Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2023 Feb 19;24(4):4150. doi: 10.3390/ijms24044150

Genomic Distribution of Pro-Virulent cpdB-like Genes in Eubacteria and Comparison of the Enzyme Specificity of CpdB-like Proteins from Salmonella enterica, Escherichia coli and Streptococcus suis

João Meireles Ribeiro 1, José Canales 1, María Jesús Costas 1, Alicia Cabezas 1, Rosa María Pinto 1, Miguel García-Díaz 2, Paloma Martín-Cordero 3, José Carlos Cameselle 1,*
Editor: Franklin WN Chow
PMCID: PMC9958556  PMID: 36835561

Abstract

The cpdB gene is pro-virulent in avian pathogenic Escherichia coli and in Salmonella enterica, where it encodes a periplasmic protein named CpdB. It is structurally related to cell wall-anchored proteins, CdnP and SntA, encoded by the also pro-virulent cdnP and sntA genes of Streptococcus agalactiae and Streptococcus suis, respectively. CdnP and SntA effects are due to extrabacterial hydrolysis of cyclic-di-AMP, and to complement action interference. The mechanism of CpdB pro-virulence is unknown, although the protein from non-pathogenic E. coli hydrolyzes cyclic dinucleotides. Considering that the pro-virulence of streptococcal CpdB-like proteins is mediated by c-di-AMP hydrolysis, S. enterica CpdB activity was tested as a phosphohydrolase of 3′-nucleotides, 2′,3′-cyclic mononucleotides, linear and cyclic dinucleotides, and cyclic tetra- and hexanucleotides. The results help to understand cpdB pro-virulence in S. enterica and are compared with E. coli CpdB and S. suis SntA, including the activity of the latter on cyclic-tetra- and hexanucleotides reported here for the first time. On the other hand, since CpdB-like proteins are relevant to host-pathogen interactions, the presence of cpdB-like genes was probed in eubacterial taxa by TblastN analysis. The non-homogeneous genomic distribution revealed taxa with cpdB-like genes present or absent, identifying eubacteria and plasmids where they can be relevant.

Keywords: eubacteria; virulence; cpdB gene; sntA gene; genomic distribution; 3′-nucleotidase; 2′,3′-cyclic nucleotide phosphodiesterase; cyclic oligoadenylate; c-di-AMP; c-di-GMP

1. Introduction

The CpdB protein was first identified as a periplasmic protein encoded by the cpdB gene of Escherichia coli with attributed 3′-nucleotidase and 2′,3′-cyclic mononucleotide (2′,3′-cNMP) phosphodiesterase activities [1,2,3]. These activities have been observed also in other Gram-negative bacteria [4,5,6]. After the expression of E. coli CpdB as a recombinant protein, it was characterized as a highly efficient enzyme, also active on cyclic and linear dinucleotides (c-di-NMP and pNpN) [7,8]. In Gram-positives, two CpdB-like cell-wall-attached proteins named CdnP and SntA have been studied in Streptococcus agalactiae [9] and Streptococcus suis [10], respectively. They are structurally related to CpdB and also display activities as 3′-nucleotidases and phosphodiesterases of 2′,3′-cNMP, and linear or cyclic 3′,5′-dinucleotides.

The genes encoding CpdB-like proteins have been recognized as pro-virulent factors of several pathogens. The cpdB gene of avian pathogenic E. coli has been reported to favor the long-term colonization of chicken organs [11]. The cpdB gene of Salmonella enterica serovar Pullorum has been demonstrated to be pro-virulent in a chicken infection model. In the course of infection with either the wild-type or a cpdB mutant of S. enterica, similar numbers of bacteria were found in internal organs for up to 5–6 days post infection. Interestingly, the cpdB mutant was cleared relatively quickly, while the wild type persisted in high numbers for up to 16 days [12]. Similar attenuation of virulence occurs in cpdB mutants of S. enterica serovar Enteritidis [13]. The sntA gene of S. suis has been also reported to be pro-virulent in pigs [14,15] and the cdnP gene of S. agalactiae in mice [9]. In contrast to all these studies, no evidence was obtained for pro-virulence of the cpdB gene of Yersinia enterocolítica in an oral and intravenous mouse infection model [4]. The cpdB gene of the plant pathogen Pectobacterium atrosepticum offers a different point of view, since gene mutations make the pathogen resistant to potassium tetraborate tetrahydrate used as disinfectant [16].

The pro-virulent character of the cdnP gene of S. agalactiae is related to the mitigation of the type-I interferon response of infected mice, driven by the enzymatic hydrolysis of extracellular c-di-AMP by the cdnP-encoded protein CdnP [9]. During intracellular infections, this cyclic dinucleotide is released by the microbe in the host cytosol, where it acts as a pathogen-associated molecular pattern (PAMP) which activates immune response by interaction with the stimulator of interferon genes STING [9,17,18,19,20,21,22]. The hydrolysis of extracellular c-di-AMP by cell-wall-bound CdnP mitigates the interferon response of the host, and thus explains the pro-virulent character of the cdnP gene.

The pro-virulent sntA gene of S. suis is overexpressed under iron starvation [23], and it is a heme-binding protein that favors iron acquisition from infected host reservoirs, also inhibiting host antioxidant protein AOP2 [15]. Moreover, it also interferes with the complement system [14], and its protein product SntA, like S. agalactiae CdnP, catalyzes the hydrolysis of c-di-AMP rather efficiently [9,10]. These characteristics can explain the pro-virulence of sntA.

S. enterica is a facultative intracellular pathogen that can invade phagocytic and non-phagocytic cells of many organisms, including humans and birds [24,25,26,27,28,29], and, like E. coli, it contains periplasmic CpdB [30,31]. The mechanism of cpdB pro-virulence remains unknown other than its possible action through activation of the expression of other genes [12], or a hypothetical role in iron acquisition similar to that of S. suis SntA [15], taking into account that iron uptake is required for the persistence of S. enterica within vacuoles of fibroblasts [32]. The intermediation of extracellular c-di-AMP removal to explain cpdB pro-virulence is unlikely as, while there is some evidence for its presence and role in Gram-negative bacteria, this is rather limited [33,34,35,36]. However, S. enterica, like most Gram-negatives, produces the cyclic dinucleotide c-di-GMP. The role of c-di-GMP signaling in S. enterica has been recently reviewed [37], and different effects have been put forward for the cytoplasmic and the extracytoplasmic dinucleotide [29]. Cytoplasmic c-di-GMP in S. enterica controls the transition between biofilm and virulence, and modulates virulence phenotypes: it is a regulator of the sessility versus motility transition, with high levels favoring biofilm formation and inhibiting, for instance, the invasiveness of intestinal epithelial cells [29,37,38,39,40]. It is known that STING-dependent type-I interferon response of infected host cells can be evoked also by c-di-GMP, including infections by S. enterica [18,29,41,42]. For instance, in dendritic cells, c-di-GMP triggers innate immunity mediated by STING and induces TH17 cells [29,42].

In this study, based on what is known about cpdB-like bacterial genes and their encoded proteins, we posed two questions (see Scheme 1). Since the hypothetical hydrolytic activity of S. enterica CpdB towards cyclic dinucleotides could be relevant to host-pathogen interaction, an extensive study of its so-far unknown enzyme specificity was performed using a recombinant enzyme cloned from serovar Typhimurium genomic DNA. Among other things, we concluded that its detected activity on extracellular c-di-GMP could be the basis for the pro-virulent character of the cpdB gene of this species. However, intrigued by a casual observation that 40% of the sequenced genomes of S. enterica serovar Typhimurium do not contain a cpdB gene, we also analyzed the genomic distribution of cpdB-like genes in eubacteria, to explore the extent to which these genes could participate in host-pathogen interactions in different eubacterial taxa. It was concluded that cpdB-like genes are not ubiquitous among bacterial taxa and that, within many taxa where they occur, their distribution is not homogeneous, even at the level of species in many cases. This opens a new global perspective on the role of these genes.

Scheme 1.

Scheme 1

Questions addressed in this study and summary of conclusions.

2. Results and Discussion

2.1. Enzyme Characterization of S. enterica CpdB Protein

This CpdB protein, devoid of its signal sequence, was overexpressed in BL21 cells from plasmid pGEX-6P-3-S.enter_CpdB which encodes a fusion protein GST-CpdB. The recombinant enzyme present in cell lysate supernatants was purified by affinity to GSH-Sepharose and recovered free of the GST tag by specific proteolysis with PreScission protease. An extensive enzymatic characterization was performed using 3′-nucleotides, 2′,3′-cNMP, linear dinucleotides, cyclic di-, tetra- and hexanucleotides, among other substrates. The cyclic oligoadenylates c-tetra-AMP and c-hexa-AMP are second messengers produced by type III CRISPR-Cas systems [43], and there is little data about phosphodiesterases hydrolyzing them other than the so-called ring nucleases [44,45,46]. So far, c-tetra-AMP and c-hexa-AMP had not been tested as substrates of CpdB-like enzymes.

With all the substrates of CpdB, except 2′,3′-cGAMP, saturation kinetics were studied by assaying initial rates of phosphohydrolysis at different substrate concentrations. Estimations of kcat, KM and catalytic efficiency (kcat/KM) were obtained by non-linear regression of the Michaelis–Menten equation to the experimental data. In the case of 2′,3′-cGAMP, the catalytic efficiency was estimated from initial-rate assays directly proportional to substrate concentration. The results are shown in Table 1 in order of decreasing catalytic efficiencies.

Table 1.

Kinetic parameters of S. enterica CpdB. New data for S. suis SntA are shown in the lower part of the table. Data are mean values ± standard deviations of three experiments.

k cat 1 K m 1 kcat/Km1
(s−1) (µM) (M−1s−1)
S. enterica CpdB
3′-GMP 219.07 ± 48.74 4.66 ± 1.34 5.23 × 107
3′-UMP 154.93 ± 13.31 4.54 ± 0.53 3.42 × 107
2′,3′-cCMP 146.18 ± 9.39 4.52 ± 0.69 3.32 × 107
3′-AMP 171.85 ± 41.34 6.53 ± 1.16 2.76 × 107
2′,3′-cGMP 120.04 ± 4.74 7.52 ± 1.46 1.63 × 107
2′,3′-cAMP 209.47 ± 16.94 14.41 ± 3.68 1.53 × 107
2′,3′-cUMP 324.03 ± 21.76 22.65 ± 2.56 1.44 × 107
pApA 2.85 ± 1.04 0.22 ± 0.12 1.39 × 107
bis-4NPhP 250.22 ± 9.82 33.74 ± 4.77 7.53 × 106
pGpG 2.27 ± 1.95 3.07 ± 3.67 9.88 × 105
4-NPhP 24.89 ± 2.54 92.94 ± 44.66 3.01 × 105
3′,3′-cGAMP 0.30 ± 0.03 2.13 ± 0.32 1.97 × 105
ATP 23.06 ± 2.74 137.42 ± 59.23 1.82 × 105
ADP 2.83 ± 0.19 28.09 ± 1.82 1.01 × 105
Ap4A 2.64 ± 0.24 49.21 ± 12.46 5.50 × 104
c-di-AMP 0.31 ± 0.06 8.89 ± 2.31 3.55 × 104
Ap3A 2.10 ± 0.17 69.09 ± 19.31 3.16 × 104
ADP-ribose 2.40 ± 0.36 99.61 ± 15.81 2.44 × 104
c-di-GMP 0.09 ± 0.01 4.12 ± 0.98 2.24 × 104
CDP-choline 2.84 ± 0.30 191.82 ± 19.71 1.49 × 104
c-tetra-AMP 0.042 ± 0.001 18.44 ± 4.95 2.37 × 103
3′,5′-cAMP 0.67 ± 0.32 2444.10 ± 1337.05 2.94 × 102
c-hexa-AMP 0.006 ± 0.001 24.24 ± 7.60 2.38 × 102
ADP-glucose 0.06 ± 0.02 299.39 ± 105.92 2.13 × 102
UDP-glucose 0.12 ± 0.02 851.05 ± 216.31 1.46 × 102
2′,3′-cGAMP Nd Nd 9.06 × 101
5′-AMP 2 Nd Nd Nd
2′-AMP 2 Nd Nd Nd
S. suis SntA
c-tetra-AMP 1.13 ± 0.16 262.5 ± 62.14 4.38 × 103
c-hexa-AMP 0.11 ± 0.01 2.63 ± 0.88 4.57 × 104

1kcat and KM were calculated from saturation curves obtained at different concentrations of substrate; the catalytic efficiencies were calculated by dividing kcat/KM or, when these parameters were not available (2′,3′-cGAMP), by the procedure described in Section 3.2. 2 In assays at a fixed 500 µM concentration, the activities on 5′-AMP and 2′-AMP represented less than 0.0006% of the activity on 3′-GMP and less than 2% of the activity on 3′,5′-cAMP. Nd: not determined.

The catalytic efficiencies for the substrates tested ranged from very high (>107 M−1s−1; near the diffusion rate limit) for 3′-nucleotides, 2′,3′-cNMP and the linear dinucleotide pApA, to low values (<103 M−1s−1) for c-tetra-AMP, c-hexa-AMP, 3′,5′-cAMP, NDP-hexoses, 2′,3′-cGAMP, 5′-AMP and 2′-AMP. Actually, with the two latter compounds no activity was detected, highlighting the strict specificity of the enzyme for 3′-nucleotides. Between the two extremes of catalytic efficiency, there are twelve intermediate substrates with catalytic efficiencies ranging 106–104 M−1s−1. Among them, pGpG, 3′,3′-cGAMP, c-di-AMP and c-di-GMP are relevant, together with pApA, to the role of cyclic dinucleotides as possible intermediates in the interferon response of the infected host. Although they are clearly worse substrates than 3′-nucleotides and 2′,3′-cNMP, they cannot be disregarded because catalytic efficiencies of 106–104 M−1s−1 are around the average value of catalytic efficiencies in the enzyme universe (≈105 M−1s−1) [47].

Taking into account the periplasmic location of CpdB, one would expect that it targets extracytoplasmic c-di-GMP. In this context, the hydrolysis of c-di-GMP by the periplasmic CpdB of S. enterica, followed by the degradation of the pGpG product by the same enzyme, could explain the pro-virulence of the cpdB gene [12]. Removal of the secreted dinucleotide would hinder host immune response, a defense strategy similar to that followed by streptococci through the hydrolysis of bacterial secreted c-di-AMP to diminish the innate response of the infected host cells [9,10].

Another interesting aspect of CpdB is related to its high activity towards 2′,3′-cNMP. These compounds are formed by RNase I, an enzyme present in bacterial cytosol and periplasmic space [48,49,50,51]. Therefore, at least in the latter case, 2′,3′-cNMP formed by RNase I would be hydrolyzed by periplasmic CpdB. Recently, 2′,3′-cNMP have been proposed as a novel class of bacterial signals [50,51,52,53]. In E. coli, they have clear physiological effects on gene expression, flagellar motility, biofilm formation and acid tolerance. In S. enterica, despite the evolutionary closeness with E. coli, the response to 2′,3′-cNMP is quite different. To begin with, out of the many genes that are dysregulated upon 2′,3′-cNMP depletion, only two of them show consistent changes in both species. In general, it can be said that there is little overlap in the respective cellular responses [51]. Anyhow, the possible physiological impacts of extracytoplasmic 2′,3′-cNMP, and of their hydrolysis by periplasmic CpdB are unknown.

2.2. Comparisons of CpdB-like Enzyme Specificities of Different Bacteria

Besides the Table 1 data, there are two published reports of detailed substrate specificity of CpdB-like enzymes with kinetic parameters, one for E. coli CpdB [7] and the other for S. suis SntA [10]. Figure 1 presents the comparison of S. enterica CpdB with S. suis SntA, while S. enterica CpdB is compared to E. coli CpdB in Figure 2. A direct comparison between S. suis SntA and E. coli CpdB can be found elsewhere [10].

Figure 1.

Figure 1

Comparison of kinetic parameters of S. enterica CpdB versus S. suis SntA for different substrates. S. enterica data are taken from Table 1, while those for S. suis were from previous work [10], except for c-tetra-AMP and c-hexa-AMP (Table 1). The bars represent parameter ratios in logarithmic scale: (a) ratios of kcat values; (b) ratios of KM values; (c) ratios of kcat/KM values. Blank columns in panels (a,b) indicate absence of the corresponding parameter (kcat or KM) for S. enterica and/or S. suis SntA. In the three panels, the substrates are ordered from higher to lower ratios of catalytic efficiency (kcat/KM).

Figure 2.

Figure 2

Comparison of kinetic parameters of S. enterica CpdB versus E. coli CpdB for different substrates. S. enterica data are taken from Table 1, while those for E. coli were from previous work [7]. The bars represent parameter ratios in logarithmic scale: (a) ratios of kcat values; (b) ratios of KM values; (c) ratios of kcat/KM values. In the three panels, the substrates are ordered from higher to lower ratios of catalytic efficiency.

The comparison of S. enterica CpdB with S. suis SntA in terms of kcat/KM (Figure 1c) revealed two substrate groups depending on the ratio of catalytic efficiencies between both enzymes being higher or lower than unity. The enzyme from S. enterica was less efficient than that from S. suis for 10 substrates, including cyclic oligonucleotides, particularly for c-hexa-AMP and c-di-AMP, and (much) less markedly for 2′,3′-cGAMP, c-di-GMP, 3′,3′-cGAMP and c-tetra-AMP. In all these cases, the lesser efficiency of S. enterica CpdB was generally related to higher KM values (with the exception of c-tetra-AMP; Figure 1b) and lower kcat values (except for c-di-GMP and 3′,3′-cGAMP; Figure 1a). On the other hand, for the other 16 substrates, the enzyme from S. enterica was more efficient than that from S. suis (Figure 1c) generally related to lower KM (Figure 1b) and higher kcat values (Figure 1a).

The results of the above comparison are similar to those obtained when S. suis SntA is compared to E. coli CpdB [10], although in this case less substrates were available. The differences of SntA versus E. coli CpdB, were more marked than versus S. enterica CpdB. This reflects better in the direct comparison between both CpdB enzymes (Figure 2), where all the substrates that could be compared were more efficiently hydrolyzed by the enzyme from S. enterica (Figure 2c), particularly so with the linear dinucleotides, reflecting higher kcat and lower KM values with a few exceptions (Figure 2a,b).

2.3. Structural Comparison of CpdB-like Proteins of Different Bacteria

The specificity differences among the three CpdB-like enzymes studied should be the consequence of sequential/structural differences among the proteins. The protein alignment of Figure 3 displays separately the differences between S. suis Snta and S. enterica CpdB (above the alignment), and those between E.coli CpdB and S. enterica CpdB (below the alignment). There are many differences between the sequences of S. suis SntA and S. enterica CpdB. The former is 813 amino acids long, and in the alignment only 283 of them are identical. Within the parts that align with S. enterica CpdB, there are several gaps either in SntA or CpdB. The amino acid sequences of the CpdB proteins from S. enterica and E. coli are 90.3% identical. Both proteins are 647 amino acids long, and 584 of them are identical in the alignment. They align without any gap. The differences (Figure 3) should be responsible for the different specificity of SntA versus CpdB (Figure 1c), and for the higher efficiency of S. enterica CpdB compared to E. coli CpdB (Figure 2c).

Figure 3.

Figure 3

Sequence alignment of the proteins used in this study. The alignment was prepared with Clustal Omega online (https://www.ebi.ac.uk/Tools/msa/clustalo/; accessed 5 February 2023) with a few manual edits. The sequences correspond to NCBI Protein accessions: Ssui, AYV64543; Sent, P26265; Ecol, AKS04560 with the addition of the signal sequence. The symbol = above Ssui sequence and below Ecol one indicates identity with the Sent sequence. The recombinant proteins studied start and finish in the amino acids marked with arrowheads. The sequences within boxes correspond to the interdomain linkers between the N-terminal “metallophos” and the C-terminal “5_nucleotid_C” domains (see the structures shown in Figure 4). Bold-type amino acids in the Sent sequence are either those coordinated (in the metallophos domain) with the metal ions or located (in the 5_nucleotid_C domain) at ≤4 angstrom of a 3′-AMP substrate modeled in the active site of E. coli CpdB. Shadowed in blue are His117, which has a catalytic role in enzymes of the metallophosphatase family, Tyr440 and Tyr544, which form a sandwich with the nitrogen base of substrates like 3′-AMP [8,10]. Red lines above the Ssui sequence, mark the most significant differences found with respect to the Sent sequence, most of them related to alignment gaps in either sequence. Amino acids in red type in the Ecol sequence mark the differences with respect to the Sent sequence. All these differences are highlighted in red in the structures shown in Figure 4a,c.

Currently, there are no crystal structures available for any of the three proteins considered, and within the AlphaFold Protein Structure Database [54,55] there is a model only for S. enterica CpdB (UniProt ID P26265; AF-P26265-F1-model_v4.pdb). So, to evaluate possible structural differences among the three proteins, we used homology models of E. coli CpdB and S. suis SntA prepared using the AlphaFold structure of S. enterica CpdB as the template. The homology models were obtained in the Phyre2 server [56].

To analyze how the differences among the three proteins can have some bearing on their specificity and catalytic efficiency, it is necessary to consider the dynamic events occurring during the catalytic cycle of the metallophosphatases that contain a 5_nucleotid_C domain (Scheme 2). This is inferred from detailed studies of the 5′-nucleotidase UshA [57,58,59,60,61,62] and recently it has been extrapolated to CpdB [8]. The 5_Nucleotid_C domain contains the substrate-binding pocket, which in the “open” conformation faces the medium. After substrate binding, this domain undergoes a 96° rotation towards the “closed” conformation, bringing the scissible linkage of the substrate to the catalytic dimetallic site of the metallophos domain where phosphohydrolysis takes place. This is the conformation shown in the models of Figure 4.

Scheme 2.

Scheme 2

Rotation of the 5_nucleotid_C domain of UshA-like and CpdB-like metallophosphatases during the catalytic cycle.

Figure 4.

Figure 4

Molecular models of the CpdB-like proteins of (a) S. suis, (b) S. enterica and (c) E. coli. The three structures correspond to the parts of the proteins that were used for enzyme characterization (as indicated in Figure 3). They contain the 5_nucleotid_C domain, the interdomain linker (colored pink in panel (b)) and the metallophos domain. The upper and lower panels show the same structures with a 50° rotation. The figure shows (panel (b)) a 3′-AMP molecule in the active site of S. enterica CpdB (taken from [8]; it fits equally well in the other proteins, not shown). The dimetallic centers of the three proteins are shown (grey spheres). The amino acid side chains configuring the substrate binding center in the 5_nucleotid_ C domain (colored in green), and those coordinated to the metal ions in the metallophos domain (colored in blue) are all sequentially and spatially conserved in the three proteins. In the SntA structure (a), parts colored in red (except A714–S715) are those showing differences of structure with respect to CpdB (marked also in Figure 3), and those colored in orange depict the parts of CpdB which are substituted in SntA. In the E. coli CpdB structure (c), parts colored in red indicate differences of sequence with respect to S. enterica CpdB (marked also in Figure 3). For comments on s1–s10 and other labels, see the text of Section 2.3.

The differences of sequence between S. suis SntA and S. enterica CpdB are too many to warrant a systematic analysis of all of them (there are 364 different amino acids within the aligned regions in Figure 3). Therefore, attention was centered on the gaps arising in the alignment: 17 gaps in the SntA sequence and 6 gaps in the CpdB one. They are marked by upper red lines in the SntA sequence (Figure 3) and colored in red in the 3D model (Figure 4a; s1–s10). Related to these gaps, the SntA model presents structural variations with respect to CpdB, as can be confirmed by careful comparison of Figure 4a with Figure 4b. This is underscored in Figure 4a by representing colored in orange the parts of CpdB that do not overlap with SntA.

Most of the structural differences between SntA and the CpdB proteins are located in the 5_Nucleotid_C domain (s4–s10; Figure 4a), which is responsible for substrate binding in the open conformation (not shown), and undergoes the large rotation needed to bring the substrate to the catalytic site (Scheme 2). Several of the structural differences occur in regions near the active site in the closed conformation (s2, s5, s6 and s7), or near the region where twisting occurs during the rotation (s3, s5, s10). The most conspicuous difference is the one marked as s3, which affects amino acids 419–424 of S. suis SntA, that in S. enterica and E. coli CpdB proteins are substituted by amino acids 322–332 which include two lysine residues (Lys327 and Lys328) absent in SntA. In CpdB proteins, this structural variation is associated with the presence of two aspartates (Asp634 and Asp636) which are also different in SntA (Ala714 and Ser715). As can be seen in Figure 4b, Lys327 (in the metallophos domain) and the two aspartates (in the 5_Nucleotid_C domain) may establish an electrostatic interaction during rotation of the latter domain. This could retard the full closing of the active site of the CpdB proteins and at least partly explain some kinetic differences of efficiency (Figure 1). This analysis is complicated by the variety of substrates hydrolyzed by the enzymes, and by the possibility that the “closed” conformation is not the same with substrates of different sizes, e.g., 3′-nucleotides and cyclic dinucleotides.

Despite the 63 non-identical amino acids in the sequences of S. enterica and E. coli proteins, their 3D structures were practically undistinguishable in the overlapped models (not shown but compare Figure 4b with Figure 4c). Therefore, we centered our analysis on the differential sequences, which are highlighted in red both in the E. coli CpdB sequence (Figure 3) and the 3D model (Figure 4c). None of these variations appears close enough to the active site in the “closed” conformation to explain the higher efficiency shown by S. enterica CpdB (Figure 2c). However, one of the sequence differences (marked as Q350 in Figure 4c) is located in the region of the interdomain linker that twists during the large rotation suffered by the 5_Nucleotid_C domain to bring the substrate towards the catalytic site in the metallophos domain (see Scheme 2). The difference is a substitution of Gln350 in E. coli CpdB by Glu350 in S. enterica CpdB. It is conceivable that the negative charge favors the rotation and makes it occur more quickly. This would justify the larger kcat values observed with many substrates, but it explains neither why this does not occur with all, nor the differences of KM (Figure 2a,b). Similar reasoning can be applied to other differences near the Q350 mark in Figure 4c: I324, N326, E339, T340, Y421, R428 and S569, since they are located near the region twisted during the rotation of the 5_Nucleotide_C domain, and also interesting is G186, not far from the space occupied by substrates in the closed conformation. In E. coli CpdB, they represent significant substitutions with respect to S. enterica CpdB: Gly186Ile, Ile324Ala, Asn326Ala, Glu339Gly, Thr340Ile, Tyr421Phe, Arg428Gln and Ser569Ala. All of these substitutions imply differences of charge, polarity, hydrophobicity and/or size in the side chain at those positions.

Altogether, the structural dataset provided by this study paves the way for future studies of mutagenesis to elucidate the molecular basis of the differential specificity and catalytic efficiency of the three CpdB-like proteins compared.

2.4. Genomic Distribution of cpdB-like Genes in Eubacteria

To perform a systematic study of this distribution, the strategy explained in Materials and Methods Section 3.4 was applied to the Bacteria taxa of the NCBI Taxonomy browser [63] at different levels (Table 2, Table 3, Table 4, Table 5 and Table 6). TblastN analyses [64,65] were run using S. enterica CpdB (accession number P26265) as the query, with the score and query coverage limits indicated. A score limit of 150 was chosen taking into account the occurrence of CpdB-like homologs named 5′-nucleotidase/UDP-sugar hydrolase (UshA) [66,67], with a two-domain structure similar to CpdB. In BlastP comparisons, most UshA proteins align with P26265 with scores < 130 (as compared to scores > 1000 for alignments between CpdB proteins from different bacteria). Nevertheless, the limit of score 150 is somewhat arbitrary, as one cannot totally rule out that some true cpdB relatives align with P26265 with lower scores, while choosing a lower limit to avoid this would count some ushA genes as cpdB-like. The borderline hits in every Bacteria phylum (Table 2); when tested by BlastP, it showed a (much) better alignment score with CpdB than with UshA. In a few cases that this was not so, the affected hits were removed (see footnotes 4 and 3 of Table 2 and Table 3, respectively). The limit of 70% query coverage was chosen to ensure that the two domains typical of CpdB are covered by the alignment. In principle, the search was performed among genome “sequences from type material” [68], but in some cases this restriction was removed (see below).

Table 2.

Distribution of cpdB-like genes in different phyla or groups of phyla of the superkingdom Bacteria, as obtained by TblastN analysis using S. enterica CpdB as the query 1.

Phylum or Group of Phyla Taxonomy ID Genome Hits/Total 2 Hit Score Range Key 3
Proteobacteria 1224 530/1756 1307–181 P
Firmicutes 1239 248 4/644 681–155 4 P
Deinococcus-Thermus 1297 23/45 600–557 P
Spirochaetes 203691 12/57 554–160 P
Thermotogae 200918 9/23 376–167 P
Actinobacteria 201174 116 4/668 334–192 4 P
FCB group 1783270 32/291 244–152 P
Coprothermobacterota 2138240 1/1 (1/1) 258 (258) Wm
Calditrichaeota 1930617 1/1 (1/1) 167 (167) Wm
PVC group 1783257 2/89 (2/393) 239–221 (293–221) Nm
Fusobacteria 32066 1/14 (3/74) 193 (193–154) Nm
Tenericutes 544448 1/121 (2/499) 166 (166–162) Nm
Cyanobacteria 1117 0/28 (2/221) – (238–237) Nm
Armatimonadetes 67819 0/1 (1/5) – (166) Nm
Acidobacteria 57723 0/18 (1/47) – (206) Nm
Chloroflexi 200795 0/17 (0/51) – (–) N
Aquificae 200783 0/10 (0/16) – (–) N
Deferribacteres 200930 0/6 (0/8) – (–) N
Thermodesulfobacteria 200940 0/6 (0/7) – (–) N
Synergistetes 508458 0/5 (0/8) – (–) N
Nitrospirae 40117 0/3 (0/13) – (–) N
Dictyoglomi 68297 0/2 (0/2) – (–) N
Elusimicrobia 74152 0/2 (0/5) – (–) N
Atribacterota 67818 0/1 (0/1) – (–) N
Caldiserica/Cryosericota group 2498710 0/1 (0/1) – (–) N
Chrysiogenetes 200938 0/1 (0/2) – (–) N
Nitrospinae/Tectomicrobia group 1802340 0/1 (0/1) – (–) N

1 Those phyla without any fully sequenced genome of type material were not included in the table. 2 A “Genome hit” corresponds to a TblastN alignment with score > 150 and query coverage > 70% in the Complete Genomes database (limited to “sequences from type material”, records without “plasmid” in the title, and the indicated taxonomy ID). “Total” refers to the number of sequences in the database with the same limits. Data in parenthesis were obtained by removing the search limit “sequences from type material”. Access on 13–23 December 2022. The numbers vary slightly depending on accession date. 3 The key indicates, in a somewhat subjective manner, the presence of cpdB-like genes in the bacterial taxa: W, widespread; P, partial; N, negative; m, mainly (as a modifier of W or N; indicating that there are a few exceptions and/or there is only a single genome available). 4 In these cases, one hit with score 151 (in Actinobacteria) or 152 (in Firmicutes) was removed as it showed higher BlastP alignment scores with UshA than with CpdB (see the text).

Table 3.

Distribution of cpdB-like genes in different classes of phyla Proteobacteria and Firmicutes, as obtained by TblastN analysis using S. enterica CpdB as the query.

Class Taxonomy ID Genome Hits/Total 1 Hit Score Range Key 2
Phylum Proteobacteria
Gammaproteobacteria 1236 345/813 1307–362 P
Betaproteobacteria 28216 68/333 776–395 P
Alphaproteobacteria 28211 107/409 647–245 P
Delta/epsilon subdivisions 68525 10/190 640–181 P
Oligoflexia 1553900 0/4 (1/17) – (672) Nm
Acidithiobacillia 1807140 0/4 (0/17) – (–) N
Zetaproteobacteria 580370 0/2 (0/2) – (–) N
Hydrogenophilalia 2008785 0/1 (0/1) – (–) N
Phylum Firmicutes
Bacilli 91061 194/384 681–155 P
Clostridia 186801 48 3/215 509–155 3 P
Erysipelotrichia 526524 4/15 176–156 P
Limnochordia 1676648 1/1 (1/1) 420 (420) Wm
Negativicutes 909932 1/16 (2/41) 240 (240–201) Nm
Tissierellia 1737404 0/12 (0/26) – (–) N

1,2,3 See footers 2, 3 and 4 of Table 2, respectively.

Table 4.

Distribution of cpdB-like genes in different orders of classes Gammaproteobacteria and Bacilli, as obtained by TblastN analysis using S. enterica CpdB as the query.

Order Taxonomy ID Genome Hits/Total 1 Hit Score Range Key 2
Class Gammaproteobacteria
Pasteurellales 135625 31/31 875–813 W
Enterobacterales 91347 166/181 1307–547 Wm
Moraxellales 2887326 3/32 1031–455 P
Vibrionales 135623 70/153 930–376 P
Alteromonadales 135622 39/93 912–362 P
Oceanospirillales 135619 13/47 867–560 P
Cellvibrionales 1706369 3/18 656–640 P
Aeromonadales 135624 6/10 595–554 P
Xanthomonadales 135614 10/45 452–375 P
Orbales 1240482 2/3 (5/6) 876–796 (876–796) P
Chromatiales 135613 1/29 (1/38) 591 (591) Nm
Thiotrichales 72273 1/33 (2/205) 460 (460–459) Nm
Pseudomonadales 72274 0/85 (1/1348) — (664) Nm
Legionellales 118969 0/28 (0/176) — (–) N
Methylococcales 135618 0/8 (0/30) — (–) N
Kangiellales 2887327 0/4 (0/4) — (–) N
Acidiferrobacterales 1692040 0/2 (0/4) — (–) N
Nevskiales 1775403 0/2 (0/4) — (–) N
Cardiobacteriales 135615 0/1 (0/4) — (–) N
Immundisolibacterales 1934945 0/1 (0/1) — (–) N
Class Bacilli
Bacillales 1385 125/218 681–155 P
Lactobacillales 186826 69/166 556–156 P

1,2 See footers 2 and 3 of Table 2, respectively.

Table 5.

Distribution of cpdB-like genes in different families of orders Enterobacterales and Lactobacillales, as obtained by TblastN analysis using S. enterica CpdB as the query.

Family Taxonomy ID Genome Hits/Total 1 Hit Score Range Key 2
Order Enterobacterales
Morganellaceae 1903414 9/9 (260/267) 976–547 (982–547) Wm
Enterobacteriaceae 543 81/83 1307–826 Wm
Yersiniaceae 1903411 50/52 (329/337) 1087–1045 (1097–754) Wm
Pectobacteriaceae 1903410 14/15 (144/149) 1074–1060 (1075–734) Wm
Erwiniaceae 1903409 10/13 (102/174) 1075–662 (1078–662) P
Hafniaceae 1903412 1/3 (10/42) 1046 (1050–1042) P
Budviciaceae 1903416 0/3 (2/6) — (904–904) P
Bruguierivoracaceae 2812006 0/1 (0/9) — (–) N
Order Lactobacillales
Streptococcaceae 1300 21/64 556–170 P
Lactobacillaceae 33958 27/61 221–156 P
Enterococcaceae 81852 13/17 227–179 P
Carnobacteriaceae 186828 4/8 208–180 P
Aerococcaceae 186827 2/9 (5/17) 194 (196–194) P

1,2 See footers 2 and 3 of Table 2, respectively.

Table 6.

Selected pathogens that contain or do not contain cpdB-like genes, as obtained by TblastN analysis using S. enterica CpdB as the query without limiting to “sequences from type material”.

Specific Name Taxonomy ID Group in Table 2, Table 3, Table 4 and Table 5 Genome Hits/Total 1 Hit Score Range Key 2
Aeromonas hydrophila 644 Aeromonadales 56/56 597–445 W
Bacillus anthracis 1392 Bacillales 107/107 556–541 W
Bacillus cereus 1396 Bacillales 122/122 558–449 W
Bacillus subtilis 1423 Bacillales 234/234 557–537 W
Bacillus subtilis group (excluding B. subtilis) 653685 Bacillales 331/332 563–311 Wm
Citrobacter (genus) 544 Enterobacteriaceae 206/206 1248–1187 W
Clostridium perfringens 1502 Clostridia 58/60 175–165 Wm
Clostridium tetani 1513 Clostridia 3/3 157–155 W
Enterobacter cloacae complex 354276 Enterobacteriaceae 481/483 1207–535 Wm
Escherichia (genus) (excluding E. coli) 561 Enterobacteriaceae 113/113 1203–523 W
Escherichia coli 562 Enterobacteriaceae 3014/3023 1200–240 Wm
Haemophilus influenzae 727 Pasteurellales 92/92 865–850 W
Haemophilus parainfluenzae 729 Pasteurellales 16/16 870–860 W
Hafnia alvei 569 Hafniaceae 6/6 1050–1042 W
Helicobacter pylori 210 Delta/epsilon subdiv. 252/254 209–177 Wm
Klebsiella (genus) 570 Enterobacteriaceae 2191/2196 1204–318 Wm
Kluyvera ascorbata 51288 Enterobacteriaceae 1/1 1208 Wm
Morganella morganii 582 Morganellaceae 50/50 981–547 W
Pasteurella multocida 747 Pasteurellales 133/134 843–469 Wm
Plesiomonas shigelloides 703 Enterobacteriaceae 5/6 1016–1015 Wm
Proteus mirabilis 584 Morganellaceae 98/98 936–932 W
Proteus vulgaris 585 Morganellaceae 11/11 937–927 W
Providencia stuartii 588 Morganellaceae 14/15 976–946 Wm
Salmonella bongori 54736 Enterobacteriaceae 12/12 1273–1264 W
S. enterica subsp. arizonae 59203 Enterobacteriaceae 8/8 1291–1274 W
S. enterica subsp. diarizonae 59204 Enterobacteriaceae 12/12 1291–1290 W
S. enterica subsp. enterica serovar Typhi 90370 Enterobacteriaceae 110/110 1296–1295 W
S. enterica subsp. houtenae 59205 Enterobacteriaceae 5/5 1290–1273 W
S. enterica subsp. salamae 59202 Enterobacteriaceae 14/14 1295–729 W
S. enterica subsp. VII 59208 Enterobacteriaceae 2/2 1278–1274 W
Serratia liquefaciens 614 Yersiniaceae 8/8 1081–1075 W
Serratia marcescens 615 Yersiniaceae 138/139 1086–996 Wm
Shigella (genus) 620 Enterobacteriaceae 176/176 1197–650 W
Streptococcus agalactiae 1311 Streptococcaceae 87/87 545–248 W
Streptococcus sanguinis 1305 Streptococcaceae 8/8 547–540 W
Streptococcus suis 1307 Streptococcaceae 115/116 549–409 Wm
Streptococcus thermophilus 1308 Streptococcaceae 84/84 504–152 W
Yersinia (genus) 629 Yersiniaceae 171/171 1097–754 W
Clostridium botulinum 1491 Clostridia 10/65 167–151 P
Enterococcus avium 33945 Enterococcaceae 2/3 208–207 P
Enterococcus faecalis 1351 Enterococcaceae 91/97 216–208 P
Enterococcus faecium 1352 Enterococcaceae 34/305 196–196 P
Salmonella enterica 28901 Enterobacteriaceae 1613/1750 1307–224 P
S. enterica subsp. enterica ser. Typhimurium 90371 Enterobacteriaceae 204/335 1307–1043 P
Staphylococcus epidermidis 1282 Bacillales 116/125 137–130 P
Staphylococcus saprophyticus 29385 Bacillales 4/16 169–167 P
Streptococcus dysgalactiae 1334 Streptococcaceae 13/26 543–158 P
Streptococcus parasuis 1501662 Streptococcaceae 3/6 538–536 P
Vibrio cholerae 666 Vibrionales 110/217 920–365 P
Acinetobacter calcoaceticus/baumannii complex 909 Moraxellales 0/590 – N
Aerococcus urinae 1376 Aerococcaceae 0/3 – N
Borrelia burgdorferi 139 Spirochaetes 0/11 – N
Brucella (genus) 234 Alphaproteobacteria 0/322 – N
Campylobacter jejuni 197 Delta/epsilon subdiv. 0/321 – N
Chlamydia (genus) 810 PVC group 0/188 – N
Clostridiodis difficile 1496 Clostridia 0/118 – N
Corynebacterium diphtheriae 1717 Actinobacteria 0/71 – N
Coxiella burnetii 777 Legionellales 0/16 – N
Francisella tularensis 263 Thiotrichales 0/62 – N
Legionella pneumophila 446 Legionellales 0/111 – N
Leptospira (genus) 171 Spirochaetes 0/160 – N
Listeria monocytogenes 1639 Bacillales 0/282 – N
Moraxella catarrhalis 480 Moraxellales 0/12 – N
Mycobacterium (genus) 1763 Actinobacteria 0/510 – N
Mycoplasma (genus) 2093 Tenericutes 0/118 – N
Neisseria (genus) 487 Betaproteobacteria 0/306 – N
Pseudomonas aeruginosa 287 Pseudomonadales 0/509 – N
Pseudomonas fluorescens gr. 136843 Pseudomonadales 0/107 – N
Rickettsia rickettsii 783 Alphaproteobacteria 0/14 – N
Staphylococcus aureus 1280 Bacillales 0/1105 – N
Staphylococcus warnerii 1292 Bacillales 0/10 – N
Stenotrophomonas maltophilia group 995085 Xanthomonadales 0/61 – N
Streptococcus mitis 28037 Streptococcaceae 0/10 – N
Streptococcus mutans 1309 Streptococcaceae 0/21 – N
Streptococcus pneumoniae 1313 Streptococcaceae 0/143 – N
Streptococcus pyogenes 1314 Streptococcaceae 0/253 – N
Treponema pallidum 160 Spirochaetes 0/9 – N

1 In this table, a “Genome hit” corresponds to a TblastN alignment with a score > 150 and a query cover > 70% in the Complete Genomes database (limited to records of the indicated taxonomy ID, without “plasmid” in the title). “Total” refers to the number of sequences in the database with the same limits. 2 See footer of Table 2. The results are ordered by distribution key (W or Wm), P, (Nm or N), and alphabetically within each key.

Another point one should be aware of is that some organisms rather than, or in addition to having separate proteins CpdB and UshA, may express a natural fusion of both, as the result of two-gene fusion [69]. Such a protein was experimentally observed and characterized in Bacillus subtilis [70], and it is detected mainly in sequenced genomes of phylum Firmicutes (classes Bacilli and Clostridia). Of course, the fused genes were counted as cpdB-like, since P26265 aligns well with their cpdB moiety, and no attempt to correct this was performed. Among other things, the CpdB-UshA natural fusions may be enzymatically active [70].

Following the described search strategy and limits, out of 83,531 sequences of complete genomes of Bacteria (NCBI:txid2), 1772 gave significant TblastN alignments with S. enterica CpdB, and 984 aligned with score > 150 and query coverage > 70%. In contrast, the superkingdom Archaea (NCBI:txid2157) gave no significant alignments with the same limits. In Table 2, Table 3, Table 4, Table 5 and Table 6, the near one thousand cpdB-like genes found in Bacteria are shown distributed among taxonomical groups according to different levels of classification. Results obtained at the level of phylum or groups of phyla are shown in Table 2, where all the well-established phyla are included except those for which, at the time of running the final search (15 December 2022), sequenced genomes of type material were not available. Further exploration was run at the level of class, only within the phyla Proteobacteria and Firmicutes (Table 3). Thereafter, results at the level of order were obtained only for those belonging to classes Gammaproteobacteria and Bacilli (Table 4), and results at the level of family only for those belonging to orders Enterobacterales and Lactobacillales (Table 5). Finally, an extensive selection of specific examples of pathogens of clinical interest is included in Table 6. Interestingly, the genomic distribution of cpdB-like genes among the genomes of Bacteria was not homogeneous, as indicated in Table 2, Table 3, Table 4, Table 5 and Table 6 by qualification keys “N” (Negative), “Nm” (Negative, mainly), “P” (Partial), “Wm” (Widespread, mainly) and “W” (Widespread).

Let us consider first the results obtained at the level of phyla (Table 2). The presence of cpdB-like genes was clear in Proteobacteria, Firmicutes, Deinococcus-Thermus, Spirochaetes, Thermotogae, Actinobacteria and the FCB group of phyla. In none of them the presence was widespread, only partial, meaning that, out of the tens to hundreds of sequenced genomes of type material for each of those phyla, between 11% and 51% gave hits indicative of cpdB-like genes. A wide range of scores was obtained, from near the limit of 150 to high values, which were higher in Proteobacteria than in the other cases (an expected result as the query is a protein from a Proteobacteria species; see below). In addition, the phyla Coprothermobacterota and Calditrichaeota, with a single sequenced genome each, contained a low-score hit. The rest of the phyla were either mainly negative, giving 1–2 hits with low scores in 5–221 sequenced genomes, or fully negative in 1–51 sequenced genomes. For all the phyla that gave only 0–2 hits in the available sequenced genomes of type material, the search was extended to additional genomes sequenced by removing the limit to type material (data also shown in Table 2). This revealed a small number of additional hits that did not modify the qualification key of the genomic distribution for any phylum.

In summary, out of the 27 phyla or groups of phyla with complete genomes available, cpdB-like genes are absent or near absent in 18, and present in the other 9 phyla. In the latter, the distribution is partial not homogeneous, with some genomes containing a cpdB-like gene and others not, except for two phyla with only one genome sequenced.

Further exploration of cpdB-like genes at levels lower than phylum was centered on Proteobacteria and Firmicutes, where there are many type-material genomes sequenced that gave hits in 30% and 39% of cases, respectively, with many high scores. There were 139 hits with score > 1000 in Proteobacteria, and 72 hits with scores > 500 in Firmicutes. The difference depends on the sequential differences between genes coding for enzymes either periplasmic (such as S. enterica CpdB) or cell wall-bound (such as S. suis SntA). When the TblastN was repeated using SntA sequence (accession AYV64543) as the query, the scores were higher for Firmicutes than for Proteobacteria. It may be remarked that the CpdB-like enzymes compared in Section 2.1 and 2.2 come either from Proteobacteria Enterobacteriaceae fam. (S. enterica and E. coli), or from Firmicutes Streptococcaceae fam. (S. suis).

In Table 3, phyla Proteobacteria and Firmicutes are subdivided into classes that also showed a non-ubiquitous and non-homogeneous distribution of cpdB-like genes. In Proteobacteria, 5–42% of the type-material genomes of Gammaproteobacteria, Betaproteobacteria, Alphaproteobacteria and Delta/epsilon subdivisions gave hits with high scores. In Firmicutes, Bacilli, and Clostridia gave hits in 22% and 51% of the genomes, respectively. The other Proteobacteria and Firmicutes classes were mainly negative or just negative, except Erysipelotrichia, with a partial distribution of cpdB-like genes with very low scores, and Limnochordia, with a moderately high score in a single genome sequenced.

In Table 4, the orders pertaining to classes Gammaproteobacteria and Bacilli were analyzed. Here, for the first time in the course of the TblastN analysis, appeared a taxonomical level with 100% of the type-material genomes with hits (except some taxonomical levels with a single genome sequenced), namely the order Pasteurellales. In this case, repetition of the TblastN without the limit “sequences from type material” gave 86% of the total genomes with hits (460/532). In addition, the order Enterobacterales gave hits in 92% of the type-material genomes, while Moraxellales, Vibrionales, Alteromonadales, Oceanospirillales, Cellvibrionales, Aeromonadales, Xanthomonadales, Orbales, Bacillales and Lactobacillales gave hits in 9% to 67% of the type-material genomes. The rest of orders were mainly negative or just negative, including Pseudomonadales and Legionellales.

In Table 5, the families pertaining to orders Enterobacterales and Lactobacillales were analyzed. Among Enterobacterales, the families Morganellaceae, Enterobacteriaceae, Yersiniaceae and Pectobacteriaceae showed very near to widespread distribution of cpdB-like genes, whereas Erwiniaceae, Hafniaceae and Budviciaceae displayed a partial distribution. Bruguierivoracaceae fam. was the only one with clearly negative results. Among Lactobacillales, all the families exhibited a partial distribution.

In Table 6, selected examples are shown, at the level of species, groups of species, or genus, of clinically relevant bacteria that either contain or do not contain a cpdB-like gene. In this case, TblastN analyses were always run without the limit “sequences from type material”; therefore, the results include all the available complete genomes for each species. At this level, 34 species or groups showed a completely or mainly widespread distribution of cpdB-like genes, i.e., they were present in 100% or near 100% of the genomes; 10 species showed a partial distribution, with some genomes containing and others not containing cpdB-like genes in the same species; and 28 species were negative or mainly negative as they were devoid of cpdB-like genes in 100% or near 100% of the genomes.

Let us discuss now what would be the repercussions of the three kinds of gene distribution found, taking into account that those from E. coli, S. enterica, S. agalactiae and S. suis are provirulent in different organisms [9,10,11,14]. Both the presence and the absence of cpdB-like genes in the genome can be relevant (although not exclusively, of course) for the virulence degree of the pathogen.

First, for species that did not contain cpdB-like genes (i.e., those that in Table 6 are indicated with the N key), it can be safely concluded that these organisms cannot explode the CpdB-like protein-dependent strategy of degrading extracellular cyclic dinucleotides recognized as PAMPs by the infected host [9,10], or of interfering with the complement system [14]. Of course, it is possible that other proteins replace CpdB-like ones. For instance, this occurs in the Mycobacterium tuberculosis that is negative for cpdB-like genes (Table 6), but expresses a pro-virulent cyclic nucleotide phosphodiesterase, encoded by the Rv2837c or cnpB gene, which inhibits innate immune cytosolic surveillance [19,71]. Incidentally, this M. tuberculosisis protein has been named also CdnP [71], such as the CpdB-like protein of S. agalactiae [9], but its encoding gene was not a hit in the TblastN search run with S. enterica CpdB (Table 6), as they are very different proteins encoded by different genes.

Second, concerning species in which cpdB-like genes were widespread (i.e., those that in Table 6 are indicated with the W key), they constitute a field where the possible role of these genes in virulence can be explored by constructing gene mutants, and testing them in suitable infection systems in comparison with wildtype bacteria, or by expressing the encoded proteins and studying their enzyme specificity. By extension of what is known about the provirulent role of cpdB-like genes, and of CpdB-like enzyme activities, in E. coli, S. enterica, S. agalactiae and S. suis [7,8,9,10,11,14], this strategy could be fruitful if applied to other species. For instance, it will be worth exploring genera such as Bacillus, Enterobacter, Haemophilus, Klebsiella, Morganella, Pasteurella, Proteus, Providencia, Serratia, Shigella and Yersinia, among others, which contain cpdB-like genes aligning with high TblastN scores with S. enterica CpdB (Table 6).

Third, particularly interesting are species with a partial distribution of cpdB-like genes, indicative that different strains or isolates differ in this concern. This occured very markedly in pathogens like S. enterica subsp. enterica ser. Typhimurium, Streptococcus dysgalactiae and Vibrio cholerae, to mention those that gave higher TblastN scores for alignment with S. enterica CpdB (Table 6). In this case, one should consider whether the presence or absence of a cpdB-like gene could modulate the virulence of pathogen strains or isolates.

Another interesting observation from Table 6 is that species of the same genus may differ drastically in the content of cpdB-like genes. This was the case for genus Streptococcus, since all the genomes of S. agalactiae, Streptococcus sanguinis, S. suis (with one exception) and S. thermophilus contained a cpdB-like gene, but those of Streptococcus mitis, Streptococcus mutans, Streptococcus pneumoniae and Streptococcus pyogenes did not, and those of S. dysgalactiae and Streptococcus parasuis showed a partial distribution. This was confirmed by repeating the TblastN searches using S. suis SntA as the query: scores higher than those shown in Table 6 (S. enterica CpdB as the query) were obtained, but the distribution of sntA-like genes was the same as in Table 6 for every Streptococcus species. Another example worthy of comment are the TblastN results with genus Salmonella, much more homogeneous in their content of cpdB-like genes, which were widespread in S. bongori and in S. enterica subspecies arizonae, diarizonae, houtenau, salamae VII, and enterica serovar Typhi, while it was markedly partial in serovar Typhimurium. Concerning genus Escherichia, the presence of cpdB-like genes was almost constant, and only a very minor proportion of E. coli genomes (0.3%) lack them.

2.5. Anecdotal Findings of cpdB-like Genes Outside Eubacteria Chromosomal Genomes

Incidentally, besides the findings summarized in Table 2, Table 3, Table 4, Table 5 and Table 6 for chromosomal genomes, we also observed the presence of cpdB-like genes in some unexpected genomic locations, including sequences from: plasmids, Viruses (NCBI:txid10239) and Eukaryota (NCBI:txid2759). To analyze this as deeply as possible, different ad hoc TblastN searches were ran in the NCBI Nucleotide (nr/nt) database with S. enterica CpdB as the query, as described below.

Within the superkingdom Archaea, the TblastN run without any limits, other than the taxonomical one, gave no hits with score > 150.

Within the superkingdom Bacteria, applying the Entrez query “plasmid[Title]”, 41 plasmid sequences containing cpdB-like genes with scores ranging 1303–169 were recovered (Table S1). Seven of these hits showed TblastN scores > 1000, with 100% query coverage and >88% identity, and pertained to bacterial species Salmonella sp., Klebsiella pneumoniae, and E. coli. Hits with lower scores corresponded to many different bacteria. The finding of cpdB-like genes in plasmids is theoretically in agreement with the protective character of CpdB-like enzymes against innate immune responses of the host [72].

Within the superkingdom Viruses, the TblastN run without any limits, other than the taxonomical one, gave two hits (Table S2), one of them with a score of 1062 corresponding to a cpdB-like gene of an unclassified bacteriophage of family Myoviridae [73,74].

Within the superkingdom Eukaryota, the TblastN run without any limits, other than the taxonomical one, gave 4 hits (Table S3). Three of them, with score 1185, corresponded to the genome of Digitaria exilis, a nutritious cereal known as white fonio that constitutes a vital crop of West Africa [75]. The fourth one, with score 457, corresponded to the genome of Leishmania major, a protozoan parasite with the ability to invade macrophages and that causes cutaneous leishmaniasis [76,77].

The presence of cpdB-like genes in plasmids, viruses and, particularly, in a higher plant or in a parasitic protozoan is intriguing. One wonders, for instance, whether CpdB-like proteins could have in Leishmania the same protective effect versus the immune system of the infected host as they display in Bacteria.

3. Materials and Methods

3.1. Cloning, Expression and Purification of Recombinant CpdB

Genomic DNA of S. enterica subsp. enterica serovar Typhimurium strain LT2 was acquired from the Colección Española de Cultivos Tipo (CECT, Valencia, Spain). The coding sequence of the mature CpdB protein without signal sequence (GenBank accession number NC_003197.2:c4639575-4641461) was amplified with primers CACTGGGGATCCGCCACCGTCGATCTCCGTATCATGG (forward) and CTGCACGAATTCTTACTTGCTTAAATCCACCTG (reverse), containing, respectively, BamHI and EcoRI sites (underlined). The amplicon was expected to contain the desired coding sequence flanked by those restriction sites. It was obtained with the Advantage cDNA polymerase mix (Clontech), so it contained 3′ A extensions that allowed for T4 DNA ligation to the 3′ T extensions of the pGEM-T Easy vector (Promega). Transformation of competent JM109 cells (Promega) yielded white colonies from where plasmids were obtained (High Pure Plasmid Isolation Kit, Roche). After identification of the correct construct by sequencing, it was cut with BamHI and EcoRI, and the passenger was inserted into the corresponding sites of the pGEX-6P-3 vector in frame with the PreScission protease cut sequence and the glutathione-S-transferase (GST) label. The resulting construct (pGEX-6P-3-S.enter_cpdB) was analyzed by double-strand sequencing (Servicio de Genómica, Instituto de Investigaciones Biomédicas Alberto Sols, Consejo Superior de Investigaciones Científicas, Universidad Autónoma, Madrid). The sequence of the insert matched exactly the genomic coding sequence.

The expression and purification of the recombinant CpdB was performed as described [7]. In brief: BL-21 cells were transformed with pGEX-6P-3-S.enter_cpdB under ampicillin selection; transformed cells were cultured in suspension, induced by IPTG and collected by centrifugation. After IPTG induction of the tac promoter of the vector, the supernatant of the BL-21 cell lysate was used for purification of the GST fusion protein by affinity chromatography on GSH-Sepharose (GE Healthcare Life Sciences) followed by separation from the GST label by specific proteolysis with the PreScission protease (GE Healthcare Life Sciences). This yielded mature CpdB with a GPLGS N-terminal extension, with a purity of 80–85% estimated by SDS gel electrophoresis and image analysis [78].

3.2. Enzymatic Assays

All the reactions assayed involved the phosphohydrolysis of monoester, diester or anhydride phosphate linkages. Enzyme incubations were carried out in mixtures containing 50 mM Tris-HCl, pH 7.5 at 37 °C, 2 mM MnCl2, 0.1 mg mL−1 bovine serum albumin, diverse concentrations of substrate and recombinant enzyme. All the incubations were carried out at 37 °C, under conditions of linearity with respect to incubation length and amount of enzyme. Enzyme-less and/or substrate-less controls were run and subtracted from results of full reaction mixtures. In assays with nucleoside-mono-, di- and triphosphates, and 4-NPhP, the amount of phosphate liberated as a product was measured colorimetrically. For assays with cyclic mononucleotides, diadenosine-oligophosphates, NDP-sugars, CDP-choline, and bis-4NPhP as substrates, an excess of alkaline phosphatase was included in the reaction mixture to liberate phosphate from the reaction products. The colorimetric assay of inorganic phosphate is described elsewhere [7]. The hydrolytic reactions of linear or cyclic oligonucleotides were studied by HPLC monitored at 260 nm, and reaction products separated from substrates were quantitated, as described below.

The hydrolysis of pApA, c-di-AMP, c-tetra-AMP and c-hexa-AMP was assayed measuring the accumulation of 5′-AMP (respectively, 2 mol, 2 mol, 4 mol or 6 mol per mole of substrate), except for the hydrolysis of c-hexa-AMP by S. enterica CpdB, which was assayed measuring substrate consumption. This avoided complications due to the formation of linear oligonucleotides during the reaction progress towards the formation of 5′-AMP. This is in contrast with the behavior of S. suis SntA that gave 5′-AMP as the only detectable product, indicating that linear oligonucleotide intermediates were rapidly hydrolyzed. The hydrolysis of pGpG was assayed measuring the accumulation of GpG, 5′-GMP and guanosine. The hydrolysis of 3′,3′-cGAMP was assayed measuring the accumulation of adenosine and guanosine, indicating that 3′-nucleotide products were rapidly dephosphorylated. The very slow hydrolysis of 2′,3′-cGAMP was assayed by the formation of a not well characterized product tentatively identified as G2′p5′A.

Saturation kinetics were studied by measuring initial rates at diverse substrate concentrations. Kinetic parameters kcat and KM were estimated by nonlinear regression as described [10]. The catalytic efficiency equals the quotient kcat/KM, but when saturation plots could not be obtained, this parameter was derived from initial rate data obtained at substrate concentrations much lower than the KM, i.e., when the initial rate is practically proportional to substrate concentration and most part of the enzyme is in free form. Under these conditions kcat/KM = v/([E][S]), [E] being the total concentration of enzyme [79].

3.3. HPLC Methods

The HPLC analyses were run on a Tracer Excel 120 column (150 mm × 4 mm) protected by a pre-column (10 mm × 4 mm) of the same material (octadecylsilica; Teknokroma, San Cugat del Vallés, Barcelona). An HP1100 system was used with a diode array detector adjusted to measure A260. Samples of 20 µL were injected and the elution was performed at 1 mL/min with four different buffers: A, 5 mM Na-phosphate, pH 7.0, 5 mM tetrabutylammonium, 20% methanol (by vol.); B, 100 mM Na-phosphate, pH 7.0, 5 mM tetrabutylammonium, 20% methanol; C, 10 mM Na-phosphate pH 7.0; D, 10 mM Na-phosphate pH 7.0; 50% methanol. The buffers used and the gradient method applied depended on the enzymatic reaction being studied, as indicated below.

To analyze the hydrolysis of pApA, the initial mobile phase was 80% A, 20% B, and a linear gradient was applied up to 100% B in 10 min.

To analyze the hydrolysis of pGpG, the initial mobile phase was 100% A, and a linear gradient was applied up to 40% A and 60% B in 10 min, followed by another linear gradient up to 30% A and 70% B in 5 min.

To analyze the hydrolysis of c-di-AMP, the initial mobile phase was 100% A, and a linear gradient was applied up to 40% A and 60% B in 5 min, followed by another linear gradient up to 30% A and 70% B in 10 min.

To analyze the hydrolysis of c-di-GMP, the initial mobile phase was 80% A, 20% B, and a linear gradient was applied up to 40% A and 60% B in 10 min.

To analyze the hydrolysis of c-tetra-AMP and c-hexa-AMP, the initial mobile phase was 100% C, and a linear gradient was applied up to 100% D in 10 min.

To analyze the hydrolysis of 2′,3′-cGAMP and 3′,3′-cGAMP, the initial mobile phase was 100% A, and a linear gradient was applied up to 50% A and 50% B in 4 min, followed by another linear gradient up to 100% B in 1 min and isocratic elution with 100%B for 4 min.

3.4. Analyses of the Genomic Distribution of cpdB-like Genes

To perform a systematic study of the distribution of cpdB-like genes in the Eubacteria superkingdom, we chose to use the protein sequence of S. enterica CpdB as query (GenBank accession number P26265), and searched for genomic sequences that, after translation, give significant alignments. The TblastN tool of NCBI was used to this end [64,65]. In the absence of any limits imposed on the search, the complexity of the results would be overwhelming due to the large numbers of microbial genomes currently stored in GenBank for a single species. For instance, a TblastN run with query P26265 against complete genomes of S. suis (158 available on 14 December 2022), without any other limit imposed than the organism Taxonomy ID, hits on 127 sequences with scores 409–549 and very significant E values of 10−144 and lower. The abundance of sequences for a single species precludes obtaining an unbiased panorama of the genomic distribution in Eubacteria, particularly because species with many genome sequences would be overrepresented in the final panorama. To avoid this bias, and to obtain results in which each species is represented by a single or a small number of genomes, the ability to limit the search to “sequences from type material” was activated in the microbial TblastN launch page [68]. In addition, the Genome database contains many plasmid sequences that count as complete genomes of the host bacterial species. To eliminate these “false” genomes from the TblastN results, the Entrez query “NOT plasmid[Title]” was added to the search. Further to the above strategy, to compute the results obtained in each taxonomy group by alignment to P26265, we imposed that the alignment score should be >150 and the query coverage >70%.

In cases that the above search strategy gave 0-2 hits, and in other selected cases, the search was repeated after removing the limit “sequences from type material” (Table 2, Table 3, Table 4 and Table 5). This was also done for analyses of individual species, genus of specific groups (Table 6). In special cases (Tables S1–S3), the TblastN search was run in the NCBI Nucleotide database (nr/nt).

4. Conclusions

S. enterica CpdB is a phosphohydrolase of broad specificity with a remarkable selectivity for some substrates versus others. Cyclic and linear dinucleotides are hydrolyzed with efficiencies of 104 M−1s−1 to 107 M−1s−1, which makes CpdB capable of acting on these bacterial regulators in the extracytoplasmic media of bacteria, and in the context of host-pathogen interaction.

S. enterica CpdB and S. suis SntA hydrolyze, albeit with lower efficiencies, the cyclic oligoadenylates c-tetra-AMP and c-hexa-AMP, and so these enzymes add to the shortlist of phosphodiesterases able to degrade these novel bacterial second messengers.

In the genomes of superkingdom Bacteria, cpdB-like genes are far from ubiquitous, as they are present in some phyla but not in others.

Within phyla containing cpdB-like genes, their distribution is not homogeneous, since at any taxonomical level above species there are few taxa containing a cpdB-like gene in all the sequenced genomes.

At the level of species, the distribution is more homogeneous, as out of 77 taxa investigated, 38 show a widespread or near widespread distribution of cpdB-like genes, 11 show a partial distribution, and 28 do not contain cpdB-like genes.

Species that do not contain cpdB-like genes cannot explode the CpdB-like protein-dependent strategy of degrading extracellular cyclic dinucleotides recognized as PAMPs by the infected host.

Species in which cpdB-like genes are widespread constitute a field where the possible role of these genes in virulence can be explored by creating gene mutants and studying the enzyme specificity of the CpdB-like protein.

In species with a partial distribution of cpdB-like genes, the presence or absence of a cpdB-like gene could modulate the virulence of pathogen strains or isolates.

Acknowledgments

We are grateful to María Antonia Günther and Antonio Sillero, former researchers at the Instituto de Investigación Biomédica Alberto Sols, Consejo Superior de Investigaciones Científicas, and Facultad de Medicina, Universidad Autónoma de Madrid, Madrid, Spain, for their generous gifts of biochemical research products useful for this work.

Abbreviations

2′,3′-cAMP 2′,3′-cyclic monoadenylate
2′,3′-cCMP 2′,3′-cyclic monocitidylate
2′,3′-cGAMP 2′,3′-cyclic GMP-AMP
2′,3′-cGMP 2′,3′-cyclic monoguanylate
2′,3′-cNMP 2′,3′-cyclic mononucleoside monophosphate
2′,3′-cUMP 2′,3′-cyclic monouridylate
3′,3′-cGAMP 3′,3′-cyclic GMP-AMP
3′,5′-cAMP 3′,5′-cyclic monoadenylate
4-NPhP 4-nitrophenylphosphate
ADP-glucose adenosine 5′-diphosphoglucose
ADP-ribose adenosine 5′-diphosphoribose
Ap3A diadenosine triphosphate
Ap4A diadenosine tetraphosphate
bis-4NPhP bis-4-nitrophenylphosphate
c-di-AMP cyclic-3′,5′-diadenylate
c-di-GMP cyclic-3′,5′-diguanylate
c-di-NMP cyclic-3′,5′-dinucleotide
c-hexa-AMP cyclic-3′,5′-hexanucleotide
c-tetra-AMP cyclic-3′,5′-tetranucleotide
CDP-choline cytidine 5′-diphosphocholine
G2′p5′A guanosine-2′,5′-AMP
GST glutathione -S-transferase
HPLC high performance liquid chromatography
NDP-hexose nucleoside 5′-diphosphohexose
PAMP pathogen-associated molecular pattern
pApA linear-3′,5′-diadenylate
pGpG linear-3′,5′-diaguanylate
pNpN linear-3′,5′-dinucleotide
RNase ribonuclease
STING stimulator of interferon genes
UDP-glucose uridine 5′-diphosphoglucose
UDP-sugar uridine 5′-diphosphosugar

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24044150/s1.

Author Contributions

Conceptualization, J.M.R., M.G.-D., P.M.-C. and J.C.C.; Formal analysis, J.M.R. and J.C.C.; Funding acquisition, M.J.C. and J.C.C.; Investigation, J.M.R., J.C., M.J.C., A.C. and R.M.P.; Writing—original draft, J.M.R., M.G.-D. and J.C.C.; Writing—review and editing, J.M.R., J.C., M.J.C., A.C., R.M.P., M.G.-D., P.M.-C. and J.C.C. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The supporting raw data may be requested from the corresponding author without reservation.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Funding Statement

This research was funded by Consejería de Economía, Ciencia y Agenda Digital, Junta de Extremadura, Spain (grant numbers IB16066, GR18127 and GR21100). All grants were co-funded by FEDER (European Regional Development Fund). The APC was funded by a waiver benefit granted by MDPI.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Anraku Y. A new cyclic phosphodiesterase having a 3′-nucleotidase activity from Escherichia coli B. I. Purification and some properties of the enzyme. J. Biol. Chem. 1964;239:3412–3419. doi: 10.1016/S0021-9258(18)97738-0. [DOI] [PubMed] [Google Scholar]
  • 2.Anraku Y. A new cyclic phosphodiesterase having a 3′-nucleotidase activity from Escherichia coli B. II. Further studies on substrate specificity and mode of action of the enzyme. J. Biol. Chem. 1964;239:3420–3424. doi: 10.1016/S0021-9258(18)97739-2. [DOI] [PubMed] [Google Scholar]
  • 3.Liu J., Burns D.M., Beacham I.R. Isolation and sequence analysis of the gene (cpdB) encoding periplasmic 2′,3′-cyclic phosphodiesterase. J. Bacteriol. 1986;165:1002–1010. doi: 10.1128/jb.165.3.1002-1010.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Trülzsch K., Roggenkamp A., Pelludat C., Rakin A., Jacobi C., Heesemann J. Cloning and characterization of the gene encoding periplasmic 2′,3′-cyclic phosphodiesterase of Yersinia enterocolitica O:8. Microbiology. 2001;147:203–213. doi: 10.1099/00221287-147-1-203. [DOI] [PubMed] [Google Scholar]
  • 5.Anderson B.M., Kahn D.W., Anderson C.D. Studies of the 2′:3′-cyclic nucleotide phosphodiesterase of Haemophilus influenzae. J. Gen. Microbiol. 1985;131:2041–2045. doi: 10.1099/00221287-131-8-2041. [DOI] [PubMed] [Google Scholar]
  • 6.Unemoto T., Takahashi F., Hayashi M. Relationship between the active sites of 2′,3′-cyclic phosphodiesterase with 3′-nucleotidase activity purified from Vibrio alginolyticus. Biochim. Biophys. Acta. 1969;185:134–142. doi: 10.1016/0005-2744(69)90289-7. [DOI] [PubMed] [Google Scholar]
  • 7.López-Villamizar I., Cabezas A., Pinto R.M., Canales J., Ribeiro J.M., Cameselle J.C., Costas M.J. The characterization of Escherichia coli CpdB as a recombinant protein reveals that, besides having the expected 3′-nucleotidase and 2′,3′-cyclic mononucleotide phosphodiesterase activities, it is also active as cyclic dinucleotide phosphodiesterase. PLoS ONE. 2016;11:e0157308. doi: 10.1371/journal.pone.0157308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.López-Villamizar I., Cabezas A., Pinto R.M., Canales J., Ribeiro J.M., Rodrigues J.R., Costas M.J., Cameselle J.C. Molecular dissection of Escherichia coli CpdB: Roles of the N domain in catalysis and phosphate inhibition, and of the C domain in substrate specificity and adenosine inhibition. Int. J. Mol. Sci. 2021;22:1977. doi: 10.3390/ijms22041977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Andrade W.A., Firon A., Schmidt T., Hornung V., Fitzgerald K.A., Kurt-Jones E.A., Trieu-Cuot P., Golenbock D.T., Kaminski P.A. Group B Streptococcus degrades cyclic-di-AMP to modulate STING-dependent type I interferon production. Cell Host Microbe. 2016;20:49–59. doi: 10.1016/j.chom.2016.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Cabezas A., Costas M.J., Canales J., Pinto R.M., Rodrigues J.R., Ribeiro J.M., Cameselle J.C. Enzyme characterization of pro-virulent SntA, a cell wall-anchored protein of Streptococcus suis, with phosphodiesterase activity on cyclic-di-AMP at a level suited to limit the innate immune system. Front. Microbiol. 2022;13:843068. doi: 10.3389/fmicb.2022.843068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu H., Chen L., Si W., Wang C., Zhu F., Li G., Liu S. Physiology and pathogenicity of cpdB deleted mutant of avian pathogenic Escherichia coli. Res. Vet. Sci. 2017;111:21–25. doi: 10.1016/j.rvsc.2016.11.010. [DOI] [PubMed] [Google Scholar]
  • 12.Liu H., Chen L., Wang X., Si W., Wang H., Wang C., Liu S., Li G. Decrease of colonization in the chicks′ cecum and internal organs of Salmonella enterica serovar Pullorum by deletion of cpdB by Red system. Microb. Pathog. 2015;80:21–26. doi: 10.1016/j.micpath.2015.01.002. [DOI] [PubMed] [Google Scholar]
  • 13.Si W., Wang X., Liu H., Yu S., Li Z., Chen L., Zhang W., Liu S. Physiology, pathogenicity and immunogenicity of live, attenuated Salmonella enterica serovar Enteritidis mutants in chicks. Microb. Pathog. 2015;83–84:6–11. doi: 10.1016/j.micpath.2015.03.018. [DOI] [PubMed] [Google Scholar]
  • 14.Deng S., Xu T., Fang Q., Yu L., Zhu J., Chen L., Liu J., Zhou R. The surface-exposed protein SntA contributes to complement evasion in zoonotic Streptococcus suis. Front. Immunol. 2018;9:1063. doi: 10.3389/fimmu.2018.01063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wan Y., Zhang S., Li L., Chen H., Zhou R. Characterization of a novel streptococcal heme-binding protein SntA and its interaction with host antioxidant protein AOP2. Microb. Pathog. 2017;111:145–155. doi: 10.1016/j.micpath.2017.08.018. [DOI] [PubMed] [Google Scholar]
  • 16.Liu Y., Filiatrault M.J. Antibacterial activity and mode of action of potassium tetraborate tetrahydrate against soft-rot bacterial plant pathogens. Microbiology. 2020;166:837–848. doi: 10.1099/mic.0.000948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Woodward J.J., Iavarone A.T., Portnoy D.A. c-di-AMP secreted by intracellular Listeria monocytogenes activates a host type I interferon response. Science. 2010;328:1703–1705. doi: 10.1126/science.1189801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Parvatiyar K., Zhang Z., Teles R.M., Ouyang S., Jiang Y., Iyer S.S., Zaver S.A., Schenk M., Zeng S., Zhong W., et al. The helicase DDX41 recognizes the bacterial secondary messengers cyclic di-GMP and cyclic di-AMP to activate a type I interferon immune response. Nat. Immunol. 2012;13:1155–1161. doi: 10.1038/ni.2460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yang J., Bai Y., Zhang Y., Gabrielle V.D., Jin L., Bai G. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection. Mol. Microbiol. 2014;93:65–79. doi: 10.1111/mmi.12641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Devaux L., Kaminski P.A., Trieu-Cuot P., Firon A. Cyclic di-AMP in host-pathogen interactions. Curr. Opin. Microbiol. 2018;41:21–28. doi: 10.1016/j.mib.2017.11.007. [DOI] [PubMed] [Google Scholar]
  • 21.Commichau F.M., Heidemann J.L., Ficner R., Stülke J. Making and breaking of an essential poison: The cyclases and phosphodiesterases that produce and degrade the essential second messenger cyclic di-AMP in bacteria. J. Bacteriol. 2019;201:e00462-18. doi: 10.1128/JB.00462-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Louie A., Bhandula V., Portnoy D.A. Secretion of c-di-AMP by Listeria monocytogenes leads to a STING-dependent antibacterial response during enterocolitis. Infect. Immun. 2020;88:e00407-20. doi: 10.1128/IAI.00407-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li W., Liu L., Chen H., Zhou R. Identification of Streptococcus suis genes preferentially expressed under iron starvation by selective capture of transcribed sequences. FEMS Microbiol. Lett. 2009;292:123–133. doi: 10.1111/j.1574-6968.2008.01476.x. [DOI] [PubMed] [Google Scholar]
  • 24.de Jong H.K., Parry C.M., van der Poll T., Wiersinga W.J. Host-pathogen interaction in invasive Salmonellosis. PLoS Pathog. 2012;8:e1002933. doi: 10.1371/journal.ppat.1002933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jajere S.M. A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance. Vet. World. 2019;12:504–521. doi: 10.14202/vetworld.2019.504-521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Luk C.H., Enninga J., Valenzuela C. Fit to dwell in many places—The growing diversity of intracellular Salmonella niches. Front. Cell. Infect. Microbiol. 2022;12:989451. doi: 10.3389/fcimb.2022.989451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Castanheira S., García-Del Portillo F. Salmonella populations inside host cells. Front. Cell. Infect. Microbiol. 2017;7:432. doi: 10.3389/fcimb.2017.00432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pham T.H.M., Xue Y., Brewer S.M., Bernstein K.E., Quake S.R., Monack D.M. Single-cell profiling identifies ACE(+) granuloma macrophages as a nonpermissive niche for intracellular bacteria during persistent Salmonella infection. Sci. Adv. 2023;9:eadd4333. doi: 10.1126/sciadv.add4333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lamprokostopoulou A., Römling U. Yin and Yang of biofilm formation and cyclic di-GMP signaling of the gastrointestinal pathogen Salmonella enterica serovar Typhimurium. J. Innate Immun. 2022;14:275–292. doi: 10.1159/000519573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shome A., Kumawat M., Pesingi P.K., Bhure S.K., Mahawar M. Isolation and identification of periplasmic proteins in Salmonella Typhimurium. Int. J. Curr. Microbiol. Appl. Sci. 2020;9:1923–1936. doi: 10.20546/ijcmas.2020.906.238. [DOI] [Google Scholar]
  • 31.Liu J., Beacham I.R. Transcription and regulation of the cpdB gene in Escherichia coli K12 and Salmonella typhimurium LT2: Evidence for modulation of constitutive promoters by cyclic AMP-CRP complex. Mol. Gen. Genet. 1990;222:161–165. doi: 10.1007/BF00283039. [DOI] [PubMed] [Google Scholar]
  • 32.Domínguez-Acuña L., García-Del Portillo F. Ferrous iron uptake is required for Salmonella to persist within vacuoles of host cells. Infect. Immun. 2022;90:e0014922. doi: 10.1128/iai.00149-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Barker J.R., Koestler B.J., Carpenter V.K., Burdette D.L., Waters C.M., Vance R.E., Valdivia R.H. STING-dependent recognition of cyclic di-AMP mediates type I interferon responses during Chlamydia trachomatis infection. mBio. 2013;4:e00018-13. doi: 10.1128/mBio.00018-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ye M., Zhang J.J., Fang X., Lawlis G.B., Troxell B., Zhou Y., Gomelsky M., Lou Y., Yang X.F. DhhP, a cyclic di-AMP phosphodiesterase of Borrelia burgdorferi, is essential for cell growth and virulence. Infect. Immun. 2014;82:1840–1849. doi: 10.1128/IAI.00030-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Savage C.R., Arnold W.K., Gjevre-Nail A., Koestler B.J., Bruger E.L., Barker J.R., Waters C.M., Stevenson B. Intracellular concentrations of Borrelia burgdorferi cyclic di-AMP are not changed by altered expression of the CdaA synthase. PLoS ONE. 2015;10:e0125440. doi: 10.1371/journal.pone.0125440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rubin B.E., Huynh T.N., Welkie D.G., Diamond S., Simkovsky R., Pierce E.C., Taton A., Lowe L.C., Lee J.J., Rifkin S.A., et al. High-throughput interaction screens illuminate the role of c-di-AMP in cyanobacterial nighttime survival. PLoS Genet. 2018;14:e1007301. doi: 10.1371/journal.pgen.1007301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Römling U. Cyclic di-GMP signaling in Salmonella enterica serovar Typhimurium. In: Chou S.H., Guiliani N., Lee V.T., Römling U., editors. Microbial Cyclic Di-Nucleotide Signaling. Springer Nature; Cham, Switzerland: 2020. pp. 395–425. [DOI] [Google Scholar]
  • 38.Solano C., Garcia B., Latasa C., Toledo-Arana A., Zorraquino V., Valle J., Casals J., Pedroso E., Lasa I. Genetic reductionist approach for dissecting individual roles of GGDEF proteins within the c-di-GMP signaling network in Salmonella. Proc. Natl. Acad. Sci. USA. 2009;106:7997–8002. doi: 10.1073/pnas.0812573106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lamprokostopoulou A., Monteiro C., Rhen M., Römling U. Cyclic di-GMP signalling controls virulence properties of Salmonella enterica serovar Typhimurium at the mucosal lining. Environ. Microbiol. 2010;12:40–53. doi: 10.1111/j.1462-2920.2009.02032.x. [DOI] [PubMed] [Google Scholar]
  • 40.Ahmad I., Lamprokostopoulou A., Le Guyon S., Streck E., Barthel M., Peters V., Hardt W.D., Römling U. Complex c-di-GMP signaling networks mediate transition between virulence properties and biofilm formation in Salmonella enterica serovar Typhimurium. PLoS ONE. 2011;6:e28351. doi: 10.1371/journal.pone.0028351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Burdette D.L., Monroe K.M., Sotelo-Troha K., Iwig J.S., Eckert B., Hyodo M., Hayakawa Y., Vance R.E. STING is a direct innate immune sensor of cyclic di-GMP. Nature. 2011;478:515–518. doi: 10.1038/nature10429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Park S.M., Omatsu T., Zhao Y., Yoshida N., Shah P., Zagani R., Reinecker H.C. T cell fate following Salmonella infection is determined by a STING-IRF1 signaling axis in mice. Commun. Biol. 2019;2:464. doi: 10.1038/s42003-019-0701-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Niewoehner O., Garcia-Doval C., Rostol J.T., Berk C., Schwede F., Bigler L., Hall J., Marraffini L.A., Jinek M. Type III CRISPR-Cas systems produce cyclic oligoadenylate second messengers. Nature. 2017;548:543–548. doi: 10.1038/nature23467. [DOI] [PubMed] [Google Scholar]
  • 44.Brown S., Gauvin C.C., Charbonneau A.A., Burman N., Lawrence C.M. Csx3 is a cyclic oligonucleotide phosphodiesterase associated with type III CRISPR-Cas that degrades the second messenger cA(4) J. Biol. Chem. 2020;295:14963–14972. doi: 10.1074/jbc.RA120.014099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Molina R., Garcia-Martin R., López-Méndez B., Jensen A.L.G., Ciges-Tomas J.R., Marchena-Hurtado J., Stella S., Montoya G. Molecular basis of cyclic tetra-oligoadenylate processing by small standalone CRISPR-Cas ring nucleases. Nucleic Acids Res. 2022;50:11199–11213. doi: 10.1093/nar/gkac923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Athukoralage J.S., Rouillon C., Graham S., Gruschow S., White M.F. Ring nucleases deactivate type III CRISPR ribonucleases by degrading cyclic oligoadenylate. Nature. 2018;562:277–280. doi: 10.1038/s41586-018-0557-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bar-Even A., Noor E., Savir Y., Liebermeister W., Davidi D., Tawfik D.S., Milo R. The moderately efficient enzyme: Evolutionary and physicochemical trends shaping enzyme parameters. Biochemistry. 2011;50:4402–4410. doi: 10.1021/bi2002289. [DOI] [PubMed] [Google Scholar]
  • 48.Beacham I.R. Periplasmic enzymes in gram-negative bacteria. Int. J. Biochem. 1979;10:877–883. doi: 10.1016/0020-711X(79)90117-4. [DOI] [PubMed] [Google Scholar]
  • 49.Cannistraro V.J., Kennell D. RNase I*, a form of RNase I, and mRNA degradation in Escherichia coli. J. Bacteriol. 1991;173:4653–4659. doi: 10.1128/jb.173.15.4653-4659.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Fontaine B.M., Martin K.S., Garcia-Rodriguez J.M., Jung C., Briggs L., Southwell J.E., Jia X., Weinert E.E. RNase I regulates Escherichia coli 2′,3′-cyclic nucleotide monophosphate levels and biofilm formation. Biochem. J. 2018;475:1491–1506. doi: 10.1042/BCJ20170906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Duggal Y., Kurasz J.E., Fontaine B.M., Marotta N.J., Chauhan S.S., Karls A.C., Weinert E.E. Cellular effects of 2′,3′-cyclic nucleotide monophosphates in Gram-negative bacteria. J. Bacteriol. 2022;204:e0020821. doi: 10.1128/JB.00208-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Fontaine B.M., Duggal Y., Weinert E.E. 2′,3′-Cyclic mononucleotide metabolism and possible roles in bacterial physiology. In: Chou S.H., Guiliani N., Lee V.T., Römling U., editors. Microbial Cyclic Di-Nucleotide Signaling. Springer Nature; Cham, Switzerland: 2020. pp. 627–637. [DOI] [Google Scholar]
  • 53.Chauhan S.S., Marotta N.J., Karls A.C., Weinert E.E. Binding of 2′,3′-cyclic nucleotide monophosphates to bacterial ribosomes inhibits translation. ACS Cent. Sci. 2022;8:1518–1526. doi: 10.1021/acscentsci.2c00681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Jumper J., Evans R., Pritzel A., Green T., Figurnov M., Ronneberger O., Tunyasuvunakool K., Bates R., Žídek A., Potapenko A., et al. Highly accurate protein structure prediction with AlphaFold. Nature. 2021;596:583–589. doi: 10.1038/s41586-021-03819-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Varadi M., Anyango S., Deshpande M., Nair S., Natassia C., Yordanova G., Yuan D., Stroe O., Wood G., Laydon A., et al. AlphaFold Protein Structure Database: Massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 2022;50:D439–D444. doi: 10.1093/nar/gkab1061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Kelley L.A., Mezulis S., Yates C.M., Wass M.N., Sternberg M.J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015;10:845–858. doi: 10.1038/nprot.2015.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Krug U., Patzschke R., Zebisch M., Balbach J., Sträter N. Contribution of the two domains of E. coli 5′-nucleotidase to substrate specificity and catalysis. FEBS Lett. 2013;5793:010. doi: 10.1016/j.febslet.2013.01.010. [DOI] [PubMed] [Google Scholar]
  • 58.Knöfel T., Sträter N. Mechanism of hydrolysis of phosphate esters by the dimetal center of 5′-nucleotidase based on crystal structures. J. Mol. Biol. 2001;309:239–254. doi: 10.1006/jmbi.2001.4656. [DOI] [PubMed] [Google Scholar]
  • 59.Schultz-Heienbrok R., Maier T., Sträter N. Trapping a 96 degrees domain rotation in two distinct conformations by engineered disulfide bridges. Protein Sci. 2004;13:1811–1822. doi: 10.1110/ps.04629604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Knöfel T., Sträter N. X-ray structure of the Escherichia coli periplasmic 5′-nucleotidase containing a dimetal catalytic site. Nat. Struct. Biol. 1999;6:448–453. doi: 10.1038/8253. [DOI] [PubMed] [Google Scholar]
  • 61.Knöfel T., Sträter N.E. coli 5′-nucleotidase undergoes a hinge-bending domain rotation resembling a ball-and-socket motion. J. Mol. Biol. 2001;309:255–266. doi: 10.1006/jmbi.2001.4657. [DOI] [PubMed] [Google Scholar]
  • 62.Schultz-Heienbrok R., Maier T., Sträter N. A large hinge bending domain rotation is necessary for the catalytic function of Escherichia coli 5′-nucleotidase. Biochemistry. 2005;44:2244–2252. doi: 10.1021/bi047989c. [DOI] [PubMed] [Google Scholar]
  • 63.Schoch C.L., Ciufo S., Domrachev M., Hotton C.L., Kannan S., Khovanskaya R., Leipe D., McVeigh R., O′Neill K., Robbertse B., et al. NCBI Taxonomy: A comprehensive update on curation, resources and tools. Database. 2020;2020:baaa062. doi: 10.1093/database/baaa062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Gertz E.M., Yu Y.K., Agarwala R., Schaffer A.A., Altschul S.F. Composition-based statistics and translated nucleotide searches: Improving the TBLASTN module of BLAST. BMC Biol. 2006;4:41. doi: 10.1186/1741-7007-4-41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z., Miller W., Lipman D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Alves-Pereira I., Canales J., Cabezas A., Cordero P.M., Costas M.J., Cameselle J.C. CDP-alcohol hydrolase, a very efficient activity of the 5′-nucleotidase/UDP-sugar hydrolase encoded by the ushA gene of Yersinia intermedia and Escherichia coli. J. Bacteriol. 2008;190:6153–6161. doi: 10.1128/JB.00658-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Cabezas A., López-Villamizar I., Costas M.J., Cameselle J.C., Ribeiro J.M. Substrate specificity of chimeric enzymes formed by interchange of the catalytic and specificity domains of the 5′-nucleotidase UshA and the 3′-nucleotidase CpdB. Molecules. 2021;26:2307. doi: 10.3390/molecules26082307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Federhen S. Type material in the NCBI Taxonomy Database. Nucleic Acids Res. 2015;43:D1086–D1098. doi: 10.1093/nar/gku1127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Yamamoto H., Uchiyama S., Sekiguchi J. Cloning and sequencing of a 40.6 kb segment in the 73 degrees-76 degrees region of the Bacillus subtilis chromosome containing genes for trehalose metabolism and acetoin utilization. Microbiology. 1996;142:3057–3065. doi: 10.1099/13500872-142-11-3057. [DOI] [PubMed] [Google Scholar]
  • 70.Chambert R., Pereira Y., Petit-Glatron M.F. Purification and characterization of YfkN, a trifunctional nucleotide phosphoesterase secreted by Bacillus subtilis. J. Biochem. 2003;134:655–660. doi: 10.1093/jb/mvg189. [DOI] [PubMed] [Google Scholar]
  • 71.Dey R.J., Dey B., Zheng Y., Cheung L.S., Zhou J., Sayre D., Kumar P., Guo H., Lamichhane G., Sintim H.O., et al. Inhibition of innate immune cytosolic surveillance by an M. tuberculosis phosphodiesterase. Nat. Chem. Biol. 2017;13:210–217. doi: 10.1038/nchembio.2254. [DOI] [PubMed] [Google Scholar]
  • 72.Hall J.P.J., Botelho J., Cazares A., Baltrus D.A. What makes a megaplasmid? Philos. Trans. R. Soc. Lond. B Biol. Sci. 2022;377:20200472. doi: 10.1098/rstb.2020.0472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.International Committee on Taxonomy of Viruses . Family—Myoviridae. In: King A.M.Q., Adams M.J., Carstens E.B., Lefkowitz E., editors. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press; Amsterdam, The Netherlands: 2012. pp. 46–62. [Google Scholar]
  • 74.Tisza M.J., Buck C.B. A catalog of tens of thousands of viruses from human metagenomes reveals hidden associations with chronic diseases. Proc. Natl. Acad. Sci. USA. 2021;118:e20232021. doi: 10.1073/pnas.2023202118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Wang X., Chen S., Ma X., Yssel A.E.J., Chaluvadi S.R., Johnson M.S., Gangashetty P., Hamidou F., Sanogo M.D., Zwaenepoel A., et al. Genome sequence and genetic diversity analysis of an under-domesticated orphan crop, white fonio (Digitaria exilis) Gigascience. 2021;10:giab013. doi: 10.1093/gigascience/giab013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Kumar A. Leishmania and Leishmaniasis. Springer; New York, NY, USA: 2013. [DOI] [Google Scholar]
  • 77.Alraey Y., Alhweti R., Almutairi H., Abdullah Al-Qahtani A., Alshahrani M.I., Asiri M.H., Alhammas A.M., Alwagdi S.J., Alshahrani A., Alouffi A., et al. Molecular characterization of Leishmania species among patients with cutaneous leishmaniasis in Asir province, Saudi Arabia. Pathogens. 2022;11:1472. doi: 10.3390/pathogens11121472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Lazar I., Jr., Lazar I., Sr. Gel Analyzer 19.1. [(accessed on 1 December 2022)]. Available online: http://www.gelanalyzer.com.
  • 79.Fehrst A. Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding. W. Freeman & Co.; New York, NY, USA: 1998. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The supporting raw data may be requested from the corresponding author without reservation.


Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES