Abstract
In the present study, the occurrence of indicator antibiotic-resistant bacteria (ARB) and antibiotic resistance genes (ARGs) both in the influent and the effluent of four Spanish wastewater treatment plants (WWTPs) was monitored for 12 months, and the susceptibility profiles of 89 recovered extended spectrum β-lactamase (ESBL)-producing Escherichia coli isolates were obtained against a wide range of antimicrobials. The aim of the study was to better understand whether the current wastewater treatment practices allow us to obtain safe reclaimed water mitigating the spread of ARB and ARGs to the environment. Results showed high concentrations of ESBL-producing E. coli as well as a high prevalence of a range of ARGs in the influent samples. The reclamation treatments implemented in the WWTPs were effective in reducing both the occurrence of ESBL E. coli and ARGs, although significant differences were observed among WWTPs. Despite these reductions in occurrence observed upon wastewater treatment, our findings suggest that WWTP effluents may represent an important source of ARGs, which could be transferred among environmental bacteria and disseminate antimicrobial resistance through the food chain. Remarkably, no major differences were observed in the susceptibility profiles of the ESBL E. coli isolated from influent and effluent waters, indicating that water treatments do not give rise to the emergence of new resistance phenotypes.
Keywords: wastewater treatment plants (WWTPs), antibiotic-resistant bacteria (ARB), antibiotic resistance genes (ARGs), extended spectrum β-lactamase (ESBL)-producing Escherichia coli, reclaimed water
1. Introduction
The spread of antimicrobial resistant bacteria (ARB) and antimicrobial resistance genes (ARGs) is considered a major threat to human health, requiring an urgent action plan across every domain where the environment plays an important role [1]. A growing set of evidence suggests that the environment is a great contributor to the dissemination of ARB and ARGs [2,3,4]. Among these reservoirs, urban wastewater treatment plants (WWTPs) have been considered hotspots for antimicrobial resistance spread [2,5,6,7,8]. A meta-analysis study based on 57 works concluded that the prevalence of extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae in wastewater has been increasing over the years [9]. Additionally, the same study reported a high prevalence for blaCTX-M genes in Enterobacteriaceae isolated from wastewater, accounting for approximately 67% of the ESBL genes detected, which is an important indicator of the spread of antimicrobial resistance.
Water scarcity is also recognized as one of the leading challenges of our time, with agricultural activity being one of its main drivers [10]. To overcome this global problem, the European Commission promotes an integrated water management approach, in which treated wastewater from urban WWTPs can represent an alternative water source to alleviate the demand for irrigation water [11]. Reclaimed water re-used for agriculture irrigation should meet some minimum quality requirements (MQR) to guarantee its safety, thus ensuring protection not only of the environment but also of human and animal health [11]. However, there is still a general unwillingness to accept reclaimed treated wastewater for irrigation partly due to the limited information existing on the efficacy of treatments applied in urban WWTPs to remove microbial contaminants, including ARB and ARGs, which may lead to their introduction in the farm fields. Some efforts have been made to study the elimination of microbial contaminants by various wastewater treatment processes [12]; however, the knowledge available on the selection and spread of ARB, as well as ARGs, in urban WWTPs is still limited. Some reports have recognized that conventional wastewater treatments are not completely effective in the removal or significant reduction of the potential risks to the environment posed by ARB and ARGs and that the application of advanced wastewater treatment technologies is necessary to control their occurrence and consequent release [13,14]. In this regard, in addition to the conventional secondary and tertiary wastewater treatment processes usually implemented in urban WWTPs, different methods have been recently studied and applied, including chlorination, adsorption and advanced oxidation processes, such as UV radiation, Fenton-reaction, solar-driven Fenton oxidation, photocatalytic oxidation, ozonation and ionizing radiation [15,16,17,18,19,20,21,22,23].
Some of the ARGs most commonly identified in urban WWTPs include integrase genes and genes associated with resistance to β-lactams, quinolones, sulfonamides, tetracyclines and macrolides [24]. Nevertheless, contradictory results have been reported regarding the occurrence of ARB and ARGs in WWTP effluents as compared to influents. Slightly higher antimicrobial resistance prevalence for enterococci and Escherichia coli [25] and Enterobacteriaceae [26] isolates were reported in WWTP effluents, as compared to influents. Similarly, an increased abundance of ARGs was found in WWTP effluents, as compared to influents, despite the significant reductions of about 99% obtained in the number of total bacteria [27,28,29]. Alexander et al. [27] reported a general increase in the abundance and release of three (vanA, blaVIM-1 and ampC) out of four studied ARGs in the effluent of four WWTPs, as compared to the influents. However, the opposite trends have also been reported on other occasions. Yang et al. [30] reported a significant decrease in the abundance and diversity of ARGs revealed through the metagenomic sequencing of WWTP effluents. These authors reported lower relative abundances of tetracycline, multidrug and aminoglycoside resistance genes in the effluent as compared to influent samples. These findings agree with those of other studies, where a reduction of ARGs after the wastewater treatment process has also been detected [31,32]. Likewise, multi-drug resistant bacteria from different bacterial species found in the influent disappeared completely in post-treated effluents [33].
Based on published works, fecal indicators, including total coliforms, enterococci and E. coli, are the ARBs most frequently detected in urban WWTP samples. For example, Ferreira da Silva et al. [34] found high numbers of E. coli strains resistant to amoxicillin and tetracycline isolated from the treated effluent. Bacterial resistance to β-lactam antibiotics, classified as first-line antibiotics for common infections, has been reported worldwide, and the presence of ESBL-producing E. coli strains in effluent samples from urban WWTPs may contribute to its spread throughout the food chain, mainly through irrigation of fresh produce [35,36,37]. ESBL-producing E. coli are considered a One Health antimicrobial resistance (AMR) surveillance target due to several aspects, including their long use as a subject of environmental surveillance, as well as an indicator of faecal contamination in the microbial monitoring of food and water from WWTPs [38].
Previous studies focused on the surveillance of ARB and ARGs highlighted the need to implement regular surveillance and control measures, which may need to be appropriate for the geographic regions [3]. Additionally, there is an urgent need to validate the potential for wastewater treatments currently implemented in the WWTPs as an antibiotic resistance critical control point. The present study will therefore assess the occurrence of indicator ARB and ARGs both in the influent and the effluent of four Spanish WWTPs following different approaches for urban wastewater disinfection. Furthermore, the susceptibility profiles of 89 recovered ESBL-producing E. coli isolates against a wide range of antimicrobials were also examined in order to better understand whether the current wastewater treatment practices allow us to obtain safe reclaimed water mitigating the spread of ARB and ARGs to the environment.
2. Materials and Methods
2.1. Urban Wastewater Treatment Plants (WWTPs)
Four urban WWTPs (plants A, B, C and D) with different treatment systems located in the south of Spain were used in this study. WWTP-A processed approximately 2750 m3 per day of mainly domestic wastewater from a population of about 35,252 inhabitants. WWTP-B treated approximately 4168 m3 per day of both domestic and industrial wastewater for a population of about 24,866 inhabitants. The amount of treated domestic and industrial wastewater from WWTP-C was about 1950 m3 per day for a population of about 12,062 inhabitants. In the case of WWTP-D, the amount of treated wastewater that flowed through was about 1850 m3 per day for a population of about 11,400 inhabitants. The schematic diagram of each WWTP is shown in Figure 1. In general, wastewater is primarily treated through aeration grit, including separation of suspended solids and particles, desanding-grease removal and a primary setting tank of different dimensions. The secondary treatment consists of a biological aerobic or anaerobic process in a secondary settling tank, including coagulation/flocculation and complementary lamellar clarification. In addition, disinfection processes are carried out with chlorine (Cl), ultraviolet radiation (UV) or the combination of chlorine/UV, or peracetic acid (PAA)/UV as tertiary treatments (Table 1). The disinfection treatments applied are adjusted based on the minimum effective doses required to meet microbiological quality standards. For those urban WWTPs that used chlorine, sodium hypochlorite with 10–20% active chlorine (NewChem, SL, Alicante, Spain) was added to maintain a residual concentration of free chlorine (FC) that varies between 0.1 and 3.0 mg/L. Combined treatments are performed by adding an aqueous chlorine solution or PAA into the tank, followed by a closed pipe or open channel UV disinfection system. UV doses ranged between 20–40 mJ/cm2. In the case of UV/PAA, a commercial solution of 15% PAA + 16% acetic acid + 24% hydrogen peroxide is used (Brenntag, Essen, Germany), reaching PAA concentrations between 3.0 and 5.0 mg/L.
Figure 1.
Schematic diagram of each WWTP including pre-, secondary and tertiary treatments applied.
Table 1.
Urban wastewater Treatment Plants (WWTPs), sampling times, treated effluent flow and disinfection system: chlorine, peracetic acid (PAA), ultraviolet radiation (UV).
| Sampling Times | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Urban WWTPs | Parameters | 06/2020 | 07/2020 | 08/2020 | 09/2020 | 10/2020 | 11/2020 | 12/2020 | 01/2021 | 02/2021 | 03/2021 | 04/2021 | 05/2021 |
| A | Treatment | UV | UV | UV | Cl + UV | Cl + UV | UV | UV | UV | UV | PAA + UV | PAA + UV | PAA + UV |
| Effluent Flow (m3/day) | _____ | _____ | 2916 | 2600 | 2430 | 2029 | 2065 | 2126 | 1897 | 2900 | 2441 | 2441 | |
| B | Treatment | Cl + UV | Cl + UV | Cl + UV | Cl + UV | PAA + UV | PAA + UV | PAA + UV | PAA + UV | PAA + UV | PAA + UV | PAA + UV | PAA + UV |
| Effluent Flow (m3/day) | 4479 | 4180 | 4050 | 4065 | 3921 | 4150 | 3894 | _____ | _____ | _____ | _____ | _____ | |
| C | Treatment | UV | Cl | UV | Cl + UV | UV | UV | PAA + UV | PAA + UV | PAA + UV | UV | UV | UV |
| Effluent Flow (m3/day) | 1700 | 1740 | 1533 | 1641 | 1673 | 1520 | 1529 | 1616 | 1714 | 2560 | 4284 | 2769 | |
| D | Treatment | Cl | UV | UV | Cl + UV | UV | UV | UV | UV | UV | UV | UV | UV |
| Effluent Flow (m3/day) | 1115 | 3366 | _____ | 2272 | 1015 | 1895 | 2156 | 1914 | _____ | 2504 | 2838 | _____ | |
2.2. Wastewater Sample Collection
The information regarding sampling time and tertiary treatment applied for each urban WWTP is shown in Table 1. Eight raw wastewater (influent) and tertiary effluent samples were collected monthly over a one-year period (June 2020 to May 2021) from the four urban WWTPs (plants A, B, C and D). Due to a mistake during sampling at WWTP-A, some samples were collected before the UV treatment was completed. The specific sampling times when this happened were June 2020, August 2020, November 2020, December 2020 and January to May 2021. Collected samples (1 L) in sterile polypropylene plastic bottles (Labbox Labware S.L., Barcelona, Spain) were stored under refrigeration conditions, transported within 2 h to the laboratory and stored at 4 °C until their analysis.
2.3. Enumeration and Isolation of Extended-Spectrum β-Lactamase-Producing E. coli (ESBL E. coli)
A standard plate count method on CHROMagar ESBL (CHROMagar, Paris, France) plates was used for the enumeration of ESBL E. coli in all water samples. Depending on the expected bacterial concentration, serial decimal dilutions were prepared in sterile 0.2% buffered peptone water (BPW, Scharlab, Barcelona, Spain) and, subsequently, spread plating (0.1 mL), pour plating (1 mL) or membrane filtration (10 and 100 mL) methods were used. Samples were filtered through 0.45 μm cellulose nitrate membrane filters (Sartorius, Madrid, Spain) using a filter holder manifold (Millipore, Madrid, Spain). Plates were then incubated for 24 h at 37 °C, and dark pink-reddish colonies were counted. The analysis was performed in duplicate, and the results were expressed as cfu/100 mL. The detection limit (LOD) for ESBL E. coli counts in the raw water samples was 3.0 log cfu/100 mL (100 cfu/100 mL), while in the tertiary effluents, the LOD was 0 log cfu/100 mL (1 cfu/100 mL). When possible, five dark pink-reddish colonies on E. coli ESBL agar were picked from each positive sample and sub-cultured in brain infusion (BHI) at 37 °C for 24 h. After incubation, 1 mL of each culture was supplemented with 30% glycerol and kept at −20 °C until further analysis.
2.4. Wastewater DNA Extraction
Influent samples (10 mL) were concentrated by carrying out one centrifugation at 3000× g for 10 min. The supernatant was removed, and the pellet was resuspended in 1 mL of phosphate-buffered saline (PBS, Sigma-Aldrich, LS, USA). Subsequently, the resuspended pellet was centrifuged at 9000× g, 4 °C, for 10 min, and the supernatant was discarded. In the case of the effluent samples, water samples (100 mL each) were vacuum filtered through sterile cellulose nitrate filters (0.45 µm). Filters were placed in falcon tubes (50 mL) containing 20 mL of PBS (Sigma-Aldrich) supplemented with Tween 80 (1 mL/L; Sigma-Aldrich) and shaken in a vortex for 7 min. After that, the filters were removed, and the tubes were centrifuged at 3000× g for 10 min. Then, the supernatant was discarded, and the pellet was resuspended in PBS (1 mL). The resuspended pellet was concentrated by centrifugation (9000× g, 4 °C, 10 min). Influent and effluent pellets were kept at −20 °C until the genomic DNA extraction was performed. Genomic DNA was extracted and purified using the MasterPure™ kit (Lucigen, WI, USA) following the manufacturer’s instructions. An Implen NanoPhotometer N60/50 (Implen, Munich, Germany) was used to determine the concentration and purity of the DNA. All DNA samples were stored at −20 °C.
2.5. Antimicrobial Resistance Genes (ARGs) Detection
The presence of the ARGs blaCTX-M-G1, blaTEM, catl, cmlA, qnrA, qnrB, sul1, sul2, tetA and tetB was assessed by conventional polymerase chain reaction (PCR) using a T10Si 0 thermal cycler (Bio-Rad, CA, USA). Primer sequences and main PCR conditions are listed in Table 2. PCR reactions were performed in a 25 µL reaction mixture containing 5 µL of 5 × Flexi Buffer (Promega, Madison, WI, USA), 5 µL of 25 mM MgCl2, 0.50 µL of 10 mM dNTPs, 0.20 µL of 5 U/µL GoTaq G2 Hot Start Polymerase (Promega, Madison, WI, USA), DNAse free water and the primers listed in Table 2. In all cases, a non-template control (NTC) was included using 1 µL of DNAse free water instead of the DNA template. The PCR products were analyzed by electrophoresis of 2% agarose gels (SeaKem LE agarose, Lonza) supplemented with Red-dye staining (Biotium, Hayward, CA, USA) in Tris-borate-EDTA (TBE) buffer (89 mM Tris, 89 mM boric acid, 2.5 mM EDTA) at 80 V for 50–60 min. UV fluorescence emission was recorded and quantified by using ImageQuant™ LAS 500 (GE Healthcare Bio-Sciences AB).
Table 2.
Conventional PCR primers used in this study.
| Target Gene | Primer Sequence (5′ → 3′) | Concentration (µM) | Cycling Parameters | Amplicon Size (bp) | Reference | |
|---|---|---|---|---|---|---|
| bla CTX-M-G1 | FW | TTAGGAARTGTGCCGCTGYA | 0.4 | 94 °C for 10 min; 35 cycles (94 °C for 40 s, 60 °C for 40 s, 72 °C for 1 min); 72 °C for 10 min | 688 | [39] |
| RV | CGATATCGTTGGTGGTRCCAT | |||||
| bla TEM | FW | CATTTCCGTGTCGCCCTTATTC | 0.4 | 94 °C for 10 min; 30 cycles (94 °C for 40 s, 60 °C for 40 s, 72 °C for 1 min); 72 °C for 10 min | 800 | [39] |
| RV | CGTTCATCCATAGTTGCCTGAC | |||||
| catA1 | FW | GGTGATATGGGATAGTGTT | 0.4 | 95 °C for 7 min; 34 cycles (95 °C for 40 s, 55 °C for 1 min, 72 °C for 40 s); 72 °C for 5 min | 349 | [40] |
| RV | CCATCACATACTGCATGATG | |||||
| cmlA | FW | GCCAGCAGTGCCGTTTAT | 1 | 95 °C for 5 min; 35 cycles (95 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s); 72 °C for 7 min | 158 | [41] |
| RV | GGCCACCTCCCAGTAGAA | |||||
| qnrA | FW | GATAAAGTTTTTCAGCAAGAGG | 0.5 | 95 °C for 7 min; 34 cycles (95 °C for 40 s, 55 °C for 1 min, 72 °C for 40 s); 72 °C for 5 min | 543 | [42] |
| RV | ATCCAGATCGGCAAAGGTTA | |||||
| qnrB | FW | GATCGTGAAAGCCAGAAAGG | 0.5 | 95 °C for 5 min; 38 cycles (95 °C for 40 s, 50 °C for 40 s, 72 °C for 40 s); 72 °C for 7 min | 476 | [42] |
| RV | ATGAGCAACGATGCCTGGTA | |||||
| sul1 | FW | TGAGATCAGACGTATTGCGC | 1 | 95 °C for 4 min; 32 cycles (95 °C for 2 min, 52,7 °C for 2 min, 72 °C for 2 min); 72 °C for 10 min | 400 | [43] |
| RV | TTGAAGGTTCGACAGCACGT | |||||
| sul2 | FW | GCGCTCAAGGCAGATGGCATT | 1 | 94 °C for 5 min; 30 cycles (94 °C for 15 s, 69 °C for 30 s, 72 °C for 60 s); 72 °C for 7 min | 293 | [44] |
| RV | GCGTTTGATACCGGCACCCGT | |||||
| tetA | FW | GTAATTCTGAGCACTGTCGC | 0.4 | 94 °C for 3 min; 25 cycles (94 °C for 1 min, 57 °C for 1 min, 72 °C for 1 min); 72 °C for 10 min | 956 | [45] |
| RV | CTGCCTGGACAACATTGCTT | |||||
| tetB | FW | AAAACTTATTATATTATAGTG | 0.4 | 94 °C for 3 min; 30 cycles (94 °C for 1 min, 52 °C for 1 min, 72 °C for 1 min); 72 °C for 10 min | 169 | [46] |
| RV | TGGAGTATCAATAATATTCAC | |||||
2.6. Antibiotic Susceptibility Testing (AST)
A total of 89 ESBL E. coli isolates obtained from WWTP-A were subjected to AST. This treatment plant was selected considering that it contained the highest load of ESBL E. coli both in influent and effluent samples. The susceptibility of ESBL E. coli isolates to different antibiotics was determined by the microdilution method using Sensititre EUVSEC plates (Thermo Scientific, TREK Diagnostic Systems Ltd., East Grinstead, UK), according to the manufacturer’s instructions. Briefly, ESBL E. coli isolates cultured in Brain Heart Infusion broth (BHI, Merck, Germany) at 37 °C for 24 h were suspended in 10 mL of sterile water to reach a turbidity of McFarland 0.5. Subsequently, 20 µL of the ESBL E. coli suspension was transferred to 11 mL of Mueller-Hinton broth (Thermo Scientific, TREK Diagnostic Systems Ltd., East Grinstead, UK), and each well of the AST plate was filled in with 50 μL of the suspension using the Sensititre AIM Automated Inoculation Delivery System (Thermo Scientific, TREK Diagnostic Systems Ltd., East Grinstead, UK). After incubation at 37 °C for 24 h, the absence/presence of growth in each well was visually assessed to calculate the minimum inhibitory concentration of each antibiotic. The resistant or sensitive status of the isolate for each of the antimicrobials tested was determined considering the epidemiological cut-off value (ECOFF) of EUCAST (European Committee of Antimicrobial Susceptibility Testing). The antibiotics included in the AST panel were: sulfamethoxazole, trimethoprim, ciprofloxacin, tetracycline, meropenem, azithromycin, nalidixic acid, cefotaxime, chloramphenicol, tigecycline, ceftazidime, colistin, ampicillin and gentamicin.
2.7. Statistical Analysis
Non-zero microbial counts, evaluated by plating, were log-transformed (base-10) and stored along with zero counts (samples with undetected contamination) in an Excel spreadsheet (Microsoft Excel, 2016). For calculation and graphical representation of the median and interquartile range of microbial counts, only positive samples were included. Differences in log cfu/100 mL and prevalence (%) of ARGs were statistically analyzed after grouping them based on the WWTP (A, B, C, D) and the type of sample (influent and effluent) by using the post hoc Wilcoxon test, with significance established at p < 0.05. Boxplots were generated with ggplot2 R-package. The antibiotic resistance profile of ESBL E. coli isolates to different groups of antimicrobials was represented in a heatmap generated with the pheatmap R-package. The statistical analyses were performed with R Studio (v 4.0.4).
3. Results and Discussion
The environment is thought to play an important role in the dissemination of antimicrobial resistance, with ESBL-producing E. coli being considered a relevant threat that particularly contributes to the horizontal transfer of critically important resistance determinants through the food chain. The current study demonstrates the frequent occurrence of ESBL-producing E. coli and of a range of indicator ARGs (including the ESBL genes blaCTX-M and blaTEM) both in influent and effluent waters from four Spanish WWTPs. Thus far, very few studies have examined the spatio-temporal distribution of ESBL-producing E. coli in urban WWTPs; therefore, it is difficult to find data for identical or even similar conditions across studies to compare the efficacy of tertiary treatments in their removal.
3.1. Occurrence of ESBL Producing E. coli in Wastewater Samples
The spatio-temporal distribution of ESBL-producing E. coli counts in the four WWTPs studied during the one-year sampling period are presented in Figure 2A. Little variation, with similar medians among the different WWTPs in the influent counts, was observed (Figure 2B). ESBL-producing E. coli counts ranged from 4.1 to 5.8 log cfu/100 mL in WWTP-A, 4.5 to 6.6 log cfu/100 mL in WWTP-B, 4.8 to 6.4 log cfu/100 mL in WWTP-C and 4.4 to 5.6 log cfu/100 mL in WWTP-D. In general, the ESBL E. coli counts observed in the influent samples were quite high, with an overall mean of about 5.0 log units/100 mL, demonstrating that urban wastewater is an important reservoir of these bacteria. Similar concentrations of ESBL-producing E. coli in untreated urban wastewater were observed by Haberecht et al. [47], with 2.3 × 105 cfu/100 mL, whereas Schmiege et al. [48] reported higher ESBL E. coli counts (7.5 × 105 cfu/mL). Regarding the effluent samples in our study, significantly lower concentrations of ESBL-producing E. coli were observed (Figure 2B), with counts ranging from <LOD to 3.1 log cfu/100 mL in WWTP-A, <LOD to 4.2 log cfu/100 mL in WWTP-B, <LOD to 2.3 log cfu/100 mL in WWTP-C and <LOD to 2.7 log cfu/100 mL in WWTP-D. In general, the average concentration of ESBL-producing E. coli in the effluent water was below 1.0 log unit/100 mL, with most samples providing results below the detection limit (1 cfu/100 mL), with the exception of samples from WWTP-A, with an average count of approximately 2.0 log cfu/100 mL. It should be considered that in specific sampling times, effluent samples from the WWTP-A were collected before the UV treatment had been finalized, which affected the counts of ESBL-producing E. coli, particularly from November 2020 to May 2021. The fact that several sampling points showed results below the limit of detection (Figure 2A), mainly in WWTP-B, C and D, demonstrates that wastewater reclamation processes, including primary, secondary and tertiary treatments, were able to reduce ESBL E. coli counts in about 5.0 log units. These results highlight the efficacy of the water treatments employed, which are mainly UV light alone or in combination with chlorine and PAA, in reducing the ESBL E. coli load. Similarly, low levels of ESBL E. coli (around 2 cfu/mL) were previously reported by Raven et al. [49] in effluent waters after UV treatment as a disinfection method. Also, Bréchet et al. [50] observed lower concentrations of ESBL-producing E. coli in the treated water than in the untreated water (22 vs. 481 cfu/100 mL, respectively). In this case, the water was subjected to a typical flow treatment, including sedimentation, biological degradation and effluent polishing, without specification on the disinfection method used. Nzima et al. [51] determined the occurrence of ESBL-producing E. coli in surface water receiving an effluent discharge from a WWTP, and higher counts in the range of 2.5–3.3 log cfu/mL, were detected in all effluent samples when compared to our study. On the other hand, Solaiman et al. [52] reported that ESBL-producing E. coli were recovered at low prevalence in the ponds, rivers and reclaimed water examined.
Figure 2.
Spatio-temporal (A) and spatial (B) distribution of ESBL-producing E. coli (log cfu/100 mL) in influent and effluent samples for all four WWTPs between June 2020 and May 2021. In the boxplot, the solid horizontal line represents the median, and the box displays the 25–75% quartile range. Only significant p values (p < 0.05) obtained from the Wilcoxon signed-rank test analysis are indicated (**).
Although a significant reduction of ESBL-producing E. coli counts was observed in effluent samples, as compared with influents, occasionally, higher counts were detected in different sampling months that exceeded 2.0 log units/100 mL. These outlier points were mostly observed in WWTP-B and D (Figure 2B), while samples from WWTP-A consistently showed high ESBL E. coli levels throughout most of the sampling period due to an incomplete application of the UV treatment. Nevertheless, significant differences (p < 0.05) were only observed between the counts in effluent samples from WWTP-A with respect to the samples taken from WWTP-C. It is worth mentioning that these occasional increases in ESBL E. coli counts in each of the WWTPs took place in different sampling months; hence they cannot be attributed to a seasonal influence. Seasonal differences were previously observed by Schmiege et al. [48], who reported higher ESBL E. coli counts during the winter season, indicating a higher antibiotic use against infections among the population in cold months. Similar trends were also documented in previous works [53,54]. The specific increases observed in our study can be due to different events, including factors related to the operation of the treatment plant or extrinsic factors, such as weather conditions or specific waste discharges.
3.2. Prevalence of Indicator ARGs in the Wastewater Collected from WWTPs
The prevalence and distribution of ten ARGs associated with resistance to tetracycline (tetA, tetB), sulfonamides (sul1, sul2), quinolones (qnrA, qnrB), β-lactams (blaCTX-M-G1, blaTEM) and chloramphenicol (catI, cmlA) in the influent and effluent samples are shown in Table 3 and Figure 3. The ten studied ARGs were detected in the influent samples from all WWTPs with a very high prevalence, which ranged from 50 (six out of 12 samples) to 100%, with the only exception of the qnrA gene, which was detected in five out of 12 samples (41.67%) from WWTP-D (Table 3). The genes cmlA and sul2, associated with resistance to chloramphenicol and sulfonamides, respectively, were the most prevalent ARGs, with a prevalence of 100% in all WWTP influents. Moreover, the ARGs blaTEM, catI, sul1 and tetA showed more than 80% prevalence in all WWTP influents. On the other extreme, ARGs associated with resistance to quinolones showed the lowest prevalence in all influent samples, which ranged from 41.67 to 66.67%. In Figure 3, the distribution of the prevalences obtained for all tested ARGs in influent and effluent samples for each WWTP showed statistical differences (p < 0.05) for effluent samples between WWTP-A, B and C and WWTP-D, with this latter one having, in general, the lowest ARG prevalences (Figure 3B).
Table 3.
Prevalence (%) of different ARGs detected in influent and effluent samples of each Urban Wastewater Treatment Plant (WWTP).
| Gene (nº Positive Samples/nº Total Samples) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Urban WWTPs | Sampling Site | bla CTX-M-G1 | bla TEM | sul1 | sul2 | catI | cmlA | qnrA | qnrB | tetA | tetB |
| A | Influent | 83.33 (10/12) |
91.67 (11/12) |
83.33 (10/12) |
100 (12/12) |
100 (12/12) |
100 (12/12) |
50.00 (6/12) |
66.67 (8/12) |
100 (12/12) |
100 (12/12) |
| Effluent | 66.67 (8/12) |
91.67 (11/12) |
75.00 (9/12) |
91.67 (11/12) |
91.67 (11/12) |
91.67 (11/12) |
25.00 (3/12) |
58.33 (7/12) |
66.67 (8/12) |
83.33 (10/12) |
|
| B | Influent | 75.00 (9/12) |
100 (12/12) |
91.67 (11/12) |
100 (12/12) |
83.33 (10/12) |
100 (12/12) |
66.67 (8/12) |
66.67 (8/12) |
100 (12/12) |
91.67 (11/12) |
| Effluent | 58.33 (7/12) |
83.33 (10/12) |
75.00 (9/12) |
83.33 (10/12) |
83.33 (10/12) |
100 (12/12) |
33.33 (4/12) |
58.33 (7/12) |
33.33 (4/12) |
75.00 (9/12) |
|
| C | Influent | 75.00 (9/12) |
100 (12/12) |
100 (12/12) |
100 (12/12) |
100 (12/12) |
100 (12/12) |
50.00 (6/12) |
75.00 (9/12) |
100 (12/12) |
75.00 (9/12) |
| Effluent | 41.67 (5/12) |
91.67 (11/12) |
75.00 (9/12) |
100 (12/12) |
91.67 (11/12) |
100 (12/12) |
0 (0/12) |
66.67 (8/12) |
75.00 (9/12) |
75.00 (9/12) |
|
| D | Influent | 75.00 (9/12) |
91.67 (11/12) |
91.67 (11/12) |
100 (12/12) |
100 (12/12) |
100 (12/12) |
41.67 (5/12) |
66.67 (8/12) |
83.33 (10/12) |
58.33 (7/12) |
| Effluent | 16.67 (2/12) |
50.00 (6/12) |
83.33 (10/12) |
100 (12/12) |
66.67 (8/12) |
100 (12/12) |
8.33 (1/12) |
58.33 (7/12) |
33.33 (4/12) |
58.33 (7/12) |
|
Figure 3.
Boxplot of the prevalences (%) of ARGs detected in influent and effluent samples of each Urban Wastewater Treatment Plant (WWTP). (A) shows significant differences between WWTPs, and (B) shows significant differences between influent and effluent samples for each WWTP. Solid horizontal lines represent the median, and the boxes display the 25–75% quartile range. Only significant p values (p < 0.05) obtained from the Wilcoxon signed-rank test analysis are indicated (*, **).
A high abundance of ARGs in influent and effluent waters was previously reported after the extensive surveillance of 12 urban WWTPs located in seven countries (Portugal, Spain, Ireland, Cyprus, Germany, Finland and Norway) [3]. The authors observed a major abundance of ARGs associated with resistance against first-generation antibiotics in influent samples, including aminoglycosides (aadA and strB), β-lactams (blaGES, blaOXA and blaVEB), macrolides (ereA and ermF), sulfonamides (sul1), tetracyclines (tetM and tetQ) and multidrug resistance (qacEdelta1 and qacH). Additionally, other genetic elements implicated in ARG transfer, such as intI1, tnpA, Tp614, ISAba3, ISPps and ISSm2, were also detected in all influents. On the other hand, ARGs of high clinical concern, like blaNDM-1, blaKPC, blaVIM, blaIMP, mcr-1, mecA and vanA, were barely detected in influents from the different countries. From the review published by Wang et al. [19] reporting data on ARGs abundance from 2007 to 2019, it was concluded that the most dominant ARGs frequently found in influent and effluent samples were blaCTX-M, blaTEM, ermB, sul1, sul2, tetO, tetQ and tetW.
Similar to the influent waters, a high prevalence of ARGs in all WWTP effluents was observed (Figure 3). All the ten ARGs considered were present in all the analyzed effluents, except in the case of the qnrA gene that was not detected in WWTP-C effluents (Table 3), illustrating that WWTPs can definitely be considered a potential hotspot for the dissemination of resistance genes to the environment, although the entire perspective of the dynamics of ARG spread through WWTPs is far from complete. In WWTP-B, C and D, a significant (p < 0.05) reduction in the prevalence of ARGs after tertiary water treatment was observed, while these reductions in prevalence were subtler and not statistically significant for WWTP-A (Figure 3B), probably due to the incomplete UV treatment applied in this WWTP. Reductions in ARG prevalence ranged from 8.33 to 58.33% depending on the WWTP and the ARG of concern (Table 3). For instance, the genes showing the highes decrease of prevalence (>50% reduction) were blaCTX-M-G1, qnrA and tetA, associated with resistance to β-lactams, quinolones and tetracycline, respectively. Noticeably, the gene tetA showed one of the highest prevalence values in influent samples and experienced one of the greatest reductions upon tertiary treatment of waters.
Nevertheless, this gene was still in high prevalence in WWTP-A and C effluents, showing values of 66.67% and 75%, respectively (Table 3). The gene qnrA gene showed the lowest prevalence in effluents of all ARGs considered in the study. It was not detected in WWTP-C effluents and showed a prevalence of 8.33, 25 and 33.33% in WWTP-D, A and B, respectively. Even though the occurrence of most of the ARGs decreased after treatment, ARGs were still discharged in effluent waters with a relatively high prevalence. Particularly, the catI, cmlA, sul1, sul2, tetA, tetB and blaTEM genes showed high prevalence in both influent (>83.33%) and effluent (>50%) samples. Similarly, sul genes appeared to be the most frequently detected in effluents from China, the USA and Sweden [55,56,57,58]. In our study, in some WWTPs, the prevalence of some of the studied ARGs remained almost unchanged. For example, the cmlA, sul2 and tetB genes showed no removal at all in WWTP-C and D. Furthermore, catI and cmlA prevalence also remained unchanged after treatment in WWTP-B, and the same result was observed for the gene blaTEM in WWTP-A.
Among all treatment plants studied, the lowest prevalence values for all ten ARGs were observed in WWTP-D, which used UV light as a more frequent disinfection method during tertiary treatment, in some occasions combined with chlorine disinfection, indicating that when properly applied, the use of UV alone or combined with chlorine or other biocides can be an effective water disinfection treatment. However, the results previously reported regarding the use of UV light as a tertiary treatment to control the prevalence of ARGs are far from conclusive. For example, Auerbach et al. [59] observed no significant removal of tet genes and Ferro et al. [60] reported that the abundance of the qnrS gene remained unchanged and the abundance of the blaTEM gene increased after treatment. More recently, McConnell et al. [61] studied the efficacy of different UV doses on ARGs (intl1, blaCTX-M, blaTEM, ermB, qnrS, sul1, sul2, tet(O), mecA and vanA) removal and they observed that the total ARG concentration decreased by 0.2 log copies/mL with a UV dose of 50 mJ/cm2 and around 0.6 log copies/mL with a higher UV dose of 250 mJ/cm2. Low levels of removal of tet and sul genes after UV disinfection were also observed in the past [58,59,62]. In disagreement with the results of some previous studies [32,57,63,64,65,66,67], an enrichment of ARGs after tertiary treatment was not observed in any of the four WWTPs here studied. For example, Mao et al. [57] observed a rise in the occurrence of twelve ARGs (tetA, tetB, tetE, tetG, tetH, tetS, tetT, tetX, sul1, sul2, qnrB and ermC) in the final effluents. Likewise, Marti et al. [66] also observed an increase in the relative abundance of almost all ARGs studied after wastewater treatment.
When comparing these results with those obtained on the occurrence of ESBL-producing E. coli in effluent samples, it can be seen that ARB and ARGs presented different responses to wastewater treatments. This is in agreement with results obtained in previous works where they observed that ARGs are more tolerant to wastewater treatments than ARB [24,60,68,69]. Moreover, these results can also be explained by the reduced detection sensitivity of bacterial enumeration techniques in environmental samples that may produce an underestimation of bacterial counts. The employment of qPCR techniques to quantify the absolute abundances of ARGs in WWTP samples will help to better assess the impact of ARGs released through effluents since the final risk is not only influenced by the presence of the genes but also by their concentration in the wastewaters. Additionally, through shotgun metagenomic DNA sequencing, Bengtsson-Palme et al. [70] investigated the relative abundances of ARGs in Sewage treatment plants (STPs). The authors observed a great reduction in the number of resistance genes per volume of water, although their relative abundance per bacterial 16S rRNA was only slightly decreased. It is worth mentioning that a few resistance genes, including the carbapenemase gene blaOXA-48, were enriched after the treatment processes in the STPs compared to the influent. However, the opposite trends have also been reported on other occasions. Yang et al. [30] reported a significant decrease in the abundance and diversity of ARGs revealed through the metagenomic sequencing of WWTP effluents. These authors reported lower relative abundances of tetracycline, multidrug and aminoglycoside resistance genes in the effluent as compared to the influent. These findings agree with those of other studies, where a reduction of ARGs after the wastewater treatment process has also been detected [31,32]. Likewise, multi-drug resistant bacteria from different bacterial species found in the influent disappeared completely in post-treated effluent in the study by Nimonkar et al. [33].
Thus, our findings, together with those previously reported, suggest that WWTP effluents may represent a source of ARGs, which could be transferred among environmental bacteria and disseminate antimicrobial resistance through the food chain when using reclaimed water for irrigation of crops. This is of utmost relevance, particularly in those areas where effluent water from the WWTPs is directly used as reclaimed water for the irrigation of crops. This is the case of the effluent from WWTPs C and D.
3.3. Antibiotic Resistance Profile of ESBL E. coli Isolates
A total of 89 ESBL E. coli isolates were recovered from influent and effluent waters of WWTP-A, the treatment plant showing the highest ESBL E. coli counts and ARGs prevalence in the effluents. Of these 89 ESBL E. coli strains, 37 were isolated from effluent samples. Figure 4 shows the resistance profile of these ESBL isolates to a broad range of antibiotics, including sulfamethoxazole, trimethoprim, ciprofloxacin, tetracycline, meropenem, azithromycin, nalidixic acid, cefotaxime, chloramphenicol, tigecycline, ceftazidime, colistin, ampicillin and gentamicin. The isolates showed resistance to a large number of antibiotics and can be considered multidrug-resistant (MDR) bacteria as they showed low susceptibility to at least one agent from three or more antimicrobial classes. While most isolates showed resistance to different β-lactam antibiotics (cefotaxime (100%), ceftazidime (99%), ampicillin (100%)), quinolones (ciprofloxacin (93%), nalidixic acid (66%)), tetracyclines (82%) and antifolate antimicrobials (sulfamethoxazole (96%), trimethoprim (79%)), almost all tested isolates (all the isolates from effluent samples) showed susceptibility to the action of last resort antimicrobials like meropenem, tigecycline and colistin. Interestingly, all isolates were susceptible to meropenem, and only one ESBL-producing E. coli isolate (from influent water) exhibited resistance to colistin but was susceptible to tigecycline. Resistance to tigecycline was observed in two isolates, also from influent samples. As shown in Figure 4, the clustering of isolates based on their antimicrobial susceptibility was mainly determined by the sampling date, while the type of sample (influent vs. effluent) had little influence. Similarly, Amador et al. [26] reported a high frequency of resistance in Enterobacteriaceae isolated from WWTP waters. They found resistance to several β-lactam antibiotics, tetracycline, ciprofloxacin and also to trimethoprim/sulfamethoxazole. Other studies have also reported antimicrobial resistance profiles for E. coli isolates originating from WWTPs [25,71]. Those isolates frequently presented resistance to sulfonamides, tetracyclines and aminopenicillins, while lower resistance rates were observed against quinolones. Noteworthy, the fact that no major differences were observed in the phenotypic profile of the ESBL E. coli isolated from influent and effluent waters indicates that water treatments do not give rise to the emergence of new resistance phenotypes. Furthermore, resistance to last-resort antibiotics (carbapenems, colistin, tigecycline) was very scarce, and when present, tertiary treatments were effective in removing them. However, this study has limitations, as only one indicator of ARB has been monitored. The prevalence of carbapenem resistance bacteria could have been higher if other bacterial species had been monitored, such as Acinetobacter or Klebsiella. Nevertheless, the presence of MDR bacteria in effluent waters is of particular concern considering the spread of antimicrobial resistance to the environment.
Figure 4.
Heatmap showing the antibiotic resistance profile obtained for the ESBL producing E. coli isolates recovered from WWTP-A. ECOFF values from EUCAST served as threshold to classify the isolates (n = 89) into antibiotic resistant (in red) or susceptible (in blue).
4. Conclusions
Based on the current literature, there remains a knowledge gap on how different wastewater treatments implemented in urban WWTPs may affect the occurrence or removal of ARB and ARGs in reclaimed water applied as irrigation water. The current study demonstrated the frequent occurrence of ESBL-producing E. coli and of a range of indicator ARGs, both in the influent and effluent waters from four Spanish WWTPs. The ESBL E. coli counts observed in the influent samples were quite high, while in the effluent samples, significantly lower concentrations were observed. The ten studied ARGs showed a high prevalence in the influent samples from all WWTPs, with the genes cmlA and sul2 associated with resistance to chloramphenicol and sulfonamides, respectively, being the most prevalent ARGs. ARGs associated with resistance to quinolones showed the lowest prevalence in all influent samples. In general, all the ARGs were present in the effluent samples, except for the qnrA gene, illustrating that WWTPs can be considered a potential hotspot for the dissemination of resistance genes to the environment. However, the lower prevalence in the effluent samples indicates that, when properly applied, UV alone or combined with chlorine or other biocides can be an effective water disinfection treatment. The ESBL E. coli isolates showed resistance to a large number of antibiotics and can be considered multidrug-resistant (MDR) bacteria as they show low susceptibility to at least one agent from three or more antimicrobial classes. These findings demonstrate the relevance of urban wastewater as an important reservoir of these bacteria. However, it can be concluded that wastewater reclamation processes, including primary, secondary and particularly tertiary treatments, when adequately applied, are able to significantly reduce ESBL E. coli counts (in about 5.0 log units) and ARGs prevalence.
Acknowledgments
The authors are thankful for the financial support from the Spanish Ministry of Science and Innovation (Project TED2021-131427B-C21 and TED2021-131427B-C22). The author M. Oliveira is in receipt of a Juan de la Cierva—Incorporación contract [IJC2018-035523 I] awarded by the Spanish Ministry of Science and Innovation (MCIN/AEI/10.13039/501100011033). P. Truchado is holding a Ramon y Cajal contract from the Ministry of Science and Innovation. The technical assistance of Macarena Moreno (CEBAS-CSIC) and Pedro J. Simón-Andreu (ESAMUR) was very much appreciated.
Author Contributions
Conceptualization, P.T., M.I.G., M.A.S., A.R., F.G., A.Á.-O. and A.A.; Data curation, M.I.G., A.Á.-O. and A.A.; Formal analysis, M.O. and P.T.; Funding acquisition, A.Á.-O. and A.A.; Investigation, M.O., P.T., R.C.-G., A.Á.-O. and A.A.; Methodology, M.O., P.T., R.C.-G., A.Á.-O. and A.A.; Project administration, M.A.S., A.R. and F.G.; Resources, M.A.S., A.R. and F.G.; Supervision, M.O., P.T. and A.A.; Writing—original draft, M.O.; Writing—review & editing, M.I.G., A.Á.-O. and A.A. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
This research was funded by the Spanish Ministry of Science and Innovation (TED2021-131427B-C21 and TED2021-131427B-C22).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.World Health Organization (WHO) Report of the 6th Meeting of the WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance with AGISAR 5-Year Strategic Framework to Support Implementation of the Global Action Plan on Antimicrobial Resistance (2015–2019) 2015. [(accessed on 26 July 2022)]. Available online: https://apps.who.int/iris/bitstream/handle/10665/190954/9789241509534_eng.pdf.
- 2.Michael I., Rizzo L., McArdell C.S., Manaia C.M., Merlin C., Schwartz T., Dagot C., Fatta-Kassinos D. Urban wastewater treatment plants as hotspots for the release of antibiotics in the environment: A review. Water Res. 2013;47:957–995. doi: 10.1016/j.watres.2012.11.027. [DOI] [PubMed] [Google Scholar]
- 3.Pärnänen K.M.M., Narciso-Da-Rocha C., Kneis D., Berendonk T.U., Cacace D., Do T.T., Elpers C., Fatta-Kassinos D., Henriques I., Jaeger T., et al. Antibiotic resistance in European wastewater treatment plants mirrors the pattern of clinical antibiotic resistance prevalence. Sci. Adv. 2019;5:eaau9124. doi: 10.1126/sciadv.aau9124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Rizzo L., Manaia C., Merlin C., Schwartz T., Dagot C., Ploy M.C., Michael I., Fatta-Kassinos D. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: A review. Sci. Total Environ. 2013;447:345–360. doi: 10.1016/j.scitotenv.2013.01.032. [DOI] [PubMed] [Google Scholar]
- 5.Guardabassi L., Wong D.M.L.F., Dalsgaard A. The effects of tertiary wastewater treatment on the prevalence of antimicrobial resistant bacteria. Water Res. 2002;36:1955–1964. doi: 10.1016/S0043-1354(01)00429-8. [DOI] [PubMed] [Google Scholar]
- 6.Jury K.L., Khan S.J., Vancov T., Stuetz R.M., Ashbolt N.J. Are sewage treatment plants promoting antibiotic resistance? Crit. Rev. Environ. Sci. Technol. 2011;41:243–270. doi: 10.1080/10643380902772589. [DOI] [Google Scholar]
- 7.Moura A., Henriques I., Smalla K., Correia A. Wastewater bacterial communities bring together broad-host range plasmids, integrons and a wide diversity of uncharacterized gene cassettes. Res. Microbiol. 2010;161:58–66. doi: 10.1016/j.resmic.2009.11.004. [DOI] [PubMed] [Google Scholar]
- 8.Rodríguez E.A., Ramirez D., Balcázar J.L., Jiménez J.N. Metagenomic analysis of urban wastewater resistome and mobilome: A support for antimicrobial resistance surveillance in an endemic country. Environ. Pollut. 2021;276:116736. doi: 10.1016/j.envpol.2021.116736. [DOI] [PubMed] [Google Scholar]
- 9.Zaatout N., Bouras S., Slimani N. Prevalence of extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae in wastewater: A systematic review and meta-analysis. J. Water Health. 2021;19:705–723. doi: 10.2166/wh.2021.112. [DOI] [PubMed] [Google Scholar]
- 10.Truchado P., Gil M.I., López C., Garre A., López-Aragón R.F., Böhme K., Allende A. New standards at European Union level on water reuse for agricultural irrigation: Are the Spanish wastewater treatment plants ready to produce and distribute reclaimed water within the minimum quality requirements? Int. J. Food Microbiol. 2021;16:109352. doi: 10.1016/j.ijfoodmicro.2021.109352. [DOI] [PubMed] [Google Scholar]
- 11.EU (European Union) Regulation (EU) 2020/741 of the European Parliament and of the Council of 25 May 2020 on minimum requirements for water reuse. Off. J. Eur. Union L. 2020;177:32–55. [Google Scholar]
- 12.Cai Y., Sun T., Li G., An T. Traditional and Emerging Water Disinfection Technologies Challenging the Control of Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes. ACS ES&T Eng. 2021;1:1046–1064. doi: 10.1021/acsestengg.1c00110. [DOI] [Google Scholar]
- 13.Pei M., Zhang B., He Y., Su J., Gin K., Lev O., Shen G., Hu S. State of the art of tertiary treatment technologies for controlling antibiotic resistance in wastewater treatment plants. Environ. Int. 2019;131:105026. doi: 10.1016/j.envint.2019.105026. [DOI] [PubMed] [Google Scholar]
- 14.Sharma V.K., Johnson N., Cizmas L., McDonald T.J., Kim H. A review of the influence of treatment strategies on antibiotic resistant bacteria and antibiotic resistance genes. Chemosphere. 2016;150:702–714. doi: 10.1016/j.chemosphere.2015.12.084. [DOI] [PubMed] [Google Scholar]
- 15.Liu Y., Fan Q., Wang J. Zn-Fe-CNTs catalytic in situ generation of H2O2 for Fenton-like degradation of sulfamethoxazole. J. Hazard. Mater. 2018;342:166–176. doi: 10.1016/j.jhazmat.2017.08.016. [DOI] [PubMed] [Google Scholar]
- 16.Pariente M., Segura Y., Álvarez-Torrellas S., Casas J., de Pedro Z., Diaz E., García J., López-Muñoz M., Marugán J., Mohedano A., et al. Critical review of technologies for the on-site treatment of hospital wastewater: From conventional to combined advanced processes. J. Environ. Manag. 2022;320:115769. doi: 10.1016/j.jenvman.2022.115769. [DOI] [PubMed] [Google Scholar]
- 17.Tang J.T., Wang J.L. MOF-derived three-dimensional flower-like FeCu@C composite as an efficient Fenton-like catalyst for sulfamethazine degradation. Chem. Eng. J. 2019;375:122007. doi: 10.1016/j.cej.2019.122007. [DOI] [Google Scholar]
- 18.Wang J., Chen H. Catalytic ozonation for water and wastewater treatment: Recent advances and perspective. Sci. Total Environ. 2020;704:135249. doi: 10.1016/j.scitotenv.2019.135249. [DOI] [PubMed] [Google Scholar]
- 19.Wang J., Chu L., Wojnárovits L., Takács E. Occurrence and fate of antibiotics, antibiotic resistant genes (ARGs) and antibiotic resistant bacteria (ARB) in municipal wastewater treatment plant: An overview. Sci. Total Environ. 2020;744:140997. doi: 10.1016/j.scitotenv.2020.140997. [DOI] [PubMed] [Google Scholar]
- 20.Wang J., Zhuang S. Removal of various pollutants from water and wastewater by modified chitosan adsorbents. Crit. Rev. Environ. Sci. Technol. 2017;47:2331–2386. doi: 10.1080/10643389.2017.1421845. [DOI] [Google Scholar]
- 21.Wang J., Zhuang S. Covalent organic frameworks (COFs) for environmental applications. Coord. Chem. Rev. 2019;400:213046. doi: 10.1016/j.ccr.2019.213046. [DOI] [Google Scholar]
- 22.Zhuan R., Wang J. Degradation of sulfamethoxazole by ionizing radiation: Kinetics and implications of additives. Sci. Total Environ. 2019;668:67–73. doi: 10.1016/j.scitotenv.2019.03.027. [DOI] [PubMed] [Google Scholar]
- 23.Zhuang S.T., Liu Y., Wang J.L. Covalent organic frameworks as efficient adsorbent for sulfamethazine removal from aqueous solution. J. Hazard. Mater. 2020;383:121126. doi: 10.1016/j.jhazmat.2019.121126. [DOI] [PubMed] [Google Scholar]
- 24.Pazda M., Kumirska J., Stepnowski P., Mulkiewicz E. Antibiotic resistance genes identified in wastewater treatment plant systems—A review. Sci. Total Environ. 2019;697:134023. doi: 10.1016/j.scitotenv.2019.134023. [DOI] [PubMed] [Google Scholar]
- 25.Łuczkiewicz A., Jankowska K., Fudala-Książek S., Olańczuk-Neyman K. Antimicrobial resistance of fecal indicators in municipal wastewater treatment plant. Water Res. 2010;44:5089–5097. doi: 10.1016/j.watres.2010.08.007. [DOI] [PubMed] [Google Scholar]
- 26.Amador P.P., Fernandes R.M., Prudencio M.C., Barreto M.P., Duarte I.M. Antibiotic resistance in wastewater: Occurrence and fate of Enterobacteriaceae producers of class A and class C β-lactamases. J. Environ. Sci. Health Part A Toxic/Hazard. Subst. Environ. Eng. 2015;50:26–39. doi: 10.1080/10934529.2015.964602. [DOI] [PubMed] [Google Scholar]
- 27.Alexander J., Bollmann A., Seitz W., Schwartz T. Microbiological characterization of aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance genes of opportunistic bacteria. Sci. Total Environ. 2015;512:316–325. doi: 10.1016/j.scitotenv.2015.01.046. [DOI] [PubMed] [Google Scholar]
- 28.Biswal B.K., Mazza A., Masson L., Gehr R., Frigon D. Impact of wastewater treatment processes on antimicrobial resistance genes and their co-occurrence with virulence genes in Escherichia coli. Water Res. 2014;50:245–253. doi: 10.1016/j.watres.2013.11.047. [DOI] [PubMed] [Google Scholar]
- 29.Korzeniewska E., Korzeniewska A., Harnisz M. Antibiotic resistant Escherichia coli in hospital and municipal sewage and their emission to the environment. Ecotoxicol. Environ. Saf. 2013;91:96–102. doi: 10.1016/j.ecoenv.2013.01.014. [DOI] [PubMed] [Google Scholar]
- 30.Yang Y., Li B., Zou S., Fang H.H., Zhang T. Fate of antibiotic resistance genes in sewage treatment plant revealed by metagenomic approach. Water Res. 2014;62:97–106. doi: 10.1016/j.watres.2014.05.019. [DOI] [PubMed] [Google Scholar]
- 31.Hultman J., Tamminen M., Pärnänen K., Cairns J., Karkman A., Virta M. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent. FEMS Microbiol. Ecol. 2018;94:fiy038. doi: 10.1093/femsec/fiy038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Laht M., Karkman A., Voolaid V., Ritz C., Tenson T., Virta M., Kisand V. Abundances of Tetracycline, Sulphonamide and Beta-Lactam Antibiotic Resistance Genes in Conventional Wastewater Treatment Plants (WWTPs) with Different Waste Load. PLoS ONE. 2014;9:e103705. doi: 10.1371/journal.pone.0103705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Nimonkar Y.S., Yadav B., Talreja P., Sharma A., Patil S., Saware S.S., Ranade D.R., Prakash O. Assessment of the Role of Wastewater Treatment Plant in Spread of Antibiotic Resistance and Bacterial Pathogens. Indian J. Microbiol. 2019;59:261–265. doi: 10.1007/s12088-019-00793-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ferreira da Silva M., Vaz-Moreira I., Gonzalez-Pajuelo M., Nunes O., Manaia C.M. Antimicrobial resistance patterns in Enterobacteriaceae isolated from an urban wastewater treatment plant. FEMS Microbiol. Ecol. 2007;60:166–176. doi: 10.1111/j.1574-6941.2006.00268.x. [DOI] [PubMed] [Google Scholar]
- 35.Amarasiri M., Sano D., Suzuki S. Understanding human health risks caused by antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARG) in water environments: Current knowledge and questions to be answered. Crit. Rev. Environ. Sci. Technol. 2020;50:2016–2059. doi: 10.1080/10643389.2019.1692611. [DOI] [Google Scholar]
- 36.Franz E., Veenman C., van Hoek A.H.A.M., Husman A.D.R., Blaak H. Pathogenic Escherichia coli producing Extended-Spectrum β-Lactamases isolated from surface water and wastewater. Sci. Rep. 2015;5:14372. doi: 10.1038/srep14372. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Usui M., Ozeki K., Komatsu T., Fukuda A., Tamura Y. Prevalence of Extended-Spectrum β-Lactamase–Producing Bacteria on Fresh Vegetables in Japan. J. Food Prot. 2019;82:1663–1666. doi: 10.4315/0362-028X.JFP-19-138. [DOI] [PubMed] [Google Scholar]
- 38.EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards) Koutsoumanis K., Allende A., Álvarez-Ordóñez A., Bolton D., Bover-Cid S., Chemaly M., Davies R., De Cesare A., Herman L., et al. Scientific Opinion on the role played by the environment in the emergence and spread of antimicrobial resistance (AMR) through the food chain. EFSA J. 2021;19:e06651. doi: 10.2903/j.efsa.2021.6651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Dallenne C., Da Costa A., Decré D., Favier C., Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010;65:490–495. doi: 10.1093/jac/dkp498. [DOI] [PubMed] [Google Scholar]
- 40.Ng K.H., Samuel L., Kathleen M.M., Leong S.S., Felecia C. Distribution and prevalence of chloramphenicol-resistance gene in Escherichia coli isolated from aquaculture and other environment. Int. Food Res. J. 2014;21:1321–1325. [Google Scholar]
- 41.Liu X., Wang H., Zhao H. Propagation of antibiotic resistance genes in an industrial recirculating aquaculture system located at northern China. Environ. Pollut. 2020;261:114155. doi: 10.1016/j.envpol.2020.114155. [DOI] [PubMed] [Google Scholar]
- 42.Cummings D.E., Archer K.F., Arriola D.J., Baker P.A., Faucett K.G., Laroya J.B., Pfeil K.L., Ryan C.R., Ryan K.R.U., Zuill D.E. Broad Dissemination of Plasmid-Mediated Quinolone Resistance Genes in Sediments of Two Urban Coastal Wetlands. Environ. Sci. Technol. 2011;45:447–454. doi: 10.1021/es1029206. [DOI] [PubMed] [Google Scholar]
- 43.Gonçalves D.M. Ph.D. Thesis. University of Porto; Academic repository of the University of Porto, Porto, Portugal: 2013. Escherichia coli e Klebsiella pneumoniae, das ESBL´s às Carbapenemases, Colonização Fecal e Infeção. Influência da População Idosa Numa Região do Norte de Portugal. [Google Scholar]
- 44.Aarestrup F.M., Lertworapreecha M., Evans M.C., Bangtrakulnonth A., Chalermchaikit T., Hendriksen R.S., Wegener H.C. Antimicrobial susceptibility and occurence of resistance genes among Salmonella enterica serovar Weltevreden from different countries. J. Antimicrob. Chemother. 2003;52:715–718. doi: 10.1093/jac/dkg426. [DOI] [PubMed] [Google Scholar]
- 45.Khan S.A., Sung K., Nawaz M.S. Detection of aacA-aphD, qacEδ1, marA, floR, and tetA genes from multidrug-resistant bacteria: Comparative analysis of real-time multiplex PCR assays using EvaGreen® and SYBR® Green I dyes. Mol. Cell. Probes. 2011;25:78–86. doi: 10.1016/j.mcp.2011.01.004. [DOI] [PubMed] [Google Scholar]
- 46.Liu X., Wang H., Zhao H. Prevalence of antibiotic resistance genes in wastewater collected from ornamental fish market in northern China. Environ. Pollut. 2021;271:116316. doi: 10.1016/j.envpol.2020.116316. [DOI] [PubMed] [Google Scholar]
- 47.Haberecht H.B., Nealon N.J., Gilliland J.R., Holder A.V., Runyan C., Oppel R.C., Ibrahim H.M., Mueller L., Schrupp F., Vilchez S., et al. Antimicrobial-resistant Escherichia coli from environmental waters in northern Colorado. J. Environ. Public Health. 2019;2019:3862949. doi: 10.1155/2019/3862949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Schmiege D., Zacharias N., Sib E., Falkenberg T., Moebus S., Evers M., Kistemann T. Prevalence of multidrug-resistant and extended-spectrum beta-lactamase-producing Escherichia coli in urban community wastewater. Sci. Total Environ. 2021;785:147269. doi: 10.1016/j.scitotenv.2021.147269. [DOI] [PubMed] [Google Scholar]
- 49.Raven K.E., Ludden C., Gouliouris T., Blane B., Naydenova P., Brown N.M., Parkhill J., Peacock S.J. Genomic surveillance of Escherichia coli in municipal wastewater treatment plants as an indicator of clinically relevant pathogens and their resistance genes. Microb. Genom. 2019;5:e000267. doi: 10.1099/mgen.0.000267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Bréchet C., Plantin J., Sauget M., Thouverez M., Talon D., Cholley P., Guyeux C., Hocquet D., Bertrand X. Wastewater Treatment Plants Release Large Amounts of Extended-Spectrum β-Lactamase–Producing Escherichia coli Into the Environment. Clin. Infect. Dis. 2014;58:1658–1665. doi: 10.1093/cid/ciu190. [DOI] [PubMed] [Google Scholar]
- 51.Nzima B., Adegoke A., Ofon U., Al-Dahmoshi H., Saki M., Ndubuisi-Nnaji U., Inyang C. Resistotyping and extended-spectrum beta-lactamase genes among Escherichia coli from wastewater treatment plants and recipient surface water for reuse in South Africa. New Microbes New Infect. 2020;38:100803. doi: 10.1016/j.nmni.2020.100803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Solaiman S., Handy E., Brinks T., Goon K., Bollinger C., Sapkota A.R., Sharma M., Micallef S.A. Extended spectrum β-lactamase activity and cephalosporin resistance in Escherichia coli from U.S. Mid-Atlantic surface and reclaimed water. Appl. Environ. Microbiol. 2022;88:e0083722. doi: 10.1128/aem.00837-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Caucci S., Karkman A., Cacace D., Rybicki M., Timpel P., Voolaid V., Gurke R., Virta M., Berendonk T.U. Seasonality of antibiotic prescriptions for outpatients and resistance genes in sewers and wastewater treatment plant outflow. FEMS Microbiol. Ecol. 2016;92:fiw060. doi: 10.1093/femsec/fiw060. [DOI] [PubMed] [Google Scholar]
- 54.Lépesová K., Olejníková P., Mackuľak T., Tichý J., Birošová L. Annual changes in the occurrence of antibiotic-resistant coliform bacteria and enterococci in municipal wastewater. Environ. Sci. Pollut. Res. 2019;26:18470–18483. doi: 10.1007/s11356-019-05240-9. [DOI] [PubMed] [Google Scholar]
- 55.Ben W., Wang J., Cao R., Yang M., Zhang Y., Qiang Z. Distribution of antibiotic resistance in the effluents of ten municipal wastewater treatment plants in China and the effect of treatment processes. Chemosphere. 2017;172:392–398. doi: 10.1016/j.chemosphere.2017.01.041. [DOI] [PubMed] [Google Scholar]
- 56.Berglund B., Fick J., Lindgren P.-E. Urban wastewater effluent increases antibiotic resistance gene concentrations in a receiving northern European river. Environ. Toxicol. Chem. 2015;34:192–196. doi: 10.1002/etc.2784. [DOI] [PubMed] [Google Scholar]
- 57.Mao D., Yu S., Rysz M., Luo Y., Yang F., Li F., Hou J., Mu Q., Alvarez P.J.J. Prevalence and proliferation of antibiotic resistance genes in two municipal wastewater treatment plants. Water Res. 2015;85:458–466. doi: 10.1016/j.watres.2015.09.010. [DOI] [PubMed] [Google Scholar]
- 58.Munir M., Wong K., Xagoraraki I. Release of antibiotic resistant bacteria and genes in the effluent and biosolids of five wastewater utilities in Michigan. Water Res. 2011;45:681–693. doi: 10.1016/j.watres.2010.08.033. [DOI] [PubMed] [Google Scholar]
- 59.Auerbach E.A., Seyfried E.E., McMahon K.D. Tetracycline resistance genes in activated sludge wastewater treatment plants. Water Res. 2007;41:1143–1151. doi: 10.1016/j.watres.2006.11.045. [DOI] [PubMed] [Google Scholar]
- 60.Ferro G., Guarino F., Castiglione S., Rizzo L. Antibiotic resistance spread potential in urban wastewater effluents disinfected by UV/H2O2 process. Sci. Total Environ. 2016;560:29–35. doi: 10.1016/j.scitotenv.2016.04.047. [DOI] [PubMed] [Google Scholar]
- 61.McConnell M.M., Hansen L.T., Jamieson R.C., Neudorf K.D., Yost C.K., Tong A. Removal of antibiotic resistance genes in two tertiary level municipal wastewater treatment plants. Sci. Total Environ. 2018;643:292–300. doi: 10.1016/j.scitotenv.2018.06.212. [DOI] [PubMed] [Google Scholar]
- 62.Chen H., Zhang M. Effects of Advanced Treatment Systems on the Removal of Antibiotic Resistance Genes in Wastewater Treatment Plants from Hangzhou, China. Environ. Sci. Technol. 2013;47:8157–8163. doi: 10.1021/es401091y. [DOI] [PubMed] [Google Scholar]
- 63.Amos G.C.A., Hawkey P.M., Gaze W.H., Wellington E.M. Wastewater effluent contributes to the dissemination of CTX-M-15 in the natural environment. J. Antimicrob. Chemother. 2014;69:1785–1791. doi: 10.1093/jac/dku079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Hiller C., Hübner U., Fajnorova S., Schwartz T., Drewes J. Antibiotic microbial resistance (AMR) removal efficiencies by conventional and advanced wastewater treatment processes: A review. Sci. Total Environ. 2019;685:596–608. doi: 10.1016/j.scitotenv.2019.05.315. [DOI] [PubMed] [Google Scholar]
- 65.Liu L., Xin Y., Huang X., Liu C. Response of antibiotic resistance genes in constructed wetlands during treatment of livestock wastewater with different exogenous inducers: Antibiotic and antibiotic-resistant bacteria. Bioresour. Technol. 2020;314:123779. doi: 10.1016/j.biortech.2020.123779. [DOI] [PubMed] [Google Scholar]
- 66.Marti E., Jofre J., Balcazar J.L. Prevalence of Antibiotic Resistance Genes and Bacterial Community Composition in a River Influenced by a Wastewater Treatment Plant. PLoS ONE. 2013;8:e78906. doi: 10.1371/journal.pone.0078906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Sousa J.M., Macedo G., Pedrosa M., Becerra-Castro C., Castro-Silva S., Pereira M.F.R., Silva A.M., Nunes O.C., Manaia C.M. Ozonation and UV254nm radiation for the removal of microorganisms and antibiotic resistance genes from urban wastewater. J. Hazard. Mater. 2017;323:434–441. doi: 10.1016/j.jhazmat.2016.03.096. [DOI] [PubMed] [Google Scholar]
- 68.Lee J., Jeon J.H., Shin J., Jang H.M., Kim S., Song M.S., Kim Y.M. Quantitative and qualitative changes in antibiotic resistance genes after passing through treatment processes in municipal wastewater treatment plants. Sci. Total Environ. 2017;605:906–914. doi: 10.1016/j.scitotenv.2017.06.250. [DOI] [PubMed] [Google Scholar]
- 69.Umar M. From Conventional Disinfection to Antibiotic Resistance Control—Status of the Use of Chlorine and UV Irradiation during Wastewater Treatment. Int. J. Environ. Res. Public Health. 2022;19:1636. doi: 10.3390/ijerph19031636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Bengtsson-Palme J., Hammarén R., Pal C., Östman M., Björlenius B., Flach C.-F., Fick J., Kristiansson E., Tysklind M., Larsson D.J. Elucidating selection processes for antibiotic resistance in sewage treatment plants using metagenomics. Sci. Total Environ. 2016;572:697–712. doi: 10.1016/j.scitotenv.2016.06.228. [DOI] [PubMed] [Google Scholar]
- 71.Ferreira da Silva M., Tiago I., Veríssimo A., Boaventura R.A.R., Nunes O.C., Manaia C.M. Antibiotic resistance of enterococci and related bacteria in an urban wastewater treatment plant. FEMS Microbiol. Ecol. 2006;55:322–329. doi: 10.1111/j.1574-6941.2005.00032.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Not applicable.





