Skip to main content
PeerJ logoLink to PeerJ
. 2023 Feb 23;11:e14896. doi: 10.7717/peerj.14896

Emergence of colistin resistance and characterization of antimicrobial resistance and virulence factors of Aeromonas hydrophila, Salmonella spp., and Vibrio cholerae isolated from hybrid red tilapia cage culture

Varangkana Thaotumpitak 1, Jarukorn Sripradite 2, Edward R Atwill 3, Saharuetai Jeamsripong 1,✉
Editor: Morteza Saki
PMCID: PMC9968459  PMID: 36855429

Abstract

Background

Tilapia is a primary aquaculture fish in Thailand, but little is known about the occurrence of antimicrobial resistance (AMR) in Aeromonas hydrophila, Salmonella spp., and Vibrio cholerae colonizing healthy tilapia intended for human consumption and the co-occurrence of these AMR bacteria in the cultivation water.

Methods

This study determined the phenotype and genotype of AMR, extended-spectrum β-lactamase (ESBL) production, and virulence factors of A. hydrophila, Salmonella spp., and V. cholerae isolated from hybrid red tilapia and cultivation water in Thailand. Standard culture methods such as USFDA’s BAM or ISO procedures were used for the original isolation, with all isolates confirmed by biochemical tests, serotyping, and species-specific gene detection based on PCR.

Results

A total of 278 isolates consisting of 15 A. hydrophila, 188 Salmonella spp., and 75 V. cholerae isolates were retrieved from a previous study. All isolates of A. hydrophila and Salmonella isolates were resistance to at least one antimicrobial, with 26.7% and 72.3% of the isolates being multidrug resistant (MDR), respectively. All A. hydrophila isolates were resistant to ampicillin (100%), followed by oxytetracycline (26.7%), tetracycline (26.7%), trimethoprim (26.7%), and oxolinic acid (20.0%). The predominant resistance genes in A. hydrophila were mcr-3 (20.0%), followed by 13.3% of isolates having floR, qnrS, sul1, sul2, and dfrA1. Salmonella isolates also exhibited a high prevalence of resistance to ampicillin (79.3%), oxolinic acid (75.5%), oxytetracycline (71.8%), chloramphenicol (62.8%), and florfenicol (55.3%). The most common resistance genes in these Salmonella isolates were qnrS (65.4%), tetA (64.9%), blaTEM (63.8%), and floR (55.9%). All V. cholerae isolates were susceptible to all antimicrobials tested, while the most common resistance gene was sul1 (12.0%). One isolate of A. hydrophila was positive for int1, while all isolates of Salmonella and V. cholerae isolates were negative for integrons and intSXT. None of the bacterial isolates in this study were producing ESBL. The occurrence of mcr-3 (20.0%) in these isolates from tilapia aquaculture may signify a serious occupational and consumer health risk given that colistin is a last resort antimicrobial for treatment of Gram-negative bacteria infections.

Conclusions

Findings from this study on AMR bacteria in hybrid red tilapia suggest that aquaculture as practiced in Thailand can select for ubiquitous AMR pathogens, mobile genetic elements, and an emerging reservoir of mcr and colistin-resistant bacteria. Resistant and pathogenic bacteria, such as resistance to ampicillin and tetracycline, or MDR Salmonella circulating in aquaculture, together highlight the public health concerns and foodborne risks of zoonotic pathogens in humans from cultured freshwater fish.

Keywords: Aeromonas hydrophila, Antimicrobial resistance, Colistin, Salmonella, Vibrio cholerae, Hybrid red tilapia

Introduction

Thailand is one of the main producers of global freshwater fish production. Tilapia is highlighted as the main cultivated fish in Thailand with a production of at least 200,000 tons per year (FAO, 2020). The increased demand for tilapia leads to the intensification of fish farming, and this circumstance can make fish more susceptible to bacterial and viral infection. Aeromonas spp. and Vibrio cholerae are native inhabitants of the aquatic environment. A. hydrophila is the main causative agent of motile Aeromonas septicemia (MAS), while V. cholerae is the normal flora of freshwater fish and is postulated as an opportunistic fish pathogen (Halpern & Izhaki, 2017; Nicholson et al., 2020). These two bacteria play a particular role in foodborne pathogens. A. hydrophila has been implicated in foodborne diarrheal outbreaks and the presence of V. cholerae in freshwater fish has been associated with cholera in human cases (Liu, Whitehouse & Li, 2018; Elimian et al., 2019). Salmonella is one of the top five bacterial pathogens that causes foodborne and waterborne diseases in humans (Lee & Yoon, 2021). Although Salmonella is harmless in fish, it has been associated with many foodborne diseases related to freshwater fish (Liu, Whitehouse & Li, 2018). For example, human infection with non-typhoidal Salmonella (NTS) associated with contaminated fish can cause gastroenteritis, potential bacteremia and potential life-threatening infections (Akinyemi, Ajoseh & Fakorede, 2021).

Antimicrobial resistance (AMR) is of increasing concern due to its impact on therapeutic options, resulting in failure of treatment and public health impacts. AMR bacteria found in fish and aquatic environments can originate from human activities, land-based agriculture, and aquaculture (Bollache et al., 2019). Resistant bacteria from the environment can contribute to AMR in aquaculture and possibly in humans as an important One Health issue. However, AMR occurrence in fish and the surrounding aquatic environments is poorly studied. Extended-spectrum β-lactamase (ESBL)-producing bacteria are resistant to most penicillins and cephalosporins, and can also be co-resistant to other antimicrobial groups such as fluoroquinolones and colistin (Zhang et al., 2019; Gawish et al., 2021). Multidrug resistant (MDR) A. hydrophila, Salmonella spp. and V. cholerae isolated from fish have been documented (Saharan, Verma & Singh, 2020), which can elevate the risk of co-infection with MDR and ESBL-producing bacteria. Colistin is a last-line antimicrobial reserved for the treatment of serious gram-negative bacterial infections in humans. In livestock, colistin is used primarily for the treatment of diarrhea and is currently banned in many countries, including Thailand due to the emergence of plasmid-borne colistin resistance genes (mcr) reported in meat and poultry products that indicate potential transferable resistance (Pungpian et al., 2021). The mcr genes are commonly detected in Enterobacterales, including E. coli and Salmonella, and are occasionally found in other zoonotic gram-negative bacteria such as A. hydrophila, and Klebsiella pneumonia (Elbediwi et al., 2019; Luo, Wang & Xiao, 2020). The global dissemination of the mcr genes among these pathogens is highly concerning, because they can be potentially transmitted from animals to humans, resulting in unsuccessful gram-negative bacterial infection treatment. Furthermore, the presence of resistance to colistin in fish has been reported (Liu et al., 2020; Saharan, Verma & Singh, 2020), with a recent study indicating that the consumption of fish products was a risk factor for infection by bacteria harboring the mcr-1 gene among healthy Chinese (Lv et al., 2022).

Quinolones are effective antimicrobials for the treatment of gram-negative bacterial infection. Their analogs have been applied to both humans and aquatic animals. For example, ciprofloxacin is commonly used for the treatment of gastrointestinal and urinary tract infections in humans, while oxolinic acid and enrofloxacin are approved for the treatment of columnaris and MAS in aquatic animals (Baoprasertkul, Somsiri & Boonyawiwat, 2012). Mutations in quinolone resistance determining regions (QRDRs) in the gyrA and parC regions, and plasmid-encoded quinolone resistance (PMQR) genes can confer quinolone resistance. However, the main mechanism conferred on resistance in aquatic bacteria has not been clearly investigated. Few studies of the phenotype, genotype, and its determinants of AMR related to foodborne bacteria in hybrid red tilapia have been reported in Thailand. Therefore, the aims of this study were to characterize the phenotype and genotype of AMR bacteria, virulence genes, and ESBL production of A. hydrophila, Salmonella spp., and V. cholerae isolated from the surface of fish, intestine, muscle, liver and kidney of hybrid red tilapia and their cultivation water, and to characterize gyrA and parC in QRDRs of ciprofloxacin-resistant isolates.

Materials & Methods

Bacterial strains

A total of 278 isolates of A. hydrophila (n = 15), Salmonella (n = 188) and V. cholerae (n = 75) were obtained from an existing bank of bacterial isolates from a previous study on bacterial pathogens from cage cultured tilapia in Thailand (Thaotumpitak et al., 2022), which were stored at the Department of Veterinary Public Health, Faculty of Veterinary Science, Chulalongkorn University (Table 1). In summary, these isolates were collected from healthy fresh tilapia (carcass rinse, intestine, muscle, liver, and kidney) and cultivation water in Kanchanaburi Province from October 2019 to November 2020, with the study location and bacterial isolation procedures described previously (Thaotumpitak et al., 2022). All isolates had been stored in 20% glycerol at −80 °C. This study was reviewed and approved by IBC No. 2031027 of the Faculty of Veterinary Science, Chulalongkorn University.

Table 1. Number of bacterial isolates tested in this study (n = 278).

Sample type No. of bacterial isolate ( n )
A. hydrophila Salmonella V. cholerae
Hybrid red tilapia
Carcass rinse 10 24 10
Intestine 0 57 23
Meat 0 0 2
Liver and kidney 0 1 6
Cultivation water 5 106 34
Total 15 188 75

DNA preparation and polymerase chain reaction (PCR)

The DNA template was prepared using the whole cell boiling method (Lévesque et al., 1995). Briefly, the pure bacterial isolate was streaked onto nutrient agar (Difco, Franklin Lakes, NJ, USA) and incubated at 37 °C for 18–24 h. Then a single colony was harvested and transferred to an Eppendorf tube containing 150 µL of rNase-free water. The well-mixed suspension was heated for 10 min and immediately placed on ice. The suspension was centrifuged at 11,000 rpm for 5 min and the supernatant was used as a DNA template.

Bacterial confirmation

Bacterial confirmation was carried out for A. hydrophila, Salmonella, and V. cholerae using genus-specific and species-specific primers listed in Table 2. Confirmation of A. hydrophila was carried out by targeting genus-specific and species-specific primers (aer and ah), respectively. Salmonella isolates were confirmed by detection of the invasion gene (invA), which also served as the Salmonella virulence gene. The V. cholerae isolates were confirmed using a pair of species-specific primers (ompW) targeting the outer membrane protein. In addition, all V. cholerae isolates were serogrouped by slide-agglutination test with polyvalent V. cholerae O1, monoclonal V. cholerae O139, and monoclonal V. cholerae O141 from commercial antiserum (S&A reagents lab, Bangkok, Thailand).

Table 2. Primers used for bacterial confirmation, AMR genotype, resistance determinants, virulence genes, and QRDRs detection.

Gene Primer Oligonucleotide sequences (5′–3′) Amplicon size (bp) Reference
Genus/species confirmation
A. hydrophila
aer aer-F CTACTTTTGCCGGCGAGCGG 953 Ahmed et al. (2018)
aer-R TGATTCCCGAAGGCACTCCC
ah ah-F GAAAGGTTGATGCCTAATACGTA 625 Ahmed et al. (2018)
ah-R CGTGCTGGCAACAAAGGACAG
Salmonella
invA* invA-F GTGAAATTATCGCCACGTTCGGGCAA 284 Kumar, Datta & Lalitha (2015)
invA-R TCATCGCACCGTCAAAGGAACC
V. cholerae
ompW ompW-F CACCAAGAAGGTGACTTTATTGTG 588 Sathiyamurthy, Baskaran & Subbaraj (2013)
ompW-R GAACTTATAACCACCCGCG
Resistance genes
bla TEM blaTEM-F GCGGAACCCCTATTT 964 Hasman et al. (2005)
blaTEM-R TCTAAAGTATATATGAGTAAACTTGGTCTGAC
bla SHV blaSHV-F TTCGCCTGTGTATTATCTCCCTG 854 Hasman et al. (2005)
blaSHV-R TTAGCGTTGCCAGTGYTG
bla CTX−M blaCTX−M-F CGATGTGCAGTACCAGTAA 585 Batchelor et al. (2005)
blaCTX−M-R AGTGACCAGAATCAGCGG
bla NDM blaNDM-F GGTTTGGCGATCTGGTTTTC 621 Pungpian et al. (2021)
blaNDM-R CGGAATGGCTCATCACGATC
bla PSE blaPSE-F GCAAGTAGGGCAGGCAATCA 422 Chuanchuen et al. (2008)
blaPSE-R GAGCTAGATAGATGCTCACAA
bla OXA blaOXA-F ACACAATACATATCAACTTCGC 813 Costa et al. (2006)
blaOXA-R AGTGTGTGTTTAGAATGGTGATC
sul1 sul1-F CGGCGTGGGCTACCTGAACG 433 Khan et al. (2019)
sul1-R GCCGATCGCGTGAAGTTCCG
sul2 sul2-F CGGCATCGTCAACATAACCT 721 Khan et al. (2019)
sul2-R TGTGCGGATGAAGTCAGCTC
sul3 sul3-F CAACGGAAGTGGGCGTTGTGGA 244 Khan et al. (2019)
sul3-R GCTGCACCAATTCGCTGAACG
qnrA qnrA-F AGAGGATTTCTCACGCCAGG 580 Cattoir et al. (2007)
qnrA-R TGCCAGGCACAGATCTTGAC
qnrB qnrB-F GGMATHGAAATTCGCCACTG 264 Cattoir et al. (2007)
qnrB-R TTTGCYGYYCGCCAGTCGAAC
qnrS qnrS-F GCAAGTTCATTGAACAGGGT 428 Cattoir et al. (2007)
qnrS-R TCTAAACCGTCGAGTTCGGCG
ermB ermB-F AGACACCTCGTCTAACCTTCGCTC 640 Raissy et al. (2012)
ermB-R TCCATGTACTACCATGCCACAGG
dfrA1 dfrA1-F GGAGTGCCAAAGGTGAACAGC 367 Shahrani, Dehkordi & Momtaz (2014)
dfrA1-R GAGGCGAAGTCTTGGGTAAAAAC
dfrA12 dfrA12-F TTCGCAGACTCACTGAGGG 330 Chuanchuen et al. (2008)
dfrA12-R CGGTTGAGACAAGCTCGAAT
catA catA-F CCAGACCGTTCAGCTGGATA 454 Chuanchuen et al. (2008)
catA-R CATCAGCACCTTGTCGCCT
catB catB-F CGGATTCAGCCTGACCACC 461 Chuanchuen et al. (2008)
catB-R ATACGCGGTCACCTTCCTG
cmlA cmlA-F TGGACCGCTATCGGACCG 641 Chuanchuen et al. (2008)
cmlA-R CGCAAGACACTTGGGCTGC
strA strA-F TGGCAGGAGGAACAGGAGG 405 Chuanchuen et al. (2008)
strA-R AGGTCGATCAGACCCGTGC
strB strB-F GGCAGCATCAGCCTTATAATTT 470 Mala et al. (2017)
strB-R GTGGATCCGTCATTCATTGTT
tetA tetA-F GGCGGTCTTCTTCATCATGC 502 Khan et al. (2019)
tetA-R CGGCAGGCAGAGCAAGTAGA
tetB tetB-F CGCCCAGTGCTGTTGTTGTC 615 Khan et al. (2019)
tetB-R CGCGTTGAGAAGCTGAGGTG
tetD tetD-F AAACCATTACGGCATTCTGC 787 Kumai et al. (2005)
tetD-R GACCGGATACACCATCCATC
addA1 addA1-F CTCCGCAGTGGATGGCGG 631 Chuanchuen et al. (2008)
addA1-R GATCTGCGCGCGAGGCCA
addA2 addA2-F CATTGAGCGCCATCTGGAAT 500 Chuanchuen et al. (2008)
addA2-R ACATTTCHCTCATCGCCGGC
aac(3)IV aac(3)IV-F GTGTGCTGCTGGTCCACAGC 627 Stoll et al. (2012)
aac(3)IV-R AGTTGACCCAGGGCTGTCGC
aac(6′)-Ib aac(6′)-Ib-F TTGCGATGCTCTATGAGTGGCTA 482 Park et al. (2006)
aac(6′)-lb-R CTCGAATGCCTGGCGTGTTT
qepA qepA- F GCAGGTCCAGCAGCGGGTAG 199 Yamane et al. (2008)
qepA- R CTTCCTGCCCGAGTATCGTG
floR floR-F ATGGTGATGCTCGGCGTGGGCCA 800 Ying et al. (2019)
floR-R GCGCCGTTGGCGGTAACAGACACCGTGA
mcr-1 mcr-1-F AGTCCGTTTGTTCTTGTGGC 320 Rebelo et al. (2018)
mcr-1-R AGATCCTTGGTCTCGGCTTG
mcr-2 mcr-2-F CAAGTGTGTTGGTCGCAGTT 715 Rebelo et al. (2018)
mcr-2-R TCTAGCCCGACAAGCATACC
mcr-3 mcr-3-F AAATAAAAATTGTTCCGCTTATG 929 Rebelo et al. (2018)
mcr-3-R AATGGAGATCCCCGTTTTT
mcr-4 mcr-4-F TCACTTTCATCACTGCGTTG 1116 Rebelo et al. (2018)
mcr-4-R TTGGTCCATGACTACCAATG
mcr-5 mcr-5-F ATGCGGTTGTCTGCATTTATC 1644 Rebelo et al. (2018)
mcr-5-R TCATTGTGGTTGTCCTTTTCTG
Integrons and integrative and conjugative elements
int1 int1-F CCTGCACGGTTCGAATG 497 Kitiyodom et al. (2010)
int1-R TCGTTTGTTCGCCCAGC
int2 int2-F GGCAGACAGTTGCAAGACAA 247 Kitiyodom et al. (2010)
int2-R AAGCGATTTTCTGCGTGTTT
int3 int3-F CCGGTTCAGTCTTTCCTCAA 155 Kitiyodom et al. (2010)
int3-R GAGGCGTGTACTTGCCTCAT
int SXT intSXT-F GCTGGATAGGTTAAGGGCGG 592 Kitiyodom et al. (2010)
intSXT-R CTCTATGGGCACTGTCCACATTG
Virulence genes
A. hydrophila
aero aero-F CACAGCCAATATGTCGGTGAAG 326 Ahmed et al. (2018)
aero-R GTCACCTTCTCGCTCAGGC
hly hly-F CTATGAAAAAACTAAAAATAACTG 1500 Ahmed et al. (2018)
hly-R CAGTATAAGTGGGGAAATGGAAAG
V. cholerae
hlyA hlyA-F GGCAAACAGCGAAACAAATACC 481 Imani et al. (2013)
hlyA-R CTCAGCGGGCTAATACGGTTTA
ctx ctx-F CAGTCAGGTGGTCTTATGCCAAGAGG 167 Wong, You & Chen (2012)
ctx-R CCCACTAAGTGGGCACTTCTCAAACT
tcpA tcpA-F CACGATAAGAAAACCGGTCAAGAG 453 Singh, Isac & Colwell (2002)
tcpA-R CGAAAGCACCTTCTTTCACGTTG
QRDR
gyrA gyrA-F GCTGAAGAGCTCCTATCTGG 436 Chuanchuen & Padungtod (2009)
gyrA-R GGTCGGCATGACGTCCGG
parC parC-F GTACGTGATCATGGATCGTG 390 Chuanchuen & Padungtod (2009)
parC-R TTCCTGCATGGTGCCGTCG

Notes.

*

Virulence gene of Salmonella.

Antimicrobial susceptibility test

The agar dilution method was used to determine antimicrobial susceptibility to twelve antimicrobial agents, including ampicillin, chloramphenicol, ciprofloxacin, enrofloxacin, florfenicol, gentamicin, oxolinic acid, oxytetracycline, streptomycin, sulfamethoxazole, tetracycline, and trimethoprim according to the CLSI standard (CLSI, 2015). These antimicrobials were chosen from common antimicrobials used in human and aquatic medicine. The clinical breakpoints and epidemiological cutoff values of A. hydrophila, Salmonella, and V. cholerae were determined (CLSI, 2014; CLSI, 2015; CLSI, 2016; CLSI, 2020). Reference strains, including Staphylococcus aureus ATCC 29213, Escherichia coli ATCC 25922, and Pseudomonas aeruginosa ATCC 27853 were used for quality control.

Detection of ESBL production

The disc diffusion method was performed according to the CLSI guideline (CLSI, 2015). In the screening test, three disks of ceftazidime (30 µg), cefotaxime (30 µg), and cefpodoxime (10 µg) (Oxoid, Basingstoke, Hampshire, UK) were used to test antimicrobial susceptibility. Isolates that exhibited resistance to at least one of these cephalosporins were further confirmed using a combination disk diffusion method. Ceftazidime (30 µg), cefotaxime (30 µg), and these two disks combined with clavulanic acid were used. The difference in inhibition zone between single cephalosporin and cephalosporins containing clavulanic acid greater than five mm indicates positive ESBL-producing isolates.

AMR gene and virulence-encoded gene detection

All primers for resistance genes, their determinants, and virulence genes are listed in Table 2. Resistance genes were chosen to correspond with AMR phenotypes: blaTEM, blaSHV, blaCTX−M and blaPSE corresponding to β-lactam resistance and ESBL production; blaNDM and blaOXA corresponding to carbapenem resistance; catA, catB, floR and cmlA corresponding to phenicol resistance; ermB corresponding to erythromycin resistance; qnrA, qnrB, qnrS, aac(6′)-Ib, and qepA corresponding to quinolone resistance; aadA1, aadA2 and aac(3)IV corresponding to gentamicin resistance; tetA, tetB and tetD corresponding to tetracycline resistance; strA and strB corresponding to streptomycin resistance; sul1, sul2, and sul3 corresponding to sulfonamide resistance; dfrA1 and dfrA12 corresponding to trimethoprim resistance; mcr-1 to mcr-5 corresponding to colistin resistance. To confirm the existence of colistin-resistant genes (n = 3), sequence-positive mcr isolates from a previous study were used as reference strains (Pungpian et al., 2021). Integrons (int1, int2, and int3) and integrative and conjugative elements (SXT element; intSXT) were also detected. For the presence of virulence genes, isolates of A. hydrophila (aerolysin gene: aero; hemolysin gene: hly), Salmonella (invA: invasive gene) and V. cholerae (hemolysin gene: hlyA, cholera toxin: ctx, and co-regulated toxin: tcpA) were examined to determine their virulence factors.

The final volume (50 µL) of the PCR mixture was prepared according to the manufacturer’s instructions. A 5 µL of template DNA, 25 µL of TopTaq Master Mix (Qiagen, Hilden, Germany), 2 µL of each forward and reverse primer, 5 µL of coralLoad, and 11 µL of sterile rNase free water were used. PCR amplification was carried out on a Tpersonal combi model (Biometra, Göttingen, Germany). The PCR product was separated on 1.5% (w/v) agarose gel and stained with Redsafe™ nucleic acid staining solution (Intron Biotechnology, Seongnam, Republic of Korea). The results were photographed using the Omega Fluor™ gel documentation system (Aplegen, Pleasanton, CA, USA).

Determination of QRDR nucleotide sequences

Salmonella isolates (n = 11) were DNA sequenced for detection of the QRDRs. Two target sites at gyrA and parC were amplified by PCR using the primers listed in Table 2. Eight Salmonella isolates were randomly selected from the intestinal tract (n = 4), cultivation water (n = 2), carcass rinses (n = 2) based on the resistance gradient of ciprofloxacin, and susceptible isolates to ciprofloxacin (n = 3) were used as a negative control. The gyrA and parC were submitted for purification and nucleotide sequencing (Bionics Co., LTD., Gyeonggi-Do, Republic of Korea). The identity of amino acid sequences were analyzed using Molecular Evolutionary Genetic Analysis (MEGA) software version 11 (Tamura, Stecher & Kumar, 2021). Reference sequences (accession number NC_003197:2) from the GenBank database are available at the National Centre for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov).

Statistical analysis

Descriptive statistics were used to characterize the prevalence of AMR, MDR, virulence genes, integrons, SXT element, ESBL production, and QRDR mutations from A. hydrophila, Salmonella, and V. cholerae isolates. Logistic regression was used to determine the association between resistance and its determinants, virulence factors, and ESBL production (OR >1: positive association; OR <1: negative association). Two-sided hypothesis testing, with p < 0.05 were considered statistically significant. All statistical analyzes were performed with Stata version 14.0 (StataCorp, College Station, TX, USA).

Results

Phenotype and genotype of AMR and virulence genes of A. hydrophila

A. hydrophila was only detected in carcass rinses and cultivation water (Table 1). All isolates (n = 15) were resistant to ampicillin (Table 3), with four isolates (26.7%) resistant to oxytetracycline, tetracycline, and trimethoprim; three isolates (20.0%) were resistant to oxolinic acid. Resistance to at least one antimicrobial and MDR in A. hydrophila were 100% and 26.7%, respectively. Among the six AMR patterns, AMP alone (53.3%) was the most common pattern, with AMP-OTC-TET-TRI and AMP-OXO found in two isolates (13.3%) (Table 4). The most prevalent resistance gene found in A. hydrophila was mcr-3 (20.0%), followed by 13.3% of isolates having floR, qnrS, sul1, sul2, and dfrA1 (Table 3). The mcr-3 was only detected in fish carcass rinses, and only one isolate (6.7%) was positive for int1. The presence of aero and hly was observed in all isolates of A. hydrophila (100.0%) (Table 3).

Table 3. Phenotypic and genotypic resistance and virulence genes of A. hydrophila (n = 15) isolated from hybrid red tilapia carcass rinses and cultivation water.

Variable Resistance (%)
Carcass rinse (n = 10) Cultivation water (n = 5) Grand total (n = 15)
Antimicrobials
Ampicillin 10 (100.0) 5 (100.0) 15 (100.0)
Cefotaxime 0 (0) 0 (0) 0 (0)
Cefpodoxime 0 (0) 0 (0) 0 (0)
Ceftazidime 0 (0) 0 (0) 0 (0)
Chloramphenicol 0 (0) 0 (0) 0 (0)
Ciprofloxacin 0 (0) 0 (0) 0 (0)
Enrofloxacin 0 (0) 0 (0) 0 (0)
Florfenicol 0 (0) 0 (0) 0 (0)
Gentamicin 0 (0) 0 (0) 0 (0)
Oxolinic acid 3 (30.0) 0 (0) 3 (20.0)
Oxytetracycline 3 (30.0) 1 (20.0) 4 (26.7)
Streptomycin 0 (0) 0 (0) 0 (0)
Sulfamethoxazole 0 (0) 0 (0) 0 (0)
Tetracycline 3 (30.0) 1 (20.0) 4 (26.7)
Trimethoprim 3 (30.0) 1 (20.0) 4 (26.7)
MDR 3 (30.0) 1 (20.0) 4 (26.7)
AMR genes
floR 2 (20.0) 0 (0) 2 (13.3)
qnrS 2 (20.0) 0 (0) 2 (13.3)
sul1 2 (20.0) 0 (0) 2 (13.3)
sul2 2 (20.0) 0 (0) 2 (13.3)
dfrA1 2 (20.0) 0 (0) 2 (13.3)
mcr-3 3 (30.0) 0 (0) 3 (20.0)
Integrons
int1 1 (10.0) 0 (0) 1 (6.7)
Virulence genes
aero 10 (100.0) 5 (100.0) 15 (100.0)
hly 10 (100.0) 5 (100.0) 15 (100.0)

Notes.

The table presented for positive isolates, which were only detected in carcass rinses and cultivation water. Non-detected genes in A. hydrophila were: blaTEM, blaSHV, blaCTX−M, blaNDM, blaPSE, blaOXA, sul3, qnrA, qnrB, ermB, dfrA12, catA, catB, cmlA, strA, strB, tetA, tetB, tetD, addA1, addA2, aac(3)IV, aac(6′)-Ib, qepA, mcr-1, mcr-2, mcr-4, mcr-5, int2, int3, and intSXT.

Table 4. Resistance patterns of A. hydrophila isolated from hybrid red tilapia carcass rinses and cultivation water (n = 15).

AMR pattern Resistance (%)
Carcass rinses (n = 10) Cultivation water (n = 5) Grand total (n = 15)
AMP 4 (40.0) 4 (80.0) 8 (53.3)
AMP-OTC-TET-TRI 1 (10.0) 1 (20.0) 2 (13.3)
AMP-OTC-TRI 1 (10.0) 0 (0) 1 (6.7)
AMP-OTC-OXO-TET 1 (10.0) 0 (0) 1 (6.7)
AMP-OXO 2 (20.0) 0 (0) 2 (13.3)
AMP-TRI 1 (10.0) 0 (0) 1 (6.7)

Notes.

AMP
ampicillin
OTC
oxytetracycline
OXO
oxolinic acid
TET
tetracycline
TRI
trimethoprim

Phenotype and genotype of AMR, and virulence genes of Salmonella spp.

All Salmonella isolates (n = 188) were resistant to at least one antimicrobial (Table 5). There was a high prevalence of resistance to ampicillin (79.3%), oxolinic acid (75.5%), oxytetracycline (71.8%) and tetracycline (70.7%). All Salmonella isolates were sensitive to gentamicin (100%) and only two isolates (1.1%) were resistant to trimethoprim. More than 70% of Salmonella isolates exhibited MDR: of the 34 unique resistance patterns, the two most common were AMP-CHP-FFC-OTC-OXO-TET (20.7%) and AMP-CHP-ENR-FFC-OTC-OXO-TET (18.6%) (Table 6). Most Salmonella harbored qnrS (65.4%), followed by tetA (64.9%), blaTEM (63.8%), and floR (55.9%) (Table 5). None of the colistin resistance genes was observed in the Salmonella isolates. In general, cultivation water exhibited higher resistance levels than any other types of fish organ or tissue sample. Based on the type of fish sample, Salmonella isolated from the intestine had a higher prevalence of the AMR phenotype and genotype than the fish carcass rinses. The invA gene was detected in all Salmonella isolates.

Table 5. Phenotypic and genotypic resistance and virulence genes of Salmonella isolates (n = 188) from hybrid red tilapia and cultivation water.

Variable Resistance (%)
Carcass rinse (n = 24) Intestine (n = 57) Liver and kidney (n = 1) Cultivation water (n = 106) Grand total (n = 188)
Antimicrobials
Ampicillin 13 (54.2) 38 (66.7) 1 (100.0) 97 (91.5) 149 (79.3)
Cefotaxime 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Cefpodoxime 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Ceftazidime 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Chloramphenicol 11 (45.8) 28 (49.1) 1 (100.0) 78 (73.6) 118 (62.8)
Ciprofloxacin 3 (12.5) 14 (24.6) 0 (0) 23 (21.7) 40 (21.3)
Enrofloxacin 6 (25.0) 20 (35.1) 0 (0) 43 (40.6) 69 (36.7)
Florfenicol 12 (50.0) 22 (38.6) 1 (100.0) 69 (65.1) 104 (55.3)
Gentamicin 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Oxolinic acid 16 (66.7) 40 (70.2) 0 (0) 86 (81.1) 142 (75.5)
Oxytetracycline 13 (54.2) 34 (59.6) 0 (0) 88 (83.0) 135 (71.8)
Streptomycin 0 (0) 2 (3.5) 0 (0) 2 (1.9) 4 (2.1)
Sulfamethoxazole 0 (0) 1 (1.8) 0 (0) 3 (2.8) 4 (2.1)
Tetracycline 13 (54.2) 32 (56.1) 0 (0) 88 (83.0) 133 (70.7)
Trimethoprim 0 (0) 0 (0) 0 (0) 2 (1.9) 2 (1.1)
MDR 13 (54.2) 34 (59.6) 0 (0) 89 (84.0) 136 (72.3)
AMR genes
bla TEM 10 (41.7) 34 (59.6) 1 (100.0) 75 (70.8) 120 (63.8)
floR 10 (41.7) 24 (42.1) 0 (0) 71 (67.0) 105 (55.9)
qnrS 13 (54.2) 31 (54.4) 0 (0) 79 (74.5) 123 (65.4)
tetA 13 (54.2) 31 (54.4) 0 (0) 78 (73.6) 122 (64.9)
tetB 0 (0) 1 (1.8) 0 (0) 2 (1.9) 3 (1.6)
strA 0 (0) 1 (1.8) 0 (0) 2 (1.9) 3 (1.6)
sul1 0 (0) 0 (0) 0 (0) 2 (1.9) 2 (1.1)
sul2 0 (0) 1 (1.8) 0 (0) 2 (1.9) 3 (1.6)
Virulence genes
invA 24 (100.0) 57 (100.0) 1 (100.0) 106 (100.0) 188 (100.0)

Notes.

This table presented only positive isolates from various tilapia samples except fish muscle, which were negative for Salmonella. Non-detected genes in Salmonella were: blaSHV, blaCTX−M, blaNDM,blaPSE, blaOXA, sul3, qnrA, qnrB, ermB, dfrA1, dfrA12, catA, catB, cmlA, strB, tetD, addA1, addA2, aac(3)IV, aac(6′)-Ib, qepA, floR, mcr-1, mcr-2, mcr-3, mcr-4, mcr-5, int1, int2, int3, and intSXT.

Table 6. Resistance patterns of Salmonella isolates (n = 188) from hybrid red tilapia carcass rinses, intestine, liver and kidney, and cultivation water.

AMR pattern No of isolates (%)
Fish carcassrinse (n = 24) Intestine (n = 57) Liver andkidney (n = 1) Cultivation water (n = 106) Total (n = 188)
Susceptible 8 (33.3) 11 (19.3) 0 (0) 4 (3.8) 23 (12.2)
AMP-CHP-CIP-ENR-FFC-OTC-OXO-TET 1 (4.2) 2 (3.5) 0 (0) 1 (0.9) 4 (2.1)
AMP-CHP-CIP-ENR-OTC-OXO-TET 0 (0) 4 (7.0) 0 (0) 6 (5.7) 10 (5.3)
AMP-CHP-CIP-FFC-OTC-OXO-TET 0 (0) 0 (0) 0 (0) 3 (2.8) 3 (1.6)
AMP-CHP-CIP-OTC-OXO-TET 0 (0) 0 (0) 0 (0) 2 (1.9) 2 (1.1)
AMP-CHP-ENR-FFC-OTC-OXO-STR-TET 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-CHP-ENR-FFC-OTC-OXO-SMZ-TET 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
AMP-CHP-ENR-FFC-OTC-OXO-TET 5 (20.8) 5 (8.8) 0 (0) 25 (23.6) 35 (18.6)
AMP-CHP-FFC 0 (0) 3 (5.3) 1 (100.0) 8 (7.5) 12 (6.4)
AMP-CHP-FFC-OTC 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
AMP-CHP-FFC-OTC-OXO 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-CHP-FFC-OTC-OXO-TET 5 (20.8) 7 (12.3) 0 (0) 27 (25.5) 39 (20.7)
AMP-CHP-FFC-OXO-STR 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-CHP-FFC-TET 0 (0) 0 (0) 0 (0) 3 (2.8) 3 (1.6)
AMP-CHP-OTC-OXO-TET 0 (0) 1 (1.8) 0 (0) 1 (0.9) 2 (1.1)
AMP-CHP-OXO 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-CHP-OXO-TET 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-CIP-ENR-OTC-OXO-SMZ-TET 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-CIP-ENR-OTC-OXO-TET 0 (0) 6 (10.5) 0 (0) 8 (7.5) 14 (7.4)
AMP-CIP-ENR-OTC-OXO-TET-TRI 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
AMP-CIP-FFC-OTC-OXO-TET 1 (4.2) 0 (0) 0 (0) 0 (0) 1 (0.5)
AMP-CIP-OTC-OXO-TET 1 (4.2) 1 (1.8) 0 (0) 1 (0.9) 3 (1.6)
AMP-CIP-TET 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
AMP-ENR-OTC-OXO-TET 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-FFC-OTC-OXO-TET 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
AMP-OTC-OXO-SMZ-STR-TET 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
AMP-OTC-OXO-TET-TRI 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
AMP-OTC-SMZ-STR-TET 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
AMP-OTC-OXO-TET 0 (0) 0 (0) 0 (0) 5 (4.7) 5 (2.7)
AMP-OTC-TET 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
CHP-FFC 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
ENR-OTC-OXO 0 (0) 0 (0) 0 (0) 1 (0.9) 1 (0.5)
OTC 0 (0) 1 (1.8) 0 (0) 2 (1.9) 3 (1.6)
OTC-OXO 0 (0) 1 (1.8) 0 (0) 0 (0) 1 (0.5)
OXO 3 (12.5) 5 (8.8) 0 (0) 2 (1.9) 10 (5.3)

Notes.

This table presented only positive isolates from various tilapia samples except fish muscle, which were negative for Salmonella.

AMP
ampicillin
CHP
chloramphenicol
CIP
ciprofloxacin
ENR
enrofloxacin
FFC
florfenicol
OTC
oxytetracycline
OXO
oxolinic acid
STR
streptomycin
SMZ
sulfamethoxazole
TET
tetracycline
TRI
trimethoprim

Phenotype and genotype of AMR and virulence genes of V. cholerae

All V. cholerae isolates (n = 75) were non-agglutinating Vibrios (NAGs) with O1 and O139, and non-agglutination with O141. All V. cholerae isolates (100%) were susceptible to the 12 antimicrobials tested. The predominant AMR gene in V. cholerae was sul1 (12.0%) (Table 7). The genes catB, qnrS, tetA, tetB, strA, and dfrA1 were all present at a 4.0% prevalence. Colistin resistance genes, integrons, and SXT element were not found in any V. cholerae isolates in this study, in contrast, all isolates had detectable hlyA.

Table 7. Genotypic resistance and virulence genes of V. cholerae isolates (n = 75) of hybrid red tilapia and cultivation water.

Genotype Prevalence (%)
Fish carcassrinse (n = 10) Intestine (n = 23) Meat (n = 2) Liver andkidney (n = 6) Cultivation water (n = 34) Total (n = 75)
AMR genes
catB 1 (10.0) 0 (0) 0 (0) 0 (0) 2 (5.9) 3 (4.0)
qnrS 1 (10.0) 0 (0) 0 (0) 0 (0) 2 (5.9) 3 (4.0)
tetA 1 (10.0) 0 (0) 0 (0) 0 (0) 2 (5.9) 3 (4.0)
tetB 0 (0) 1 (4.3) 0 (0) 0 (0) 2 (5.9) 3 (4.0)
strA 0 (0) 1 (4.3) 0 (0) 0 (0) 2 (5.9) 3 (4.0)
sul1 1 (10.0) 0 (0) 0 (0) 0 (0) 8 (23.5) 9 (12.0)
dfrA1 1 (10.0) 0 (0) 0 (0) 0 (0) 2 (5.9) 3 (4.0)
Virulence genes
hlyA 10 (100.0) 23 (100.0) 2 (100.0) 6 (100.0) 34 (100.0) 75 (100.0)
ctx 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
tcpA 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)

Notes.

This table showed only positive isolates. Non-detected genes in V. cholerae were: blaTEM, blaSHV, blaCTX−M, blaNDM,blaPSE, blaOXA, sul2, sul3, qnrA, qnrB, ermB, dfrA12, catA, cmlA, strB, tetD, addA1, addA2, aac(3)IV, aac(6′)-Ib, qepA, floR, mcr-1, mcr-2, mcr-3, mcr-4, mcr-5, int1, int2, int3, and intSXT.

ESBL production in A. hydrophila, Salmonella, and V. cholerae

ESBL production was not detected in any of the bacterial strains from tilapia aquaculture or the fish tissues or organs (n = 278).

Association between phenotypic and genotypic AMR

Logistic regression analyses indicated there were statistically significant associations between phenotypic and genotypic resistance of tetracycline and the presence of tetA (O.R. = 259.0, CI [52.3–1283.6], p < 0.0001), sulfamethoxazole resistance and the presence of sul2 (O.R. = 90.3, CI [5.6–1455.1], p = 0.001), and streptomycin resistance and the presence of strA (O.R. = 273.0, CI [1.8–42,372.4], p = 0.029).

Mutation of QRDRs

Eight isolates from the 40 Salmonella isolates that were resistant to ciprofloxacin were randomly selected for sequence analysis and QRDR determination. The serovars of these eight isolates were Virchow (n = 1), Saintpaul (n = 5), Neukoelln (n = 1) and Chartes (n = 1) (Table 8). Six of the eight ciprofloxacin-resistant isolates had a point mutation in gyrA from C to A at position 248 (Ser83Tyr); the other two resistant isolates did not have gyrA mutations. The gyrA sequences from the eight Salmonella isolates have been deposited at GenBank under accession numbers OP831158–OP831165. All isolates carried qnrS without any mutations in the parC region.

Table 8. Mutations of gyrA in QRDRs in ciprofloxacin-resistant Salmonella isolates (n = 8).

Sample type Serovar ( n ) gyrA mutation PMQR MIC (µg/mL)
CIP ENR OXO
Carcass rinse Virchow (1) – qnrS 4 4 8
Saintpaul (1) C248A qnrS 4 2 16
Intestine Saintpaul (4) C248A qnrS 4–8 2–8 4–32
Cultivation water Neukoelln (1) – qnrS 4 2 4
Chartes (1) C248A qnrS >32 >64 >128

Notes.

CIP
ciprofloxacin
ENR
enrofloxacin
OXO
oxolinic acid

Discussion

AMR and virulence genes of A. hydrophila

The low prevalence of A. hydrophila observed in this study was consistent with previous work which found a low prevalence of 2.0% and 2.7% in the internal organs and fish muscle, respectively (Ahmed et al., 2018). This low prevalence is likely due to the samples being collected from clinically healthy hybrid red tilapia. Furthermore, fish liver is typically the main target organ for colonization by A. hydrophila; however, none of the liver samples in this study were positive for this bacterium (Algammal et al., 2020). In this study, all isolates (100%) were resistant to ampicillin, which was consistent with previous studies in tilapia and other aquatic animals due to their intrinsic resistance (El-ghareeb, Zahran & Abd-Elghany, 2019). More than a fourth of the A. hydrophila isolates (26.7%) were resistant to oxytetracycline, tetracycline, and trimethoprim, which was also consistent with previous studies (El-ghareeb, Zahran & Abd-Elghany, 2019; Yu et al., 2021). The wide range resistance of A. hydrophila observed in this study could result from these bacteria persisting in high concentrations of antimicrobials leading to up-regulation of the efflux pump and the production of antioxidative agents (Yu et al., 2021).

Oxytetracycline and oxolinic acid are broad-spectrum antimicrobials belonging to tetracyclines and fluoroquinolones, which have been approved for use in aquatic animals (OIE, 2018). These antimicrobials were the priority antibiotics in use when outbreaks occurred on the hybrid red tilapia farms enrolled in this study, possibly leading to widespread selection of resistant A. hydrophila. A previous study found that A. hydrophila can harbor various tet genes and transfer resistance to tetracycline to E. coli (Harnisz, Korzeniewska & Gołaś, 2015). Therefore, A. hydrophila might serve as an important reservoir of resistance to tetracycline in the aquatic environment. Regarding resistance in the A. hydrophila isolates, all isolates resistant to oxolinic acid were susceptible to both ciprofloxacin and enrofloxacin, although these antimicrobials were grouped in similar quinolone derivatives. Furthermore, a study of Aeromonas isolated from diseased hybrid red tilapia in Thailand also showed a difference in the resistant phenotype (Mursalim et al., 2022). The explanation for this discrimination could be that different generations conferred distinct antimicrobial potency (Sinwat et al., 2018; Pham, Ziora & Blaskovich, 2019). In detail, ciprofloxacin and enrofloxacin are second-generation quinolones, therefore, they have broader bactericidal activities against Gram-negative bacteria compared to oxolinic acid, which is a first-generation quinolone. To quantify the accurate antimicrobial susceptibility testing in bacteria isolated from aquatic animals, oxolinic acid should be taken into account as a mandatory antimicrobial test regardless of whether other quinolones were selected.

In Thailand, colistin has been banned in food-producing animals as a feed additive since 2017; however, therapeutic use of colistin is still being reported in pig farms (Olaitan et al., 2021; Rueanghiran et al., 2022) and may select for colistin-resistance in these livestock facilities. The dissemination of colistin-resistant enteric bacteria from livestock into the environment could accelerate the horizontal gene transfer of mobile genetic elements to autochthonous aquatic bacteria (Elbediwi et al., 2019). The resistance of colistin and mcr genes in Aeromonas was previously reported in healthy freshwater fish and cultivation water in China (Li et al., 2022). This study confirmed that colistin resistant A. hydrophila isolates already existed in hybrid red tilapia aquaculture. To our knowledge, this finding is the first report on the occurrence of mcr-3 in freshwater fish originating in Thailand. The mcr-3 had been previously detected in E. coli and Salmonella in pigs and pork (Pungpian et al., 2021), with the global spread of mcr-1, mcr-3 and mcr-4 is shown in Fig. 1.

Figure 1. Global distribution of colistin resistance genes in bacteria isolated from fish.

Figure 1

In this study, all A. hydrophila isolates contained aero and hly genes, which were more prevalent than a previous study of freshwater fish in Egypt (Ahmed et al., 2018). These virulence genes found in A. hydrophila were also reported in an outbreak of diarrheal patients in Brazil (Silva et al., 2017). These findings suggest that A. hydrophila isolated from hybrid red tilapia and cultivation water can be both resistant and pathogenic which elevates the public health and food safety risk from these bacteria.

AMR and virulence genes of Salmonella

Isolates of Salmonella from tilapia and cultivation water exhibited a high prevalence to ampicillin (79.3%), which may be due to part to intrinsic resistance to penicillins by Salmonella. In addition, amoxicillin has been approved for off-label use to treat streptococcosis in tilapia aquaculture by the Thai Food and Drug Administration (Baoprasertkul, Somsiri & Boonyawiwat, 2012). The extensive use of amoxicillin in Thai aquaculture can select for β-lactam-resistant bacteria that then colonize tilapia and the immediate aquaculture environment. This study also found high Salmonella resistance to oxolinic acid and oxytetracycline. The improper use of oxolinic acid and oxytetracycline can select for the development of AMR and MDR Salmonella. In particular, high resistance to chloramphenicol (62.8%) and florfenicol (55.3%) was observed, although antimicrobials in the amphenicol groups have not been approved for use in aquaculture in Thailand. Among this collection of isolates, resistance to gentamicin and trimethoprim were not observed which was similar to a previous study in Kenya (Wanja et al., 2020). Moreover, the high prevalence (>75%) of MDR Salmonella isolates is consistent with previous studies in freshwater fish (Saharan, Verma & Singh, 2020; Gawish et al., 2021).

Regarding genotypic AMR, the predominant resistance genes were qnrS (65.4%) which was similar in tilapia and catfish in Egypt (Algammal et al., 2022), and tetA (64.9%) and floR (55.9%) which was also observed in a previous study on farmed fish in Brazil (Ferreira et al., 2021). These phenotypic and genotypic AMR findings indicate a likelihood of transmission of AMR Salmonella by consumption of contaminated fish products.

AMR and virulence genes of V. cholerae

Human infection with V. cholerae is a major public concern because this bacterium is a causative agent of cholera, a severe fatal diarrhea caused by the cholera toxin. Serogroups O1 and O139 have been widely reported in cholera outbreaks with high mortality in humans worldwide. On the contrary, serogroup O141 caused sporadic outbreaks of cholera-like diarrhea (Elimian et al., 2019). All V. cholerae isolates found in this study belonged to non-O1/O139 and non-O141 serogroups, which is consistent with a low prevalence of these serogroups in fish and aquatic environments and in contrast to their high prevalence in human cases (Halpern & Izhaki, 2017; Schwartz et al., 2019). However, the infection of indigenous non-O1/O139 and non-O141 V. cholerae originating from aquaculture products can cause watery-to-severe diarrhea in humans due to other virulence factors (Vezzulli et al., 2020).

Among the V. cholerae isolates in this study, none of them was phenotypically resistant to antimicrobials. This finding is consistent with a previous study that found a low prevalence of AMR in non-cholera environmental strains (Bier et al., 2015). In contrast, a study in China found that over half of V. cholerae (57.6%) isolated from freshwater fish (n = 370) were MDR to streptomycin, ampicillin, and rifampin (Fu et al., 2020). Therefore, it is postulated that resistance to non-used antimicrobials in aquaculture may result from the distribution of AMR bacteria from the anthropogenic sources that then contaminate the aquaculture environment. For example, wastewater and effluent from human communities could be an important contributor to AMR in aquaculture. The most prevalent AMR genotype of V. cholerae in this study was sul1 (12.0%), which encoded resistance to sulfamethoxazole. This finding could be problematic for human clinical treatment options because sulfamethoxazole is a drug of choice for the treatment of cholera (Leibovici-Weissman et al., 2014). In particular, a recent report showed that V. parahaemolyticus isolated from shrimp in China contained the mcr-1 gene (Lei et al., 2019). These findings highlight the need to monitor these bacteria in aquaculture for the emergence of colistin-resistant genes, especially in non-Enterobacterale.

Among the virulence genes examined in this study, hlyA, ctx, and tcpA, the hlyA genes were the most prevalent (100.0%), which was consistent with a previous study regarding V. cholerae isolated from fish, shellfish, and environmental samples (Shan et al., 2022). The hlyA encoding pore-forming toxin can cause cytotoxicity and cell vacuolation of intestinal cells leading to fluid leakage (Ramamurthy et al., 2020). The common prevalence of the hlyA gene was reported in clinical or epidemic strains of V. cholerae isolates, indicating its likely role in the pathogenesis of many cases of V. cholerae (Imani et al., 2013). No strains carrying ctx or tcpA were detected among V. cholerae isolates in this study. The ctx gene that encodes cholera enterotoxin leads to massive secretion of electrolytes and water into the intestinal lumen leading to severe fluid loss, while the tcpA gene acts as a promotor of pilus formation inducing bacterial colonization in the host’s intestine (Ramamurthy et al., 2020). This indicated that the V. cholerae in this study were not cholera-causing strains; nonetheless, human infection with these V. cholerae strains can pose a risk of diarrhea due to the presence of hlyA.

ESBL production in A. hydrophila, Salmonella, and V. cholerae

In this study, no ESBL-producing pathogenic bacteria were detected in hybrid red tilapia and cultivation water. However, the increasing prevalence of ESBL-producing bacteria has been reported in environmental water, livestock animals and humans in Thailand (Runcharoen et al., 2017; Lay et al., 2020). The finding of ESBL-producing bacteria in aquaculture environments was speculated to be due to bacterial contamination of natural water resources used for aquatic animal cultivation. Several studies have reported that ESBL-producing bacteria are presented in many aquatic animals, such as tilapia, catfish, and shrimp (Hon et al., 2016; Gawish et al., 2021). Importantly, bacteria harboring ESBL genes can co-select other plasmid-mediated AMR, such as sulfamethoxazole/trimethoprim, quinolones, and colistin, which are critically important antimicrobials. Infection of these co-resistant bacteria can hamper disease treatment due to the limitation of available therapeutic options, resulting in longer hospital stays and increased antibiotic costs. The surveillance of ESBL-producing bacteria in hybrid red tilapia helps monitor and quantify the possible novel risk of ESBL transmission through consumption of cultured tilapia.

Association between phenotypic and genotypic AMR

In general, tetA was the predominant genotypic resistance observed in Salmonella and V. cholerae isolates. This gene can confer high phenotypic resistance to tetracycline, which was consistent with the statistical association between phenotypic and genotypic resistance to tetracycline based on the logistic regression analyses in this study. Oxytetracycline is a common antimicrobial used in tilapia farms in Thailand due to its effective treatment of aeromoniasis and francisellosis, which are endemic in Thailand (Baoprasertkul, Somsiri & Boonyawiwat, 2012). Previous study also observed a high prevalence of tetA in freshwater fish and water, and other tet genes, such as tetL, tetO, and tetW were also previously reported in aquaculture (Harnisz, Korzeniewska & Gołaś, 2015). The statistical association between resistance to sulfamethoxazole and the presence of sul2, and streptomycin and the presence of strA indicated that phenotypic resistance is strongly associated with the presence of the corresponding resistance genes. Other pairs of AMR phenotype-genotype did not observe statistical association. This may be due to non-examined genes or other mechanisms conferred to those resistance.

Mutation of QRDRs

Of eight ciprofloxacin resistant Salmonella, only a single-point mutation in gyrA (Ser83Tyr) was observed in six isolates. In Salmonella, mutations in gyrA of QRDRs are a substantial mechanism of resistance to quinolones, while parC mutations are rare (Shaheen et al., 2021). The amino acid change in gyrA was reported in Salmonella isolated from chicken, pork, and clinical isolates of humans (Sinwat et al., 2018). This study was in agreement with the frequent identification of gyrA mutations in environmental Enterobacterale in the aquatic environment, including Salmonella (Johnning et al., 2015). The qnrS, which is the PMQR gene presented in all isolates, can mediate low resistance to quinolone and enhance resistance mediated by gyrA mutations. Higher MICs were mostly observed in mutant isolates. However, three isolates were resistant to ciprofloxacin and oxolinic acid, but susceptible to enrofloxacin (Table 8). The inconsistency of resistance to quinolone has previously reported and is still not conclusive (Sinwat et al., 2018). Two ciprofloxacin-resistant Salmonella isolates were not mutants in the gyrA and parC regions. Other genes that confer resistance to quinolones, including aac(6′)-Ib, the aminoglycoside acetyltransferase variant gene, and qepA, the plasmid-mediated nonspecific efflux pump gene, were absent from these eight ciprofloxacin-resistant Salmonella. These results imply that the mutations in gyrA and qnrS expression were pivotal factors driving resistance in Salmonella. The common use of quinolones in both animals and humans can promote horizontal gene transfer and the acquisition of quinolone-resistance genes between these two sectors through environment links. Mechanisms of quinolone resistance in Salmonella need to be further investigated. The rational use of common antimicrobials and rigorous antimicrobial stewardship for both animal and human therapeutic intervention can delay the spread of AMR. Increasing AMR monitoring and developing AMR control strategies in aquaculture to overcome adverse consequences of AMR should be initiated immediately.

Conclusions

Findings from this study on AMR bacteria in hybrid red tilapia suggest that aquaculture as practiced in Thailand can select for ubiquitous AMR pathogens, mobile genetic elements, and an emerging reservoir of mcr and colistin-resistant bacteria. Resistant and pathogenic bacteria, such as resistance to ampicillin and tetracycline, or MDR Salmonella circulating in aquaculture together highlight the public health concerns and foodborne risks of zoonotic pathogens to humans from cultured freshwater fish. The main sources of AMR bacteria should be evaluated to better understand of their circulation between aquaculture and their production environment. Good personal hygiene, occupational safeguards, and farm biosecurity are highly recommended to reduce AMR bacterial contamination of freshwater fish. The surveillance and monitoring of AMR in aquaculture under One Health, and improved antimicrobial stewardship for farmers, should be promoted to better control AMR in tropical aquaculture.

Supplemental Information

Supplemental Information 1. Raw data.
DOI: 10.7717/peerj.14896/supp-1
Supplemental Information 2. Sequencing data.
DOI: 10.7717/peerj.14896/supp-2

Acknowledgments

The authors thank Sutida Chalee and Saran Anuntawirun for field collection and laboratory assistance.

Funding Statement

This study was funded by the University of California, Davis, USA (A19-4577-S001), and the 90th anniversary of Chulalongkorn University fund (Ratchadaphiseksomphot Endowment Fund). Varangkana Thaotumpitak is a recipient of the Royal Golden Jubilee Ph.D. program, which was supported by the National Research Council of Thailand (NRCT5-RGJ63001-017). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Additional Information and Declarations

Competing Interests

The authors declare there are no competing interests.

Author Contributions

Varangkana Thaotumpitak performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Jarukorn Sripradite performed the experiments, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Edward R. Atwill conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Saharuetai Jeamsripong conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

DNA Deposition

The following information was supplied regarding the deposition of DNA sequences:

The sequences of gyrA are available at GenBank: OP831158 to OP831165.

Data Availability

The following information was supplied regarding data availability:

The raw data and sequencing data are available in the Supplementary Files.

References

  • Ahmed et al. (2018).Ahmed HA, Mohamed MEM, Rezk MM, Gharieb RMA, Abdel-Maksoud SA. Aeromonas hydrophila in fish and humans; prevalence, virulotyping and antimicrobial resistance. Slovenian Veterinary Research. 2018;55:113–124. doi: 10.26873/Svr-636-2018. [DOI] [Google Scholar]
  • Akinyemi, Ajoseh & Fakorede (2021).Akinyemi KO, Ajoseh SO, Fakorede CO. A systemic review of literatures on human Salmonella enterica serovars in Nigeria (1999-2018) The Journal of Infection in Developing Countries. 2021;15(9):1222–1235. doi: 10.3855/jidc.12186. [DOI] [PubMed] [Google Scholar]
  • Algammal et al. (2022).Algammal AM, Mabrok M, Ezzat M, Alfifi KJ, Esawy AM, Elmasry N, El-Tarabili RM. Prevalence, antimicrobial resistance (AMR) pattern, virulence determinant and AMR genes of emerging multi-drug resistant Edwardsiella tarda in Nile tilapia and African catfish. Aquaculture. 2022;548:737643. doi: 10.1016/j.aquaculture.2021.737643. [DOI] [Google Scholar]
  • Algammal et al. (2020).Algammal AM, Mohamed MF, Tawfiek BA, Hozzein WN, El Kazzaz WM, Mabrok M. Molecular typing, antibiogram and PCR-RFLP based detection of Aeromonas hydrophila complex isolated from Oreochromis niloticus. Pathogens. 2020;9(3):238. doi: 10.3390/pathogens9030238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Baoprasertkul, Somsiri & Boonyawiwat (2012).Baoprasertkul P, Somsiri T, Boonyawiwat V. Bonded-Reantaso MG, Arthur JR, Subasinghe RP, editors. Use of veterinary medicines in Thai aquaculture: current status. Rome: FAO Fisheries and Aquaculture Technical paper No. 547 Improving biosecurity through prudent and responsible use of veterinary medicines in aquatic food production. 2012:83–89.
  • Batchelor et al. (2005).Batchelor M, Hopkins K, Threlfall EJ, Clifton-Hadley FA, Stallwood AD, Davies RH, Liebana E. blaCTX−M genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003. Antimicrobial Agents and Chemotherapy. 2005;49(4):1319–1322. doi: 10.1128/AAC.49.4.1319-1322.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Bier et al. (2015).Bier N, Schwartz K, Guerra B, Strauch E. Survey on antimicrobial resistance patterns in Vibrio vulnificus and Vibrio cholerae non-O1/non-O139 in Germany reveals carbapenemase-producing Vibrio cholerae in coastal waters. Frontiers in Microbiology. 2015;6:1179. doi: 10.3389/fmicb.2015.01179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Bollache et al. (2019).Bollache L, Bardet E, Depret G, Motreuil S, Neuwirth C, Moreau J, Hartmann A. Dissemination of CTX-M-producing Escherichia coli in freshwater fishes from a French watershed (Burgundy) Frontiers in Microbiology. 2019;9:3239. doi: 10.3389/fmicb.2018.03239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Cattoir et al. (2007).Cattoir V, Poirel L, Rotimi V, Soussy CJ, Nordmann P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. Journal of Antimicrobial Chemotherapy. 2007;60(2):394–397. doi: 10.1093/jac/dkm204. [DOI] [PubMed] [Google Scholar]
  • Chuanchuen & Padungtod (2009).Chuanchuen R, Padungtod P. Antimicrobial resistance genes in Salmonella enterica isolates from poultry and swine in Thailand. Journal of Veterinary Medical Science. 2009;71(10):1349–1355. doi: 10.1292/jvms.001349. [DOI] [PubMed] [Google Scholar]
  • Chuanchuen et al. (2008).Chuanchuen R, Pathanasophon P, Khemtong S, Wannaprasat W, Padungtod P. Susceptibilities to antimicrobials and disinfectants in Salmonella isolates obtained from poultry and swine in Thailand. Journal of Veterinary Medical Science. 2008;70(6):595–601. doi: 10.1292/jvms.70.595. [DOI] [PubMed] [Google Scholar]
  • CLSI (2014).CLSI . CLSI document VET03/VET04-S2. Wayne, PA: Clinical and Laboratory Standards Institute; 2014. Performance standards for antimicrobial susceptibility testing of bacteria isolated from aquatic animals. [Google Scholar]
  • CLSI (2015).CLSI . CLSI standard VET01-S3 (Third Edition) Wayne, PA: Clinical and Laboratory Standards Institute; 2015. Performance standards for antimicrobial disk and dilution susceptibility test for bacteria isolated from animals. [Google Scholar]
  • CLSI (2016).CLSI . CLSI guideline M45 (Third Edition) Wayne, PA: Clinical and Laboratory Standards Institute; 2016. Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria. [Google Scholar]
  • CLSI (2020).CLSI . CLSI supplement VET04 (Third Edition) Wayne, PA: Clinical and Laboratory Standards Institute; 2020. Performance standards for antimicrobial susceptibility testing for bacteria isolated from aquatic animals. [Google Scholar]
  • Costa et al. (2006).Costa D, Poeta P, Sáenz Y, Vinué L, Rojo-Bezares B, Jouini A, Zarazaga M, Rodrigues J, Torres C. Detection of Escherichia coli harbouring extended-spectrum β-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal. Journal of Antimicrobial Chemotherapy. 2006;58(6):1311–1312. doi: 10.1093/jac/dkl415. [DOI] [PubMed] [Google Scholar]
  • El-ghareeb, Zahran & Abd-Elghany (2019).El-ghareeb HM, Zahran E, Abd-Elghany SM. Occurrence, molecular characterization and antimicrobial resistance of pathogenic Aeromonas hydrophila from retail fish. Alexandria Journal for Veterinary Sciences. 2019;62(1):172–181. doi: 10.5455/ajvs.49297. [DOI] [Google Scholar]
  • Elbediwi et al. (2019).Elbediwi M, Li Y, Paudyal N, Pan H, Li X, Xie S, Rajkovic A, Feng Y, Fang W, Rankin SC, Yue M. Global burden of colistin-resistant bacteria: mobilized colistin resistance genes study (1980–2018) Microorganisms. 2019;7(10):461. doi: 10.3390/microorganisms7100461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Elimian et al. (2019).Elimian KO, Musah A, Mezue S, Oyebanji O, Yennan S, Jinadu A, Williams N, Ogunleye A, Fall IS, Yao M, Eteng WE, Abok P, Popoola M, Chukwuji M, Omar LH, Ekeng E, Balde T, Mamadu I, Adeyemo A, Namara G, Okudo I, Alemu W, Peter C, Ihekweazu C. Descriptive epidemiology of cholera outbreak in Nigeria, January-November, 2018: implications for the global roadmap strategy. BMC Public Health. 2019;19(1):1–11. doi: 10.1186/s12889-019-7559-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • FAO (2020).FAO https://doi.org/10.4060/ca9229en The State of World Fisheries and Aquaculture 2020. Sustainability in action. Rome. 2020
  • Ferreira et al. (2021).Ferreira ACADO, Pavelquesi SLS, Monteiro EDS, Rodrigues LFS, Silva CMDS, Silva ICRD, Orsi DC. Prevalence and antimicrobial resistance of Salmonella spp. in aquacultured Nile tilapia (Oreochromis niloticus) commercialized in federal district, Brazil. Foodborne Pathogens and Diseases. 2021;18(11):778–783. doi: 10.1089/fpd.2021.0010. [DOI] [PubMed] [Google Scholar]
  • Fu et al. (2020).Fu H, Yu P, Liang W, Kan B, Peng X, Chen L. Virulence, resistance, and genomic fingerprint traits of Vibrio cholerae isolated from 12 species of aquatic products in Shanghai, China. Microbial Drug Resistance. 2020;26(12):1526–1539. doi: 10.1089/mdr.2020.0269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Gawish et al. (2021).Gawish MF, Ahmed AM, Torky HA, Shimamoto T. Prevalence of extended-spectrum β-lactamase (ESBL)-producing Salmonella enterica from retail fishes in Egypt: a major threat to public health. International Journal of Food Microbiology. 2021;351:109268. doi: 10.1016/j.ijfoodmicro.2021.109268. [DOI] [PubMed] [Google Scholar]
  • Halpern & Izhaki (2017).Halpern M, Izhaki I. Fish as hosts of Vibrio cholerae. Frontiers in Microbiology. 2017;8:282. doi: 10.3389/fmicb.2017.00282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Harnisz, Korzeniewska & Gołaś (2015).Harnisz M, Korzeniewska E, Gołaś I. The impact of a freshwater fish farm on the community of tetracycline-resistant bacteria and the structure of tetracycline resistance genes in river water. Chemosphere. 2015;128:134–141. doi: 10.1016/j.chemosphere.2015.01.035. [DOI] [PubMed] [Google Scholar]
  • Hasman et al. (2005).Hasman H, Mevius D, Veldman K, Olesen I, Aarestrup FM. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. Journal of Antimicrobial Chemotherapy. 2005;56(1):115–121. doi: 10.1093/jac/dki190. [DOI] [PubMed] [Google Scholar]
  • Hon et al. (2016).Hon NTN, Hoa TTT, Thinh NQ, Hinenoya A, Nakayama T, Harada K, Asayama M, Warisaya M, Hirata K, Phuong NT, Yamamoto Y. Spread of antibiotic and antimicrobial susceptibility of ESBL-producing Escherichia coli isolated from wild and cultured fish in the Mekong Delta, Vietnam. Fish Pathology. 2016;51:S75–S82. doi: 10.3147/jsfp.51.S75. [DOI] [Google Scholar]
  • Imani et al. (2013).Imani FA, Iman ID, Hosseini DR, Karami A, Marashi SM. Design of a multiplex PCR method for detection of toxigenic-pathogenic in Vibrio cholerae. Asian Pacific Journal of Tropical Medicine. 2013;6(2):115–118. doi: 10.1016/S1995-7645(13)60005-X. [DOI] [PubMed] [Google Scholar]
  • Johnning et al. (2015).Johnning A, Kristiansson E, Fick J, Weijdegård B, Larsson DJ. Resistance mutations in gyrA and parC are common in Escherichia communities of both fluoroquinolone-polluted and uncontaminated aquatic environments. Frontiers in Microbiology. 2015;6:1355. doi: 10.3389/fmicb.2015.01355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Khan et al. (2019).Khan SB, Khan MA, Ahmad I, Rehman T, Ullah S, Dad R, Sultan A, Memon AM. Phentotypic, gentotypic antimicrobial resistance and pathogenicity of Salmonella enterica serovars Typimurium and Enteriditis in poultry and poultry products. Microbial Pathogenesis. 2019;129:118–124. doi: 10.1016/j.micpath.2019.01.046. [DOI] [PubMed] [Google Scholar]
  • Kitiyodom et al. (2010).Kitiyodom S, Khemtong S, Wongtavatchai J, Chuanchuen R. Characterization of antibiotic resistance in Vibrio spp. isolated from farmed marine shrimps (Penaeus monodon) FEMS Microbiology Ecology. 2010;72(2):219–227. doi: 10.1111/j.1574-6941.2010.00846.x. [DOI] [PubMed] [Google Scholar]
  • Kumai et al. (2005).Kumai Y, Suzuki Y, Tanaka Y, Shima K, Bhadra RK, Yamasaki S, Kuroda K, Endo G. Characterization of multidrug-resistance phenotypes and genotypes of Escherichia coli strains isolated from swine from an abattoir in Osaka, Japan. Epidemiology & Infection. 2005;133(1):59–70. doi: 10.1017/S0950268804003280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kumar, Datta & Lalitha (2015).Kumar R, Datta TK, Lalitha KV. Salmonella grows vigorously on seafood and expresses its virulence and stress genes at different temperature exposure. BMC Microbiology. 2015;15(1):1–10. doi: 10.1186/s12866-015-0579-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lay et al. (2020).Lay KK, Torio HE, Bitrus AA, Mala W, Nuananong S, Chuanchuen R. Multidrug resistant Escherichia coli harboring extended-spectrum β-lactamase-encoding genes isolated from clinically-healthy pigs. The Thai Journal of Veterinary Medicine. 2020;51:303–310. doi: 10.20944/preprints202009.0494.v1. [DOI] [Google Scholar]
  • Lee & Yoon (2021).Lee H, Yoon Y. Etiological agents implicated in foodborne illness world wide. Food Science of Animal Resources. 2021;41(1):1–7. doi: 10.5851/kosfa.2020.e75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lei et al. (2019).Lei T, Zhang J, Jiang F, He M, Zeng H, Chen M, Wu S, Wang J, Ding Y, Wu Q. First detection of the plasmid-mediated colistin resistance gene, mcr-1 in virulent Vibrio parahaemolyticus. International Journal of Food Microbiology. 2019;308:108290. doi: 10.1016/j.ijfoodmicro.2019.108290. [DOI] [PubMed] [Google Scholar]
  • Leibovici-Weissman et al. (2014).Leibovici-Weissman YA, Neuberger A, Bitterman R, Sinclair D, Salam MA, Paul M. Antimicrobial drugs for treating cholera. Cochrane Database of Systematic Reviews. 2014;6:CD008625. doi: 10.1002/14651858.CD008625.pub2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lévesque et al. (1995).Lévesque C, Piché L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrobial Agents and Chemotherapy. 1995;39(1):185–191. doi: 10.1128/AAC.39.1.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li et al. (2022).Li L, Yao R, Olsen RH, Zhang Y, Meng H. Antibiotic resistance and polymyxin B resistance mechanism of Aeromonas spp. isolated from yellow catfish, hybrid snakeheads and associated water from intensive fish farms in Southern China. LWT-Food Science Technology. 2022;166:113802. doi: 10.1016/j.lwt.2022.113802. [DOI] [Google Scholar]
  • Liu et al. (2020).Liu D, Song H, Ke Y, Xia J, Shen Y, Ou Y, Hao Y, He J, Li X, Zhou Y, Fu J, Wang Y, Lv Z, Wu C. Co-existence of two novel phosphoethanolamine transferase gene variants in Aeromonas jandaei from retail fish. International Journal of Antimicrobial Agents. 2020;55(1):105856. doi: 10.1016/j.ijantimicag.2019.11.013. [DOI] [PubMed] [Google Scholar]
  • Liu, Whitehouse & Li (2018).Liu H, Whitehouse CA, Li B. Presence and persistence of Salmonella in water: the impact on microbial quality of water and food safety. Frontiers in Public Health. 2018;6:159. doi: 10.3389/fpubh.2018.00159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Luo, Wang & Xiao (2020).Luo Q, Wang Y, Xiao Y. Prevalence and transmission of mobilized colistin resistance (mcr) gene in bacteria common to animals and humans. Biosafety and Health. 2020;2(2):71–78. doi: 10.1016/j.bsheal.2020.05.001. [DOI] [Google Scholar]
  • Lv et al. (2022).Lv Z, Shen Y, Liu W, Ye H, Liu D, Liu J, Fu Y, Peng C, Chen K, Deng X, Liu B, He J, Yang L, Xu C, Cai C, Wang Y, Ke Y, Shen J. Prevalence and risk factors of mcr-1-positive volunteers after colistin banning as animal growth promoter in China: a community-based case control study. Clinical Microbiology and Infection. 2022;28(2):267–272. doi: 10.1016/j.cmi.2021.06.033. [DOI] [PubMed] [Google Scholar]
  • Mala et al. (2017).Mala W, Faksri K, Samerpitak K, Yordpratum U, Kaewkes W, Tattawasart U, Chomvarin C. Antimicrobial resistance and genetic diversity of the SXT element in Vibrio cholerae from clinical and environmental water samples in northeastern Thailand. Infection, Genetics and Evolution. 2017;52:89–95. doi: 10.1016/j.meegid.2017.04.013. [DOI] [PubMed] [Google Scholar]
  • Mursalim et al. (2022).Mursalim MF, Budiyansah H, Raharjo HM, Debnath PP, Sakulworakan R, Chokmangmeepisarn P, Yindee J, Piasomboon P, Elayaraja S, Rodkhum C. Diversity and antimicrobial susceptibility profiles of Aeromonas spp. isolated from diseased freshwater fishes in Thailand. Journal of Fish Diseases. 2022;45:1149–1163. doi: 10.1111/jfd.13650. [DOI] [PubMed] [Google Scholar]
  • Nicholson et al. (2020).Nicholson P, Mon-on N, Jaemwimol P, Tattiyapong P, Surachetpong W. Coinfection of tilapia lake virus and Aeromonas hydrophila synergistically increased mortality and worsened the disease severity in tilapia (Oreochromis spp.) Aquaculture. 2020;520:734746. doi: 10.1016/j.aquaculture.2019.734746. [DOI] [Google Scholar]
  • OIE (2018).OIE OIE List of antimicrobials of veterinary importance. 2018. https://www.woah.org/app/uploads/2021/03/a-oie-list-antimicrobials-may2018.pdf. [1 October 2022]. https://www.woah.org/app/uploads/2021/03/a-oie-list-antimicrobials-may2018.pdf
  • Olaitan et al. (2021).Olaitan AO, Dandachi I, Baron SA, Daoud Z, Morand S, Rolain JM. Banning colistin in feed additives: a small step in the right direction. The Lancet Infectious Diseases. 2021;21(1):29–30. doi: 10.1016/S1473-3099(20)30915-4. [DOI] [PubMed] [Google Scholar]
  • Park et al. (2006).Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United States of aac (6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrobial Agents and Chemotherapy. 2006;50(11):3953–3955. doi: 10.1128/AAC.00915-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Pham, Ziora & Blaskovich (2019).Pham TD, Ziora ZM, Blaskovich MA. Quinolone antibiotics. MedChemComm. 2019;10:1719–1739. doi: 10.1039/C9MD00120D. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Pungpian et al. (2021).Pungpian C, Lee S, Trongjit S, Sinwat N, Angkititrakul S, Prathan R, Srisanga S, Chuanchuen R. Colistin resistance and plasmid-mediated mcr genes in Escherichia coli and Salmonella isolated from pigs, pig carcass and pork in Thailand, Lao PDR and Cambodia border provinces. Journal of Veterinary Science. 2021;22:1–15. doi: 10.4142/jvs.2021.22.e68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Raissy et al. (2012).Raissy M, Moumeni M, Ansari M, Rahimi E. Antibiotic resistance pattern of some Vibrio strains isolated from seafood. Iranian Journal of Fisheries Science. 2012;11:618–626. [Google Scholar]
  • Ramamurthy et al. (2020).Ramamurthy T, Nandy RK, Mukhopadhyay AK, Dutta S, Mutreja A, Okamoto K, Miyoshi SI, Nair GB, Ghosh A. Virulence regulation and innate host response in the pathogenicity of Vibrio cholerae. Frontiers in Cellular and Infection Microbiology. 2020;10:572096. doi: 10.3389/fcimb.2020.572096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Rebelo et al. (2018).Rebelo AR, Bortolaia V, Kjeldgaard JS, Pedersen SK, Leekitcharoenphon P, Hansen IM, Guerra B, Malorny B, Borowiak M, Hammerl JA, Battisti A, Franco A, Alba P, Perrin-Guyomard A, Granier SA, De Frutos Escobar C, Malhotra-Kumar S, Villa L, Carattoli A, Hendriksen RS. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance. 2018;23(6):17-00672. doi: 10.2807/1560-7917.ES.2018.23.6.17-00672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Rueanghiran et al. (2022).Rueanghiran C, Dawanpa A, Pinneum N, Sanguankiat A, Chiemchaisri C, Chiemchaisri W, Sritumpawa W, Kijpreedaborisuthi O, Jeon B, Tulayakul P. Environmental risk quotient of the antibiotic, phenotypic, and genotypic profiles for antibiotic resistance of Escherichia coli collected from manure and wastewater at swine farms in Prachinburi Province, Thailand. Emerging Contaminants. 2022;8:340–350. doi: 10.1016/j.emcon.2022.07.003. [DOI] [Google Scholar]
  • Runcharoen et al. (2017).Runcharoen C, Raven KE, Reuter S, Kallonen T, Paksanont S, Thammachote J, Anun S, Blane B, Parkhill J, Peacock SJ, Chantratita N. Whole genome sequencing of ESBL-producing Escherichia coli isolated from patients, farm waste and canals in Thailand. Genome Medicine. 2017;9(1):1–11. doi: 10.1186/s13073-017-0471-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Saharan, Verma & Singh (2020).Saharan VV, Verma P, Singh AP. High prevalence of antimicrobial resistance in Escherichia coli, Salmonella spp. and Staphylococcus aureus isolated from fish samples in India. Aquaculture Research. 2020;51(3):1200–1210. doi: 10.1111/are.14471. [DOI] [Google Scholar]
  • Sathiyamurthy, Baskaran & Subbaraj (2013).Sathiyamurthy K, Baskaran A, Subbaraj DK. Prevalence of Vibrio cholerae and other vibrios from environmental and seafood sources, Tamil Nadu, India. British Microbiology Research Journal. 2013;3(4):538–549. doi: 10.9734/bmrj/2013/480510.9734/BMRJ. [DOI] [Google Scholar]
  • Schwartz et al. (2019).Schwartz K, Hammerl JA, Göllner C, Strauch E. Environmental and clinical strains of Vibrio cholerae non-O1, non-O139 from Germany possess similar virulence gene profiles. Frontiers in Microbiology. 2019;10:733. doi: 10.3389/fmicb.2019.00733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Shaheen et al. (2021).Shaheen A, Tariq A, Iqbal M, Mirza O, Haque A, Walz T, Rahman M. Mutational diversity in the quinolone resistance-determining regions of type-II topoisomerases of Salmonella serovars. Antibiotics. 2021;10(12):1455. doi: 10.3390/antibiotics10121455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Shahrani, Dehkordi & Momtaz (2014).Shahrani M, Dehkordi FS, Momtaz H. Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran. Biological Research. 2014;47(1):1–13. doi: 10.1186/0717-6287-47-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Shan et al. (2022).Shan X, Fu J, Li X, Peng X, Chen L. Comparative proteomics and secretomics revealed virulence, and coresistance-related factors in non O1/O139 Vibrio cholerae recovered from 16 species of consumable aquatic animals. Journal of Proteomics. 2022;251:104408. doi: 10.1016/j.jprot.2021.104408. [DOI] [PubMed] [Google Scholar]
  • Silva et al. (2017).Silva LCAD, Leal-Balbino TC, Melo BSTD, Mendes-Marques CL, Rezende AM, Almeida AMPD, Leal NC. Genetic diversity and virulence potential of clinical and environmental Aeromonas spp. isolates from a diarrhea outbreak. BMC Microbiology. 2017;17(1):1–9. doi: 10.1186/s12866-017-1089-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Singh, Isac & Colwell (2002).Singh DV, Isac SR, Colwell R. Development of a hexaplex PCR assay for rapid detection of virulence and regulatory genes in Vibrio cholerae and Vibrio mimicus. Journal of Clinical Microbiology. 2002;40(11):4321–4324. doi: 10.1128/JCM.40.11.4321-4324.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Sinwat et al. (2018).Sinwat N, Poungseree J, Angkittitrakul S, Chuanchuen R. Mutations in QRDRs of DNA gyrase and topoisomerase IV genes in nalidixic acid and ciprofloxacin-resistant Salmonella enterica isolated from chicken meat, pork and humans. The Thai Journal of Veterinary Medicine. 2018;48:79–84. [Google Scholar]
  • Stoll et al. (2012).Stoll C, Sidhu JP, Tiehm A, Toze S. Prevalence of clinically relevant antibiotic resistance genes in surface water samples collected from Germany and Australia. Environmental Science & Technology. 2012;46(17):9716–9726. doi: 10.1021/es302020s. [DOI] [PubMed] [Google Scholar]
  • Tamura, Stecher & Kumar (2021).Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Molecular Biology and Evolution. 2021;38(7):3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Thaotumpitak et al. (2022).Thaotumpitak V, Sripradite J, Atwill ER, Tepaamorndech S, Jeamsripong S. Bacterial pathogens and factors associated with Salmonella contamination in hybrid red tilapia (Oreochromis spp.) cultivated in a cage culture system. Food Quality and Safety. 2022;6:fyac036. doi: 10.1093/fqsafe/fyac036. [DOI] [Google Scholar]
  • Vezzulli et al. (2020).Vezzulli L, Baker-Austin C, Kirschner A, Pruzzo C, Martinez-Urtaza J. Global emergence of environmental non-O1/O139 Vibrio cholerae infections linked with climate change: a neglected research field? Environmental Microbiology. 2020;22(10):4342–4355. doi: 10.1111/1462-2920.15040. [DOI] [PubMed] [Google Scholar]
  • Wanja et al. (2020).Wanja DW, Mbuthia PG, Waruiru RM, Bebora LC, Ngowi HA, Nyaga PN. Antibiotic and disinfectant susceptibility patterns of bacteria isolated from farmed fish in Kirinyaga county, Kenya. International Journal of Microbiology. 2020;2020:8897338. doi: 10.1155/2020/8897338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wong, You & Chen (2012).Wong HC, You WY, Chen SY. Detection of toxigenic Vibrio cholerae, V. parahaemolyticus and V. vulnificus in oyster by multiplex-PCR with internal amplification control. Journal of Food and Drug Analysis. 2012;20(1):48–58. [Google Scholar]
  • Yamane et al. (2008).Yamane K, Wachino JI, Suzuki S, Arakawa Y. Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrobial Agents and Chemotherapy. 2008;52(4):1564–1566. doi: 10.1128/AAC.01137-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Ying et al. (2019).Ying Y, Wu F, Wu C, Jiang Y, Yin M, Zhou W, Zhu X, Cheng C, Zhu L, Li K, Lu J, Xu T, Bao Q. Florfenicol resistance in Enterobacteriaceae and whole-genome sequence analysis of florfenicol-resistant Leclercia adecarboxylata strain R25. International Journal of Genomics. 2019;2019:9828504. doi: 10.1155/2019/9828504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yu et al. (2021).Yu J, Ramanathan S, Chen L, Zeng F, Li X, Zhao Y, Lin L, Monaghan SJ, Lin X, Pang H. Comparative transcriptomic analysis reveals the molecular mechanisms related to oxytetracycline-resistance in strains of Aeromonas hydrophila. Aquaculture Reports. 2021;21:100812. doi: 10.1016/j.aqrep.2021.100812. [DOI] [Google Scholar]
  • Zhang et al. (2019).Zhang P, Wang J, Wang X, Bai X, Ma J, Dang R, Xiong Y, Fanning S, Yang Z. Characterization of five Escherichia coli isolates co-expressing ESBL and mcr-1 resistance mechanisms from different origins in China. Frontiers in Microbiology. 2019;10:1994. doi: 10.3389/fmicb.2019.0199. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Information 1. Raw data.
DOI: 10.7717/peerj.14896/supp-1
Supplemental Information 2. Sequencing data.
DOI: 10.7717/peerj.14896/supp-2

Data Availability Statement

The following information was supplied regarding data availability:

The raw data and sequencing data are available in the Supplementary Files.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES