qRT-PCR
Total RNA was extracted with TRIzol reagent (Product number: T9424; Sigma-Aldrich). Genomic DNA was degraded using DNase I (Product number: EN0521; Thermo Fisher Scientific) prior to reverse transcription. cDNA was synthesized using Moloney’s murine leukemia virus reverse transcriptase (Product number: M1302; Sigma-Aldrich) and random primers (3 µg/µL; Product number: 48190011; Invitrogen, CA, USA). qRT-PCR was performed in triplicate on a ABI 7500-Fast Real-Time PCR System (Applied Biosystem, CA, USA) using a OneStep qPCR kit (Product number: 210210; Qiagen, Duesseldorf, Germany). The temperature protocol was 95°C for 15 min, followed by 39 cycles of 95°C for 15 s and 58.5°C for 15 s. Beta (β)-actin served as an internal control. The mRNA levels were analyzed using the 2(−ΔΔCT) method [22]. The primer sequences are shown in Table 1. The specificity of qRT-PCR product was ascertained through gel electrophoresis and melt curve analysis.
Table 1.
qPCR primers used in the study
| Gene | Sense (5′–3′) | Anti-sense (5′–3′) | T m (°C) | PCR product size (bp) | Amplification efficiency (%) |
|---|---|---|---|---|---|
| ACART | TCAGTGGATTTATGTCTGTTGGG | AGAATGTACGTGTGTGTGTGTGTG | 59.3/58.3 | 162 | 94.9 |
| PPARγ | ACAGTTGATTTCTCCAGCATTTC | GCAGGTTCTACTTTGATCGCAC | 58.0/59.3 | 134 | 95.3 |
| C/EBPα | CGCAAGAGCCGAGATAAAGC | AGGCAGCTGGCGGAAGATG | 60.4/63.6 | 150 | 92.7 |
| FABP4 | GGTGAAGAGCATCATAACCCTAG | ATAACACATTCCACCACCAGC | 57.8/57.2 | 120 | 95.8 |
| AdipoQ | CGACCAGTATCAGGAAAAGAATG | GGAAGAGAAGAAAGCCAGTAAAT | 58.5/56.4 | 164 | 92.5 |
| β-Actin | AATCGTGCGTGACATCAAAGAG | AGGAAGGCTGGAAAAGAGCC | 60.3/60.1 | 176 | 96.2 |
Primer concentrations: 10 µM.
2.6. Western blot
3T3-L1 cells were lysed with RIPA buffer (Product number: R0010; Solarbio), and the protein concentration was quantified with a BCA protein assay kit (Product number: PC0020; Solarbio). For western blot analysis, equal amounts of protein were loaded on a 10% sodium dodecyl sulfate polyacrylamide gel electro-phoresis gel and then electrotransferred to polyvinylidene fluoride membranes (Product number: 1620177; Bio-Rad, CA, USA). The membranes were blocked with 5% nonfat milk for 90 min and then treated with antibodies against PPARγ (1:1,000, ab178866; Abcam, CA, USA), C/EBPα (1:800, ab40764; Abcam), BCL-2 (1:1,500, ab196495), BAX (1:3,000, ab32503), and β-actin (1:2,000, ab8226; Abcam) overnight at 4°C. An anti-rabbit secondary antibody (1:8,000, ab288151; Abcam) was used to treat the membranes, and an ECL kit (Pierce, IL, USA) was applied to visualize the membranes.
2.7. Cell proliferation
Cell proliferation assays were performed with cell counting kit (CCK)-8 reagent (Product number: CA1210; Solarbio). Briefly, 24 h after transfection with sh-Acart or sh-NC, 3T3-L1 cells were plated into 96-well plates (4 × 103 cells per well) and incubated for 1, 2, 3, and 4 days. Ten microliters of CCK-8 was added to the wells for 60 min, and then, the absorbance was measured at 450 nm with a microplate reader (Bio-Rad, CA, USA).
2.8. Edu incorporation assay
Twenty-four hours after transfection with sh-Acart or sh-NC, 3T3-L1 cells (0.5 × 105 cells per well in 24-well plates) were induced to differentiate for 24 h and labeled with EdU (Product number: CA1170; Solarbio) and Hoechst (Product number: CA1170; Solarbio) for 1 h. The fluorescence of EdU and Hoechst was observed using a BX53 fluorescence microscope (Olympus).
2.9. Data analysis
Data are shown as the mean ± standard deviation from three independent experiments. Statistical analysis was carried out using two-tailed Student’s t-test with SPSS 20.0 statistical software (IBM, NY, USA). p < 0.05 was considered statistically significant.
3. Results
3.1. Acart level was upregulated during preadipocyte differentiation
Acart is an lncRNA with 2193 bp in length, mainly located in cytoplasm (Figure A1(a–c)). In a previous study, Acart was identified to play an important role in protecting against cardiomyocyte injury by activating PPARγ signaling [17]. Given that PPARγ is an essential transcription factor in adipogenesis, we first investigated whether Acart was dysregulated during preadipocyte differentiation. To this end, the 3T3-L1 cell line, a well-established preadipocyte, was treated with MDI differentiation medium to simulate adipogenesis in vitro. As shown in Figure 1a, MDI treatment significantly increased lipid droplet accumulation in a time-dependent manner. To further validate 3T3-L1 preadipocyte differentiation, the expression of major adipogenesis markers was assessed. The results from qRT-PCR analysis revealed that the expression of Pparγ, C/ebpα, and Fabp4 exhibited a differentiation-dependent increase (Figure 1b). Based on these results, Acart level was assessed in 3T3-L1 cells during differentiation. Figure 1c shows that Acart levels were significantly upregulated during MDI-induced 3T3-L1 preadipocyte differentiation.
Figure 1.
Acart level was increased during preadipocyte differentiation. (a) 3T3-L1 cells were treated with MDI differentiation medium, and lipid accumulation was assayed using oil red O staining at D0, D2, D4, and D8. Scan bar = 100 µm. (b) 3T3-L1 cells were treated with MDI, and then qRT-PCR analysis was carried out to assess the mRNA level of Pparγ, C/ebpα, and Fabp4. (c) 3T3-L1 cells were treated with MDI, and then, qRT-PCR analysis was carried out to assess Acart levels. **p < 0.01, ***p < 0.001.
3.2. Acart was increased in adipose tissues from obese mice
To investigate the association of Acart with obesity, subcutaneous, perirenal, and epididymal fat was obtained from HFD obese mice and BD normal mice. As expected, Pparγ and C/ebpα expression levels were higher in subcutaneous, perirenal, and epididymal adipose tissues from mice with HFD-induced obesity than from mice fed a BD (Figure 2a–c). More importantly, Acart level was also markedly increased in subcutaneous, perirenal, and epididymal adipose tissues in HFD-fed obese mice compared with BD-fed normal mice (Figure 2d and f). We did not detect Acart expression in muscular tissues (Figure A2).
Figure 2.
Acart level was increased in adipose tissues from obese mice. Subcutaneous (a), perirenal (b), and epididymal (c) adipose tissues were collected from HFD-fed mice and BD-fed mice, and Pparγ and C/ebpα mRNA levels were assessed using the qRT-PCR analysis. Subcutaneous (d), perirenal (e), and epididymal (f) adipose tissues were collected from HFD-fed mice and BD-fed mice, and Acart levels were assessed using the qRT-PCR analysis. ***p < 0.001.
3.3. Acart depletion inhibited preadipocyte differentiation
To explore the biological role of Acart in preadipocyte differentiation, 3T3-L1 cells were treated with pLKO.1-sh-Acart to repress Acart level and then treated with MDI differentiation medium. The results from Oil Red O staining showed that Acart depletion resulted in a significant decrease in lipid droplet accumulation (Figure 3a). Figure 3b shows that the expression levels of four major adipogenesis markers (Pparγ, C/ebpα, Fabp4, and Adipoq) were decreased in Acart-deficient cells. The results from the western blot analysis revealed that PPARγ and C/EBPα protein expression levels were significantly decreased in Acart-deficient 3T3-L1 cells (Figure 3c–e).
Figure 3.
Acart depletion inhibited preadipocyte differentiation. (a) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 8 days, and lipid accumulation was assayed using oil red O staining. Scan bar = 100 µm. (b) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 8 days, and then qRT-PCR analysis was carried out to assess the mRNA levels of Acart, Pparγ, C/ebpα, Fabp4, and Adipoq. (c–e) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 8 days, and then western blot (c) and quantitative (d and e) analyses were carried out to assess PPARγ and C/EBPα protein expression. **p < 0.01, ***p < 0.001.
3.4. Acart depletion inhibited preadipocyte proliferation
Given that preadipocyte proliferation is an essential precondition for cell differentiation [19] and that Acart level is promptly increased during preadipocyte differentiation, the role of Acart in regulating preadipocyte proliferation was further explored. The results from the EdU assay showed that the EdU-positive cell proportion was significantly decreased in Acart-deficient cells compared with the negative control cells (Figure 4a and b). Acart knockdown increased BAX expression and decreased BCL-2 expression in 3T3-L1 cells, indicating that Acart knockdown facilitated cell apoptosis (Figure 4c). The CCK-8 assay revealed that cell proliferation was significantly repressed from day 2 to day 4 after Acart depletion (Figure 4d). Conversely, Acart overexpression accelerated preadipocyte proliferation (Figure 5a and b) and inhibited cell apoptosis (Figure 5c and d). Acart overexpression decreased BAX expression and increased BCL-2 expression in 3T3-L1 cells, indicating that Acart inhibited cell apoptosis (Figure 5e). The results from Oil Red O staining revealed that Acart overexpression resulted in a significant increase in lipid droplet accumulation (Figure 5f). These results demonstrate that Acart knockdown inhibits preadipocyte proliferation and differentiation.
Figure 4.
Acart depletion inhibited preadipocyte proliferation. (a and b) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 24 h, and then, an EdU assay was carried out to assess cell proliferation. (c) The protein expression of BAX and BCL-2 was assessed in 3T3-L1 cells after Acart knockdown. (d) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for different time periods, and then, a CCK-8 assay was carried out to assess cell proliferation. **p < 0.01.
Figure 5.
Acart overexpression accelerated preadipocyte proliferation and differentiation. (a and b) 3T3-L1 cells were treated with pcDNA-Acart and MDI for 24 h, and then, cell proliferation was assessed using the CCK-8 assay. After ACART overexpression, 3T3-L1 cells were treated with MDI for 24 h, and cell apoptosis (c and d) and lipid accumulation (f) were assayed using TUNEL and oil red O staining, respectively. (e) The protein expression of BAX and BCL-2 was assessed in 3T3-L1 cells after Acart overexpression. Scan bar = 100 µm. **p < 0.01.
4. Discussion
Adipocytes are a major component of adipose tissue and exert a critical role in homeostatically regulating whole body metabolism [23]. In addition to the primary function of controlling energy balance, adipocytes play an important role in regulating tissue metabolism [24], immune responses [25,26], insulin resistance [27], and cardiovascular disorders [23,28,29]. Preadipocyte differentiation is a complex multistep process involving many transcription factors and differentiation-related proteins and ncRNAs [8]. Here, we demonstrated that (1) Acart was upregulated during preadipocyte differentiation, (2) Acart was increased in adipose tissues from obese mice, (3) Acart silencing inhibited preadipocyte differentiation, and (4) Acart silencing inhibited preadipocyte proliferation. The current data identified the function of Acart in accelerating adipogenesis and indicated that Acart might exert an important role in adipogenesis.
PPARγ and C/EBPα synergistically control preadipocyte differentiation and are frequently used as markers to indicate adipose differentiation [30]. As a transcription factor, PPARγ can initiate the transcription of lipid metabolism-related mRNAs, including those for perilipin1 [31], fatty acid synthase [32], and insulin-like growth factor-binding protein-2 [33]. The mechanisms underlying PPARγ signaling activation are constantly being revealed. For instance, the upregulation of lncRNA-Gm15290 in adipose tissue accelerates fat deposition by activating PPARγ [34].
Recently, transcriptomic analyses have identified thousands of abnormally expressed lncRNAs during adipogenesis, and functional analyses have revealed the biological role of lncRNAs in adipocyte development and differentiation. Through microarray analysis, Xiao et al. revealed that 677 lncRNAs are downregulated and 513 lncRNAs are upregulated in mesenteric white adipose tissues (mWATs) from fasted mice compared with the mWATs from control mice [20]. Functional studies further demonstrated that the downregulation of lncRNA-Fr332443 contributes to adipogenesis by regulating RUNX1 and the mitogen-activated protein kinase pathway [20]. lncRNA-Plnc1 could upregulate PPARγ2 transcription and expression by repressing the methylation of the PPARγ2 promoter and thus promote adipogenesis [16].
In a recent study, a newly identified lncRNA, Acart, exerted a protective effect against cardiomyocyte injury by transactivating PPARγ signaling. Given the key role of PPARγ in adipogenesis, we next investigated whether Acart regulates preadipocyte differentiation. As expected, Acart was increased during 3T3-L1 preadipocyte differentiation. Moreover, Acart was markedly increased in obese mouse-derived adipose tissues. Functionally, Acart knockdown significantly decreased 3T3-L1 preadipocyte proliferation and differentiation. There are major limitations of this study. First, the direct effect of Acart on regulating PPARγ signaling activation has not been validated in 3T3-L1 cells. Second, the underlying mechanism by which Acart accelerates 3T3-L1 cell proliferation and differentiation has not been identified. Generally speaking, lncRNAs enriched in the nucleus epigenetically control gene expression by regulating histone methyltransferase- or deacetylase-mediated chromatin remodeling [35,36]. lncRNAs located in the cytoplasm commonly function as competing endogenous RNAs to control target gene expression [37,38]. It is essential to identify the subcellular localization of Acart in 3T3-L1 cells to explore the underlying mechanisms.
5. Conclusion
Acart knockdown contributes to inhibit 3T3-L1 preadipocyte proliferation and differentiation.
Appendix
Figure A1.
The basic information of Acart. (a) The full sequence of Acart (2193 bp). (b) The coding probability of Acart predicted by CPC2.0 tool (http://cpc2.gao-lab.org/). (c) The subcellular localization of Acart in 3T3-L1 cells.
Figure A2.

Acart expression in subcutaneous fat and muscular tissue. qRT-PCR analysis of Acart expression in subcutaneous fat and muscular tissue.
Footnotes
Funding information: Authors state no funding involved.
Conflict of interest: Authors state no conflict of interest.
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
- [1].Caballero B. Humans against obesity: Who Will Win? Adv Nutr. 2019;10:S4–9. [DOI] [PMC free article] [PubMed]
- [2].Ng M, Fleming T, Robinson M, Thomson B, Graetz N, Margono C, et al. Global, regional, and national prevalence of overweight and obesity in children and adults during 1980–2013: A systematic analysis for the Global Burden of Disease Study 2013. Lancet. 2014;384:766–81. [DOI] [PMC free article] [PubMed]
- [3].Apovian CM. The obesity epidemic–understanding the disease and the treatment. N Engl J Med. 2016;374:177–9. [DOI] [PubMed]
- [4].Di Cesare M, Soric M, Bovet P, Miranda JJ, Bhutta Z, Stevens GA, et al. The epidemiological burden of obesity in childhood: A worldwide epidemic requiring urgent action. BMC Med. 2019;17:212. [DOI] [PMC free article] [PubMed]
- [5].Vishvanath L, Gupta RK. Contribution of adipogenesis to healthy adipose tissue expansion in obesity. J Clin Invest. 2019;129:4022–31. [DOI] [PMC free article] [PubMed]
- [6].Haider N, Larose L. Harnessing adipogenesis to prevent obesity. Adipocyte. 2019;8:98–104. [DOI] [PMC free article] [PubMed]
- [7].Wei S, Du M, Jiang Z, Hausman GJ, Zhang L, Dodson MV. Long noncoding RNAs in regulating adipogenesis: New RNAs shed lights on obesity. Cell Mol Life Sci. 2016;73:2079–87. [DOI] [PMC free article] [PubMed]
- [8].Farmer SR. Transcriptional control of adipocyte formation. Cell Metab. 2006;4:263–73. [DOI] [PMC free article] [PubMed]
- [9].Chen J, Liu Y, Lu S, Yin L, Zong C, Cui S, et al. The role and possible mechanism of lncRNA U90926 in modulating 3T3-L1 preadipocyte differentiation. Int J Obes (Lond). 2017;41:299–308. [DOI] [PMC free article] [PubMed]
- [10].Squillaro T, Peluso G, Galderisi U, Di Bernardo G. Long non-coding RNAs in regulation of adipogenesis and adipose tissue function. eLife. 2020;9:e59053. [DOI] [PMC free article] [PubMed]
- [11].Lee JT. Lessons from X-chromosome inactivation: Long ncRNA as guides and tethers to the epigenome. Genes Dev. 2009;23:1831–42. [DOI] [PMC free article] [PubMed]
- [12].Ghafouri-Fard S, Taheri M. The expression profile and role of non-coding RNAs in obesity. Eur J Pharmacol. 2021;892:173809. [DOI] [PubMed]
- [13].Sun L, Goff LA, Trapnell C, Alexander R, Lo KA, Hacisuleyman E, et al. Long noncoding RNAs regulate adipogenesis. Proc Natl Acad Sci U S A. 2013;110:3387–92. [DOI] [PMC free article] [PubMed]
- [14].Zhao XY, Li S, Wang GX, Yu Q, Lin JD. A long noncoding RNA transcriptional regulatory circuit drives thermogenic adipocyte differentiation. Mol Cell. 2014;55:372–82. [DOI] [PMC free article] [PubMed]
- [15].Lo KA, Huang S, Walet ACE, Zhang ZC, Leow MK, Liu M, et al. Adipocyte long-noncoding rna transcriptome analysis of obese mice identified lnc-leptin, which regulates leptin. Diabetes. 2018;67:1045–56. [DOI] [PubMed]
- [16].Zhu E, Zhang J, Li Y, Yuan H, Zhou J, Wang B. Long noncoding RNA Plnc1 controls adipocyte differentiation by regulating peroxisome proliferator-activated receptor gamma. FASEB J. 2019;33:2396–408. [DOI] [PubMed]
- [17].Wu H, Zhu H, Zhuang Y, Zhang J, Ding X, Zhan L, et al. LncRNA ACART protects cardiomyocytes from apoptosis by activating PPAR-gamma/Bcl-2 pathway. J Cell Mol Med. 2020;24:737–46. [DOI] [PMC free article] [PubMed]
- [18].Park Y, Jang I, Park HY, Kim J, Lim K. Hypoxic exposure can improve blood glycemic control in high-fat diet-induced obese mice. Phys Act Nutr. 2020;24:19–23. [DOI] [PMC free article] [PubMed]
- [19].Wang Z, Luo Z, Dai Z, Zhong Y, Liu X, Zuo C. Long non-coding RNA lnc-OAD is required for adipocyte differentiation in 3T3-L1 preadipocytes. Biochem Biophys Res Commun. 2019;511:753–8. [DOI] [PubMed]
- [20].Xiao F, Tang CY, Tang HN, Wu HX, Hu N, Li L, et al. Long non-coding RNA 332443 inhibits preadipocyte differentiation by targeting Runx1 and p38-MAPK and ERK1/2-MAPK signaling pathways. Front Cell Dev Biol. 2021;9:663959. [DOI] [PMC free article] [PubMed]
- [21].Fink T, Zachar V. Adipogenic differentiation of human mesenchymal stem cells. Methods Mol Biol. 2011;698:243–51. [DOI] [PubMed]
- [22].Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–8. [DOI] [PubMed]
- [23].Ali AT, Hochfeld WE, Myburgh R, Pepper MS. Adipocyte and adipogenesis. Eur J Cell Biol. 2013;92:229–36. [DOI] [PubMed]
- [24].Kahn CR, Wang G, Lee KY. Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome. J Clin Invest. 2019;129:3990–4000. [DOI] [PMC free article] [PubMed]
- [25].Rajbhandari P, Arneson D, Hart SK, Ahn IS, Diamante G, Santos LC, et al. Single cell analysis reveals immune cell-adipocyte crosstalk regulating the transcription of thermogenic adipocytes. eLife. 2019;8:e49501. [DOI] [PMC free article] [PubMed]
- [26].Maurizi G, Della Guardia L, Maurizi A, Poloni A. Adipocytes properties and crosstalk with immune system in obesity-related inflammation. J Cell Physiol. 2018;233:88–97. [DOI] [PubMed]
- [27].Morigny P, Houssier M, Mouisel E, Langin D. Adipocyte lipolysis and insulin resistance. Biochimie. 2016;125:259–66. [DOI] [PubMed]
- [28].Ryden M, Arner P. Cardiovascular risk score is linked to subcutaneous adipocyte size and lipid metabolism. J Intern Med. 2017;282:220–8. [DOI] [PubMed]
- [29].Nakayama Y, Fujiu K. Effects of adipocyte expansion on cardiovascular system and ongoing debate over obesity paradox. Int Heart J. 2019;60:499–502. [DOI] [PubMed]
- [30].Cristancho AG, Lazar MA. Forming functional fat: A growing understanding of adipocyte differentiation. Nat Rev Mol Cell Biol. 2011;12:722–34. [DOI] [PMC free article] [PubMed]
- [31].Sun Y, Zhai G, Li R, Zhou W, Li Y, Cao Z, et al. RXRalpha positively regulates expression of the chicken PLIN1 gene in a PPARgamma-independent manner and promotes adipogenesis. Front Cell Dev Biol. 2020;8:349. [DOI] [PMC free article] [PubMed]
- [32].Zhang W, Sun Q, Zhong W, Sun X, Zhou Z. Hepatic peroxisome proliferator-activated receptor gamma signaling contributes to alcohol-induced hepatic steatosis and inflammation in mice. Alcohol Clin Exp Res. 2016;40:988–99. [DOI] [PMC free article] [PubMed]
- [33].Kang HS, Kim MY, Kim SJ, Lee JH, Kim YD, Seo YK, et al. Regulation of IGFBP-2 expression during fasting. Biochem J. 2015;467:453–60. [DOI] [PMC free article] [PubMed]
- [34].Liu W, Ma C, Yang B, Yin C, Zhang B, Xiao Y. LncRNA Gm15290 sponges miR-27b to promote PPARgamma-induced fat deposition and contribute to body weight gain in mice. Biochem Biophys Res Commun. 2017;493:1168–75. [DOI] [PubMed]
- [35].Sun Q, Hao Q, Prasanth KV. Nuclear long noncoding RNAs: Key regulators of gene expression. Trends Genet. 2018;34:142–57. [DOI] [PMC free article] [PubMed]
- [36].Xiao T, Liu L, Li H, Sun Y, Luo H, Li T, et al. Long noncoding RNA ADINR regulates adipogenesis by transcriptionally activating C/EBPalpha. Stem Cell Reports. 2015;5:856–65. [DOI] [PMC free article] [PubMed]
- [37].Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: The rosetta stone of a hidden RNA language? Cell. 2011;146:353–8. [DOI] [PMC free article] [PubMed]
- [38].Guo L, Chao X, Huang W, Li Z, Luan K, Ye M, et al. Whole transcriptome analysis reveals a potential regulatory mechanism of LncRNA-FNIP2/miR-24-3p/FNIP2 Axis in chicken adipogenesis. Front Cell Dev Biol. 2021;9:653798. [DOI] [PMC free article] [PubMed]






