Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jun 1.
Published in final edited form as: Ann Neurol. 2012 Feb 24;71(6):797–804. doi: 10.1002/ana.23545

Synergistic effects of CNS-directed gene therapy and bone marrow transplantation in the murine model of infantile neuronal ceroid lipofuscinosis

Shannon L Macauley 1,†, Marie S Roberts 1,†, Andrew M Wong 2, Francesca McSloy 2, Adarsh S Reddy 1, Jonathan D Cooper 2, Mark S Sands 1,3,*
PMCID: PMC3369009  NIHMSID: NIHMS353711  PMID: 22368049

Abstract

Objective

Infantile neuronal ceroid lipofusciniosis (INCL) is an inherited childhood neurodegenerative disorder caused by the loss of palmitoyl protein thioesterase-1 (PPT1) activity. Affected children suffer from blindness, epilepsy, motor dysfunction, cognitive decline, and premature death. The Ppt1−/− mouse shares the histological and clinical features of INCL. Previous single-therapy approaches using small molecule drugs, gene therapy, or neuronal stem cells resulted in partial histological correction, with minimal improvements in motor function or lifespan. Here, we combined CNS-directed AAV2/5-mediated gene therapy with bone marrow transplantation (BMT) in the INCL mouse.

Methods

At birth, Ppt1−/− and WT mice were given either intracranial injections of AAV2/5-PPT1 or bone marrow transplantation, separately as well as in combination. To assess function, we measured monthly rotorod performance monthly as well as lifespan. At terminal timepoints, we evaluated the therapeutic effects on several INCL specific parameters, such as cortical thickness, autofluorescent accumulation, and glial activation. Finally, we determined levels of PPT1 enzyme activity and bone marrow engraftment in treated mice.

Results

AAV2/5-mediated gene therapy alone resulted in significant histological correction, improved motor function, and increased life span. Interestingly, the addition of BMT further increased the lifespan of treated mice and led to dramatic, sustained improvements in motor function. These data are truly striking given the fact that BMT alone is ineffective yet it synergizes with CNS-directed gene therapy to dramatically increase efficacy and lifespan.

Interpretation

AAV2/5-mediated gene therapy in combination with BMT provides an unprecedented increase in lifespan as well as dramatic improvement on functional and histological parameters.

Introduction

Infantile neuronal ceroid lipofuscinosis (INCL, Infantile Batten disease) is an inherited, neurodegenerative disease caused by a deficiency in the lysosomal enzyme, palmitoyl protein thioesterase-1 (PPT1)1. INCL is characterized by autofluorescent storage material accumulation in the CNS, brain atrophy, cortical thinning, neuronal loss, and glial activation. The clinical features include vision loss, intractable seizures, motor deficits, and shortened lifespan. The PPT1-deficient (Ppt1−/−) mouse model shares most of the pathological and clinical features of the human disease2–6.

Currently, gene-, stem cell-, and small molecule-based therapies are in preclinical development for the treatment of INCL4, 7–9. Thus far, these approaches have provided some biochemical and histological improvements. However, the behavioral improvements were transient and modest, and the maximum reported increase in lifespan was approximately two weeks.

Three independent clinical studies were initiated using either human CNS-derived stem cells (huCNS-SCs), the PPT1 mimetic, Cystagon, or allogeneic bone marrow transplantation (BMT) for the treatment of INCL. Although all therapies were considered safe, a second clinical trial using huCNS-SCs was suspended9, and neither Cystagon (ClinicalTrials.gov Identifier: NCT00028262) nor BMT10 provided any long-term benefits.

Given the complex clinical presentation of INCL, the involvement of multiple organ systems11, and the limitations of individual therapies, we hypothesized that a combination therapy approach would be more efficacious. Therefore, we coupled intracranial AAV2/5-PPT1 with BMT in newborn Ppt1−/−mice. We saw biochemical and histological improvements, dramatically increased lifespan, and sustained improvement in motor function in the combination-treated group. These results demonstrate an unprecedented increase in efficacy in Ppt1−/− mice and help shape future treatment strategies for INCL.

Materials and Methods

Ppt1−/− and Wildtype Mice

Ppt1−/− mice were created as previously described 3, 12. Wildtype or Ppt1 deficient mice were generated at Washington University School of Medicine. Male and female mice were used in this study. Animals were housed under a 12:12 hour light:dark cycle and were provided food and water ad libitum. All procedures were carried out under an approved IACUC protocol from Washington University School of Medicine.

Lifespan

Both treated Ppt1−/− mice and untreated controls (n=6–14 per group) were used to assess longevity. The end of life was signaled by death or a predetermined moribund condition. Kaplan-Meier analysis was used to measure cumulative survival and determine significant differences (p<0.05) in lifespan.

Recombinant AAV Production

The rAAV2/5-PPT1 vector used in these studies was produced as previously described13. Briefly, the vector contained a chicken β-actin promoter, cytomegalovirus enhancer, rabbit β-globin ployadenylation signal, cDNA for human PPT1, and flanking inverted terminal repeats (ITRs) from AAV2 and was packaged using the AAV5 capsid protein. Vector titer was 5 × 1011 vector genomes, as determined by Dot blot assay.

Therapeutic approach

The therapeutic groups in this study included: 1) untreated Ppt1−/− mice, 2) untreated WT, 3) AAV2/5-PPT1 only in Ppt1−/−, 4) BMT only in Ppt1−/− mice, and 5) AAV2/5-PPT1 in combination with BMT in Ppt1−/− mice.

On post-natal day 1, rAAV2/5-PPT1 was intracranially injected into 6 sites within the Ppt1−/− brain using a Hamilton syringe and 30 gauge needle. Two μl of virus (1×1011vg/ml) was bilaterally injected into the anterior cortex (1mm rostral to bregma, 2mm medial/lateral of midline, and 2mm ventral to the skull’s surface), hippocampus/thalamus (3.5mm rostral to bregma, 2mm medial/lateral of midline, and 2mm ventral), and cerebellum (1mm rostral to lamda, 1mm medial/lateral of midline, and 2mm ventral).

On post-natal day 2, BMT was performed as previously described14. Newborn mice were given a myeloreductive dose (400 rads) of gamma-radiation from a 137Cs source followed by 106 unfractionated GFP-positive bone marrow derived cells (100μl) via a temporal vein injection15. The GFP-positive cells were isolated from congenic C57Bl/6 mice and were sex matched with recipient mice.

Biochemical Analysis

PPT1 assays were performed on homogenates from the left hemisphere as previously described 3. The values were normalized to total protein measured. One-way ANOVA followed by Tukey’s multiple comparison tests was used to determined statistical significance.

Engraftment

Levels of bone marrow engraftment were determined as previously described14. The percentage of cells fluorescing in Fl1 channel (GFP) was determined by flow cytometry. Cell Quest (BD biosciences, San Jose, CA) software was used for acquiring data and FloJo (Tree Star, Inc., Ashland, OR) software was used to analyze the data. Statistical differences were calculated using Student’s T test.

Quantitative PCR analysis

Copy number of AAV-encoded human PPT1 cDNA in liver samples was determined using real-time quantitative PCR as previously described3. Briefly, genomic DNA was isolated from the livers of WT mice and Ppt1−/− deficient mice treated with AAV+BMT or AAV only using Qiagen’s Puregene Core Kit A. The human PPT1 cDNA was quantified in each sample using the forward primer 5’GACCCTGTAGATTCGGAGTGGTT3’, reverse primer 5’GAGGTCTCCTGTAAGGGAATGGT3’ and Fam-Zen labeled Black hole quenched internal probe 5’TTTACAGAAGTGGCCAAGCCAAGGA3’ from Integrated DNA Technologies and 2X Taqman Universal PCR Mastermix from Applied Biosystems, Inc. following manufacturer’s protocol. Total genomic copy number was determined using the commercially available Rodent GAPDHkit (Applied Biosystems, Inc). PCR reactions were run simultaneously with both primer sets in duplicate using an ABI Prism 7700. Cycle number used for the calculations was in the middle if the linear range of the fluorescent curves.

Histological methods

Mouse brains were histologically processed, Nissl stained and immunostained as previously described 2. Both astroctye and microglial activation was visualized using the following antibodies, rabbit anti-GFAP antibody (1:4000, Dako); rat anti-mouse CD68 antibody (1:100, AbD Serotec), respectively. Cortical thickness and glial activation were measured as previously described 2 and statistical significance was determined using a one-way ANOVA and Newman-Keuls post-hoc tests. Autofluorescent storage material was quantified from images captured using a 405nm laser and a 63× objective on a Leica SP5 confocal microscope as adapted from Griffey et al. (2004) (2). Statistical analysis was calculated using a one-way ANOVA and Bonferroni multiple comparison test.

Rotarod Testing

Treated mice and untreated controls (n=6–14 mice per group) were tested on the constant speed rotarod every 4 weeks beginning at 6 mo. At each age, mice received three test sessions where each session included a pretest trial on a stationary rod, followed by two test trials. The rod rotated unidirectionally at 3rpms for 60s. One-way ANOVAs at each time point followed by Tukey’s multiple comparision tests were used for statistical analysis.

Results

Functional improvements in the combination-therapy mice

The median lifespan of untreated Ppt1−/− mice was approximately 35.5 weeks, or 8.9 months, of age (Figure 1A). Bone marrow transplantation provided no increase in lifespan. In contrast, AAV2/5-mediated gene therapy alone significantly improved the lifespan of treated mice (median lifespan = 54 weeks or 13.5 months; p<0.0001). Remarkably, the AAV2/5+BMT mice lived 5 mo. longer than mice treated with AAV2/5 alone, with a median lifespan of 74 weeks, or 18.5 months of age.

Figure 1.

Figure 1

Open in a new tab

(A) Lifespan of treated Ppt1−/− mice. The median lifespan of the AAV2/5+BMT group (n=10) was significantly increased to more than double the median lifespan of the BMT only (n=5) and untreated Ppt1−/− mice (n=10). AAV2/5 treatment also significantly increased the median lifespan (n=11). (B) Motor function using the constant speed rotarod paradigm. At 6 months, Ppt1−/− mice (n=10) performed poorly on the rotarod. The BMT-only performed worse than untreated controls (n=5; ω = p<0.001). By 10 months, AAV2/5 performance declined (n=15) and was significantly decreased compared to AAV2/5+BMT (n=10) or WT mice (n=15; γ = p<0.01). The AAV2/5+BMT group was indistinguishable from WT until 13 months (ψ = p<0.001). Error bars reflect standard error of the mean (±SEM).

The combination therapy group also displayed a dramatic improvement in motor function (Figure 1B). At 6 months, the untreated Ppt1−/− mice had significant motor deficits (p<0.001) when compared to AAV2/5+BMT, AAV2/5-only mice, and WT controls. The BMT-only group demonstrated a further reduction in performance (p<0.001), with an average latency to fall of 25.4s compared to 48.4s in untreated Ppt1−/− mice. This suggests that BMT is not simply ineffective but is harmful. In contrast, animals treated with AAV2/5 only or AAV2/5+BMT were indistinguishable from WT mice until approximately 10 mo. of age (note: all of the untreated and BMT-treated animals were dead by 10 mo. of age). At this time, Ppt−/− mice treated with AAV2/5 began to display significant (p<0.01) motor deficits whereas mice treated with AAV2/5+BMT were still indistinguishable from normal. At 13 mo. of age, the performance of the AAV2/5+BMT group began to deteriorate significantly (p<0.001). However, at approximately 17 mo. the AAV2/5+BMT mice were still able to stay on the rod for the same amount of time as the 6-month-old BMT-only group. This improvement in motor function in the AAV2/5-BMT mice is particularly striking given that BMT has a negative impact on motor function.

Histological improvements seen in the combination-therapy group

Significant histopathological improvements were seen in mice treated with AAV2/5 (12 mo) and AAV2/5+BMT (18 mo). The thickness of the motor cortex (M1) in AAV2/5 (12 mo) and AAV2/5+BMT (18 mo) mice was significantly greater than that of terminal (8 mo) untreated Ppt1−/− mice (Figure 2A&B; p<0.05). Bone marrow transplantation did not significantly increase cortical thickness compared to untreated Ppt1−/− mice. The accumulation of autofluorescent storage material observed in untreated Ppt1−/− brains at 8 months was diminished in both the AAV2/5− (12 mo) and AAV2/5+BMT-treated (18 mo) mice (Figure 2C&D). In both therapy groups, the resulting autofluorescent load was not significantly different from WT animals.

Figure 2.

Figure 2

Open in a new tab

Brain pathology. (A) Images of cortical thinning in primary motor (M1) cortex at terminal time points. (B) There was a significant decrease in M1 thickness in both BMT (n=2) and untreated Ppt1−/− mice (n=4), while AAV2/5 (n=4) or AAV2/5+BMT (n=3) displayed significantly less atrophy compared to these groups. (C) Images of autofluorescent accumulation in the S1BF cortex. (D) There was a significant increase in storage burden in both the untreated Ppt1−/−and BMT brains. Conversely, treatment with either AAV2/5 or AAV2/5+BMT decreased storage material such that these treated groups were indistinguishable from WT (n=4). (E) Changes in CD68+ immunostaining at terminal time points. (F) There was a significant increase in CD68+ staining in the S1BF cortex of untreated Ppt1−/− and BMT-treated mice. Following treatment with AAV2/5, either alone or in combination with BMT, there was a significant decrease in CD68 staining with levels comparable to WT brains. The morphology of individual CD68+ cells (insets) in the AAV2/5 or AAV2/5+BMT mice more closely resembled WT cells. (G) Alterations in GFAP immunoreactivity in the S1BF cortex. (H) There was a significant increase in GFAP staining in untreated Ppt1−/− and BMT brains. There appeared to be less GFAP staining in the S1BF cortex in mice treated with either AAV2/5 or AAV2/5-BMT; however, this did not reach statistical significance. Error bars reflect standard error of the mean (±SEM). (* = p<0.05; ** = p<0.01; *** = p<0.001; white scale bar = 50μm; black scale bar = 20μm)

Another major component of INCL is neuroinflammation2, 5, 6. There was a progressive increase in astrocyte activation (GFAP upregulation), followed by microglial reactivity (CD68 upregulation) in Ppt1−/− mice (Figure 2E&G). Treatment with AAV2/5 or AAV2/5+BMT significantly (p<0.001) decreased CD68 staining in S1BF at 12 mo. and 18 mo., respectively (Figure 2E&F; p<0.001). Compared to other treatment groups the morphology of CD68+ cells was markedly different in AAV2/5− or AAV2/5+BMT-treated mutants (Figure 2E; insets). CD68+ cells in the untreated Ppt1−/− and BMT brains were large, spheroid, and darkly stained. In contrast, CD68+ cells from AAV2/5− or AAV2/5+BMT-treated mice resembled those present in WT mice; smaller, less intensely stained, with numerous branched processes.

We also investigated the impact of therapy on astrocyte activation and found similar effects in AAV2/5− and AAV2/5+BMT-treated mice, which displayed lower levels of GFAP immunoreactivity. In these treatment groups, astrocytes displayed many thin, palely stained processes with a small cell body compared to the intensely stained and hypertrophied astrocytes seen in untreated and BMT-treated Ppt1−/− mice (Figure G&H). The reduction in CD68+ microglia/macrophages and GFAP+ astrocytes suggest that AAV2/5 and AAV2/5+BMT reduce inflammation in the INCL brain.

Disparate biochemical improvements in the AAV2/5+BMT and AAV2/5-only groups

To determine whether there was any biochemical improvement in the treated mice, both engraftment levels and PPT1 activity were investigated. The engraftment levels in the AAV2/5+BMT and BMT-treated mice were comparable, with a low level of engraftment at approximately 14% (Figure 3A). Both the brains and livers of treated and untreated mice were assayed for PPT1 activity. While no PPT1 activity was detectable in the brains of BMT or untreated Ppt1−/−mice, AAV2/5-treated mice had 1.5-fold higher enzyme activity than WT littermates (Figure 3B). Interestingly, AAV2/5+BMT mice displayed a 6-fold increase in PPT1 activity compared to WT brains. Similarly, the enzyme activity in the livers of the AAV2/5+BMT mice was 1.5-fold higher than WT controls, while the AAV2/5 mice had 25% WT activity (Figure 3C).

Figure 3.

Figure 3

Open in a new tab

(A) Comparable levels of bone marrow engraftment were achieved in the BMT (n=5) and AAV2/5+BMT (n=7) groups. (B) PPT1 assays performed on the brains from treated and untreated mice demonstrated a 1.5-fold increase in PPT1 activity in the CNS of AAV2/5-treated (n=5) mice when compared to WT (n=4) mice. The AAV2/5+BMT (n=7) group had a 6-fold increase compared to WT. No PPT1 activity was detected in BMT (n=2) or Ppt1−/− (n=4) brains. (C) Although AAV2/5-treated mice had an increase in liver PPT1 activity compared to Ppt1−/− mice, it was only 25% of WT levels. Conversely, AAV2/5+BMT mice had liver activity 1.5-fold higher than WT mice. (D) qPCR analysis investigating the relative copy number of AAV-PPT1 genomes in AAV2/5− (n=4) and AAV2/5+BMT− (n=8) treated mice. Four out of five AAV2/5-only treated mice had undetectable levels of AAV-PPT1 genome within their livers (level of detection = 0.00005). In comparison, all eight of the AAV2/5-BMT-treated livers had detectable levels of viral genomes. There was a ~3.4-fold increase in the ratio of vector genomes/diploid genomes within the AAV2/5-BMT mice (range=0.001–0.04) compared to AAV2/5-only mice (range=0.0–0.019). Error bars reflect standard error of the mean (±SEM). (* = p<0.05; ** = p<0.01)

To investigate a possible mechanism for the differing levels of PPT1 activity in the AAV2/5- versus AAV2/5+BMT-treated mice, we performed quantitative PCR (qPCR) to determine the relative number of AAV-PPT1 vector genomes in mouse livers following treatment (Figure 3D). In the AAV2/5-treated mice, 4 out of 5 mice had undetectable levels of AAV-PPT1 genome in the liver. Comparatively, all 8 of the AAV2/5-BMT-treated livers had detectable levels of viral genomes, ranging from .001–.04 vector genomes/diploid genomes. Thus, there was a 3.4-fold increase in the vector copy number of the AAV2/5+BMT group compared to AAV2/5 only mice. This is consistent with the 1.5- to 6- fold higher enzyme levels found in the livers and brains, respectively, of AAV2/5+BMT-treated mice compared to AAV2/5 only.

Discussion

This study used intracranial delivery of AAV2/5-mediated gene therapy in combination with bone marrow transplantation at birth to maximize therapeutic benefit in a mouse model of INCL. To date, preclinical studies in the murine model of INCL using either gene-, small molecule- or stem cell- therapies alone have resulted in only modest histological and biochemical improvements, little or no impact upon behavioral function, and no increase in lifespan. However, due to the experimental design, Tamaki et al. (2009) were unable to determine the effects on lifespan following neuronal stem cell transplantation. The one exception is a recent report of a small molecule drug, resveratrol, which resulted in a minimal increase in the median lifespan of approximately 2 weeks in the Ppt1−/− mice 16. Compared to previous gene therapy studies using AAV2 3, 4, 8, our data shows that AAV2/5 alone provides significant biochemical, histological and clinical benefit. This improvement in efficacy is not surprising, given that AAV vectors pseudotyped with the AAV5 capsid protein distribute more widely throughout the neuraxis and result in much higher levels of expression 17, 18.

Surprisingly, we show that BMT greatly enhanced the therapeutic effects of CNS-directed gene therapy. This is particularly noteworthy in light of the fact that BMT alone does not supply any detectable enzyme activity or improve any other measure of disease. In fact, BMT was found to negatively affect motor function. The histological and immunohistochemical improvements observed in the AAV2/5− and combination-treated Ppt1−/− mice are particularly impressive when taking into account their advanced age. The AAV2/5 and AAV2/5+BMT mice were analyzed at 12 and 18 mo., respectively, whereas the BMT-treated and untreated Ppt1−/− mice were approximately 8 mo. of age. Furthermore, by several measures (i.e. autofluorescence accumulation and microglial activation), the AAV2/5 and AAV2/5+BMT therapies were not significantly different from WT. It is important to note that although the levels of histological improvement in the AAV2/5 and AAV2/5+BMT appear similar, histological evaluation in the AAV2/5+BMT occurred at 18 mo. old mice, approximately 6 mo. after the analysis occurred in the AAV2/5-treated mice at a terminal timepoint.

Although a similar example of synergy between AAV2/5 and BMT was observed in the murine model of GLD, it is known that BMT alone provides significant therapeutic benefit for that disease19. In this study, it might be expected that BMT would provide essentially no additional benefit to the CNS-directed AAV-mediated gene therapy, given that BMT resulted in little or no meaningful improvements in children with INCL10. Consistent with this prediction, a recent study in the murine model of MPS IIIB, a lysosomal storage disease that is largely unresponsive to BMT, showed little or no added benefit when CNS-directed, AAV2/5-mediated gene therapy was combined with BMT20. Therefore, it is truly striking that such dramatic effects can be obtained by combining two disparate therapies in INCL, especially when one provides no benefit either pre-clinically or clinically.

We believe the explanation for this dramatic synergy is two-fold. First, we believe that the increased level of PPT1 activity in the AAV2/5+BMT mice contributes to the increased efficacy. In all likelihood, this increased enzyme activity is due to the 3.4-fold increase in AAV-PPT1 vector genomes found in the AAV2/5+BMT mice compared to AAV2/5 alone. Previous experiments showed that genotoxic agents increase AAV transduction by increasing vector copy number in vitro 21, 22. Therefore, the conditioning radiation associated with BMT is likely responsible for the increase in vector genomes. Furthermore, we believe that the increased PPT1 activity in both the CNS and viscera contributed to the enhanced efficacy in the AAV+BMT group. Although INCL is considered a neurodegenerative disease, it is now known that there is significant systemic pathology11 and supplying more enzyme systemically could dramatically increase efficacy. In fact, we hypothesize that teaming intracranial gene therapy with BMT and both intrathecal and systemic delivery of gene therapy might provide further improvement on histological, biochemical, and functional parameters. Although AAV2/5+BMT was therapeutic, the mice still succumb to the disease. However, the disease presentation was different from untreated INCL mice. The older AAV2/5+BMT-treated mice appeared more ataxic suggesting that they may have developed a peripheral neuropathy. Therefore, we hypothesize that improved targeting of both the peripheral nervous system and visceral organs would result in a more curative therapy.

The second explanation for the enhanced efficacy and dramatic synergy observed in the AAV2/5+BMT group is sustained immunomodulation mediated by the BMT. Decreases in both microglia/macrophage activation and astrocytosis have been reported in the murine model of globoid-cell leukodystrophy (GLD) when BMT is added to CNS-directed AAV2/5-mediated gene therapy 14, 19. This decrease in neuroinflammation was believed to be partly or wholly responsible for the synergy observed in that study. Such immunomodulatory effects and enhanced efficacy when BMT is added to CNS-directed gene therapy may be greatest in lysosomal storage diseases where pronounced neuroinflammation occurs. As previously mentioned, there was little or no benefit to adding BMT to CNS-directed AAV2/5-mediated gene therapy in the murine model of mucopolysaccharidosis IIIB (MPSIIIB)20, which displays much lower levels of neuroinflammation 23, compared to either INCL 2, 5, 6 or GLD19. The neuroinflammatory component of INCL has largely been underappreciated and this therapeutic strategy may effectively target this manifestation of INCL.

Although these data are encouraging, seven out of nine AAV+BMT-treated Ppt1−/− mice, ranging in age from 13 to 19 mo., had liver tumors upon gross examination. This is consistent with several long-term mouse studies showing an increase in tumorigenesis following treatment with AAV-based vectors 24–28. None of the INCL animals that received AAV only had detectable liver lesions. This is consistent with the previous studies showing that the hepatocellular carcinoma associated with AAV treatment did not appear before 12 months of age. Although liver tumors have been observed in several studies where an AAV vector was delivered to neonatal animals, two recent reports failed to show a significant increase in tumorigenesis in long-term studies following treatment of adult animals with AAV vectors 29, 30. It is also possible that PPT1-deficiency predisposes mice to liver tumors that only develop later in life. Clearly, this phenomenon requires further study.

To date, clinical studies using neuronal stem cell therapy, the small molecule, Cystagon, CNS-directed gene therapy, or allogeneic bone marrow transplantation have been performed in patients suffering from INCL or late-infantile neuronal ceroid lipofuscinosis (LINCL). Although the findings from the human studies showed that these therapies were safe, additional clinical improvement is necessary for any of these single approaches to be viable therapies. The single-treatment pre-clinical studies supporting these clinical directives showed significant but modest clinical improvements. Therefore, we believe that combining therapeutic strategies, such as BMT and intracranial AAV-mediated gene therapy, could be an effective approach to comprehensively treat the complex manifestations of INCL. Due to the lack of therapeutic options available, the dramatic results observed from this combination therapy approach, and the severity of disease in INCL, this therapeutic strategy has the potential to be of immediate clinical importance.

Acknowledgments

This study was supported by NIH grants (NS043105; MSS), Ruth L. Kirschstein NRSA Fellowship (NS056728; SLM), The Wellcome Trust (GR079491MA; JDC, AMW, FM), Batten Disease Family Association (JDC, AMW, FM), the Batten Disease Support and Research Association (JDC, AMW, FM, SLM, MSS), and the Bletsoe Family (JDC, AMW). SLM and MSS designed research. SLM, MSR, AMW, ASR, FM, JDC, and MSS performed research. SLM, AMW, JDC, and MSS analyzed the data. SLM wrote the paper. MSS and JCD provided critical revisions of the manuscript.

References

  • 1.Hofmann SL, Peltonen L. The neuronal ceroid lipofuscinosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The Metabolic and Molecular Basis of Inherited Disease. New York: McGraw-Hill; 2001. pp. 3877–3894. [Google Scholar]
  • 2.Bible E, Gupta P, Hofmann SL, et al. Regional and cellular neuropathology in the palmitoyl protein thioesterase-1 null mutant mouse model of infantile neuronal ceroid lipofuscinosis. Neurobiol Dis. 2004;16:346–359. doi: 10.1016/j.nbd.2004.02.010. [DOI] [PubMed] [Google Scholar]
  • 3.Griffey M, Bible E, Vogler C, et al. Adeno-associated virus 2-mediated gene therapy decreases autofluorescent storage material and increases brain mass in a murine model of infantile neuronal ceroid lipofuscinosis. Neurobiol Dis. 2004;16:360–369. doi: 10.1016/j.nbd.2004.03.005. [DOI] [PubMed] [Google Scholar]
  • 4.Griffey MA, Wozniak D, Wong M, et al. CNS-directed AAV2-mediated gene therapy ameliorates functional deficits in a murine model of infantile neuronal ceroid lipofuscinosis. Mol Ther. 2006;13:538–547. doi: 10.1016/j.ymthe.2005.11.008. [DOI] [PubMed] [Google Scholar]
  • 5.Kielar C, Maddox L, Bible E, et al. Successive neuron loss in the thalamus and cortex in a mouse model of infantile neuronal ceroid lipofuscinosis. Neurobiol Dis. 2007;25:150–162. doi: 10.1016/j.nbd.2006.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Macauley SL, Wozniak DF, Kielar C, et al. Cerebellar pathology and motor deficits in the palmitoyl protein thioesterase 1-deficient mouse. Exp Neurol. 2009;217:124–135. doi: 10.1016/j.expneurol.2009.01.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dawson G, Schroeder C, Dawson PE. Palmitoyl:protein thioesterase (PPT1) inhibitors can act as pharmacological chaperones in infantile Batten disease. Biochem Biophys Res Commun. 2010;395:66–69. doi: 10.1016/j.bbrc.2010.03.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Griffey M, Macauley SL, Ogilvie JM, et al. AAV2-mediated ocular gene therapy for infantile neuronal ceroid lipofuscinosis. Mol Ther. 2005;12:413–421. doi: 10.1016/j.ymthe.2005.04.018. [DOI] [PubMed] [Google Scholar]
  • 9.Tamaki SJ, Jacobs Y, Dohse M, et al. Neuroprotection of host cells by human central nervous system stem cells in a mouse model of infantile neuronal ceroid lipofuscinosis. Cell stem cell. 2009;5:310–319. doi: 10.1016/j.stem.2009.05.022. [DOI] [PubMed] [Google Scholar]
  • 10.Lonnqvist T, Vanhanen SL, Vettenranta K, et al. Hematopoietic stem cell transplantation in infantile neuronal ceroid lipofuscinosis. Neurology. 2001;57:1411–1416. doi: 10.1212/wnl.57.8.1411. [DOI] [PubMed] [Google Scholar]
  • 11.Galvin N, Vogler C, Levy B, et al. A murine model of infantile neuronal ceroid lipofuscinosis-ultrastructural evaluation of storage in the central nervous system and viscera. Pediatr Dev Pathol. 2008;11:185–192. doi: 10.2350/07-03-0242.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gupta P, Soyombo AA, Atashband A, et al. Disruption of PPT1 or PPT2 causes neuronal ceroid lipofuscinosis in knockout mice. Proc Natl Acad Sci U S A. 2001;98:13566–13571. doi: 10.1073/pnas.251485198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zolotukhin S, Byrne BJ, Mason E, et al. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 1999;6:973–985. doi: 10.1038/sj.gt.3300938. [DOI] [PubMed] [Google Scholar]
  • 14.Reddy AS, Kim JH, Hawkins-Salsbury JA, et al. Bone marrow transplantation augments the effect of brain and spinal cord-directed adeno-associated virus 2/5 gene therapy by altering inflammation in the murine model of globoid-cell leukodystrophy. J Neurosci. 2011 doi: 10.1523/JNEUROSCI.1802-11.2011. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sands MS, Barker JE. Percutaneous intravenous injection in neonatal mice. Lab Anim Sci. 1999;49:328–330. [PubMed] [Google Scholar]
  • 16.Wei H, Zhang Z, Saha A, et al. Disruption of adaptive energy metabolism and elevated ribosomal p-S6K1 levels contribute to INCL pathogenesis: partial rescue by resveratrol. Hum Mol Genet. 2011;20:1111–1121. doi: 10.1093/hmg/ddq555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Burger C, Gorbatyuk OS, Velardo MJ, et al. Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol Ther. 2004;10:302–317. doi: 10.1016/j.ymthe.2004.05.024. [DOI] [PubMed] [Google Scholar]
  • 18.Davidson BL, Stein CS, Heth JA, et al. Recombinant adeno-associated virus type 2, 4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system. Proc Natl Acad Sci U S A. 2000;97:3428–3432. doi: 10.1073/pnas.050581197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lin D, Donsante A, Macauley S, et al. Central nervous system-directed AAV2/5-mediated gene therapy synergizes with bone marrow transplantation in the murine model of globoid-cell leukodystrophy. Mol Ther. 2007;15:44–52. doi: 10.1038/sj.mt.6300026. [DOI] [PubMed] [Google Scholar]
  • 20.Heldermon CD, Ohlemiller KK, Herzog ED, et al. Therapeutic efficacy of bone marrow transplant, intracranial AAV-mediated gene therapy, or both in the mouse model of MPS IIIB. Mol Ther. 2010;18:873–880. doi: 10.1038/mt.2010.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Alexander IE, Russell DW, Miller AD. DNA-damaging agents greatly increase the transduction of nondividing cells by adeno-associated virus vectors. J Virol. 1994;68:8282–8287. doi: 10.1128/jvi.68.12.8282-8287.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yalkinoglu AO, Heilbronn R, Burkle A, et al. DNA amplification of adeno-associated virus as a response to cellular genotoxic stress. Cancer Res. 1988;48:3123–3129. [PubMed] [Google Scholar]
  • 23.Ohmi K, Greenberg DS, Rajavel KS, et al. Activated microglia in cortex of mouse models of mucopolysaccharidoses I and IIIB. Proc Natl Acad Sci U S A. 2003;100:1902–1907. doi: 10.1073/pnas.252784899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bell P, Moscioni AD, McCarter RJ, et al. Analysis of tumors arising in male B6C3F1 mice with and without AAV vector delivery to liver. Mol Ther. 2006;14:34–44. doi: 10.1016/j.ymthe.2006.03.008. [DOI] [PubMed] [Google Scholar]
  • 25.Donsante A, Levy B, Vogler C, et al. Clinical response to persistent, low-level beta-glucuronidase expression in the murine model of mucopolysaccharidosis type VII. J Inherit Metab Dis. 2007;30:227–238. doi: 10.1007/s10545-007-0483-4. [DOI] [PubMed] [Google Scholar]
  • 26.Donsante A, Miller DG, Li Y, et al. AAV vector integration sites in mouse hepatocellular carcinoma. Science. 2007;317:477. doi: 10.1126/science.1142658. [DOI] [PubMed] [Google Scholar]
  • 27.Embury JE, Frost S, Charron CE, et al. Hepatits Virus Protein X-Phenylalanine Hydroxylase fusion proteins identified in PKU mice treated with AAV-WPRE vecctors. Gene Therapy and Molecular Biology. 2008;12:69–76. [Google Scholar]
  • 28.Reiss J, Hahnewald R. Molybdenum cofactor deficiency: Mutations in GPHN, MOCS1, and MOCS2. Hum Mutat. 2011;32:10–18. doi: 10.1002/humu.21390. [DOI] [PubMed] [Google Scholar]
  • 29.Li H, Malani N, Hamilton SR, et al. Assessing the potential for AAV vector genotoxicity in a murine model. Blood. 2011;117:3311–3319. doi: 10.1182/blood-2010-08-302729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nathwani AC, Rosales C, McIntosh J, et al. Long-term safety and efficacy following systemic administration of a self-complementary AAV vector encoding human FIX pseudotyped with serotype 5 and 8 capsid proteins. Mol Ther. 2011;19:876–885. doi: 10.1038/mt.2010.274. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES