Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2005 Apr;187(7):2458–2468. doi: 10.1128/JB.187.7.2458-2468.2005

The Type III-Dependent Hrp Pilus Is Required for Productive Interaction of Xanthomonas campestris pv. vesicatoria with Pepper Host Plants

Ernst Weber 1, Tuula Ojanen-Reuhs 2,†, Elisabeth Huguet 3,‡, Gerd Hause 4, Martin Romantschuk 2,§, Timo K Korhonen 2, Ulla Bonas 1,3, Ralf Koebnik 1,*
PMCID: PMC1065247  PMID: 15774889

Abstract

The plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria expresses a type III secretion system that is necessary for both pathogenicity in susceptible hosts and the induction of the hypersensitive response in resistant plants. This specialized protein transport system is encoded by a 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Here we show that X. campestris pv. vesicatoria produces filamentous structures, the Hrp pili, at the cell surface under hrp-inducing conditions. Analysis of purified Hrp pili and immunoelectron microscopy revealed that the major component of the Hrp pilus is the HrpE protein which is encoded in the hrp gene cluster. Sequence homologues of hrpE are only found in other xanthomonads. However, hrpE is syntenic to the hrpY gene from another plant pathogen, Ralstonia solanacearum. Bioinformatic analyses suggest that all major Hrp pilus subunits from gram-negative plant pathogens may share the same structural organization, i.e., a predominant alpha-helical structure. Analysis of nonpolar mutants in hrpE demonstrated that the Hrp pilus is essential for the productive interaction of X. campestris pv. vesicatoria with pepper host plants. Furthermore, a functional Hrp pilus is required for type III-dependent protein secretion. Immunoelectron microscopy revealed that type III-secreted proteins, such as HrpF and AvrBs3, are in close contact with the Hrp pilus during and/or after their secretion. By systematic analysis of nonpolar hrp/hrc (hrp conserved) and hpa (hrp associated) mutants, we found that Hpa proteins as well as the translocon protein HrpF are dispensable for pilus assembly, while all other Hrp and Hrc proteins are required. Hence, there are no other conserved Hrp or Hrc proteins that act downstream of HrpE during type III-dependent protein translocation.


Pathogenic bacteria exploit different strategies to successfully colonize their eukaryotic hosts. One of the key bacterial pathogenicity mechanisms is the translocation of proteins into eukaryotic host cells by a type III secretion (TTS) system consisting of a trans-envelope multiprotein complex. Components of TTS systems are generally encoded by gene clusters which often reside in pathogenicity islands (25). Several TTS systems have been studied, but our knowledge on the mechanism of substrate recognition and translocation is still very limited. The injectisome of Yersinia is the prototype example of a TTS system (13). There are three hallmarks of type III protein secretion. First, upon secretion, there is no processing of the protein substrate (42). Second, targeting to the TTS system involves sequence information at the N terminus of the protein and/or the corresponding region of the mRNA (14). Third, secretion across the bacterial cell envelope appears to occur in one step without a periplasmic intermediate (11).

Xanthomonas campestris pv. vesicatoria is the causal agent of bacterial spot disease in pepper and tomato (8). The X. campestris pv. vesicatoria TTS system is encoded by a 23-kb chromosomal hrp (hypersensitive response and pathogenicity) gene cluster which contains six operons, hrpA to hrpF (Fig. 1) (5, 20, 21, 30, 51; U. Bonas, unpublished data). Loss of hrp gene function results in a pleiotropic phenotype: hrp mutants are unable to grow in the plant, no longer cause disease symptoms, and fail to induce the hypersensitive reaction in resistant host and nonhost plants (5). The hypersensitive reaction is a rapid, local, programmed cell death that is induced upon recognition of the pathogen and is concomitant with the inhibition of pathogen growth within the infected plant tissue (35).

FIG. 1.

FIG. 1.

Genetic organization of the X. campestris pv. vesicatoria hrp gene cluster. The solid lines at the top indicate the six hrp transcription units, A to F; the thick arrows indicate different genes. Conserved hrc genes are shown as black arrows, hrp genes are shown as grey arrows, and hpa genes are shown as open arrows.

hrp gene expression is induced in planta (55) and is controlled by the regulatory genes hrpG and hrpX, which are located outside the hrp gene cluster. The HrpG protein belongs to the OmpR family of two-component regulatory systems (64) and controls the expression of a large gene regulon including hrpX. The AraC-type transcriptional activator HrpX regulates the expression of the operons hrpB to hrpF (61) and of most members of the hrpG regulon (46, 47). A mutated form of the key regulatory gene hrpG, hrpG*, which leads to the constitutive expression of hrp and other genes, was instrumental for the comparison of the expression profiles of two isogenic X. campestris pv. vesicatoria strains, 85-10 and 85*, which differ in their hrp gene expression status (46, 63).

More than 20 proteins are encoded by the hrp gene cluster, 11 of which are conserved in plant and animal pathogenic bacteria (44). These genes were renamed hrc (hrp conserved) and are thought to encode the core components of the secretion apparatus (4). The role of nonconserved Hrp proteins is less clear. Two Hrp proteins, HrpB2 and HrpF, are secreted by the TTS system (51). HrpF is a component of the predicted type III translocon that inserts into the host cell membrane (10). Besides hrc and hrp genes, analysis of nonpolar mutants in the hrp gene cluster also identified hpa (hrp associated) genes that contribute to, but are not essential to, the interaction with the plant (9, 30, 47; U. Bonas and D. Büttner, unpublished data).

While the core components of TTS systems are highly conserved, their secreted substrates appear to be extremely diverse (15). Secreted proteins of Xanthomonas belong to several protein families of fundamentally different functions (15). Best-studied examples which play a role in pathogenicity are homologs of AvrBs3 (6) and peptidases of the C48 and C55 families, such as XopD and AvrXv4, respectively (27). Another class of secreted proteins are the subunits of type III-specific pili. Hrp pili were described for Pseudomonas syringae, Ralstonia solanacearum, and Erwinia amylovora (32, 49, 59) but not for any xanthomonad.

Using electron microscopy, we discovered Hrp pili in X. campestris pv. vesicatoria. Purification of these pili identified the HrpE protein as the major subunit, a finding that was confirmed by immunoelectron microscopy. Immunoelectron microscopy also revealed that type III-secreted proteins are in close contact with the Hrp pilus during and/or after their secretion. This finding agrees with the proposed role of Hrp pili to serve as conduits for the translocation of type III effector proteins (26, 50). Finally, we studied the influence of genes in the hrp gene cluster on the assembly of Hrp pili. Detection of Hrp pili required a functional TTS system as well as most nonconserved hrp genes, whereas hpa genes and hrpF were not essential for pilus assembly. This finding suggests that no other conserved Hrp or Hrc protein acts downstream of HrpE during the translocation process.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used are described in Table 1. Since the wild-type X. campestris pv. vesicatoria strain 85-10 produces large amounts of exopolysaccharides, the exopolysaccharide-negative strain 85E was used for most analyses. Plasmids were introduced into Escherichia coli by electroporation and into X. campestris pv. vesicatoria by conjugation with pRK2013 as a helper plasmid in triparental matings (18, 22). E. coli cells were cultivated at 37°C in Luria-Bertani medium, and X. campestris pv. vesicatoria strains were cultivated at 30°C in NYG broth (16), in 1.5% NYG agar, in hrp-inducing XVM2 minimal medium (62), or in minimal medium A (2) supplemented with sucrose (20 mM) and Casamino Acids (0.3%). Since flagella were rarely observed after bacterial growth in minimal medium, XVM2 medium was used in most experiments. For pilus purification, X. campestris pv. vesicatoria was cultured with shaking at 120 rpm to the late logarithmic phase in XVM2 medium at 28°C. Antibiotics were added to the media at the following final concentrations: ampicillin, 100 μg/ml; kanamycin, 25 μg/ml; tetracycline, 10 μg/ml; rifampin, 100 μg/ml; spectinomycin, 100 μg/ml.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant characteristic(s) Reference or source
Strains
    75-3 Tomato pathogenic, wild type, Rifr 43
    85-10 Pepper race 2, wild type, Rifr 6
    85E eps::Tn3-gus insertion mutant of 85-10, hrp+ Rifr Kmr 62
    85E* Derivative of 85E carrying hrpG*, constitutive expression of hrp genes 63
    85EΔAD hrpA to hpaA deletion mutant of 85E, Rifr Kmr Spcr 62
    85E* Δhpa hpa deletion mutants of 85E* This study
    85E* Δhrc hrc deletion mutants of 85E* This study
    85E* Δhrp hrp deletion mutants of 85E* This study
    85-10 and 85E* hrpEΔ9-93 hrpE mutants of 85-10 and 85E* with a premature stop codon in hrpEa This study
Plasmids
    pDS300F pDSK602 expressing AvrBs3 from the lac promoter 58
    pDSM110 pDSK604 expressing a c-myc-tagged version of AvrBs1 from its own promotor 19
    pK194 Cloning vector, p15a origin of replication, Kmr 33
    pK194-hrpE Wild-type hrpE in pK194 This study
    pKS-L2c2 4.5-kb EcoRV fragment containing hrpE in pBluescript KS+ (Stratagene) Bonas, unpublished
    pOK1 Suicide vector, sacB sacQ mobRK2 oriR6K, Spcr 30
    pOK-hrpE Wild-type hrpE in pOK1 This study
    pOK-hrpEΔ9-93 Stop codon insertion after codon 9 of hrpE in pOK1 This study
    pRK2013 Helper plasmid for triparental matings, TraRK+ Mob+ Kmr 22
    pXV9::hpaB-75 pLAFR3 hrpA to E clone from X. campestris pv. vesicatoria 75-3; Tn3-gus insertion in hpaB Bonas, unpublished
    pXV74 pLAFR3 hrpA to F clone from X. campestris pv. vesicatoria 75-3 62
a

For details, see pOK-hrpE plasmids and Materials and Methods.

Plant material and plant inoculations.

Pepper cultivar ECW and the near-isogenic line ECW-10R, which carries the resistance gene Bs1, were described previously (43). Inoculation of plant leaves and reisolation of bacteria from plant tissue were performed as described previously (5).

Construction of nonpolar mutants.

To obtain nonpolar mutations, DNA regions upstream and downstream of the gene to be deleted were cloned in tandem into suicide vector pOK1. These constructs were then used to replace the corresponding chromosomal region as described previously (30). Most nonpolar mutants of strain 85E* were obtained by using available pOK1 derivatives (hrpB1-hrcL [51], hrcU [O. Rossier and U. Bonas, unpublished data], hrcV [52], hrcQ-hrpD6 [30], hpaB [9], hpaE [L. Noël and U. Bonas, unpublished data], and hrpF [10]). Deletions of hrcC, hrcJ, and hrpB7 were constructed similarly by using PCR primers (Table 2) for amplification of approximately 1-kb DNA fragments. All mutations could be complemented.

TABLE 2.

DNA oligonucleotides used in this study

Use Oligonucleotide Nucleotide sequencea Relevant characteristic
Construction of nonpolar hrcC mutant
hrcC-Δ left-5′ GCTACTGGATCCGATCGCAGGCACGATGTT BamHI site
hrcC-Δ left-3′ GCTCTCGCTAGCATGCAACGGCTGTTTCTG NheI site
hrcC-Δ right-5′ GCTACTGCTAGCTCAGTACGGCGGCCAATG NheI site
hrcC-Δ right-3′ GCTACTTCTAGAGCCTTGCTGGCCATTTCC XbaI site
Construction of nonpolar hrpB7 mutant
hrpB7-Δ left-5′ GCTCCAGGATCCAATTGCGCGATGAAGACG BamHI site
hrpB7-Δ left-3′ GCTCCAGCTAGCCAGGTATACGCAGACAAG NheI site
hrpB7-Δ right-5′ GCTCCAGCTAGCACTCAGGCGTTCCTGCAT NheI site
hrpB7-Δ right-3′ GCTCCATCTAGACAGTGCGATGTCAATGTG XbaI site
Construction of nonpolar hrcJ mutant
hrcJ-Δ left-5′ GCTCCAGGATCCTCTGTGCACGTGTCTG BamHI site
hrcJ-Δ left-3′ GCTCCAGCTAGCCTGCGCGAGTTGAAGAAA NheI site
hrcJ-Δ right-5′ GCTCCAGCTAGCCAGCACCACCAGGCATCT NheI site
hrcJ-Δ right-3′ GCTCCATCTAGAGGCAATTACGTGGAAGGT XbaI site
Primer extension analysis
No. 144 GGGGTACCAACACGGGACCTCCACGAGC Codons 15 to 8 of hrpE
No. 145 GGGGTACCGAGTAGCGAATCCATCTGG Codons 47 to 40 of hrpE
a

Underlined sequences, relevant restriction sites.

A nonpolar mutation in hrpE, hrpEΔ9-93, was constructed as follows. A 4.6-kb BamHI-HindIII fragment of pKS-L2c2, encompassing the region from 1,178 bp upstream to 3,139 bp downstream of the hrpE coding sequence, was subcloned into pK194, leading to pK194-hrpE. From pK194-hrpE, a 2.1-kb NheI-SalI fragment (cleaved at approximately 900 bp upstream and downstream of hrpE) was transferred into XbaI-SalI-cleaved pOK1, leading to pOK-hrpE. GPS-LS linker-scanning mutagenesis (New England Biolabs, Inc., Beverly, Mass.) was then used to isolate an insertion of a premature stop codon in hrpE. The sequence at codon 8 reads as GTA7 AGT8 GTT TAA ACA GTA7 AGT8 (stop codon underlined; DraI site in italics) (pOK-hrpEΔ9-93). This pOK1 derivative was checked by restriction digestion and DNA sequence analysis before its conjugation into X. campestris pv. vesicatoria (18, 22). The chromosomal wild-type copy of hrpE was replaced by two consecutive crossover events as described previously (34). The presence of the mutation in the derived strains was verified by detection of a diagnostic DraI site.

Primer extension analysis of hrpE.

Bacteria were grown for 16 h in NYG or XVM2 or recovered from susceptible pepper plants 3 days after whole-plant infiltration. Bacterial RNA was extracted as described previously (1). Primer extension was performed as previously described (2, 62) with oligonucleotide 144 or 145 (Table 2) and reverse transcriptase Superscript RNase H− reverse transcriptase Moloney murine leukemia virus (Gibco BRL, Eggenstein, Germany).

Preparation of Hrp pili and protein analysis.

Pili were purified from strain 85E of X. campestris pv. vesicatoria by use of a deoxycholate-sucrose density gradient as described by Ojanen-Reuhs et al. (48). Briefly, after mechanical detachment from the bacterial cells, cells were pelleted and the pili-containing supernatant was concentrated by precipitation with ammonium sulfate, dialyzed, and solubilized in buffer containing deoxycholate. The sample containing the pili was purified further by ultracentrifugation in a sucrose gradient. Pili were found at the bottom of the gradient and were analyzed by Tricine sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (54). For N-terminal sequence analysis, the pilus fraction was electrophoresed, blotted on a polyvinylidene difluoride membrane, and stained with Coomassie brilliant blue. The polypeptides were excised and subjected to Edman degradation in a gas-pulsed liquid-phase sequencer.

Preparation of recombinant HrpE and antibody production.

For production of a monospecific polyclonal HrpE-specific antiserum, the coding region of the hrpE gene was amplified by PCR. The PCR-generated fragment was cloned into pET15b (Novagen, Merck KGaA, Darmstadt, Germany) vector as a NdeI/BamHI fragment, leading to synthesis of an N-terminally hexahistidine-tagged HrpE variant. This expression plasmid was then introduced into E. coli JM109(DE3) cells (Promega GmbH, Mannheim, Germany). Expression of the HrpE fusion protein was initiated by induction with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG). The recombinant HrpE, which was purified by nickel-affinity column chromatography (QIAGEN GmbH, Hilden, Germany) under denaturing conditions with 8 M urea, was desalted. Further purification of HrpE was achieved by preparative SDS-PAGE. Antibodies against the purified recombinant HrpE were raised in a New Zealand White female rabbit at the Robert Koch Institut (Wernigerode, Germany).

An HrpE-specific antipeptide antibody was generated in rabbits against the highly conserved peptide L76NKFIGKAGDNAKQ89 (Sequence Laboratories GmbH, Göttingen, Germany).

Type III secretion experiments and immunoblot analysis.

In vitro secretion experiments were performed as described previously (52). Western blots were incubated with polyclonal antiserum against HrpE (diluted 1:500) or HrpF (diluted 1:50,000) (10) or with monoclonal antibodies against c-myc (diluted 1:1,000) (Roche Diagnostics GmbH, Mannheim, Germany). Blots were then probed with anti-rabbit (for HrpE and HrpF) or anti-mouse (for c-myc) horseradish peroxidase-conjugated secondary antibody, which was detected by enhanced chemiluminescence (Amersham Pharmacia Biotech, Freiburg, Germany). The membranes were reprobed with a specific antibody against the intracellular protein HrcN to ensure that no bacterial lysis had occurred (52).

EM techniques.

For electron microscopy (EM) analyses, bacteria were grown on EM grids according to a slightly modified published protocol (7). Briefly, bacterial cultures were grown for 24 h in NYG medium with shaking at 30°C. Bacteria were washed twice in 1 mM MgCl2 and resuspended in minimal medium unless otherwise indicated. The bacterial suspension was adjusted to an optical density at 600 nm of 0.02, and a 15-μl droplet was applied to a 300-mesh gold EM grid (Sigma, Taufkirchen, Germany) coated with 1% Formvar (polyvinyl 1595E; Serva, Heidelberg, Germany). To avoid evaporation, the grids were placed in a 9-cm-diameter petri dish containing wet filter paper and sealed with Parafilm. Grids were incubated for 4 to 16 h in a growth chamber at 30°C before bacteria and pili were fixed by transferring the grid twice into a 20-μl drop of 2% formaldehyde and 0.5% glutaraldehyde in 50 mM sodium cacodylate buffer, pH 7.2, for 20 min. Specimens were then negatively stained for 10 s in 2% phosphotungstic acid and air dried before viewing.

For immunogold labeling, dried grids were washed with TBST (20 mM Tris, 500 mM NaCl, 0.1% acetylated bovine serum albumin, and 0.1% Tween 20 [pH 7.2]) and blocked with 1% acetylated bovine serum albumin in TBST for 30 min at room temperature. Primary antibodies (anti-HrpE, anti-HrpF [10], anti-AvrBs3 [36]) were used at a dilution of 1:500, and grids were incubated for 90 min at room temperature. For HrpE immunogold labeling, unfixed bacteria were used. Anti-rabbit immunoglobulin G-10-nm-diameter gold bead antibodies produced in goat (Sigma) served as secondary antibodies at a dilution of 1:100, and grids were incubated for 1 h at room temperature. All specimens were examined on an EM 900 electron microscope (Zeiss, Oberkochen, Germany) at an operating voltage of 80 kV.

Bioinformatic analyses.

The following eight prediction algorithms, most of which use neural networks, were applied to available HrpE amino acid sequences from Xanthomonas spp. (X. campestris pv. vesicatoria strain 75-3, GenBank accession no. AAD21326; Xanthomonas oryzae pv. oryzae strain MAFF 311018, GenBank accession no. BAB07867; Xanthomonas axonopodis pv. glycines strain 8ra, GenBank accession no. AAP34354; Xanthomonas axonopodis pv. citri strain 306, GenBank accession no. AAM35288; Xanthomonas campestris pv. campestris strain ATCC 33913, GenBank accession no. AAM40519): HNN (http://npsa-pbil.ibcp.fr/NPSA/npsa_hnn.html), MLRC (http://npsa-pbil.ibcp.fr/NPSA/npsa_mlr.html), PHD (http://www.embl-heidelberg.de/predictprotein/), Prof (http://www.aber.ac.uk/∼phiwww/prof/), PSIPRED (http://bioinf.cs.ucl.ac.uk/psipred/), SAM-T99 (http://www.cse.ucsc.edu/research/compbio/HMM-apps/T99-model-library-search.html), Scratch and SSpro (http://www.igb.uci.edu/tools/scratch/). A consensus prediction by residue-specific majority votes was derived for each sequence. The HrpE sequences were aligned by using the ClustalW website http://www.ebi.ac.uk/clustalw/ with default parameters (57). This alignment was used to align the consensus secondary structure assignments, thus leading to a final consensus prediction for the HrpE protein family.

The promoter recognition program BPROM (Softberry, Inc., Mt. Kisco, N.Y.) was used for prediction of bacterial sigma70 promoter motifs.

RESULTS

Xanthomonas campestris pv. vesicatoria produces type III-dependent surface appendages.

X. campestris pv. vesicatoria strain 85E was grown in hrp-inducing medium XVM2 (62). Electron microscopy of negatively stained bacteria revealed the appearance of pilus-like appendages of approximately 8 to 10 nm in diameter and up to more than 2 μm in length attached to the cell surface (Fig. 2A). The wild-type strains 85-10 and 75-3 also produced pili (data not shown). No pili were observed when 85E cells were grown in complex medium NYG, in which hrp gene expression is suppressed (55) (Fig. 2B). However, strain 85E*, which carries the constitutively active mutant form of the hrp regulator hrpG, also showed pili after growth in NYG (Fig. 2C). As X. campestris pv. vesicatoria produces pilus-like appendages only under hrp-inducing conditions, we called them Hrp pili. The dimensions are comparable to those of Hrp pili from P. syringae, R. solanacearum, and E. amylovora (32, 49, 59). In contrast to findings with R. solanacearum, we did not observe a predominant appearance of pili in the polar region of the bacteria nor did we observe a bundling of detached pili. Up to 10 individual pili per cell were evenly distributed around the cell when strain 85E* was analyzed.

FIG. 2.

FIG. 2.

Detection of Hrp pili at the surface of X. campestris pv. vesicatoria. Bacteria were incubated on coated gold grids for 6 h at 30°C. Transmission electron micrographs of negatively stained specimens are shown. Surface appendages with a diameter of 8 to 10 nm were observed only under hrp-inducing conditions: (A) growth of strain 85E in XVM2 medium; (C) presence of the HrpG* protein in strain 85E*. Neither the hrpG wild-type strain 85E grown in NYG medium (B) nor a TTS mutant (85E* ΔhrcU) (D) produced pili. Arrows indicate Hrp pili. Bars, 200 nm.

To assess whether formation of Hrp pili was dependent on the expression of other hrp genes, two hrp mutant strains were studied by electron microscopy. Neither the mutant 85EΔAD, in which a 13-kb region comprising the operons hrpA to hrpD is deleted, nor the nonpolar hrc mutant 85E*ΔhrcU carried pili under any of the growth conditions tested (Fig. 2D and data not shown). Altogether, these data indicate that Hrp pilus formation requires an intact type III secretion system.

The HrpE protein is a major component of the Hrp pilus.

To identify the protein components of the Hrp pili, they were purified from X. campestris pv. vesicatoria strain 85E grown in XVM2 medium by deoxycholate solubilization and sucrose density gradient centrifugation. Proteins present in the pilus preparations were analyzed by Tricine SDS-PAGE. These preparations contained, as a major component, a series of small proteins with an apparent molecular mass below 10 kDa under denaturing conditions and variable amounts of other proteins (Fig. 3). The small proteins were not detected in preparations of strain 85E grown in hrp-suppressing conditions and in the 85EΔAD hrp mutant.

FIG. 3.

FIG. 3.

Purification of Hrp pili. Pili were purified from X. campestris pv. vesicatoria strain 85E grown in XVM2 medium by deoxycholate solubilization and sucrose density gradient centrifugation. Proteins present in the pilus preparations were analyzed by Tricine SDS-PAGE. Lane 1, molecular mass marker; lane 2, sample of Hrp pilus preparation. Arrows point to protein bands for which sequence information has been obtained.

We attempted to obtain sequence information for the major proteins of the pilus preparation. The N-terminal sequence of a 200-kDa protein could not be resolved, but an internal sequence (QLDALAADVQT) was obtained and showed perfect identity to the outer membrane protein XadA from X. campestris pv. campestris (217 kDa) and X. axonopodis pv. citri (201 kDa) (17). An N-terminal sequence, LVPNDPFYAQYQXHLSNPNG, was obtained from the 45-kDa protein. It is 90% identical to an internal sequence of a putative extracellular serine protease from X. campestris pv. campestris and X. axonopodis pv. citri which is predicted to be processed to a mature protein of 47 kDa (17). Since the 200-kDa and 45-kDa proteins were also present in preparations of strain 85EΔAD, they probably represent a contamination of the Hrp pilus preparation.

N-terminal sequencing of the small proteins generated the sequences MQIFPEVS, VSSWRSRV, and CFTGGLSNGI. All three sequences are present in the predicted hrpE gene product of X. campestris pv. vesicatoria (predicted molecular mass, 9.7 kDa) at amino acid positions 1 to 8, 7 to 14, and 20 to 29, respectively (47). The DNA sequence of hrpE has been determined previously (GenBank accession number AF056246), but no functional studies of the HrpE protein have been performed yet. The fact that all predominant proteins in the pilus preparation correspond to the HrpE protein suggests that HrpE (or a fragment derived from HrpE) is the major Hrp pilus subunit. Possibly, N-terminally truncated fragments originated from proteolytic degradation during pilus preparation.

C termini of HrpE subunits may form core of the Hrp pilus.

Comparisons of HrpE with the protein database did not reveal homologous sequences except for highly related proteins from other xanthomonads, i.e., X. campestris pv. campestris, X. oryzae pv. oryzae, X. axonopodis pv. citri, and X. axonopodis pv. glycines (Fig. 4). HrpE from X. campestris pv. campestris is less well conserved, as it lacks three amino acid residues at the N terminus and is only conserved at the very C terminus. Intriguingly, the last 24 amino acid residues of HrpE are 100% conserved in all five xanthomonads, suggesting that this region may be crucial for HrpE function (Fig. 4).

FIG. 4.

FIG. 4.

Multiple alignment and consensus secondary structure prediction of xanthomonad HrpE proteins. Five HrpE sequences from X. campestris pv. vesicatoria (Xcv), X. oryzae pv. oryzae (Xoo), X. axonopodis pv. glycines (Xag), X. axonopodis pv. citri (Xac), and X. campestris pv. campestris (Xcc) were aligned by using the CLUSTAL X program (57) and subjected to secondary structure prediction (2D). Identical residues are shown in red, and similar residues are shown in blue. Predicted α-helical regions are indicated by a lowercase “h.”

To elucidate possible structures of Hrp pilus subunits, secondary structure prediction algorithms were applied. Strikingly, the C-terminal half was predicted to contain several α-helices, whereas the N-terminal half was largely unstructured (Fig. 4). Although three helices were also predicted in the N-terminal half, their significance remains questionable, since they were not predicted for all HrpE proteins and their statistical significance is considerably lower than for the C-terminal helices (data not shown). Interestingly, the pattern of predicted secondary structure matches with the degree of sequence conservation along the polypeptide chains. From these analyses, we speculate that the C termini of HrpE subunits may form the core of the Hrp pilus.

Hrp pili are labeled by HrpE-specific antibodies.

A polyclonal antiserum was produced against an N-terminally hexahistidine-tagged HrpE fusion protein. X. campestris pv. vesicatoria strain 85-10 and the hrpEΔ9-93 deletion mutant (see below and Materials and Methods) were analyzed for the production of HrpE-related proteins by Western blot analysis. Only in the wild type did we detect a protein of about 10 kDa in size which was missing in the hrpE deletion mutant (data not shown). No other protein was detected by the anti-HrpE antiserum, thus proving that the antiserum is monospecific.

To prove that HrpE is indeed the major pilus subunit, we used the anti-HrpE antiserum in immunoelectron microscopy. Strain 85E* was incubated on EM grids in XVM2 medium and subjected to immunogold labeling without prior fixation. Electron microscopy revealed that Hrp pili were heavily labeled by the HrpE-specific antiserum (Fig. 5A). Flagella, which were occasionally observed, were not labeled (Fig. 5A), thus proving specificity of the Hrp pilus labeling.

FIG. 5.

FIG. 5.

Immunogold labeling of X. campestris pv. vesicatoria Hrp pili with anti-HrpE (A), anti-AvrBs3 (B), or anti-HrpF (C) antisera. Bacteria were incubated on EM grids for 6 h in minimal medium, followed by in situ immunogold labeling. The following strains were used for labeling of Hrp pili: 85E* (A and C) and 85* carrying the avrBs3-containing plasmid pDS300F (B). Filled arrows indicate labeled pili, open arrows indicate unlabeled pili, and an arrowhead points to a flagellum. Dark dots along or at Hrp pili are 10-nm-diameter gold particles. Bars, 200 nm.

We also tested an antipeptide antiserum which was raised against a conserved peptide segment at the C terminus (L76NKFIGKAGDNAKQ89). This antiserum was functional in Western blot analysis (data not shown). However, when this antiserum was used in immunoelectron microscopy, no labeling of Hrp pili was observed (data not shown). The epitope is probably masked in the native pilus structure, thus supporting the idea that the C terminus of HrpE may be involved in the polymerization process.

The hrpE promoter lies in the hrpD operon.

The operon structure of the 23-kb hrp gene cluster has been deduced from complementation analyses (5) and DNA sequencing (21, 30, 47). The hrpE gene is located downstream of hrpD6 and upstream of hpaB (Fig. 1). A nonpolar deletion of 440 bp in hrpD5 (735 bp upstream of the hrpE translation start codon) did not affect hrpE expression (30; Bonas, unpublished).

From promoter studies with hrp::Tn3-gus (β-glucuronidase) fusions, it was known that hrpE has a basal transcription level in complex medium which is up-regulated in XVM2 medium and in planta (61; K. Wengelnik and U. Bonas, unpublished data). The promoter regions of several plant-inducible genes contain a conserved sequence motif, the PIP box (plant-inducible promoter) (21, 29, 30, 47). Therefore, the region upstream of the translation start codon of hrpE was scrutinized for conserved sequence elements. No PIP boxes or canonical sequence elements of σ70-regulated promoters were found in a reasonable distance.

To define the transcriptional start site of hrpE, primer extension experiments were performed with oligonucleotide 144 or 145 (Fig. 6 and data not shown). Mapping of the strongest signal indicates that hrpE transcription starts at adenosine −101 (with respect to the hrpE translation start codon). As the translation stop codon of hrpD6 is located 4 bp upstream of the hrpE transcriptional start site (30), the hrpE promoter resides in the hrpD operon.

FIG. 6.

FIG. 6.

Mapping of the transcriptional start site of hrpE by primer extension analysis. RNAs were extracted from strain 85E(pXV74) grown for 16 h in XVM2 (lane 1) and NYG (lane 2), annealed with oligonucleotide no. 144, and used as templates for reverse transcription. The nucleotide sequence is the reverse complement of the coding strand. The boxed nucleotide refers to the transcriptional start site which is indicated by an arrow.

Nonpolar mutants in hrpE do not produce Hrp pili and are defective in type III secretion.

A nonpolar mutation in hrpE was constructed which carries an insertion of 15 nucleotides, including a premature stop codon after codon 8 (hrpEΔ9-93). The mutation was introduced into X. campestris pv. vesicatoria strains 85* and 85E* and resulted in an Hrp phenotype (Fig. 7 and data not shown). The hrpE mutants could be complemented by cosmid pXV9::hpaB-75 (5; Bonas, unpublished) which carries a transposon insertion in hpaB, the gene downstream of hrpE (Fig. 7 and data not shown). Electron microscopy analysis demonstrated that the hrpE mutant did not produce Hrp pili (Fig. 8A and data not shown).

FIG. 7.

FIG. 7.

Phenotype and complementation of an hrpE mutant. Bacteria at a concentration of about 2 × 108 CFU/ml were inoculated into a 5-week-old pepper leaf. After 2 days of cultivation, plant reactions were scored. A leaf after bleaching in ethanol is shown.

FIG. 8.

FIG. 8.

Effects of hrp and hpa mutations on Hrp pilus assembly. Electron micrographs from 85E*-derived bacteria incubated in XVM2 medium are shown. Deletion mutants of hrpF (B), hpaB (C), and hpaE (D) produced pili, whereas the hrpEΔ9-93 mutant does not show any pili (A). Bars, 200 nm.

We then tested HrpE for protein secretion in a type III secretion in vitro assay. Western blot analysis of X. campestris pv. vesicatoria culture supernatants showed that the wild-type strain allowed detection of HrpE (Fig. 9), as expected. Next, we studied the effect of the hrpE mutation on type III protein secretion of other substrates. This analysis showed that only the hrpE wild-type strain allowed detection of HrpF, which is secreted by the TTS system (51), in culture supernatants (Fig. 9). This was confirmed by testing for secretion of the AvrBs1 protein, an effector that is translocated into the plant cell (19) (Fig. 9). These results demonstrate that hrpE is required not only for protein translocation into plant cells but also for protein secretion across the bacterial cell envelope.

FIG. 9.

FIG. 9.

Detection of HrpE protein in X. campestris pv. vesicatoria and effects of hrpE mutations on in vitro type III secretion. Immunoblotting analyses of total protein extracts (TE) and culture supernatants (SN) of an hrpE wild-type strain (85E*) and an hrpEΔ9-93 mutant are shown. Proteins were separated by SDS-PAGE and transferred to nitrocellulose. The blots were probed with HrpE (lanes 1 and 2)-, HrpF (lanes 3 to 5)-, or c-myc (lanes 6 to 8)-specific antibodies, respectively. The anti-c-myc (α-c-myc) antibodies detect triple c-myc-tagged AvrBs1 molecules expressed from plasmid pDSM110. Lanes 1, 3, and 7, 85E*; lanes 2 and 5, 85E* hrpEΔ9-93; lane 4, 85E* ΔhrpF; lane 6, 85E*(pDSM110); lane 8, 85E* hrpEΔ9-93(pDSM110). α-HrpE, anti-HrpE; α-HrpF, anti-HrpF.

AvrBs3 and HrpF are localized along the Hrp pilus.

Recent data for Hrp pili from P. syringae suggest that the pili elongate at the tip and serve as conduits for type III-secreted proteins (31, 40). Although the number of pili produced by X. campestris pv. vesicatoria is much lower than for P. syringae, we tested bacteria grown on EM grids for secretion of AvrBs3, a well-studied type III effector from X. campestris pv. vesicatoria. Strain 85*(pDS300F), which expresses AvrBs3, was incubated on EM grids under secretion-permissive conditions (minimal medium A, pH 5.2) (52) and analyzed by electron microscopy. Immunogold labeling revealed the presence of AvrBs3 at more than 50% of the pili (one to five dots in a distance of 20 nm along the pilus) (Fig. 5B). This amount of labeling appears to be rather low, especially in comparison to labeling of harpin or pilus subunits in other plant pathogens (7, 28, 32, 40). However, there are at least 20 different effector proteins secreted by X. campestris pv. vesicatoria (19, 45, 47; Bonas et al., unpublished), which may lead to competition so that probably only a few AvrBs3 molecules are secreted via the Hrp pilus under our conditions. As a negative control, strain 85* without pDS300F was used (data not shown). In this case, of 150 randomly chosen pili, only four were labeled once and no pili were labeled by two or more dots.

The second type III-secreted protein that we analyzed was HrpF (10). While pili were clearly labeled by the HrpF-specific antiserum in the hrpF wild-type strain X. campestris pv. vesicatoria 85E* (Fig. 5C), no labeling was observed in the case of the hrpF deletion mutant 85E*ΔhrpF (data not shown). These experiments suggest that type III-secreted proteins are in close vicinity to the Hrp pilus during and/or after their secretion.

Several genes in the hrp gene cluster are not required for assembly of Hrp pili.

The mutant analysis (see above) suggested that Hrp pilus assembly depends on a functional TTS apparatus whose components are encoded within the hrp gene cluster. However, it was not known which genes are required for pilus assembly and whether hpa and other nonconserved hrp genes play a role. Although hpa genes are not essential for pathogenicity (30, 47; Bonas et al., unpublished), it is conceivable that Hpa proteins could modulate the assembly of Hrp pili with respect to their number, length, or other morphological and functional features. Therefore, nonpolar mutations were introduced into the genome of X. campestris pv. vesicatoria strain 85E*. The following genes were tested: hrcC, hrpB7, hrcL, hrpB4, hrcJ, hrpB2, hrpB1, hrcU, hrcV, hrcQ, hrcR, hrcS, hpaA, hrcD, hrpD6, hpaB, hpaE, and hrpF (see Materials and Methods for details). Electron microscopy revealed that all hpa mutants produced pili that were morphologically the same as those of the wild type (Fig. 8C and 8D). However, it appeared that the hpaA mutant produced significantly fewer pili. This is similar to observations of R. solanacearum (60). All hrp and hrc mutants, except for hrpF, failed to produce pili (Fig. 8B and data not shown). This finding is in agreement with the proposed role for HrpF. HrpF is part of the predicted type III translocon which inserts into the host cell plasma membrane (10). Therefore, HrpF acts downstream of HrpE during secretion and translocation of effector proteins. From this comprehensive analysis, we conclude that no other conserved Hrp or Hrc protein acts downstream of HrpE during the translocation process.

DISCUSSION

In this study, we have shown that X. campestris pv. vesicatoria produces a novel surface appendage, the Hrp pilus, when bacteria are grown under conditions that mimic the in planta situation. This was achieved in vitro by growth of the bacteria in hrp-inducing medium or by use of an hrpG* mutant which constitutively expresses the hrpG regulon. It is noteworthy to mention that no type IV fimbriae were observed under any of the growth conditions tested, although strain 85-10 was reported to carry a gene for type IV fimbriae (48). Altogether, these observations add another important plant pathogenic genus to the list of Hrp pilus-producing bacteria (32, 49, 59).

The X. campestris pv. vesicatoria Hrp pili have a diameter of about 8 to 10 nm and can reach more than 2 μm in length. These dimensions are comparable to those of other Hrp pili, although the diameter appears to be slightly thicker than in the cases of P. syringae (6 to 8 nm), R. solanacearum (6.6 nm), and E. amylovora (8 nm) (32, 49, 59). Type III protein translocation serves to deliver proteins of bacterial origin across three membranes into the cytosol of eukaryotic host cells. In the case of plant pathogenic bacteria, however, membranes of both players cannot contact each other directly due to the plant cell wall, which is up to 500 nm thick. It is speculated that Hrp pili serve to bridge the distance between the bacterial cell surface and the plant cell plasma membrane, thus allowing directional protein transfer from the bacterium into the host cell cytosol (7, 28, 50).

The HrpE protein was identified as the major subunit of the X. campestris pv. vesicatoria Hrp pilus. This conclusion was based on the following results. (i) The HrpE protein was the predominant component of pilus preparations, which were isolated according to a protocol previously used for the preparation of type IV pili from E. coli (48). In another study, HrpE was detected in supernatants of hrp-induced X. oryzae pv. oryzae but not in those of a type III secretion mutant, a finding that corroborates our hypothesis that HrpE is an extracellular entity (23). (ii) Hrp pili were heavily labeled by a monospecific anti-HrpE antiserum, as revealed by immunoelectron microscopy. (iii) Mutations in hrpE lead to loss of Hrp pili and can be complemented by an hrpE-containing cosmid. (iv) Based on sequence similarity and gene order (synteny), the hrp gene cluster of X. campestris pv. vesicatoria is most closely related to that of R. solanacearum. The hrpE gene of X. campestris pv. vesicatoria is syntenic to hrpY, which encodes the major subunit of the Hrp pilus of R. solanacearum (59). (v) Although HrpE is not similar to other nonxanthomonad Hrp pilus subunits at the sequence level, it shares several characteristics with these proteins, i.e., it is small, predicted to be predominantly α-helical with the highest helical propensity at the C terminus, and unusually variable at the sequence level among several species and pathovars of the same genus (37).

Interestingly, the diameter of Hrp pili is similar to that of the needle structures which are present on top of the TTS systems of animal pathogens (3, 39, 56). TTS systems are evolutionary related to the flagellar systems (24, 53). The flagellar filament of Salmonella enterica serovar Typhimurium has an outer diameter of about 20 nm, forming a hollow cylinder which supports the internal transport of at least partially unfolded filament subunits and leads to growth at the tip (65). Collectively, the type III surface appendages are clearly thinner than the flagellar filament. So the question arises as to how protein translocation can occur through these appendages. X-ray fiber diffraction analysis and electron microscopy of the Shigella type III needle allowed the reconstruction of the needle structure with a resolution of 16 Å (12). Fitting of the protein subunits (MxiH) into the deduced structure revealed an internal diameter of about 20 Å, which is identical to the internal diameter of the flagellar filament (66). Such a canal would be large enough to accommodate partially unfolded proteins. The FliC flagellin is 494 amino acids long, and the flagellar hook protein FlgE is 402 amino acids long. Both proteins do not share sequence homology with MxiH (83 amino acids) or any other component of type III surface appendages (12). Nevertheless, it appears that these proteins are similar to each other at the structural level (predicted α-helices in common). It was therefore suggested that the small needle subunits may represent the minimum core required to build a supermolecular helical structure (12). The small size of the type III-dependent surface components appears to be a general phenomenon not only in animal pathogens (sizes ranging between 73 and 101 amino acids) but also in plant pathogens where the subunits of Hrp pili vary in size between 66 and 113 amino acids. Interestingly, rhizobial NopA proteins which may form type III-dependent pilus-like surface appendages in symbiotic bacteria are also small, ranging in size between 63 and 71 amino acids (38, 41). Moreover, Hrp pilus subunits appear to be mainly composed of α-helices (37). We therefore speculate that type III-dependent pili and needles share a common helical architecture and that both surface appendages form an internal canal of similar dimension. In line with this hypothesis, we showed by immunoelectron microscopy that two type III-secreted proteins (HrpF and AvrBs3) are in close contact with the Hrp pilus during and/or after their secretion. This finding fits nicely with the proposed role of Hrp pili to serve as conduits for the translocation of type III effector protein (26, 50). However, direct evidence for this possibility awaits experiments involving in situ immunogold labeling to visualize effector protein extrusion from the tips of the pili (31, 40).

From transcriptional β-glucuronidase fusions, it was known that hrpE has a basal transcription level in complex medium which is up-regulated in XVM2 minimal medium and in planta (61; Wengelnik and Bonas, unpublished). We therefore performed a comparative primer extension analysis and could identify the putative transcriptional start site of the messenger RNAs which are synthesized under hrp-inducing conditions. These data revealed that the corresponding hrpE promoter lies in the hrpD operon. However, we did not obtain another hrp-independent signal. Either the basal transcription level in complex medium is too low to be detected by our assay or the basal transcription starts from another promoter which is located considerably more upstream of hrpE. We could not identify any consensus promoter element upstream of the putative transcriptional start site. At present it is therefore unknown how hrp-dependent transcription of hrpE is achieved.

Mutant analyses demonstrated that Hrp pilus biogenesis depends on all hrc and hrp genes analyzed, except for hrpF, which encodes the type III-secreted translocon protein. We found that hpa genes are dispensable for production of Hrp pili. However, hpaA had an influence on the number of Hrp pili produced, a finding that is similar to the situation in R. solanacearum (60). Absence of hrpV, the hpaA homolog of R. solanacearum, was also reported to result in fewer Hrp pili. A mutation in hrpX, which is the gene upstream of hrpY in R. solanacearum, resulted in loss of pili but still allowed export of the HrpY pilus subunit. We found that the syntenic gene in X. campestris pv. vesicatoria, hrpD6, is also required for pilus biogenesis. From these observations, we assume that the three genes upstream of hrpE (hpaA-hrpD6) may play a more specialized role in pilus assembly than the rest of the hrp gene cluster, which most probably encodes the core components of the TTS system.

Acknowledgments

We thank Hannelore Espenhahn for excellent technical assistance and Bianca Rosinsky for greenhouse work. We also thank Wiebke Streckel and Helmut Tschäpe for providing the polyclonal HrpE-specific antiserum. The assistance of Niina Järvinen and Nisse Kalkkinen during preparation of Hrp pili and N-terminal protein sequencing is highly appreciated.

This work was funded in part by an ATIPE grant from CNRS to U.B. and by grants KO 1686/3-1 and /3-2 from the Deutsche Forschungsgemeinschaft to R.K.

REFERENCES

  • 1.Aiba, H., S. Adhya, and B. de Crombrugghe. 1981. Evidence for two functional gal promoters in intact Escherichia coli cells. J. Biol. Chem. 256:11905-11910. [PubMed] [Google Scholar]
  • 2.Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1996. Current protocols in molecular biology. John Wiley & Sons, New York, N.Y.
  • 3.Blocker, A., P. Gounon, E. Larquet, K. Niebuhr, V. Cabiaux, C. Parsot, and P. Sansonetti. 1999. The tripartite type III secretion of Shigella flexneri inserts IpaB and IpaC into host membranes. J. Cell Biol. 147:683-693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bogdanove, A. J., S. V. Beer, U. Bonas, C. A. Boucher, A. Collmer, D. L. Coplin, G. R. Cornelis, H. C. Huang, S. W. Hutcheson, N. J. Panopoulos, and F. Van Gijsegem. 1996. Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Mol. Microbiol. 20:681-683. [DOI] [PubMed] [Google Scholar]
  • 5.Bonas, U., R. Schulte, S. Fenselau, G. V. Minsavage, B. J. Staskawicz, and R. E. Stall. 1991. Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol. Plant-Microbe Interact. 4:81-88. [Google Scholar]
  • 6.Bonas, U., R. E. Stall, and B. Staskawicz. 1989. Genetic and structural characterization of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria. Mol. Gen. Genet. 218:127-136. [DOI] [PubMed] [Google Scholar]
  • 7.Brown, I. R., J. W. Mansfield, S. Taira, E. Roine, and M. Romantschuk. 2001. Immunocytochemical localization of HrpA and HrpZ supports a role for the Hrp pilus in the transfer of effector proteins from Pseudomonas syringae pv. tomato across the host plant cell wall. Mol. Plant-Microbe Interact. 14:394-404. [DOI] [PubMed] [Google Scholar]
  • 8.Büttner, D., and U. Bonas. 2002. Getting across-bacterial type III effector proteins on their way to the plant cell. EMBO J. 21:5313-5322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Büttner, D., D. Gürlebeck, L. Noël, and U. Bonas. 2004. HpaB from Xanthomonas campestris pv. vesicatoria acts as an exit control protein in type III-dependent protein secretion. Mol. Microbiol. 54:755-768. [DOI] [PubMed] [Google Scholar]
  • 10.Büttner, D., D. Nennstiel, B. Klüsener, and U. Bonas. 2002. Functional analysis of HrpF, a putative type III translocon protein from Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 184:2389-2398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Charkowski, A. O., H. C. Huang, and A. Collmer. 1997. Altered localization of HrpZ in Pseudomonas syringae pv. syringae hrp mutants suggests that different components of the type III secretion pathway control protein translocation across the inner and outer membranes of gram-negative bacteria. J. Bacteriol. 179:3866-3874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cordes, F. S., K. Komoriya, E. Larquet, S. Yang, E. H. Egelman, A. Blocker, and S. M. Lea. 2003. Helical structure of the needle of the type III secretion system of Shigella flexneri. J. Biol. Chem. 278:17103-17107. [DOI] [PubMed] [Google Scholar]
  • 13.Cornelis, G. R. 2002. The Yersinia Ysc-Yop ‘type III’ weaponry. Nat. Rev. Mol. Cell Biol. 3:742-752. [DOI] [PubMed] [Google Scholar]
  • 14.Cornelis, G. R. 2003. How Yops find their way out of Yersinia. Mol. Microbiol. 50:1091-1094. [DOI] [PubMed] [Google Scholar]
  • 15.Cornelis, G. R., and F. Van Gijsegem. 2000. Assembly and function of type III secretory systems. Annu. Rev. Microbiol. 54:735-774. [DOI] [PubMed] [Google Scholar]
  • 16.Daniels, M. J., C. E. Barber, P. C. Turner, M. K. Sawczyc, R. J. W. Byrde, and A. H. Fielding. 1984. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid pLAFR1. EMBO J. 3:3323-3328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.da Silva, A. C. R., J. A. Ferro, F. C. Reinach, C. S. Farah, L. R. Furlan, R. B. Quaggio, C. B. Monteiro-Vitorello, M. A. Van Sluys, N. F. Almeida, Jr., L. M. C. Alves, A. M. do Amaral, M. C. Bertolini, L. E. A. Camargo, G. Camarotte, F. Cannavan, J. Cardozo, F. Chambergo, L. P. Ciapina, R. M. B. Cicarelli, L. L. Coutinho, J. R. Cursino-Santos, H. El-Dorry, J. B. Faria, A. J. S. Ferreira, R. C. C. Ferreira, M. I. T. Ferro, E. F. Formighieri, M. C. Franco, C. C. Greggio, A. Gruber, A. M. Katsuyama, L. T. Kishi, R. P. Leite, Jr., E. G. M. Lemos, M. V. F. Lemos, E. C. Locali, M. A. Machado, A. M. B. N. Madeira, N. M. Martinez-Rossi, E. C. Martins, J. Meidanis, C. F. M. Menck, C. Y. Miyaki, D. H. Moon, L. M. Moreira, M. T. M. Novo, V. K. Okura, M. C. Oliveira, V. R. Oliveira, H. A. Pereira, Jr., A. Rossi, J. A. D. Sena, C. Silva, R. F. de Souza, L. A. F. Spinola, M. A. Takita, R. E. Tamura, E. C. Teixeira, R. I. D. Tezza, M. Trindade dos Santos, D. Truffi, S. M. Tsai, F. F. White, J. C. Setubal, and J. P. Kitajima. 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature 417:459-463. [DOI] [PubMed] [Google Scholar]
  • 18.Ditta, G., S. Stanfield, D. Corbin, and D. R. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Escolar, L., G. Van den Ackerveken, S. Pieplow, O. Rossier, and U. Bonas. 2001. Type III secretion and in planta recognition of the Xanthomonas avirulence proteins AvrBs1 and AvrBsT. Mol. Plant Pathol. 2:287-296. [DOI] [PubMed] [Google Scholar]
  • 20.Fenselau, S., I. Balbo, and U. Bonas. 1992. Determinants of pathogenicity in Xanthomonas campestris pv. vesicatoria are related to proteins involved in secretion in bacterial pathogens of animals. Mol. Plant-Microbe Interact. 5:390-396. [DOI] [PubMed] [Google Scholar]
  • 21.Fenselau, S., and U. Bonas. 1995. Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. Plant-Microbe Interact. 8:845-854. [DOI] [PubMed] [Google Scholar]
  • 22.Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Furutani, A., S. Tsuge, K. Ohnishi, Y. Hikichi, T. Oku, K. Tsuno, Y. Inoue, H. Ochiai, H. Kaku, and Y. Kubo. 2004. Evidence for HrpXo-dependent expression of type II secretory proteins in Xanthomonas oryzae pv. oryzae. J. Bacteriol. 186:1374-1380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Gophna, U., E. Z. Ron, and D. Graur. 2003. Bacterial type III secretion systems are ancient and evolved by multiple horizontal-transfer events. Gene 312:151-163. [DOI] [PubMed] [Google Scholar]
  • 25.Hacker, J., and J. B. Kaper. 2000. Pathogenicity islands and the evolution of microbes. Annu. Rev. Microbiol. 54:641-679. [DOI] [PubMed] [Google Scholar]
  • 26.He, S. Y., and Q. Jin. 2003. The Hrp pilus: learning from flagella. Curr. Opin. Microbiol. 6:15-19. [DOI] [PubMed] [Google Scholar]
  • 27.Hotson, A., and M. B. Mudgett. 2004. Cysteine proteases in phytopathogenic bacteria: identification of plant targets and activation of innate immunity. Curr. Opin. Plant Biol. 7:384-390. [DOI] [PubMed] [Google Scholar]
  • 28.Hu, W., J. Yuan, Q. L. Jin, P. Hart, and S. Y. He. 2001. Immunogold labeling of Hrp pili of Pseudomonas syringae pv. tomato assembled in minimal medium and in planta. Mol. Plant-Microbe Interact. 14:234-241. [DOI] [PubMed] [Google Scholar]
  • 29.Huguet, E., and U. Bonas. 1997. hrpF of Xanthomonas campestris pv. vesicatoria encodes an 87-kDa protein with homology to NolX of Rhizobium fredii. Mol. Plant-Microbe Interact. 10:488-498. [DOI] [PubMed] [Google Scholar]
  • 30.Huguet, E., K. Hahn, K. Wengelnik, and U. Bonas. 1998. hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host-specific hypersensitive reaction. Mol. Microbiol. 29:1379-1390. [DOI] [PubMed] [Google Scholar]
  • 31.Jin, Q., and S. Y. He. 2001. Role of the Hrp pilus in type III protein secretion in Pseudomonas syringae. Science 294:2556-2558. [DOI] [PubMed] [Google Scholar]
  • 32.Jin, Q., W. Hu, I. Brown, G. McGhee, P. Hart, A. L. Jones, and S. Y. He. 2001. Visualization of secreted Hrp and Avr proteins along the Hrp pilus during type III secretion in Erwinia amylovora and Pseudomonas syringae. Mol. Microbiol. 40:1129-1139. [DOI] [PubMed] [Google Scholar]
  • 33.Jobling, M. G., and R. K. Holmes. 1990. Construction of vectors with the p15a replicon, kanamycin resistance, inducible lacZ alpha and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18:5315-5316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kaniga, K., I. Delor, and G. R. Cornelis. 1991. A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109:137-141. [DOI] [PubMed] [Google Scholar]
  • 35.Klement, Z. 1982. Hypersensitivity, p. 149-177. In M. S. Mount and G. H. Lacy (ed.), Phytopathogenic prokaryotes, vol. 2. Academic Press, New York, N.Y.
  • 36.Knoop, V., B. Staskawicz, and U. Bonas. 1991. Expression of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria is not under the control of hrp genes and is independent of plant factors. J. Bacteriol. 173:7142-7150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Koebnik, R. 2001. The role of bacterial pili in protein and DNA translocation. Trends Microbiol. 9:586-590. [DOI] [PubMed] [Google Scholar]
  • 38.Krishnan, H. B., J. Lorio, W. S. Kim, G. Jiang, K. Y. Kim, M. DeBoer, and S. G. Pueppke. 2003. Extracellular proteins involved in soybean cultivar-specific nodulation are associated with pilus-like surface appendages and exported by a type III protein secretion system in Sinorhizobium fredii USDA257. Mol. Plant-Microbe Interact. 16:617-625. [DOI] [PubMed] [Google Scholar]
  • 39.Kubori, T., Y. Matsushima, D. Nakamura, J. Uralil, M. Lara-Tejero, A. Sukhan, J. E. Galan, and S. I. Aizawa. 1998. Supramolecular structure of the Salmonella typhimurium type III protein secretion system. Science 280:602-605. [DOI] [PubMed] [Google Scholar]
  • 40.Li, C. M., I. Brown, J. Mansfield, C. Stevens, T. Boureau, M. Romantschuk, and S. Taira. 2002. The Hrp pilus of Pseudomonas syringae elongates from its tip and acts as a conduit for translocation of the effector protein HrpZ. EMBO J. 21:1909-1915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Marie, C., W. J. Deakin, V. Viprey, J. Kopciñska, W. Golinowski, H. B. Krishnan, X. Perret, and W. J. Broughton. 2003. Characterization of Nops, nodulation outer proteins, secreted via the type III secretion system of NGR234. Mol. Plant-Microbe Interact. 16:743-751. [DOI] [PubMed] [Google Scholar]
  • 42.Michiels, T., P. Wattiau, R. Brasseur, J. M. Ruysschaert, and G. R. Cornelis. 1990. Secretion of Yop proteins by Yersiniae. Infect. Immun. 58:2840-2849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Minsavage, G. V., D. Dahlbeck, M. C. Whalen, B. Kearney, U. Bonas, B. J. Staskawicz, and R. E. Stall. 1990. Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria-pepper interactions. Mol. Plant-Microbe Interact. 3:41-47. [Google Scholar]
  • 44.Nguyen, L., I. T. Paulsen, J. Tchieu, C. J. Hueck, and M. H. Saier, Jr. 2000. Phylogenetic analyses of the constituents of type III protein secretion systems. J. Mol. Microbiol. Biotechnol. 2:125-144. [PubMed] [Google Scholar]
  • 45.Noël, L., F. Thieme, J. Gäbler, D. Büttner, and U. Bonas. 2003. XopC and XopJ, two novel type III effector proteins from Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 185:7092-7102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Noël, L., F. Thieme, D. Nennstiel, and U. Bonas. 2001. cDNA-AFLP analysis unravels a genome-wide hrpG-regulon in the plant pathogen Xanthomonas campestris pv. vesicatoria. Mol. Microbiol. 41:1271-1281. [DOI] [PubMed] [Google Scholar]
  • 47.Noël, L., F. Thieme, D. Nennstiel, D., and U. Bonas. 2002. Two novel type III-secreted proteins of Xanthomonas campestris pv. vesicatoria are encoded within the hrp pathogenicity island. J. Bacteriol. 184:1340-1348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ojanen-Reuhs, T., N. Kalkkinen, B. Westerlund-Wikstrom, J. van Doorn, K. Haahtela, E. L. Nurmiaho-Lassila, K. Wengelnik, U. Bonas, and T. K. Korhonen. 1997. Characterization of the fimA gene encoding bundle-forming fimbriae of the plant pathogen Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 179:1280-1290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Roine, E., W. Wei, J. Yuan, E. L. Nurmiaho-Lassila, N. Kalkkinen, M. Romantschuk, and S. Y. He. 1997. Hrp pilus: an hrp-dependent bacterial surface appendage produced by Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA 94:3459-3464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Romantschuk, M., E. Roine, and S. Taira. 2001. Hrp pilus: reaching through the plant cell wall. Eur. J. Plant Pathol. 107:153-160. [Google Scholar]
  • 51.Rossier, O., G. Van den Ackerveken, and U. Bonas. 2000. HrpB2 and HrpF from Xanthomonas are type III-secreted proteins and essential for pathogenicity and recognition by the host plant. Mol. Microbiol. 38:828-838. [DOI] [PubMed] [Google Scholar]
  • 52.Rossier, O., K. Wengelnik, K. Hahn, and U. Bonas. 1999. The Xanthomonas Hrp type III system secretes proteins from plant and mammalian bacterial pathogens. Proc. Natl. Acad. Sci. USA 96:9368-9373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Saier, M. H., Jr. 2004. Evolution of bacterial type III protein secretion systems. Trends Microbiol. 12:113-115. [DOI] [PubMed] [Google Scholar]
  • 54.Schägger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379. [DOI] [PubMed] [Google Scholar]
  • 55.Schulte, R., and U. Bonas. 1992. Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J. Bacteriol. 174:815-823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Sekiya, K., M. Ohishi, T. Ogino, K. Tamano, C. Sasakawa, and A. Abe. 2001. Supermolecular structure of the enteropathogenic Escherichia coli type III secretion system and its direct interaction with the EspA-sheath-like structure. Proc. Natl. Acad. Sci. USA 98:11638-11643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Van den Ackerveken, G., E. Marois, and U. Bonas. 1996. Recognition of the bacterial avirulence protein AvrBs3 occurs inside the host plant cell. Cell 87:1307-1316. [DOI] [PubMed] [Google Scholar]
  • 59.Van Gijsegem, F., J. Vasse, J. C. Camus, M. Marenda, and C. Boucher. 2000. Ralstonia solanacearum produces hrp-dependent pili that are required for PopA secretion but not for attachment of bacteria to plant cells. Mol. Microbiol. 36:249-260. [DOI] [PubMed] [Google Scholar]
  • 60.Van Gijsegem, F., J. Vasse, R. De Rycke, P. Castello, and C. Boucher. 2002. Genetic dissection of Ralstonia solanacearum hrp gene cluster reveals that the HrpV and HrpX proteins are required for Hrp pilus assembly. Mol. Microbiol. 44:935-946. [DOI] [PubMed] [Google Scholar]
  • 61.Wengelnik, K., and U. Bonas. 1996. HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 178:3462-3469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Wengelnik, K., C. Marie, M. Russel, and U. Bonas. 1996. Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction ofthe hypersensitive reaction. J. Bacteriol. 178:1061-1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Wengelnik, K., O. Rossier, and U. Bonas. 1999. Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J. Bacteriol. 181:6828-6831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Wengelnik, K., G. Van den Ackerveken, and U. Bonas. 1996. HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol. Plant-Microbe Interact. 9:704-712. [DOI] [PubMed] [Google Scholar]
  • 65.Yonekura, K., S. Maki, D. G. Morgan, D. J. DeRosier, F. Vonderviszt, K. Imada, and K. Namba. 2000. The bacterial flagellar cap as the rotary promoter of flagellin self-assembly. Science 290:2148-2152. [DOI] [PubMed] [Google Scholar]
  • 66.Yonekura, K., S. Maki-Yonekura, and K. Namba. 2003. Complete atomic model of the bacterial flagellar filament by electron cryomicroscopy. Nature 424:643-650. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES