Abstract
Various laboratories across the world have developed methods to study mitochondrial proteins/markers through extractions of mitochondrial RNA, protein, mitophagy/autophagy in Alzheimer’s disease (AD) and other age-related diseases. Techniques such as qRT-PCR, western blotting, immunofluorescence, transmission electron microscopy and Seahorse bioanalyzer, mitochondrial membrane potential, detection of mitophagy, and mitochondrial functional assays have been used as outlined in this article. Most of these techniques were performed in vitro (human and mouse neuronal cell lines, transfected with mutant APP or Tau cDNAs) and in vivo (brain tissues from different mouse models of Alzheimer’s and other neurological diseases). Mitochondrial abnormalities in Alzheimer’s disease reported various forms, such as excessive reactive oxygen species (ROS) production, mitochondrial calcium dyshomeostasis, loss of ATP, and defects in mitochondrial dynamics and transport, and mitophagy. Mitochondrial dysfunction is largely involved in aging, age-related diseases such as cancer, diabetes, obesity and neurodegenerative disorders, including Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS) and others. The essence of our article is to update protocols/methods and make them available to students, scholars, and researchers of mitochondria. We believe our article is important and useful to future mitochondrial studies.
Basic Protocol 1:
RNA extraction from brain cells and tissues of mice and qRT-PCR to measure mitochondrial gene expression
Basic protocol 2:
Prepare protein lysates from brain cells and tissues of mice for Western Blotting
Basic Protocol 3:
Immunofluorescence
Basic Protocol 4:
Mitochondrial Membrane Potential
Basic Protocol 5:
Transmission Electron Microscopy
Basic Protocol 6:
Detection of Mitophagy Methods
Basic Protocol 7:
Bioenergetic Assessment via Seahorse
Basic Protocol 8:
Mitochondrial Function
Keywords: Mitochondria, Alzheimer’s disease, mitochondrial function, Microscopy, fluorescence
Introduction
In AD, mitochondrial dysfunction due to defective mitophagy has been observed (Fang et al., 2019; Kerr et al., 2017). Mitophagy is selective autophagy, in other words, it is a process of clearing damaged or superfluous mitochondria in eukaryotic cells (e.g., in red blood cells and in sperms after fertilization). Defective mitophagy occurs when mitochondrial dynamics (fusion/ fission) is disrupted. For example, when mutant proteins such as Aβ accumulate in the neurons, this leads to increased mitochondrial fission and reduced mitochondrial fusion because Aβ interacts with Drp1, a fission protein, and with an increase in ROS production this results in increased mitochondrial fragmentation as seen in previous studies of AD (Manczak et al., 2010; Manczak et al., 2011; Silva et al., 2013; Wang et al., 2008; Wang et al., 2009). On the other hand, p-tau was also observed to interacts with Drp1 and increase mitochondrial fragmentation in AD (Manczak & Reddy, 2012).
For studying the mitochondria and detecting mitophagy, in vivo and in vitro, have been and are currently being developed to understand of role of mitochondria and the mechanism of mitophagy in AD (Fang et al., 2017; Sun et al., 2017). But before mitochondria can be studied, its RNA and protein must be extracted and purified for analysis. Cells and tissues must also be prepared by fixing and staining them for imaging (Reddy et al., 2018a, Reddy et al., 2018b; Kandimalla et al., 2018; Manczak et al., 2018; Manczak et al., 2010; Wagner et al., 2003). In previous studies, after RNA extractions, protein extractions, fixing, and staining cells and tissue samples, methods such as immunofluorescence, JC-1 and tetramethylrhodamine, ethyl ester (TMRE) staining method, transmission electron microscopy (TEM), and assays were used to study mitochondrial structure, function, and quality. Each of these methods were used to study specific aspects of the mitochondria; for example, JC-1 and TMRE staining method were used to study mitochondrial membrane potential (MMP) and the assays were used to study mitochondrial functions such as Cytochrome c oxidase activity, ATP production, free radicals production (H2O2), and lipid peroxidation levels (4-hydroxynonenal) in mice (Zorova et al., 2018; Manczak et al., 2010; Cardosa et al., 2004; Sakamuru et al., 2016; Wagner et al., 2003; Reddy et al., 2012b). Together these methods, and additional methods, can be used to further understand the structure and role of mitochondria in neurodegenerative diseases.
In this article, we’ve provided detailed protocols for studying the mitochondria in healthy and diseased states using both cells and tissues, but the techniques may have some limitations and some details may vary between laboratories (See Table 1). In basic protocol 1, we performed RNA isolation and measured mRNA expression via qRT-PCR, which showed increase fission activity and decreased fusion activity in mutantAPP-HT22 cells compared to untransfected WT HT22 cells. Similar results were seen using basic protocol 2, where, we and others extracted proteins from untranfected HT22 and other cell lines and mutant APP-HT22 cells and measured protein levels of mitochondrial dynamic proteins using western blotting. In basic protocol 3, we performed immunofluorescence analysis using fission and fusion proteins in mutant APP-HT22 cells and untransfected HT22 and other cells, which showed simar results as the qRT-PCR and western blotting. Next, basic protocol 4, outlines two methods of measuring MMP: using TMRE dye and using JC-1 dye. To measure structure of the mitochondria, TEM is performed as described in basic protocol 5. In basic protocol 6, mitophagy is detected in vivo, in vitro, and in live neurons. Seahorse bioanalyzer was used to measure bioenergetics of the mitochondria, as described in protocol 7, and showed that mitophagy enhancers increased mitochondrial respiration mutant TauHT22 cells compared to untransfected HT22 cells. Lastly basic protocol 8 describes measuring mitochondrial function using functional assay, which showed significant increase in hydrogen peroxide production and lipid peroxidation production in mutant APP HT22 cells compared to untransfected HT22 cells and significant decrease in cytochrome c activity and ATP levels in mutant APP-HT22 cells compared to untransfected HT22 cells.
Table 1:
Methods to Study the Mitochondria
| Methods | RESULT/Output | Key Reference |
|---|---|---|
| qRT-PCR | Measure gene expression via reverse transcription | Reddy et al., 2018b |
| Western Blotting | Protein-protein interaction | Reddy at al., 2018b |
| Membrane Potential and Immunofluorescence | Measure mitochondrial function | Manczak et al., 2010; abcam, 2022; Reddy et al., 2018b |
| Transmission electron microscopy | Mitochondrial structure | Kandimalla et al., 2018; Manczak et al., 2018; Manczak et al., 2010; Wagner et al., 2003, Lam et al., 2021 |
| Mitophagosomal formation | Protein-protein interaction | Ding & Yin, 2012 |
| Fluorescence | In vitro & in vivo detection of mitophagy | Reddy et al., 2018b; Peprotech, 2022 |
Basic Protocol 1: RNA extraction mice brain tissue and qRT-PCR to measure mitochondrial gene expression (within the mitochondria?)
The aim of this protocol is to measure mitochondrial gene expression (fold-change). To do this, RNA from tissue/ cell samples must be prepared via RNA Isolation. Specific primers are used to generate cDNA and measure the gene expression of specific genes across different groups. After running the PCR, a dissociation curve is generated to distinguish specific amplicons from non-specific amplifications and CT values are calculated. When mitochondrial dynamic gene primers were used, the resulting dissociation curve provided information on expression levels of those genes in that specific sample (Figure 1).
Figure 1: Flowchart of RNA preparation process.
This flowchart summarizes the steps of RNA preparation process starting from lysis/ homogenization of cells and tissue samples and ending with qRT-PCR with steps for isolation of RNA in between. The cDNA synthesis step was shown to connect sections 1.1 and 1.2. Created with BioRender.com.
Materials List:
Mouse primary hippocampal neuronal (HT22) Cells (gift from David Schupert)
Tissues from brain dissected out from animals such as mice
Tissue plates/growth vessel
Trizol Reagent (ThermoFisher Scientific, cat no. 15596–018)
Chloroform (Fisher Chemical, cat no. C298–500)
Isopropanol (Fisher Chemical, cat no. BP2618–500)
75% Ethanol (see recipe)
RNAse free water (Invitrogen, cat no. AM9932)
Primers (see Table 2)
Table 2:
Summary of Primers for Mitochondrial dynamic genes used for qRT- PCR (Reprinted with permission from Reddy et al., 2018b)
| Gene | DNA sequence (5′–3′) | PCR product size |
|---|---|---|
| Mitochondrial dynamics genes | ||
| Drp1 | Forward primer ATGCCAGCAAGTCCACAGAA | 86 |
| Reverse primer TGTTCTCGGGCAGACAGTTT | ||
| Fis1 | Forward primer CAAAGAGGAACAGCGGGACT | 95 |
| Reverse primer ACAGCCCTCGCACATACTTT | ||
| Mfn1 | Forward primer GCAGACAGCACATGGAGAGA | 83 |
| Reverse primer GATCCGATTCCGAGCTTCCG | ||
| Mfn2 | Forward primer TGCACCGCCATATAGAGGAAG | 78 |
| Reverse primer TCTGCAGTGAACTGGCAATG | ||
| Opa1 | Forward primer ACCTTGCCAGTTTAGCTCCC | 82 |
| Reverse primer TTGGGACCTGCAGTGAAGAA | ||
RNase free water, 0.1 mM EDTA (Invitrogen)
Autoclave
Autoclaved tips
Eppendorf tubes
Centrifuge
SYBER-Green qPCR Master Mix
Superscript III First-Strand Synthesis System (Thermo Scientific, cat no. 18080400)
2X Reaction Mix
SuperScript™ III Enzyme Mix
Oligo(dT)20
Random hexamers
Annealing buffer
More information on each item in the kit is on the Thermo Scientific website.
RNA quantification machine
ABI Prism 7900 sequence detection system (Applied Biosystems)
RNA Extraction
See Invitrogen User guide of TRIzol Reagent for RNA Extraction
Experimental Procedures
-
1
Culture HT22 cells in DMEM/ obtain brain tissue from mice after euthanizing them and performing necroscopy according to IACUC protocols.
-
2Using the TRIzol reagent lyse and homogenize the tissue and/or cells according to the starting material:
- Tissues: per 50–100mg of tissue, add 1ml of TRIzol reagent to the sample and homogenize.
- Cell grown in monolayer: remove growth media and, per 1 X 105 – 107 cells, add 0.3 – 0.4 ml of TRIzol to culture dish and lyse cells. Homogenize the lysed cells by pipetting up and down many times.
- Cells grown in suspension: centrifuge the cells and discard the supernatant to pellet the cells. Then, per 0.25ml of sample, add 0.75 ml of TRIzol reagent to the pellet. Homogenize the lysed cells by pipetting up and down many times.
-
3
After adding the TRIzol reagent, incubate the tissue or cell samples for 5 minutes then add 0.2 ml of chloroform (per 1 ml of TRIzol reagent), cap the tube, and incubate them for 2–3 minutes.
-
4
Then centrifuge the samples for 15 minutes at 12,000 X g at 4 degrees Celsius.
-
5
Transfer the aqueous phase containing the RNA into a new tube, angling tube at 45 degrees, and pipetting the solution out.
RNA Isolation
Per 1ml of TRIzol reagent used for lysis, add 0.5 ml of isopropanol to the aqueous phase and incubate for 10 minutes.
-
6
At 12,000 X g, 4 degrees Celsius, centrifuge for 10 minutes then discard the supernatant.
-
7
Per 1ml of TRIzol reagent used for lysis, resuspend the pellet in 1 ml of 75% ethanol. Then vortex the sample and at 7500 X g at 4 degrees Celsius centrifuge for 5 minutes.
-
8
Discard the supernatant and vacuum or airdry the RNA pellet for 5–10 minutes.
-
9
In 20–50 ul of RNase free water, 0.1 mM EDTA, resuspend the pellet by pipetting up and down.
-
10
Then for 10–15 minutes, incubate the sample in water bath or heat block set at 55–60 degrees Celsius.
-
11
Determine the RNA yield by first diluting the sample in RNase- free water then measuring the absorbance at 260 nm and 280 nm.
-
12
RNA concentration calculation formula: A260 dilution X 40 ug = ug RNA/ mL
-
13Calculate A260/A280 ratio (approximately 2 or above is considered pure)
- Typically, we get 10 ug of RNA from harvesting 1*106 cells. At this step, rhe sample can be stored in RNAse free water in the −20C freezer for up to 1 year or continue to step 15.
qRT-PCR
Real-Time quantitative reverse polymerase chain reaction (qRT-PCR) is a method used to measure mitochondrial gene expression (Reddy et al., 2018; Manczak et al., 2010; Manczak et al., 2018). In this method, RNA is reverse transcribed into cDNA using reverse transcriptase and amplified using species-specific primers. When studying the mitochondria, it is important to assess mitochondrial DNA damage, genes involved in mitophagy and mitophagosome information. Protocol (Bhatti et al., 2021):
-
14
Design and order the primers for the target gene. In this instance we were studying mitochondrial dynamic genes and the primers that were designed and ordered are listed in Table 2.
-
15
To a PCR tube containing 5 μg of RNA isolated from steps 1–12, add 1ul of Primer, 1 μl of Annealing buffer, and 8ul RNA-free water then incubate samples at 65 degrees Celsius for 5 minutes and place on ice for 1 minute.
-
16
Briefly centrifuge the tube and add 10ul of 2X First Strand Reaction Mix and 2ul of Superscript III/RNaseOUT Enzyme Mix.
-
17
Vortex the samples, briefly centrifuge, and incubate samples for 50 minutes at 50 degrees Celsius.
-
18
Terminate the reaction by heating at 85 degrees Celsius for 5 minutes.
-
19
Using SYBER-Green based real time PCR, amplify qRT-PCR reactions in an ABI Prism 7900 sequence detection system (Applied Biosystems) (See Table 3 for qRT-PCR setting).
-
20
Generate a dissociation curve to distinguish specific amplicons from non-specific amplifications.
-
21
Calculate the CT-values with sequence-detection system (SDS) software V1.7 (Applied Biosystems) and an automatic setting of base line, an average value of PCR, cycles 3–15, plus CT generated 10 times its standard deviation.
-
22For further analysis, export the amplification plots and CT-values from the exponential phase of PCR directly into Excel.
- For example, when we performed qRT-PCR on mitochondrial dynamic genes, our results indicated increase fission activity and decreased fusion activity in mutantAPP-HT22 cells compared to untransfected WT HT22 cells (See Table 4, Reddy et al., 2018b).
Table 3:
qRT-PCR conditions
| Segments | Cycles | Temperature | Time |
|---|---|---|---|
| Initial Denaturation | 50C | 2 minutes | |
| 95C | 10 minutes | ||
|
| |||
| Denaturation Annealing, Elongation, Fluorescence reading | 40 | 95C | 15 seconds |
| 60C | 1 minute | ||
Table 4:
qRT-PCR Results (Reprinted with permission from Reddy et al., 2018b)
Fold changes of mRNA expression of mitochondrial structural genes in mutant APP-HT22 cells compared to untransfected WT-HT22 cells.
| Genes | mRNA fold changes in mutant HT22 cells | |
|---|---|---|
| Mitochondrial structural genes | Drp1 | 2.1** |
| Fis1 | 1.7* | |
| Mfn1 | −1.8* | |
| Mfn2 | −2.2* | |
| OPA1 | −1.9* |
P<0.05
P<0.005.
Basic Protocol 2: Prepare Protein lysates of hippocampal neuronal HT22 cells and/or mouse brain tissues for Western Blotting
The aim of this protocol is to measure protein levels by using specific antibodies. To do this, protein lysates are prepared, and its concentration is measured using BCA method. The amount of protein added to each tube for western blotting depends on the concentration of the protein. The proteins are transferred to the PVDF membrane which undergoes blocking and primary and secondary antibody incubation, subsequently, as indicated below. Then the membrane is incubated in the developer for exactly 5 minutes and imaged. From the image, protein levels from the bands are quantified using the ImageJ software.
Materials List:
Tissue from mice or Neuronal HT22 cells
Pierce™ RIPA Buffer (ThermoFisher Scientific, cat no. 89900)
Halt™ Protease Inhibitor Cocktail (100X, Thermo Scientific, cat no. 87786)
Protease/phosphatase Inhibitor
EDTA Solution
Pierce™ BCA Protein Assay Reagent A (Thermo Scientific, cat no. 23228)
Pierce™ BCA Protein Assay Reagent B (Thermo Scientific, cat no. 23224)
BSA Standards (see recipe)
Centrifuge
Sonicator
Shaker
Autoclaved tubes
Aluminum foil
Imaging device
Bolt™ LDS Sample Buffer (Novex, cat no. 2398611)
2-Mercaptoethanol, 99%, pure (Thermo Scientific, cat no. 125472500)
Spectra™ Multicolor Broad Range Protein Ladder (Thermo Scientific, cat no. 26634)
1X PBS (see recipe)
Tris-Buffered Saline Tween 20 (TBST, see recipe)
Blocking buffer (see recipe)
BSA (see recipe)
Stacking (see recipe)
Separating Gel (see recipe)
Comb
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel glasses
Tweezer
Scissors
Trans-Blot Turbo Transfer system
Running Buffer (see recipe)
Transfer buffer (recipe)
Secondary antibody Sheep anti-mouse HRP 1:10 000
Chemiluminescence reagents (Thermo Scientific, cat no. 34076)
Trans-Blot Turbo Transfer Pack (BIO-RAD, cat no. 1704157)
PVDF membrane
Filter paper
Imaging device
Imaging software
Experimental Procedures (Manczak et al., 2016)
Protein extraction
-
1
Into each fresh tissue extracted from mice according to IACUC protocol and/ or cultured cells in DMEM, add RIPA buffer then add EDTA and protease/ phosphatase inhibitor to the buffer (each at 1:100, 1:50)
-
2
Keep the mixture on ice for 20 minutes.
-
3
For 5 pulses or 10 second intervals, sonicate the samples three times.
-
4
Then place the tubes on the shaker in +4 degrees Celsius refrigerator for 20 minutes or 1 hour.
-
5
For 20 or 30 minutes, centrifuge the tubes at 12,000 rpm at 4 degrees Celsius.
Protein estimation
-
6
Pipette the supernatant into a separate eppendorf tube and mix reagents A and B (50:1).
-
7
Then add 100 ul of the reagent mixture to an ELISA plate and add PBS to the plate to make 12.5 ul solution.
-
8
Cover the plate with foil and leave it in the 37 degrees Celsius incubator for 30 minutes.
-
9
Remove the foil and place the plate in imaging slot then make a graph of the results in Excel.
Protein denaturation
-
10
Combine loading buffer with 5% β-mercaptoethanol in a separate Eppendorf tube and add combined mixture, PBS, and sample to another microcentrifuge tube.
-
11
At 90 degrees Celsius for 5 minutes, heat the tubes and immediately put them on ice for 10 minutes to let them rest.
-
12At 7000 rpm, 4 degrees Celsius, centrifuge the tubes for one minute then store the tubes in −20 degrees Celsius freezer until ready to run gel for western blotting.
- For tissues, we use ½ of the brain tissue and consider it as 2ug of protein At this stage we can store this sample in RNAse free water in the −20C freezer for up to 1 year or continue to step 13.
Western blotting
Western blotting (Immunoblotting) is a highly sensitive technique used to identify protein levels in the mitochondria by using specific antibodies and involves both gel electrophoresis and antigen- antibody interaction (Gallagher & Chakavarti, 2008; Reddy et al., 2018a; Manczak et al., 2010; Manczak et al., 2018). This technique is also important to assess proteins involved in mitophagy and mitophagosome formation to understand the mechanisms of mitochondrial degradation.
Modified protocols for hippocampal neuronal HT22 cells for western blotting (Reddy at al., 2018a; Reddy at al., 2018b):
-
13
Make separating gel (water, bis acrylamide, resolving gel buffer, SDS, APS, and TEMED), pipette it between the 2 glass plates and let it set for 25–30 minutes.
-
14
Then make separating gel (water, bis acrylamide, stacking gel buffer, SDS, APS, and TEMED), pipette it on top of the separating gel, insert the combs, let it set for 20–25 minutes, and remove the combs before running the gel.
-
15
Resolve the protein lysates on 4–15% SDS-PAGE gel.
-
16Transfer resolved proteins to PVDF membranes and then incubate for 1 hour at room temperature with a blocking buffer (5% dry milk dissolved in a TBST buffer).
-
aThe blocking buffer prevents non-specific binding.
-
a
-
17Incubate the PVDF membranes with the primary antibodies overnight and secondary antibody Sheep anti-mouse HRP 1:10 000 for 2 hours, followed by three washes with TBST buffer at 10 minutes intervals after each incubation.
-
bTBST is a wash buffer for immunoassays.
-
b
-
18Detect proteins with chemiluminescence reagents (Pierce Biotechnology, Rockford, IL, USA), and visualize the bands from immunoblots.
- Our results indicated that fission proteins were significantly increased, and fusion proteins were significantly decreased in mutantAPP-HT22 cells compared to untransfected HT22 cells (Figure 2, Reddy et al., 2018b).
Figure 2: Example of Western blotting Results of mitochondrial dynamic proteins.
(A) Western blots show the protein level of each of the proteins compared to beta-actin in both untransfected HT22 cells (1) and HT22 cells transfected with mutant APP (2). (B) Graphs represent quantitative data analyzed from the western blots shown in Figure 2A after being normalized to beta-actin between the two groups of cells (x-axis) in terms of densitometry (y-axis). Reprinted with permission from Reddy et al., 2018b.
Basic Protocol 3: Immunofluorescence
Immunofluorescence is an advanced fluorescence technique used to assess immunoreactivities of mitochondrial proteins (Pradeepkiran et al., 2020; Reddy et al., 2018). This method can be done both in vitro and using brain sections (Reddy et al., 2018b; Peprotech, 2022; Figure 3).
Figure 3: Flowchart of Immunofluorescence process.
Both in vitro and in vivo process for immunofluorescence have been shown. After preparation of cells and tissue samples, both are incubated in primary and secondary antibodies. Then the tissues are stained while the cells are mounted on a slide before imaging the samples at 40X magnification. Created with BioRender.com.
Materials List:
Neuronal HT22 cells
1X PBS
0.1% Triton-X100
1% blocking solution (Invitrogen)
Secondary antibody conjugated with Fluor 488 (Invitrogen)
Slides
1% paraformaldehyde (see recipe)
TBST (see recipe)
Prolong™ Daimond Antifade Mountant with DAPI (DAPI, Invitrogen, cat no. P36962)
Imedge Pen (Vector Laboratories, cat no. H-4000)
Eppendorf Tubes
Multiphoton laser scanning microscope system (ZeissMeta LSM510)
Experimental Procedures
In vitro (Reddy et al., 2018b)
-
1
Wash fixed cells with warm phosphate buffered saline (PBS), fixed in paraformaldehyde in PBS for 10 min, and then wash with PBS and permeabilize with 0.1% Triton-X100 in PBS.
-
2
Then block cells with 1% blocking solution (Invitrogen) for 1 hour at room temperature.
-
3
Incubate all sections with antibodies and dilutions overnight.
-
4
After incubation, wash the cells three times with PBS, for 10 min each.
-
5
Incubate the cells with a secondary antibody conjugated with Fluor 488 (Invitrogen) for 1 hour at room temperature.
-
6
Wash the cells three times with PBS and mount on slides (DAPI is the mount).
-
7Use a multiphoton laser scanning microscope system (ZeissMeta LSM510) to take images at 40X magnifications to quantify the immunoreactivities of antibodies and assess the statistical significance.
- Our results indicated that fission proteins were significantly increased, and fusion proteins were significantly decreased in mutantAPP-HT22 cells compared to untransfected HT22 cells (Figure 4, Reddy et al., 2018b).
Figure 4:
Example of Immunofluorescence results of fission and fusion proteins in untransfected HT22 cells and HT22 cells transfected with mutant APP. (A) Immunofluorescence analysis images of fission and fusion proteins in untransfected HT22 cells and HT22 cells transfected with mutant APP. (B) Graphs represent quantitative data of fission and fusion proteins in untransfected HT22 cells and HT22 cells transfected with mutant APP (x-axis) in terms of fluorescence intensity (y-axis). Reprinted with permission from Reddy et al., 2018b.
Immunofluorescence using Brain Sections (See PeproTech, 2022, Dr. Reddy’s lab protocol, Reddy et al., 2018b)
Animal surgery and tissue processing:
Use standard animal surgery and tissue processing protocols approved by University of Iowa Animal Care and Use Committee (IACUC).
-
8
Remove slides (tissues) from the freezer and keep at room temperature for at least 30 minutes.
-
9
Dilute 16% paraformaldehyde in PBS to 1–4% paraformaldehyde then use the diluted paraformaldehyde to fix the tissues for 10 minutes.
-
10
Wash tissue sections three times with Tris Buffered Saline with Tween (TBST).
-
11
Block tissue for 1 hour and wash three times with TBST.
-
12
At 4 degrees Celsius, incubate the tissue section with the primary antibody overnight.
-
13
Wash the tissue section three times in TBST then incubate the tissue section with blocking buffer for 30 minutes.
-
14
Incubate the tissue section with the secondary antibody in the blocking buffer for 30 minutes to 1 hour.
-
15
Wash tissue three time with TBST.
-
16
Stain tissue with DAPI.
-
17
Coverslip the slide.
-
18
Take images at 40X magnifications to quantify the immunoreactivities of antibodies and assess the statistical significance.
Basic Protocol 4: Mitochondrial Membrane Potential
Proton pumps, complexes 1, 3, and 4, generate the mitochondrial membrane potential (MMP), which can be monitored to assess mitochondrial function and quality. Mitochondrial membrane potential can be measured using water-soluble mitochondrial membrane potential indicator, JC-1 method (most common), and tetramethylrhodamine, ethyl ester (TMRE) staining method (Zorova et al., 2018; Manczak et al., 2010; Cardosa et al., 2004; Sakamuru et al., 2016; Wagner et al., 2003). The protocols below show how to measure MMP using JC-1 dye and TMRE dye (Figure 5).
Figure 5: Flowchart of measuring mitochondrial membrane potential process.
This flowchart summarizes two methods: JC-1 (top) and TMRE (bottom). Both are used to measure the mitochondrial membrane potential. In the JC-1 method, cells are stained with JC-1 and washed before analyzing them. In the TMRE method, the cells are stained in TMRE and washed before pipetting them onto a microplate before analyzing them. TMRE method for cortical neurons is also shown (bottom). Created with BioRender.com.
Materials List:
Respiration buffer (10 mm TRIS, 5 mm Tris-phosphate, 0.05 mm EDTA(K), 100 mm KCl, 75 mmd-mannitol, 25 mm sucrose, pH 7.4)
JC-1 dye (1.8 μm) (Molecular Probes, Eugene, OR).
PBS/ 0.2% BSA
Cells
Confocal Microscopy
1mM TMRE
Cell culture media
20 μM FCCP
105-Well plate
Centrifuge
Microplate reader, flow cytometer or fluorescent microscope
Papain (Worthington)
Polyornithine- and fibronectin-coated coverslips
Plating medium (5% FBS, insulin, glutamate, G5 and 1 × B27) supplemented with 100× l-glutamine in Neurobasal medium (Invitrogen)
Lipofectamine 2000 (Invitrogen)
Experimental Procedures
Modified JC-1 MMP protocol (Manczak et al., 2010; Wagner et al., 2003) :
-
1
Stain mitochondria in respiration buffer (10 mm TRIS, 5 mm Tris-phosphate, 0.05 mm EDTA(K), 100 mm KCl, 75 mmd-mannitol, 25 mm sucrose, pH 7.4) with the membrane potential sensitive dye JC-1 (1.8 μm) (Molecular Probes, Eugene, OR).
-
2
Stain cells for 10 min at 37 degrees Celsius, until a final concentration of 5 μg/ml JC1 is reached.
-
3
Incubate the cells with JC-1 for 15 minutes at room temperature.
-
4
Wash the cells 3 times with PBS.
-
5
Analyze for MMP by measuring the red:green ratio with confocal microscopy.
TMRE MMP protocol (See Abcam (manufacturer)’s protocol):
For Cells
-
6
Prepare working TMRE solution by adding 1 mM TMRE in cell culture media (cell lines used will determine the required TMRE concentration).
-
7
Add and dilute 50 mM FCCP in cell culture media to 20 uM FCCP.
-
8
To cells in the media, add 20 μM FCCP and incubate for 10 minutes.
-
9
In 100 – 200 μL, prepare 105 – 2 × 105 cells/well.
-
10
Incubate cell in media with TMRE for 15–30 min.
-
11
Centrifuge to pellet the cells and remove culture media by aspiration.
-
12
Wash with PBS / 0.2% BSA and pellet the cells. Repeat (don’t pellet) and transfer to a microplate.
-
13
Analyze the plate with micro-plate reader at Ex/Em 549/575 nm, flow cytometer using 488nm laser for excitation and at emission 575 nm, or fluorescent microscope.
For Cortical Neurons (Cai et al., 2012; Ye et al., 2015; Han et al., 2021)
-
14
Dissect cortices from mouse embryos and dissociate cortical neurons by papain (Worthington)
-
15
Then plate neurons on polyornithine- and fibronectin-coated coverslips and grow in plating medium (5% FBS, insulin, glutamate, G5 and 1 × B27) supplemented with 100× l-glutamine in Neurobasal medium (Invitrogen) overnight.
-
16
Maintain cultures in conditioned medium with half-feed changes of neuronal feed every 3 days from second day, in vitro.
-
17
At days 6–8, in vitro, transfect both wild-type and mutant neurons with constructs using Lipofectamine 2000 (Invitrogen) then do a 30 minutes pulse with TMRE dye before imaging.
Basic Protocol 5: Transmission electron microscopy
Transmission electron microscopy (TEM) is a high-resolution microscope used to observe the structure of the mitochondria. We used TEM to measure mitochondrial number and lengths in presence of mutant Tau in HT22 cells (Reddy et al., 2018; Figure 6).
Figure 6: Flowchart of observing tissues and cells through transmission electron microscopy process.
Both cells and tissue samples are obtained from experimental animals such mice. Then they are stained with lead citrate and uranyl acetate and rinsed before imaging them using TEM. Created with BioRender.com.
Materials List:
Animals
Microsurgery forceps
Distilled water
Beaker
Spatula
Single-edge blades
Lead citrate (See Graham & Orenstein, 2007 for supplier, cat. No, and reagent setup information)
Uranyl acetate (See Graham & Orenstein, 2007 for supplier, cat. No, and reagent setup information)
Sodium cacodylate Buffer (0.3M, pH 7.4) (Electron Microscopy Sciences, cat no. 11652)
2.5% glutaraldehyde (See Graham & Orenstein, 2007 for supplier, cat. No, and reagent setup information)
1.6% paraformaldehyde (see recipe)
0.064% picric acid
0.1% ruthenium red
1% osmium tetroxide plus 08% potassium ferricyanide, in 100 mM sodium cacodylate, pH 7.2 (See Graham & Orenstein, 2007 for supplier, cat. No, and similar reagent setup information)
Acetone
Epon 812
Phillips Morgagni TEM equipped with a CCD
ImageJ Software
Experimental Procedures
Modified TEM Protocol written according to the following articles: (Kandimalla et al., 2018; Manczak et al., 2018; Manczak et al., 2010; Wagner et al., 2003, Lam et al., 2021):
Animal Care:
Use standard mice care protocols approved by University of Iowa Animal Care and Use Committee (IACUC) to take care and maintain conditions of mice.
For tissues (Kandimalla et al., 2018; Manczak et al., 2018):
-
1
Using the standard perfusion method, perfuse the animals then remove the skin on top of the head.
-
2
Take the brain out, post fixed the brain for 2–3 hours, and cut the desired sections.
-
3
Stain the cut sections in lead citrate for 5 minutes then in uranyl acetate for 30 minutes with a rinse between the two staining.
-
4
Rinse again and dry.
-
5
Using a Phillips Morgagni TEM equipped with a CCD, collect images at magnification of 1000X-37000X (at 60 kV).
-
6
Count the numbers of mitochondria per optic field and use one-way analysis on variance (ANOVA) to determine statistical significance.
-
7Use Image J software to analyze mitochondrial morphology and measure their length and width by clicking on “Measure” to obtain the desired measurements after tracing or adding lines to the mitochondria.
- Our results indicated that there was significant increase in mitochondria number in 12-month-old Tau mice (p=0.001) compared to WT (Figure 7; Kandimalla et al., 2018).
Figure 7:
Example of TEM results of mitochondrial number and length in tissues. (A) TEM images of hippocampus of 12-month-old Tau and WT mice (right) and graphical representation of mitochondrial number and length in hippocampus of 12-month-old Tau and WT mice (left). (B) TEM images of cerebral cortex of 12-month-old Tau and WT mice (right) and graphical representation of mitochondrial number and length in cerebral cortex of 12-month-old Tau and WT mice (left). Reprinted with permission from Kandimalla et al., 2018.
For cells (Manczak et al., 2010; Wagner et al., 2003):
-
8
Fix cells in 100 mM sodium cacodylate (pH 7.2), 2.5% glutaraldehyde, 1.6% paraformaldehyde, 0.064% picric acid, and 0.1% ruthenium red.
-
9
Then wash the cells and fix them in 1% osmium tetroxide plus 08% potassium ferricyanide, in 100 mM sodium cacodylate, pH 7.2 for 1 hour.
-
10
Rinse the cells in water, dehydrate, infiltrate the cells overnight in 1:1 acetone:Epon 812, infiltrate for 1 hour with 100% Epon 812 resin, and embed the cells in the resin.
-
11
Cut thin sections on a Reichert ultramicrotome and stain them in lead citrate for 5 minutes then in uranyl acetate for 30 minutes. Rinse the cut sections before the second staining.
-
12
Wash and dry again the cut sections.
-
13
Using a Phillips Morgagni TEM equipped with a CCD, collect images at magnification of 1000X-37000X (at 60 kV).
-
14
Count the numbers of mitochondria per optic field and use one-way ANOVA to determine statistical significance
-
15
Use Image J software to analyze mitochondrial morphology and measure their length and width by clicking on “Measure” to obtain the desired measurements after tracing or adding lines to the mitochondria.
Mitophagosomal formation observations through Electron Microscopy
Mitophagosome is a double membrane structure that is formed during the process of mitophagy, selective autophagy of mitochondria, to aid in degradation of dead mitochondria. Mitophagosomal formation is important to observe when studying defective mitophagy to understand protein-protein interactions and mechanisms of how mitophagy occurs. At various stages of degradation, mitophagosomes contain cytoplasmic material. Specific mitophagosome markers such as autophagy-related (Atg) genes can be used to observe mitophagosomal formation through electron microscopy (EM) technique such as TEM. Protocol, written above, for TEM can also be used to observe mitophagosomal formation (Ding & Yin, 2012; Kandimalla et al., 2018; Manczak et al., 2018; Manczak et al., 2010; Wagner et al., 2003, Shibutani et al., 2013, Tran & Reddy, 2021).
Since the 1950s, autophagy-related structures have been identified using EM. Transmission election microscopy can be used to measure the size of mitophagosomes because as autophagy is induced, formation of larger autophagosomes occur. During autophagy, they have a diameter that ranges from 300–900 nm. It is believed that Atg proteins play a central role in autophagosome size (Jin & Klionsky, 2015; Backues et al., 2014; Shibutani et al., 2013).
Along with autophagosome size, autophagosome number is also important during autophagy. It has been observed that number of autophagosomes increases when autophagy is induced and that Atg proteins play a central role. Using EM, number of autophagosomes can be counted to determine the number of autophagosomes formed during selective autophagy, also known as mitophagy (Jin & Klionsky, 2015; Hu & Reggiori, 2022, Zhu et al., 2011; Figure 8).
Figure 8: Flowchart of mitophagosomal formation.
The flowchart indicates change in mitophagosome number and length during mitophagy. Mitophagosomal formation starts with initiation by oxidative stress. Then the phagophore elongates and takes up the dead mitochondria with aid of ATG and other proteins forming a mitophagosome. Then the mitophagosome fuses with the lysosome, forming a mitoplysosome for degradation of dead mitochondria. Created with BioRender.com.
Basic Protocol 6: Detection of Mitophagy Methods
Mitophagy, also known as selective autophagy, is the selective removal of dead mitochondria in the cells. It is one way to maintain mitochondrial health, but multiple factors can result in defective mitophagy such as oxidative stress, DNA damage and abnormal protein-protein interactions, resulting in accumulation of dead mitochondria in the cells. Methods for detecting mitophagy accurately have been challenging to develop and are still currently being developed. These methods can be used to better understand the role of mitophagy in healthy and diseased states (Pradeepkiran et al., 2022; Pradeepkiran et al., 2020; Tran et al., 2020; Manczak et al., 2011; Manczak and Reddy, 2012a; Manczak and Reddy, 2012b; Fang et al., 2017; Sun et al., 2017; Figure 9).
Figure 9: Flowchart of detecting mitophagy.
Both in vivo and in vitro methods as well as detection of mitophagy in live neurons have been summarized. Tissue samples are cooled on ice and cut while the cells are incubated and spread in wells before images are taken using red and green channels to detect mitophagy. Detecting/ examination of mitophagy can be done by imaging or by measuring levels of desired protein marker via immunoblotting. Created with BioRender.com.
Materials List:
Mice
Tissue
Microsurgery forceps
Ice-cold PBS
Petri dish
Spatula
Single-edge blades
Distilled water
Beaker
Glass bottom dish
Confocal microscope
6-well plates
Fetal Bovine Serum
Culture Medium
37 degrees Celsius incubator
Coverslip plate
DMSO, CCCP, or CCCP with lysosomal inhibitors pepstatin A
E64D.
Centrifuge
For more complete list of materials with supplier and catalog number for in vivo and in vitro detection of mitophagy, please refer to Sun et al., 2017.
Experimental Procedures
In vivo (Fang et al., 2017, Sun et al., 2017)
-
1
Using a protocol approved by the IACUC, euthanize mice, and dissect out the desired tissue (e.g brain, liver).
-
2
Place the tissue sample on a metal plate on ice to rapidly cool the tissue.
-
3
Lift the tissue sample using curved forceps and rinse with ice-cold PBS.
-
4
Transfer the tissue to a Petri dish on ice using the spoon end of a spatula.
-
5
Cut the tissue sample into thick sections using single-edge blades (thickness depends on type of tissue such as brain or liver).
-
6
Transfer the tissue sections to a glass bottom dish using microsurgery forceps.
-
7
Carefully set the tissue section with forceps to flatten on the bottom.
-
8
Cover the sliced tissue with few drops of cold PBS.
-
9
Image the tissue sections under confocal microscopy via two sequential excitations and set two imaging channels: green channel and red channel.
In vitro (Fang et al., 2017; Sun et al., 2017)
-
10
Seed approximately 0.3–1 X 106 cells/well in a 6-well plate. Maintain the cells expressing mt-Keima in complete cell culture medium (DMEM medium supplemented with 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin) and incubate in a cell culture incubator at 37 degrees Celsius (20% O2, 5% CO2) for 24 hours.
-
11
Then replace culture medium with 2 mL DMEM.
-
12
Inside temperature-controlled microscope stage, place the imaging coverslip plate and wait until temperature is at 37 degrees Celsius.
-
13
Image the cells using confocal microscopy by using two imaging channels: green channel and red channel to visualize normal mitochondria and mitochondria which are undergoing mitophagy, respectively.
-
14
Using the imaging analysis software, calculate the mitophagy index.
Live imaging of Neurons using mt-Keima (Han et al., 2020)
-
15
Express wild-type and mutant cortical neurons with mt-Keima alone or mt-Keima with other different constructs
-
16
Then treat them with DMSO, CCCP, or CCCP with lysosomal inhibitors pepstatin A and E64D.
-
17
Then visualize neurons with an FV3000 oil immersion 60X objective (more information in Han et al., 2020).
-
18
Take images, import them into ImageJ and remove the background prior to quantification.
Monitoring Mitophagy in live neurons using protein markers (Ye et al., 2015; Cai et al., 2012)
Fluorescent labeling
-
1
Label desired protein marker in wild-type and mutant neurons with fluorescent tag.
-
2
Using an Olympus FV1000 oil immersion 60X objective, take images to determine change in protein markers between healthy and AD neurons to assess increase formation of mitophagosomes.
Fractionation and Immunoblotting
-
3
Prepare Mitochondria-enriched membrane (more information in Cai et al., 2012).
-
4
Culture wild-type and mutant cortical neurons and treat them with DMSO or 10 um CCCP at 13th day in vitro for 24 hours.
-
5
Wash cells with PBS, harvest and suspend them in ice-cold Isolation Buffer (IB).
-
6
Pass cells through a 25-gauge needle using a 1-ml syringe 20 times on ice to homogenize cells and homogenize tissues in ice-cold IB buffer.
-
7
After centrifugation of homogenates from cells or brains at 4 degrees Celsius for 10 minutes, save the supernatant as post-nuclear supernatant.
-
8
To separate the mitochondria-enriched fraction from the cytosol-enriched fraction, centrifuge the post-nuclear supernatant at 15 000g for 10 minutes.
-
9
Perform Western blotting to determine change in protein markers between healthy and AD neurons.
Basic Protocol 7: Bioenergetic Assay via Seahorse (Modified protocol from Gu et al., 2021).
Mitochondria is the powerhouse of the cell that plays a role in cellular energy metabolism or bioenergetics. One way of measuring the bioenergetics of the mitochondria is by using Seahorse XFe96 flux analyzer to mitochondrial respiration parameters. This will help us better understand the bioenergetics of the mitochondria in healthy and diseased states (Gu et al., 2021; Figure 10).
Figure 10: Flowchart of observing bioenergetics via Seahorse Analyzer.
Steps have been compartmentalized into Days since assays using seahorse takes multiple days. Cells are transfected from days 1–3 then media, cells, and solutions are prepared for running the assay on day 4. Created with BioRender.com.
Materials List:
6-well plates
DMEM supplemented with 10% fetal bovine serum (see recipe)
Lipofectamine 3000 Transfection Kit (Invitrogen, cat no. L3000–008)
Lipofectamine 3000
P3000
Opti-MEM (gibco, cat no. 31985–070)
Seahorse XF96 Cell culture microplates (Agilent, cat no. 101085–004)
Extracellular Flux Assay kits (Agilent, cat no. 103015–100))
Seahorse XF Cell Mito Stress Test Kit (Agilent, cat no. 103015–100)
2 μM oligomycin
1 μM FCCP
0.5 μM Rotenone/antimycin A
100mM Pyruvate solution (Agilent Tecnhologies, cat no. 103578–100)
200mM Glutamine solution (Agilent Technologies, cat no. 103579–100)
D-glucose (Agilent Technologies, cat no. 103577–100)
XF DMEM medium, pH 7.4 (Agilent Texhnologies, cat no. 103575–100)
non-CO2, 37 degrees Celsius incubator
Seahorse XFe96 Analyzer
Experimental Procedures
Before the Assay:
-
1
Solutions needed for preparation of assay medium: 100mM Pyruvate solution and 200mM Glutamine solution.
-
2
The cells need to be in a monolayer configuration and at 80% of confluence before further use (observe under an inverted microscope).
Transfect cells
-
3
On day 1, plate cells in a 6-well plate with 2 ml growth medium (DMEM supplemented with 10% fetal bovine serum) without antibiotics.
-
4
On Day 2, prepare the following complexes for each transfection sample: Dilute then mix, 3.75 ul Lipofectamine 3000 with 125 ul Opti-MEM and 2500 ng DNA in 125 ul of Opti-MEM without serum and add 5 ul p3000. Then combine and mix both dilutes solutions and at 20–25 degrees Celsius incubate for 5 minutes.
-
5
After incubation, add the complexes to wells containing cells and medium.
-
6
Then in a cell culture incubator with a humidified atmosphere of 5% CO2, incubate the cells at 37 degrees Celsius for 24 hours.
-
7On day 3, isolate cells from growth medium and plate cells in 100 μL growth medium (DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin and streptomycin) in each well.
- Blank the four background temperature correction wells (A1, A12, H1, and H12) with 100 μL of growth medium.
-
8
Rest the plates at 20 degrees Celsius–25 degrees Celsius in the tissue culture hood for 1 hour to distribute cells evenly and reduce edge effects for cells.
-
9
Then for 12–18 hours, incubate the cells in a cell culture incubator.
-
10
Hydrate sensory cartridge in non-CO2, 37 degrees Celsius incubator for 12–18 hours (More information in Gu et al., 2021).
-
11
Turn on the Seahorse XFe96 Analyzer, non-CO2, 37 degrees Celsius incubator and computer, then open the “Wave” software and click the “Heater on.” (Done at least 5 hours before running the assay).
Day of the Assay:
-
12On Day 4, prepare assay mediums, cells, and solutions for running the assay.
- Assay medium: Warm the water bath to 37 degrees Celsius and add the following in 98 mL XF base medium: 1 mL of 100mM pyruvate solution, 1 mL of 200 mM glutamine solution, and 0.1 g D-glucose.
- Cells: Obtain the XF96 Cell Culture Microplate from the cell incubator and remove cell growth medium until 20 ul remains and replace with 180 μL of assay medium (repeat 3 times). On the last repeat, remove 180 μL of assay medium and replace with 160 μL of assay medium. Then for 1 hour, incubate the XF96 Cell Culture Microplate in a 37 degrees Celsius incubator without CO2.
- Solutions: Suspend the compounds with assay medium (more information in Gu et al., 2021). Dilute the stock solutions of Oligomycin, FCCP and Rotenone/antimycin then load 20 μL of 2 μM oligomycin in port A, 22 μL of 1 μM FCCP in port B and 25 μL of 0.5 μM Rotenone/antimycin A in port C of the hydrated sensory cartridge (more information in Gu et al., 2021).
-
13
Run the assay (more information in Gu et al., 2021).
-
14Analyze data using the Wave software.
- The results show that mitophagy enhancers (urolithinA, actionin, tomatidine and nicotinamide riboside) increased mitochondrial respiration in mutant TauHT22 cells compared to untransfected HT22 cells (Figure 11).
Figure 11:
Example of Seahorse Bioanalyzer data for mitochondrial respiration measured in mutant Tau- HT22 cells treated with mitophagy enhancers. Graphical representations of mitochondrial respiration (top right), maximal representation (top left), ATP production (bottom right), and proton leak (bottom left). Reprinted with permission from Kshirsagar et al., 2021a.
Basic Protocol 8: Mitochondrial Function:
In the mitochondria, an enzyme called Cytochrome c oxidase (Complex IV) plays a role in the final step of oxidative phosphorylation, one of the biochemical processes, where ATP is produced (Li et al., 2006). The mitochondria also produce, an endogenous reactive oxidative species (ROS), H2O2 when mitochondrial superoxide dismutase disproportionate superoxide (O2). To prevent oxidative distress, H2O2 is quickly degraded via two antioxidant defense systems: GSH and TRX2 systems, so it is relatively stable but is a destructive molecule because as levels of H2O2 increase, various deleterious consequences occur such as genomic instability (Mailloux, 2018; Jia & Sieburth, 2021; Gough & Cotter, 2011).
Another indicator of oxidative stress, other than H2O2, are lipid peroxidates. Lipids are important for structure and function of the mitochondria but when oxidative stress via overproduction of ROS occurs, it will result in lipid peroxidation. Lipid peroxidation generates 4-hydroxynonenal (4HNE), a reactive lipid. Oxidation of lipid leads to mitochondrial dysfunction, which is associated with many neurodegenerative disorders. To assess mitochondrial function during studies, Cytochrome c oxidase, mitochondrial ATP, hydrogen peroxide (H2O2), and lipid peroxidation are used (Xiao et al., 2017; Gough & Cotter, 2011; Reddy et al., 2018b; Figure 12).
Figure 12: Flowchart of observing mitochondrial functions.
This flowchart includes four mitochondrial functions: Cytochrome c oxidase activity (top), ATP production (second), H2O2 production (third), and 4HNE levels (bottom). MitoROGFP method in cultured cortical neurons is also used to measure mitochondrial oxidation. Created with BioRender.com.
Materials List:
Mitochondrial proteins
Pierce™ BCA Protein Assay Reagent A (Thermo Scientific, cat no. 23228)
Pierce™ BCA Protein Assay Reagent B (Thermo Scientific, cat no. 23224)
BSA standards (see recipe)
ATP determination kit (Molecular Probes. Cat no. A22066)
1X Reaction buffer (see recipe)
10mM D-luciferin stock solution (see recipe)
100mM Dithiothreitol (DTT) stock solution (see recipe)
Adenosine 5′-triphosphate (ATP) standard solution (see recipe)
Luciferase, firefly recombinant (see recipe)
Amplex® Red H2O2 Assay Kit (Molecular Probes, Eugene, OR, USA)
HNE-His ELISA Kit (Cell BioLabs, Inc.)
96-well Protein Binding Plate
Anti-HNE Antibody (1000X)
Secondary Antibody, HRP Conjugate (1000X)
Assay Diluent
10X Wash Buffer
Substrate Solution
Stop Solution
Sigma Kit (Sigma–Aldrich) kit
Amplex Red reagents (50 μM)
Horseradish peroxidase (0.1 U/ml)
Reaction solution from the kit
MitoROGFP plasmid
Live neurons
1.5mL Eppendorf tubes
Spectrophotometer
Experimental Procedures
ATP (Reddy et al., 2018b, See Molecular Probes (Manufacturer) protocol)
-
1
Measure ATP levels in isolated mitochondria from all groups of cells using ATP determination kit (Molecular Probes).
-
2
Prepare the following reagents: 1 mL of 1X Reaction Buffer, 1mL of 10mM D-luciferin stock solution, 100mM DTT stock solution, low concentration of ATP standard solution.
-
3
Make a 10 ml standard reaction solution containing: 8.9 mL dH2O, 0.5 mL 20X Reaction Buffer (Component E), 0.1 mL 0.1 M DTT, 0.5 mL of 10 mM D-luciferin, 2.5 μL of firefly luciferase 5 mg/mL stock solution (adjust volume as needed).
-
4
Mix by inverting the tube.
-
5
In the luminometer, place the standard reaction solution and measure the background luminescence.
-
6
Add dilute ATP standard solution to start the reaction, read the luminescence, and subtract background luminescence.
-
7
For a series of ATP concentrations, generate a standard curve.
-
8Do the sample analysis.
- Our Results indicated that ATP levels were significantly decreased (p=0.02) in mutantAPP-HT22 cells compared to untransfected HT22 cells (Figure 13, Reddy et al., 2018b).
Figure 13:
Example of mitochondrial function results of untransfected HT22 cells and mutant APP HT22 cells. (A) Graphical representation of hydrogen peroxide production in untransfected HT22 cells and mutant APP HT22 cells in terms of nmolH2O2/mgprotein (y-axis). (B) Graphical representation of lipid peroxidation production in untransfected HT22 cells and mutant APP HT22 cells in terms of HNE ug/mgprotein (y-axis). (C) Graphical representation of cytochrome c activity in untransfected HT22 cells and mutant APP HT22 cells in terms of uUnits/mgprotein (y-axis). (D) Graphical representation of ATP level in untransfected HT22 cells and mutant APP HT22 cells in terms of nmolATP/mgprotein (y-axis). Reprinted with permission from Reddy et al., 2018b.
Free Radicals (H2O2) (Reddy et al., 2018b)
-
9
The production of H2O2 was measured using an Amplex® Red H2O2 Assay Kit (Molecular Probes, Eugene, OR, USA) using cell pellets from groups of cells.
-
10
Protein concentration was estimated using a BCA Protein Assay Kit (Pierce Biotechnology).
-
11
The reaction mixture contained mitochondrial proteins (μg/μl), Amplex Red reagents (50 μM), horseradish peroxidase (0.1 U/ml) and a reaction buffer (1X).
-
12
The mixture was incubated at room temperature for 30 minutes then spectrophotometer readings of fluorescence (570 nm) were taken.
-
13Using a standard curve equation, H2O2 production was determined (nmol/μg mitochondrial protein).
- Our Results indicated that free radical levels were significantly increased (p=0.02) in mutantAPP-HT22 cells compared to untransfected HT22 cells (Figure 13, Reddy et al., 2018b).
All Species of ROS: 4HNE- Lipid peroxidation (Reddy et al., 2018b)
-
14
Use HNE-His ELISA Kit (Cell BioLabs, Inc., San Diego, CA, USA).
-
15
Add protein to a protein binding plate and incubate at 4 degrees Celsius overnight.
-
16
Wash three times with a buffer.
-
17
Add the anti-HNE-His antibody, after the last wash, to the protein in the wells and incubate for 2 hours at room temperature and wash again three times.
-
18
Incubate the samples with a secondary antibody conjugated with peroxidase for 2 hours at room temperature. Then incubate with an enzyme substrate.
-
19Measure the Optical density (at 450 nm) to quantify the level of HNE.
- Our Results indicated that 4HNE levels were significantly increased (p=0.01) in mutantAPP-HT22 cells compared to untransfected HT22 cells (Figure 13, Reddy et al., 2018b).
ROS levels in cultured cortical neurons using MitoROGFP (Han et al., 2020; Han et al., 2021)
-
20
Transduce MitoROGFP plasmid into live neurons after isolating and amplifying the plasmid (more information in Teixeira et al., 2021).
-
21
With sequential line scanning method, excite MitoROGFP expression in neurons at two excitation wavelengths (405 nm or 488 nm).
-
22
Process images.
-
23
Normalize 405:488 ratios to the values of wild-type and mutant neurons in the presence or CCCP or glutamine (more information in Han et al., 2020 and Han et al., 2021 regarding CCCP and glutamine).
Cytochrome C oxidase activity (Reddy et al., 2018b)
-
24
Use Sigma Kit (Sigma–Aldrich) kit to assay Cytochrome C oxidase activity using a spectrophotometer.
-
25
Add 2 μg protein lysate to 1.1 ml of a reaction solution. The reaction contains: 50 μl 0.22 mM ferricytochrome c fully reduced by sodium hydrosulphide, Tris–HCl (pH 7.0) and 120 mM potassium chloride.
-
26At 10 second intervals, absorbance at 550mM was recorded for 1-minute reactions. Our results indicated that cytochrome C oxidase levels were significantly decreased (p=0.01) in mutantAPP HT22 cells compared to untransfected HT22 cells (Figure 9, Reddy et al., 2018b).
- mU/mg total mitochondrial protein = [A/min sample − (A/min blank) × 1.1 mg protein × 21.84] was the formula used to measure cytochrome C oxidase activity.
- BCA method was used to determine protein concentrations.
- Our results indicate, significant decrease (p=0.01) in cytochrome c activity in mutant APPHT22 cells compared to untransfected HT22 cells (Figure 13; Reddy et al., 2018b).
REAGENTS AND SOLUTIONS
75% Ethanol
75mL 100% Ethyl Alcohol (Fisher Chemical, cat no. 111000200)
25mL Deionized water
Store at room temperature for up to 3–6 months
1X PBS
1mL 10X PBS Buffer (ThermoFisher Scientific, cat no. AM9625)
49mL deionized water
Store at room temperature up to 6–12 months
TBST Buffer
100mL 10X Tris-Buffered Saline (TBS, BIO-RAD; cat. No. 1706435)
1mL Tween 20 (Fisher Chemicals, cat no. BP337–500)
900mL deionized water
Store at room temperature up to 2–3 days
Tween 20 is viscous so cut part of the tip before pipetting and drop pipette into the solution to make sure all the reagent is dissolved into the solution.
Blocking buffer
2.5g Instant Nonfat Dry Milk (Nestle)
50mL TBST buffer (see recipe)
Store at 4 degrees Celsius up to 1 day
BSA
5g Albumin Bovine Serum (BSA, GOLDBIO, cat no. A-420–100)
100mL TBST Buffer (see recipe)
Store at 4 degrees Celsius up to 2–3 days
BSA Standards
Concentrations : 2.2mg/ml, 1mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125 mg/ml, 0.0625mg.ml
Do 1 :1 dilution with RIPA buffer
Store at −20 degrees Celsius up to 12 months
APS
20g APS
20mL water
Store at −20 degrees Celsius up to 3 months
10% SDS
100 ml water
10g Sodium Lauryl Sulfate NF/FCC Powder (SDS, Fisher Chemical, cat no. S529–500)
Stir powder and water on stir plate
Store at room temperature up to 2–3 months
Separating Gel
Water
Acrylamide/BISacrylamide Solution (40%, 37.1:1, Alfa Aesar, cat no. J60868.K2)
Resolving Gel Buffer (BIO-RAD, cat no. 1610798)
10% SDS (see recipe)
APS (see recipe)
TEMED (Thermo Scientific, cat no. 17919)
Make right before use
Volumes depend on percentage of gel being made.
Stacking Gel
Water
Acrylamide/BISacrylamide Solution (40%, 37.1:1, Alfa Aesar, cat no. J60868.K2)
Stacking Gel Buffer (BIO-RAD, cat no. 1610799)
10% SDS (see recipe)
APS (see recipe)
TEMED (Thermo Scientific, cat no. 17919)
Make right before use
Volumes depend on percentage of gel being made.
Transfer buffer
100 ml 5X Transfer buffer (BIO-RAD, cat no. 10026938)
300 ml water
100 ml ethanol (aka: ethyl alcohol)
Store at 4 degrees Celsius up to 2–3 days
Running Buffer
890ml Water
100ml Tris-Glycine (BIO-RAD, cat no. 1610771)
10ml 10% SDS (see recipe)
Store at room temperature up to 2–3 days
1% paraformaldehyde
16% Paraformaldehyde (Electron Microscopy Sciences; cat no. 15710-S)
1X PBS (see recipe)
Use once
Total volume of the solution depends on the individual performing the experiment
Culture Medium (Basic Protocol 6)
DMEM
FBS
Penicillin- streptomycin
Store at 4 degrees Celsius up to 3–6 months
For supplier and catalogue number please refer to Sun et al. (2017)
Culture Medium (Basic Protocol 7)
DMEM (gibco, cat no. 11995–065)
10% fetal bovine serum
Store at 4 degrees Celsius up to 3–6 months
1X Reaction Buffer
50 μL of 20X Reaction Buffer (ATP Determination Kit)
950 μL of deionized water
10 mM D-luciferin stock solution
1 mL of 1X Reaction Buffer (see recipe)
One vial of D-luciferin (ATP Determination Kit
Protect from light until use.
The D-luciferin stock solution is reasonably stable for several weeks if stored at ≤–20°C, protected from light.
100 mM DTT stock solution
1.62 mL of deionized water
25 mg of DTT (ATP Determination Kit)
Aliquot into ten 160 μL volumes and store frozen at ≤–20 degrees Celsius
Store DTT Stock solutions at 4 degrees Celsius up to 6–12 months.
Thawed aliquots should be kept on ice or at 4°C until ready for use.
Low-concentration ATP standard solutions
5 mM ATP solution (ATP Determination Kit)
Deionized water
ATP standard solution concentrations and volumes depends on the luminometer being used for the experiment.
COMMENTARY:
Background Information:
Alzheimer’s disease (AD) is a prevalent neurodegenerative disorder characterized by the accumulation of amyloid β (Aβ) peptides and phosphorylated tau in the brain. Accumulation of Aβ peptide is done via interaction between amyloid precursor proteins (APP) and two proteases: beta (β-) and gamma (γ-) secretases. Normally, APP is cut by alpha (α-) and γ- secretases, forming soluble APP, which does not form plaques. But when APP interacts with β and γ-secretases, this results in an increase of Aβ production (Wang et al., 2021, Canter et al., 2016; Selkoe & Hardy, 2016). Aβ and other factors such as phosphorylation/ dephosphorylation pathway dysregulation results in hyperphosphorylated tau (p-tau). Both accumulation of amyloid-beta and p-tau can increase generation of ROS and induce mitochondrial dysfunction (Gong & Iqbal, 2008; Pradeepkiran et al., 2020).
Mitochondrial dysfunction can be observed through widely used methods such as qRT-PCR and Western blotting, which can measure mRNA expression and protein levels within eukaryotic cells and animal brain tissues, respectively (Reddy et al., 2018; Manczak et al., 2010; Manczak et al., 2018 Gallagher & Chakavarti, 2008; Reddy et al., 2018a; Manczak et al., 2010; Manczak et al., 2018). In qRT-PCR, the measurements of cDNA copy number depend on chemistry, so SYBER Green dyes or other intercalating dyes are utilized, which bind to double stranded DNA and emit fluorescence after Supercript III, a thermostable reverse transcriptase, synthesizes cDNA from RNA. Other components such as specific primers and dNTPs (Deoxynucleoside triphosphates) are used to amplify the cDNA by having the fluorescently labeled dNTPs bind to the growing DNA strand at the 5’ end, thus having synthesis occur in 5’ to 3’ direction (Bhattacharya et al., 2020).
In western blotting, specific primary antibodies are used to detect the desired proteins after the proteins are transferred to a PVDF membrane from the SDS-PAGE gel. Then secondary antibodies conjugated with an enzyme such as Horse Radish Peroxidase (HRP) or Alkaline Phosphatase (AP). are attached to the primary antibodies to allow detection of the protein of interest. In our lab, we use chemiluminescent western blotting instead of fluorescent western blotting, which is an indirect method of detection in which light emitted by the enzyme-substrate reaction is detected on an x-ray film. This technique has high sensitivity and can be used to detect presence/absence of the protein but disadvantages such as requirement of normalization/ loading control via stripping the membrane and method of visualization can lead to signal saturation exist (Kurien & Scofeild, 2006; Azure Biosystems, 2014).
Mitochondrial proteins can be further assessed using immunofluorescence both in vitro and in vivo. Immunofluorescence has a similar principle to western blotting in which it also utilizes specific antibodies with fluorescent dyes to recognize their antigen and allow visualization of the localization of the protein of interest. Compared to western blotting, immunofluorescence allows detection of the target protein at a specific location (Pradeepkiran et al., 2020; Reddy et al., 2018; Reddy et al., 2018b; Peprotech, 2022; Im et al., 2019).
Another method called electron microscopy (EM) is a tool that has been around for 50 years and has been used to observe organelles such as mitochondria in eukaryotic cells. The technique and technology have been developed to the point that we can now observe and measure mitochondrial number and length (Yin & Shen, 2022; Granata et al., 2018; Kandimalla et al., 2018; Manczak et al., 2018; Manczak et al., 2010; Wagner et al., 2003; Reddy et al., 2018) There are two types of electron microscopy: transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The type of EM described in this article is TEM, a high-resolution microscope, which our lab used to observe the structure of the mitochondria in terms of number and length in both cells and tissue samples (Kandimalla et al., 2018; Manczak et al., 2018; Manczak et al., 2010; Wagner et al., 2003; Reddy et al., 2018). The principle of TEM is that electrons are passed through the samples before they provide information on the inner structure of the samples, while for SEM, images are created from reflected electrons. Both methods are good for analysis, but TEM provides information on inner structures of the samples thus having higher resolution, while SEM provides information on surface and composition of the cells or tissue samples. In the end, which EM to use depends on the type of analysis being performed (Brodusch et al., 2021)
Since the early 21st century, we’ve also been able to measure the bioenergetics of the mitochondria in cells treated with pharmacological drugs by using Seahorse XFe96 flux analyzer. (Gu et al., 2021; Luz et al., 2015; Kshirsagar et al., 2021a). In our lab we used the following pharmacological drugs: urolithinA, actionin, tomatidine and nicotinamide riboside. These drugs gave been used as mitophagy enhancers in our lab (Kshirsagar et al., 2022; Kshirsagar et al., 2021b). Although there is an advantage of measuring mitochondrial respiration using Seahorse Bioanalyzer, it has three main limitations: cost, a single assay can only use four injectable compounds, drugs being injected may lead to inaccurate/misleading data by interfering with sensor fluorescence or plastic plate (Horan et al., 2012).
Mitochondrial quality and function can be determined by measuring MMP (JC-1 and TMRE), measuring ATP levels, ROS levels, H2O2 levels, and cytochrome c oxidase levels. The two methods used to measure MMP in both cells and tissues are 5,5’,6,6’-Tetrachloro-1,1’,3, 3’-tetraethylbenzimidazolylcarbocyanine iodide (JC-1) and TMRE along with other methods. Both are cationic dyes; JC-1, membrane permeant dye, produces green fluorescence while TMRE, cell permeant dye, produces red-orange fluorescence due to differences in excitation wavelengths. Furthermore, JC-1 can reflect changes in MMP but has higher cytotoxicity compared to TMRE, which can be used for quantitative analysis of MMP due to its low cytotoxicity, but it is not widely used (Yin & Shen, 2022). The primary energy source of the cells is ATP derived from the mitochondria to drive multiple cellular functions so when mitochondria are damaged as observed in AD, ATP production decreases. In other words, ATP production can be used to assess mitochondrial function in cells using bioluminescence assays along with other techniques such as chromatography. The bioluminescence assays used in our lab, is based on the principle that light formation from ATP and lucinferin is catalyzed by luciferase, which emitted linearly to AT concentration, measured by the luminometer (Reddy et al., 2012b; Yin & Shen, 2022).
As ATP production increases in damaged mitochondria, ROS levels (H2O2) increase, subsequently increasing cytochrome c activity and lipid peroxidation due to oxidative stress so measuring ROS production, cytochrome c activity, and lipid peroxidation are also an indicator of mitochondrial function (Xiao et al., 2017; Gough & Cotter, 2011; Reddy et al., 2018b; Mailloux, 2018; Jia & Sieburth, 2021). Many kits have been developed to assess mitochondrial function over the years. In our lab, mitochondrial functional assay kits were used to measure all three indicators. (Reddy et al., 2018b). For lipid peroxidation, HNE levels were using HNE-His ELISA Kit since HNE is the final product of lipid peroxidation. The principle of this kit is similar to protein quantification and western blotting; the ELISA plate is coated with HNE conjugate to which protein samples or BSA calibrators are added to each of the wells. After incubation, the primary antibodies then secondary antibodies conjugated with HRP added. The samples are compared to the BSA standard curve (Reddy et al., 2018b; Kamiya Biomedical Company, n.d). Cytochrome c activity and H2O2 production were assayed using the spectrophotometer after using the BCA method to determine protein concentration (Reddy et al., 2018b).
Increasing evidence suggests that mitochondrial abnormalities, including changes in mitochondrial DNA, mitochondrial gene expressions, mitochondrial ATP, mitochondrial enzymatic activities, mitochondria-induced increased free radicals, lipid peroxidation, reduced axonal transport, impaired mitochondrial biogenesis, mitochondrial dynamics and defective mitophagy are largely involved in aging and neurodegenerative diseases such as AD. Methods to study mitochondria have been evolved in the last three decades, however, there are no definitive techniques/methods thus far. Overall, purpose of our article is to collect recent techniques to assess mRNA abundance (using qRT-PCR), protein levels (using immunoblotting), protein localization (using immunofluorescence), ultrastructural changes, mitochondrial number, length and mitophagosomal formations (using transmission electron microscopy), mitochondrial membrane potential (using JC1 and TMRE), mitophagy detection (using in vitro and in vivo live cell), mitochondrial bioenergetics (using Seahorse Bioanalyzer), and other aspects. We did extensive survey of previous and current techniques of mitochondrial analysis, put together in this article. The techniques may vary slightly from laboratory to laboratory. Overall, we strongly believe that methods described in our article will be useful to mitochondrial researchers.
Critical Parameters and Troubleshooting
To design and execute the protocols to study the mitochondria in neurodegenerative diseases, several important parameters need to be considered to ensure quality and consistent results. In Table 5, critical parameters and its troubleshooting strategies have been discussed to aid in solving problems and increase validity of results.
Table 5:
Critical Parameters and its Troubleshooting Strategies for Protocols for Studying the Mitochondria
| Problem | Problem Cause | Solution(s) |
|---|---|---|
| Cells detach from the dish | Cells not handled carefully | Carefully remove the medium and add fresh pre-warmed medium along the side of the dish |
| Improper controls | Proper controls were not setup for the experiment or contamination occurred | Regarding the above methods, use WT HT22 cells or Wildtype mice (tissues) as positive controls and untransfected cells or blank tube (deionized water in place tissues) as negative controls. For qRT-PCR use housekeeping genes beta-actin and GAPDH as positive controls. For western blotting use housekeeping gene beta-actin as positive control. Cleans workstation with 70% ethanol before working. |
| Weak/ No staining in Western blotting, fluorescence-based methods etc | Not enough primary antibody Incompatible primary and secondary antibodies Antibody application Dry tissue/cells/ membrane Primary antibody/ secondary antibody/ blocking solution ran off the slide |
Higher concentration of primary antibody should be used or incubate longer in primary antibody Make sure secondary antibody is raised against host of primary antibody Make sure antibody is suitable for the method being performed Cover the tissue/ cells/membranes in liquid immediately Draw a rectangle/circle border around the sample with Imedge pen to keep Primary antibody/ secondary antibody/ blocking solution on the sample |
| Inefficient staining with dye | Dyes such as DAPI is unable to penetrate the tissue samples. | Use higher concentrations of dye. Usually, dye is used at higher concentrations for tissues compared to cells. |
| Low RNA/protein concentration, low band appearance on blots, low fluorescence intensity | Experimental Conditions: temperature, time point, light sensitivity, sample/ component concentration | Components for RNA preparation, qRT-PCR, protein samples, and tissue/ cell samples must be placed on ice or stored at −20 degrees Celsius throughout the experiments. For western blotting, developer must be placed in the dark and membrane should be incubated in the developer for no more than 5 minutes For fluorescence-based methods, don’t leave antibody out in the light. |
Understanding Results:
The data for qRT-PCR (Table 4) is expressed in fold changes (quantity change between the control and the sample), which was calculated using the formula 2 − (ΔΔCT). The variable, ΔΔCT, is the difference between ΔCT (difference between the average CT-value of the target gene and average CT value of β-actin) and the ΔCT of untransfected HT22 cells. The negative fold change values indicate decrease mRNA expression, while the positive fold change values indicate increase mRNA expression.
Figure 2A shows the raw data in form of bands that represent specific protein levels, which has been quantitively shown in Figure 2B after being normalized to Beta-actin. Figure 2A further shows equal loading of beta-actin in the two samples. Alternatively, if equal loading wasn’t shown in beta-actin then the western blotting results would’ve been invalid (not shown).
For both qRT-PCR and western blotting, RNA and protein need to be purified from cell and/ or tissues before being analyzed. RNA can be purified using the TRIzole method and 1ul of the product can be placed on the quantification machine, which will show the results in ng/ul with A260/A280 of around 2.0 or above, indicating purity of the sample. Anything RNA sample with A260/280 below 2.0 is considered contaminated. For proteins, the BCA method is used when being purified so protein quantity is measured based on the linear BCA standard curve in ug/ml.
Figure 4A shows the images of immunofluorescence analysis of fission proteins (Drp1 and Fis1) and fusion proteins (Mfn1, Mfn2, and Opa1) in untransfected HT22 cells and HT22 cells transfected with mutant APP cDNA. The quantitative immunofluorescence analysis has been shown in Figure 4B, indicating change in protein levels in HT22 cells transfected with mutant APP cDNA compared to untransfected HT22 cells. For more examples of change in protein levels between the two samples, see Reddy et al. (2018b).
Figure 7A and 7B represent TEM images of the mitochondria in WT hippocampus, Tau hippocampus, WT cortex, and Tau cortex (right side). From the images the length of the mitochondria in each of the four samples were measured and number of mitochondria were counted and quantitatively shown in Figure 7A and 7B (left side), indicating increase in mitochondrial number in Tau hippocampus and cortical tissues compared to WT hippocampus and cortical tissues. The results also indicate decreased mitochondrial length in hippocampus and cortical tissues of Tau mice compared to the hippocampus and cortical tissues of WT mice, respectively.
Figure 11 shows the graphical representations of data of mitochondrial respiration, maximal respiration, ATP production, and proton leaks obtained using Seahorse Bioanalyzer. In the graphs, all four variables are measured in terms of oxygen consumption rate (OCR), which is used to study oxidative phosphorylation function in mitochondria in pmol/min (Yin & Shen, 2022). The results show that mitophagy enhancers (urolithinA, actionin, tomatidine and nicotinamide riboside) increased mitochondrial respiration in mutant TauHT22 cells compared to untransfected HT22 cells. Before cells can be transfected, they are grown to around 80% confluency, which can be determined by placing the cell dish under the microscope.
Figure 13A to 13C represent graphical data from mitochondrial function assays (ATP levels, H2O2 levels, cytochrome c activity, and lipid peroxidation production) in untransfected HT22 cells and HT22 cells transfected with mutant APP cDNA in terms of concentration of product being analyzed per mg of protein (y-axis). ATP levels and H2O2 production were measured using the standard curve method and standard curve equation, respectively. The following equation was used to measure cytochrome c activity in uUnits/mg total protein: [A/min sample − (A/min blank) × 1.1 mg protein × 21.84]. For lipid peroxidation, optical density for absorption measurements was used to quantify HNE levels (Reddy et al., 2018b).
Time Considerations:
Before performing qRT-PCR, an hour to an hour and a half is needed to prepare the tissue or cell samples via RNA extraction. Then a couple of hours is needed to complete the qRT-PCR, clean up as described in basic protocol 1. Similar amount of time is required to prepare tissue or cell samples via protein extraction. But when it comes to Western blotting, a total of two days is required to complete the process. Once the samples are prepared, western blotting must be carefully prepared as it can take around 6 hours on the first day to complete up to the primary antibody incubation step, as described in Basic Protocol 2. For both qRT-PCR and Western blotting, time must be set aside in the beginning for obtaining tissue or cell samples. For tissue samples, we euthanize and perform necroscopy on mice while for cells we grow them in cultured media and transfect the cells before RNA/ protein performing extraction.
When performing immunofluorescence, two days is needed for the staining process before the slides can be used for imaging as described in Basic Protocol 3. Time must be carefully planned for staining the samples and for preparing the brain tissue. Similar to RT-PCR and Western blotting, before staining process is started, animals must be euthanized, and necroscopy is performed to obtain brain tissue samples. Then brain tissue must be hardened using O.C.T compound for around 4 hours before slicing them. Slicing the brain takes a couple of hours if the brain is positioned correctly during the process. After hours of preparing the tissue samples and two days of staining, data can be obtained.
When measuring MMP, around 2 hours is needed to stain the mitochondria, which includes the washes. Data can be obtained on the same day for cells but for live imaging of cortical neurons, 6–8 days are needed to prepare the cortical neurons before transfecting them constructs using Lipofectamine 2000 and pulsing them for 30 minutes with TMRE dye. Data can be obtained on the same day for analysis.
When taking the brain out of the animal, it takes 2–3 hours to post-fix the brain and additional a couple of hours to cut the desired sections. The staining process will take around 45–60 minutes before being able to take images for data analysis on the same day for TEM or the following days if the microscope for TEM is located at another location and the samples need to be transported in an ice box.
When detecting mitophagy through in vitro methods, more than 2 days in needed because cells must incubate and grow for 48 hours. Additionally, it takes 1 hour or more to count the cells (depending on number of cells present) before seeding the desired amount in cell culture medium and incubating it at 37 degrees Celsius for 24 hours. Data can be obtained the following day after replacing the culture medium. Similar to the basic protocols that require brain tissue, a couple of hours must be set aside to prepare the tissue samples before covering them in cold PBS and imaging the tissue sections.
When measuring bioenergetics of the mitochondria via Seahorse, a total of 4 days is needed. But cell transfection must be carefully planned as it can take 3 days to complete the process before beginning the assay on day 4, which includes an hour or more of counting the cells on day 1. On day 4, it’ll take around 5 hours to prepare assay mediums, cells, and solutions for running the assay. For running the assay, it takes 40 minutes to calibrate the machine using the calibration plate before removing the utility plate and putting in the cell culture microplate to run the assay for total of 1 hour and 25 minutes to obtain data for analysis.
When measuring mitochondrial function such as ATP levels, H2O2 levels, and cytochrome c oxidase levels, 30–60 minutes is needed to complete each of the experiment. For measuring 4HNE levels, around 5 hours is needed to complete the experiment due to 2 hours of incubation time for primary and secondary antibodies. Adequate time must be given to prepare the solutions before beginning the experiment. Data can be obtained on the same day for analysis. At the end of all the experiments, time must be given to properly dispose the liquids, samples, and clean the workstation.
Funding:
The research presented in this article was supported by NIH grants AG042178, AG047812, NS205473, AG060767, AG069333, and AG066347 (to PHR).
Abbreviations:
- α
alpha
- Aβ
amyloid β
- AD
Alzheimer’s Disease
- APP
amyloid precursor proteins
- ATP
adenosine triphosphate
- ALS
amyotrophic lateral sclerosis
- Atg
autophagy-related
- AP
Alkaline Phosphatase
- β
beta
- DAPI
Daimond Antifade Mountant with DAPI
- γ
gamma
- FBS
Fetal Bovine Serum
- EM
electron microscopy
- HRP
Horse Radish Peroxidase
- H2O2
hydrogen peroxide
- HTT
Huntington
- JC-1
5,5’,6,6’-Tetrachloro-1,1’,3, 3’-tetraethylbenzimidazolylcarbocyanine iodide
- MS
multiple sclerosis
- MMP
mitochondrial membrane potential
- NRF-1
nuclear respiratory factor-1
- NRF-2
nuclear respiratory factor-2
- p-tau
hyperphosphorylated tau
- PBS
phosphate buffered saline
- PD
Parkinson’s Disease
- ROS
reactive oxidative species
- SDS
sequence-detection system
- SDS-PAGE
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
- SEM
Scanning Electron microscopy
- O2
superoxide
- TMRE
tetramethylrhodamine, ethyl ester
- TBST
Tris Buffered Saline with Tween
- 4HNE
4-hydroxynonenal
- qRT-PCR
Real-Time Quantitative reverse polymerase chain reaction
Footnotes
INTERNET RESOURCES:
https://assets.thermofisher.com/TFS-Assets/LSG/manuals/trizol_reagent.pdf
A PDF of the user guide for TRIzol method by Invitrogen for RNA extraction.
https://www.peprotech.com/en/protocols-immunofluorescence-general-animal-brain-tissue
The site contains Immunofluorescence: General Animal Brain Tissue protocol.
A PDF of the protocol for measuring the mitochondrial membrane potential using TMRE dye.
A PDF of the protocol for ATP Determination kit.
https://azurebiosystems.com/wp-content/uploads/2021/03/Chemi-vs-Fluor-app-note_1.pdf
A PDF that details the differences, advantages, and disadvantages of chemiluminescent western blotting and fluorescent western blotting.
https://www.kamiyabiomedical.com/pdf/KT-957.pdf
A PDF detailing the HNE ELISA kit information.
Useful to acquire details of the Superscript III First Strand cDNA synthesis Supermix and its protocol.
Credit Authorship Contributions Statement: J. B. and P.H.R contributed to the conceptualization and formatting of the article. J. B. J.A.P and P.H.R are responsible for writing, original draft preparation, and finalization of the manuscript., and P.H.R. is responsible for funding acquisition.
Conflicts of Interest: None.
Literature Cited:
- Backues SK, Chen D, Ruan J, Xie Z, Klionsky DJ (2014). Estimating the size and number of autophagic bodies by electron microscopy. Autophagy.10(1):155–64. doi: 10.4161/auto.26856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bhattacharya A, Chaturvedi G, Singhal K, & Pandey R. (2020). Experimental toolkit to study RNA level regulation. Rna-Based Regulation in Human Health and Disease, 371–396. 10.1016/b978-0-12-817193-6.00016-9 [DOI] [Google Scholar]
- Bhatti JS, Tamarai K, Kandimalla R, Manczak M, Yin X, Ramasubramanian B, Sawant N, Pradeepkiran JA, Vijayan M, Kumar S, & Reddy PH (2021, May). Protective effects of a mitochondria-targeted small peptide SS31 against hyperglycemia-induced mitochondrial abnormalities in the liver tissues of diabetic mice, Tallyho/JngJ mice. Mitochondrion, 58, 49–58. 10.1016/j.mito.2021.02.007 [DOI] [PubMed] [Google Scholar]
- Brodusch N, Brahimi SV, Barbosa De Melo E, Song J, Yue S, Piché N, & Gauvin R. (2021). Scanning Electron Microscopy versus Transmission Electron Microscopy for Material Characterization: A Comparative Study on High-Strength Steels. Scanning, 2021, 1–19. 10.1155/2021/5511618 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cai Q, Zakaria H, Simone A, & Sheng ZH (2012). Spatial Parkin Translocation and Degradation of Damaged Mitochondria via Mitophagy in Live Cortical Neurons. Current Biology, 22(6), 545–552. 10.1016/j.cub.2012.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Calkins MJ, & Reddy PH (2011). Amyloid beta impairs mitochondrial anterograde transport and degenerates synapses in Alzheimer’s disease neurons. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1812(4), 507–513. 10.1016/j.bbadis.2011.01.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Canter RG, Penney J, & Tsai LH (2016). The road to restoring neural circuits for the treatment of Alzheimer’s disease. Nature, 539(7628), 187–196. 10.1038/nature20412 [DOI] [PubMed] [Google Scholar]
- Cardoso SM, Santana I, Swerdlow RH, Oliveira CR. (2004). Mitochondria dysfunction of Alzheimer’s disease cybrids enhances Abeta toxicity. J Neurochem, 89, 1417–1426. [DOI] [PubMed] [Google Scholar]
- Ding WX, Yin XM (2012). Mitophagy: mechanisms, pathophysiological roles, and analysis. Biol Chem.393(7):547–64. doi: 10.1515/hsz-2012-0119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Du H, Guo L, Yan S, Sosunov AA, McKhann GM, & ShiDu Yan S. (2010). Early deficits in synaptic mitochondria in an Alzheimer’s disease mouse model. Proceedings of the National Academy of Sciences, 107(43), 18670–18675. 10.1073/pnas.1006586107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fang EF, Hou Y, Palikaras K, Adriaanse BA, Kerr JS, Yang B, Lautrup S, Hasan-Olive MM, Caponio D, Dan X, Rocktäschel P, Croteau DL, Akbari M, Greig NH, Fladby T, Nilsen H, Cader MZ, Mattson MP, Tavernarakis N, & Bohr VA (2019). Mitophagy inhibits amyloid-β and tau pathology and reverses cognitive deficits in models of Alzheimer’s disease. Nature Neuroscience, 22(3), 401–412. 10.1038/s41593-018-0332-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fang EF, Palikaras K, Sun N, Fivenson EM, Spangler RD, Kerr JS, Cordonnier SA, Hou Y, Dombi E, Kassahun H, Tavernarakis N, Poulton J, Nilsen H, Bohr VA (2017). In Vitro and In Vivo Detection of Mitophagy in Human Cells, C. Elegans, and Mice. J Vis Exp.(129):56301. doi: 10.3791/56301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Faria-Pereira A, & Morais VA (2022). Synapses: The Brain’s Energy-Demanding Sites. International Journal of Molecular Sciences, 23(7), 3627. 10.3390/ijms23073627 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gallagher S, & Chakavarti D. (2008). Immunoblot Analysis. Journal of Visualized Experiments, 16. 10.3791/759 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gong CX, & Iqbal K. (2008). Hyperphosphorylation of Microtubule-Associated Protein Tau: A Promising Therapeutic Target for Alzheimer Disease. Current Medicinal Chemistry, 15(23), 2321–2328. 10.2174/092986708785909111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gough DR, & Cotter TG (2011). Hydrogen peroxide: a Jekyll and Hyde signalling molecule. Cell Death & Disease, 2(10), e213. 10.1038/cddis.2011.96 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Graham L, & Orenstein J. (2007). Processing tissue and cells for transmission electron microscopy in diagnostic pathology and research. Nat Protoc, 2(10), 2439–2450. 10.1038/nprot.2007.304 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Granata C, Jamnick NA, & Bishop DJ (2018). Training-Induced Changes in Mitochondrial Content and Respiratory Function in Human Skeletal Muscle. Sports Medicine, 48(8), 1809–1828. 10.1007/s40279-018-0936-y [DOI] [PubMed] [Google Scholar]
- Gu X, Ma Y, Liu Y, & Wan Q. (2021). Measurement of mitochondrial respiration in adherent cells by Seahorse XF96 Cell Mito Stress Test. STAR Protocols, 2(1), 100245. 10.1016/j.xpro.2020.100245 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han S, Jeong YY, Sheshadri P, Su X, & Cai Q. (2020). Mitophagy regulates integrity of mitochondria at synapses and is critical for synaptic maintenance. EMBO Reports, 21(9). 10.15252/embr.201949801 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han S, Zhang M, Jeong YY, Margolis DJ, & Cai Q. (2021). The role of mitophagy in the regulation of mitochondrial energetic status in neurons. Autophagy, 17(12), 4182–4201. 10.1080/15548627.2021.1907167 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Horan MP, Pichaud N, & Ballard JWO (2012). Review: Quantifying Mitochondrial Dysfunction in Complex Diseases of Aging. The Journals of Gerontology: Series A, 67(10), 1022–1035. 10.1093/gerona/glr263 [DOI] [PubMed] [Google Scholar]
- Hu Y, & Reggiori F. (2022). Molecular regulation of autophagosome formation. Biochemical Society Transactions, 50(1), 55–69. 10.1042/bst20210819 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Im K, Mareninov S, Diaz MFP, & Yong WH (2019). An introduction to Performing Immunofluorescence Staining. Methods in Molecular Biology (Clifton, N.J.), 1897, 299–311. 10.1007/978-1-4939-8935-5_26 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jia Q, & Sieburth D. (2021). Mitochondrial hydrogen peroxide positively regulates neuropeptide secretion during diet-induced activation of the oxidative stress response. Nature Communications, 12(1). 10.1038/s41467-021-22561-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jin M, & Klionsky DJ (2014). Regulation of autophagy: Modulation of the size and number of autophagosomes. FEBS Letters, 588(15), 2457–2463. 10.1016/j.febslet.2014.06.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kandimalla R, Manczak M, Yin X, Wang R, & Reddy PH (2018). Hippocampal phosphorylated tau induced cognitive decline, dendritic spine loss and mitochondrial abnormalities in a mouse model of Alzheimer’s disease. Human molecular genetics, 27(1), 30–40. 10.1093/hmg/ddx381 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Kerr JS, Adriaanse BA, Greig NH, Mattson MP, Cader MZ, Bohr VA, & Fang EF (2017). Mitophagy and Alzheimer’s Disease: Cellular and Molecular Mechanisms. Trends in Neurosciences, 40(3), 151–166. 10.1016/j.tins.2017.01.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kshirsagar S, Alvir RV, Pradeepkiran JA, Hindle A, Vijayan M, Ramasubramaniam B, Kumar S, Reddy AP, & Reddy PH (2022). A Combination Therapy of Urolithin A+EGCG Has Stronger Protective Effects than Single Drug Urolithin A in a Humanized Amyloid Beta Knockin Mice for Late-Onset Alzheimer’s Disease. Cells, 11(17), 2660. 10.3390/cells11172660 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Kshirsagar S, Sawant N, Morton H, Reddy AP, & Reddy PH (2021a). Mitophagy enhancers against phosphorylated Tau-induced mitochondrial and synaptic toxicities in Alzheimer disease. Pharmacological Research, 174, 105973. 10.1016/j.phrs.2021.105973 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Kshirsagar S, Sawant N, Morton H, Reddy AP, & Reddy PH (2021b). Protective effects of mitophagy enhancers against amyloid beta-induced mitochondrial and synaptic toxicities in Alzheimer disease. Human Molecular Genetics, 31(3), 423–439. 10.1093/hmg/ddab262 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Kurien B, & Scofield R. (2006). Western blotting. Methods, 38(4), 283–293. 10.1016/j.ymeth.2005.11.007 [DOI] [PubMed] [Google Scholar]
- Lam J, Katti P, Biete M, Mungai M, AshShareef S, Neikirk K, Garza Lopez E, Vue Z, Christensen TA, Beasley HK, Rodman TA, Murray SA, Salisbury JL, Glancy B, Shao J, Pereira RO, Abel ED, & Hinton A. (2021). A Universal Approach to Analyzing Transmission Electron Microscopy with ImageJ. Cells, 10(9), 2177. 10.3390/cells10092177 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Park JS, Deng JH, & Bai Y. (2006). Cytochrome c oxidase subunit IV is essential for assembly and respiratory function of the enzyme complex. Journal of Bioenergetics and Biomembranes, 38(5–6), 283–291. 10.1007/s10863-006-9052-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luz AL, Smith LL, Rooney JP, & Meyer JN (2015). Seahorse Xf e 24 Extracellular Flux Analyzer-Based Analysis of Cellular Respiration in Caenorhabditis elegans. Current Protocols in Toxicology, 66(1). 10.1002/0471140856.tx2507s66 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mailloux RJ (2018). Mitochondrial Antioxidants and the Maintenance of Cellular Hydrogen Peroxide Levels. Oxidative Medicine and Cellular Longevity, 2018, 1–10. 10.1155/2018/7857251 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manczak M, Kandimalla R, Yin X, & Reddy PH (2018). Hippocampal mutant APP and amyloid beta-induced cognitive decline, dendritic spine loss, defective autophagy, mitophagy and mitochondrial abnormalities in a mouse model of Alzheimer’s disease. Human molecular genetics, 27(8), 1332–1342. 10.1093/hmg/ddy042 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Manczak M, Kandimalla R, Fry D, Sesaki H, & Reddy PH (2016). Protective effects of reduced dynamin-related protein 1 against amyloid beta-induced mitochondrial dysfunction and synaptic damage in Alzheimer’s disease. Human Molecular Genetics, ddw330. 10.1093/hmg/ddw330 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manczak M, Mao P, Calkins MJ, Cornea A, Reddy AP, Murphy MP, Szeto HH, Park B, & Reddy PH (2010). Mitochondria-Targeted Antioxidants Protect Against Amyloid-β Toxicity in Alzheimer’s Disease Neurons. Journal of Alzheimer’s Disease, 20(s2), S609–S631. 10.3233/jad-2010-100564 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manczak M, Calkins MJ, & Reddy PH (2011). Impaired mitochondrial dynamics and abnormal interaction of amyloid beta with mitochondrial protein Drp1 in neurons from patients with Alzheimer’s disease: implications for neuronal damage. Human Molecular Genetics, 20(13), 2495–2509. 10.1093/hmg/ddr139 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manczak M, & Reddy PH (2012a). Abnormal interaction of VDAC1 with amyloid beta and phosphorylated tau causes mitochondrial dysfunction in Alzheimer’s disease. Human Molecular Genetics, 21(23), 5131–5146. 10.1093/hmg/dds360 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manczak M, & Reddy PH (2012b). Abnormal interaction between the mitochondrial fission protein Drp1 and hyperphosphorylated tau in Alzheimer’s disease neurons: implications for mitochondrial dysfunction and neuronal damage. Human Molecular Genetics, 21(11), 2538–2547. 10.1093/hmg/dds072 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pandey S, Kumari A, Singh P, & Gupta KJ (2021). Isolation and Measurement of Respiration and Structural Studies of Purified Mitochondria from Heterotrophic Plant Tissues. Current Protocols, 1(12). 10.1002/cpz1.326 [DOI] [PubMed] [Google Scholar]
- Pradeepkiran JA, & Reddy PH (2020). Defective mitophagy in Alzheimer’s disease. Ageing Research Reviews, 64, 101191. 10.1016/j.arr.2020.101191 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pradeepkiran JA, Hindle A, Kshirsagar S, & Reddy PH (2022). Are mitophagy enhancers therapeutic targets for Alzheimer’s disease? Biomedicine & Pharmacotherapy, 149, 112918. 10.1016/j.biopha.2022.112918 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Reddy PH, Manczak M, Yin X, & Reddy AP (2018a). Synergistic Protective Effects of Mitochondrial Division Inhibitor 1 and Mitochondria-Targeted Small Peptide SS31 in Alzheimer’s Disease. Journal of Alzheimer’s Disease, 62(4), 1549–1565. 10.3233/jad-170988 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Reddy PH, Yin X, Manczak M, Kumar S, Pradeepkiran JA, Vijayan M, & Reddy AP (2018b). Mutant APP and amyloid beta-induced defective autophagy, mitophagy, mitochondrial structural and functional changes and synaptic damage in hippocampal neurons from Alzheimer’s disease. Human Molecular Genetics, 27(14), 2502–2516. 10.1093/hmg/ddy154 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sakamuru S, Attene-Ramos MS, Xia M. (2016). Mitochondrial Membrane Potential Assay. Methods in Molecular Biology. 1473:17–22. doi: 10.1007/978-1-4939-6346-1_2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Selkoe DJ, & Hardy J. (2016). The amyloid hypothesis of Alzheimer’s disease at 25 years. EMBO Molecular Medicine, 8(6), 595–608. 10.15252/emmm.201606210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shibutani ST, & Yoshimori T. (2013). A current perspective of autophagosome biogenesis. Cell Research, 24(1), 58–68. 10.1038/cr.2013.159 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Silva DF, Selfridge JE, Lu J, E L, Roy N, Hutfles L, Burns JM, Michaelis EK, Yan S, Cardoso SM, & Swerdlow RH (2013). Bioenergetic flux, mitochondrial mass and mitochondrial morphology dynamics in AD and MCI cybrid cell lines. Human Molecular Genetics, 22(19), 3931–3946. 10.1093/hmg/ddt247 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun N, Malide D, Liu J, Rovira II, Combs CA, & Finkel T. (2017). A fluorescence-based imaging method to measure in vitro and in vivo mitophagy using mt-Keima. Nature Protocols, 12(8), 1576–1587. 10.1038/nprot.2017.060 [DOI] [PubMed] [Google Scholar]
- Teixeira RB, Karbasiafshar C, Sabra M, & Abid MR (2021). Optimization of mito-roGFP protocol to measure mitochondrial oxidative status in human coronary artery endothelial cells. STAR Protocols, 2(3), 100753. 10.1016/j.xpro.2021.100753 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tran M, & Reddy PH (2021). Defective Autophagy and Mitophagy in Aging and Alzheimer’s Disease. Frontiers in Neuroscience, 14. 10.3389/fnins.2020.612757 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wagner OI, Lifshitz J, Janmey PA, Linden M, McIntosh TK, & Leterrier JF (2003). Mechanisms of Mitochondria-Neurofilament Interactions. The Journal of Neuroscience, 23(27), 9046–9058. 10.1523/jneurosci.23-27-09046.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H, Kulas JA, Wang C, Holtzman DM, Ferris HA, & Hansen SB (2021). Regulation of beta-amyloid production in neurons by astrocyte-derived cholesterol. Proceedings of the National Academy of Sciences, 118(33). 10.1073/pnas.2102191118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang X, Perry G, Smith MA, & Zhu X. (2010). Amyloid-β-Derived Diffusible Ligands Cause Impaired Axonal Transport of Mitochondria in Neurons. Neurodegenerative Diseases, 7(1–3), 56–59. 10.1159/000283484 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang X, Su B, Siedlak SL, Moreira PI, Fujioka H, Wang Y, Casadesus G, & Zhu X. (2008). Amyloid-β overproduction causes abnormal mitochondrial dynamics via differential modulation of mitochondrial fission/fusion proteins. Proceedings of the National Academy of Sciences, 105(49), 19318–19323. 10.1073/pnas.0804871105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang X, Su B, Lee HG, Li X, Perry G, Smith MA, & Zhu X. (2009). Impaired Balance of Mitochondrial Fission and Fusion in Alzheimer’s Disease. Journal of Neuroscience, 29(28), 9090–9103. 10.1523/jneurosci.1357-09.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiao M, Zhong H, Xia L, Tao Y, & Yin H. (2017). Pathophysiology of mitochondrial lipid oxidation: Role of 4-hydroxynonenal (4-HNE) and other bioactive lipids in mitochondria. Free Radical Biology and Medicine, 111, 316–327. 10.1016/j.freeradbiomed.2017.04.363 [DOI] [PubMed] [Google Scholar]
- Ye X, Sun X, Starovoytov V, & Cai Q. (2015). Parkin-mediated mitophagy in mutant hAPP neurons and Alzheimer’s disease patient brains. Human Molecular Genetics, 24(10), 2938–2951. 10.1093/hmg/ddv056 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin Y, & Shen H. (2022). Common methods in mitochondrial research (Review). International Journal of Molecular Medicine, 50(4). 10.3892/ijmm.2022.5182 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu J, Dagda RK, Chu CT (2011). Monitoring mitophagy in neuronal cell cultures. Methods in Molecular Biology. 793:325–39. doi: 10.1007/978-1-61779-328-8_21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zorova LD, Popkov VA, Plotnikov EY, Silachev DN, Pevzner IB, Jankauskas SS, Babenko VA, Zorov SD, Balakireva AV, Juhaszova M, Sollott SJ, Zorov DB (2018). Mitochondrial membrane potential. Anal Biochem. 552:50–59. doi: 10.1016/j.ab.2017.07.009 [DOI] [PMC free article] [PubMed] [Google Scholar]













