Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Nov 1.
Published in final edited form as: J Med Virol. 2024 Nov;96(11):e70088. doi: 10.1002/jmv.70088

Targeting HSP70-E7 Interaction with SHetA2: A Novel Therapeutic Strategy for Cervical Cancer

Justin Garland 1, Showket Hussain 2,3, Rajani Rai 3, Amy L Kennedy 1, Zitha Redempta Isingizwe 3, Doris M Benbrook 1,3,*
PMCID: PMC11633939  NIHMSID: NIHMS2036868  PMID: 39588793

Abstract

Cervical cancer is predominantly driven by persistent infections with high-risk human papillomavirus (HR-HPV) and the continuous activity of its E6 and E7 oncoproteins. This study explored the role of heat shock proteins 70 kDa (HSP70s) in enhancing the function of these oncoproteins and examined the impact of SHetA2, an investigational new drug, on this interaction. We found that HSP70 specifically binds to E7, but not E6, protein and that SHetA2 disrupts this binding. This disruption led to a significant reduction in E6 and E7 mRNA and E7 protein levels, while effects on E6 protein levels were minimal. SHetA2 treatment also resulted in altered levels of cell cycle regulatory proteins, reduced cell cycle progression, and decreased metabolic viability in cervical cancer cell lines and xenograft models. These findings support the potential of SHetA2 to impair cervical cancer progression by targeting HSP70/E7 interactions, highlighting its promise as a therapeutic strategy for treating cervical cancer.

Keywords: Human Papillomavirus, HPV, E7, Cervical Cancer, SHetA2, Investigational New Drug, Heat Shock Protein 70, HSP70, Proteasomal degradation

1 |. INTRODUCTION

Continuous expression of the high-risk human papillomavirus (HR-HPV) early E6 and E7 genes drives cervical cancer development and maintenance.1 Persistent expression of early E6 and E7 genes from HR-HPV is crucial for the development and maintenance of cervical cancer. Although most HR-HPV infections are transient and non-progressive, those that persist can lead to cervical intraepithelial neoplasia (CIN), a precursor to cancer which, if left untreated, may evolve into malignancy. In 2018, an estimated 13 out of every 100,000 women worldwide were diagnosed with cervical cancer, ranking it as the fourth most common cancer among women.2 Persistent infection with HR-HPV is the causative factor in approximately 99.7% of cervical cancer cases.3 Among the 20 HR-HPV types identified in women with cervical cancer, HPV 16 and HPV 18 are the most significant, accounting for approximately 70% of all cases.

Primary drivers of the oncogenic mechanisms of HR-HPV E6 and E7 oncoproteins involve their manipulation of the cellular p53 and retinoblastoma (pRb) tumor suppressor proteins, respectively, leading to increased cell proliferation and survival.1,4 Attempts to inhibit E6 and E7 have been hindered by their protein structures, which have previously been considered “undruggable”.5 There are natural compounds that have demonstrated some promise in interfering with E6 and E7 function, but these compounds are still in the preliminary stages of research.6–10 Another approach has been to develop synthetic drugs that inhibit E6 or E7 protein-protein interactions (PPI).9,11,12 Inhibition of E6 PPI with E6AP leads to the recovery of p53 protein levels and cell death in cervical cancer.12,13 Similarly, inhibition of E7 PPI with pRb leads to recovery of total pRb levels and cell cycle arrest.14 These preliminary data suggest that reduction of HR-HPV E6 or E7 proteins could also allow recovery of cellular p53 and pRb protein levels leading to reinstatement of their tumor suppressor effects.

Another candidate strategy for interfering with HR-HPV E6 or E7 oncoproteins is to increase their degradation in cells. The primary mechanism of degradation of both E6 and E7 occurs through the proteasome.15,16 Heat shock proteins 70 kDa (HSP70s) are chaperones that can promote or interfere with proteasomal degradation of their client proteins.17 In most instances, HSP70s bind to their client proteins and support their establishment and maintenance of functionally folded states, stability, complex formation and intracellular localization, thereby reducing their exposure to proteasomal degradation. Sulfur heteroarotinoid A2 (SHetA2, NSC 726189) is a novel investigational new drug that disrupts HSP70/client oncoprotein complexes leading to degradation or subcellular relocalization of the client oncoproteins.18 Specifically, SHetA2 binds to three of the HSP70s: Glucose Regulated Protein 78 (Grp78) encoded by the HSPA5 gene, heat shock cognate 70 (hsc70) encoded by the HSPA8 gene, and mortalin encoded by the HSPA9 gene.19 Treatment of cells with SHetA2 caused hsc70 or mortalin release of client proteins, leading to altered client protein stability or intracellular re-localization.19–21 Based on promising preclinical studies, oral SHetA2 capsules are being evaluated in a Phase 1 clinical trial in patients with advanced and recurrent solid tumors (ClinicalTrials.gov ID NCT04928508).

In this study, we tested the strategy of using SHetA2 to reduce HR-HPV E6 or E7 oncoproteins in cells by disrupting their potential protection by HSP70s. This strategy is supported by the observation of expected downstream consequences of HR-HPV E7 degradation in SHetA2 treated cervical cancer cells and xenograft tumors, including upregulation of pRb phosphorylation in association with growth inhibition.22

2 |. METHODS

2.1 |. Cell Lines

Caski (RRID : CVCL_1100), SiHa (RRID : CVCL_0032), and C33A (RRID : CVCL_1094) cell lines [American Type Culture Collection (ATCC), Manassas, VA,USA] were grown in RPMI medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. ME180 (RRID : CVCL_1401, ATCC) cells were grown in McCoy’s 5A medium supplemented with 10% FBS and 1% penicillin/streptomycin. C-4-II (RRID : CVCL_1095, ATCC) cells were grown in Dulbecco′s Modified Eagle′s Medium (DMEM) supplemented with 10% FBS and 1% penicillin/streptomycin. All cell lines were purchased within the last three years and used within 20 passages when verified as mycoplasma-free.

2.1 |. Reagents

MG132 (474790, Sigma-Aldrich, St. Louis, MO, USA) and SHetA2 (synthesized by K. Darrell Berlin at Oklahoma State University, Stillwater, OK, USA) were dissolved in dimethyl sulfoxide (DMSO) (D8418–500ML, Sigma-Aldrich). For cell culture 10 μM MG132 and 5 μM SHetA2 were used, unless otherwise specified. For controls, cells were treated with an equal amount of DMSO according to the maximum drug dose. For animal model studies, SHetA2 (NSC 726189; provided by the US National Cancer Institute RAPID Program) was suspended in 30% W/V Kolliphor HS 15 (42966, Sigma-Aldrich) in water.

2.2 |. RT-qPCR

Total RNA was extracted using TRIzol reagent and the RNeasy Mini Kit (#74104; Qiagen, Venlo, Netherlands). The RNA concentration was determined using a Nanodrop ND-100 Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA was generated from 100 ng of total RNA using the iScript cDNA Synthesis Kit (1708890, Bio-Rad, Hercules, CA, USA). The cDNA was then combined with 2x EvaGreen Bullseye Real Time qPCR Master Mix (BEQPCR-S, MidSci, Fenton, MO, USA), 10 μM of forward and reverse primers, and brought to a final volume of 20 μL with RNase-free water. The primer sequences used were as follows: HPV 16 E6, forward 5’ CTGCAATGTTTCAGGACCCA 3’ and reverse 5’ TCATGTATAGTTGTTTGCAGCTCTGT 3’; HPV 16 E7, forward 5’ AAGTGTGACTCTACGCTTCGGTT 3’ and reverse 5’ GCCCATTAACAGGTCTTCCAAA 3’; GAPDH, forward 5’ ACAGTCAGCCGCATCTTCTT 3’, and reverse 5’ CTGGAAGATGGTGATGGGAT 3’. PCR reactions were then run on the Bio-Rad CFX 96 Real-Time PCR system (Bio-Rad). Relative mRNA expression levels were determined using the difference in the normalized cycle threshold (Ct) values after normalization.

2.3 |. Western blots

Whole cell protein extracts of cervical cancer cells were collected using mPER (78501, ThermoFisher, Waltham, MA, USA) containing 1% phosphatase inhibitor cocktail (4906845001 Sigma-Aldrich) and 1% protease inhibitor cocktail (5892791001). The total protein in the samples was determined using a BCA Assay Kit (23225, ThermoFisher). Equal protein levels (25 μg) were added to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to polyvinylidene difluoride (PVDF) membranes using a Trans-Blot Turbo Transfer System (Bio-Rad). The membranes were blocked with EveryBlot Blocking Buffer for 5 minutes (12010020, Bio-Rad). The membranes were incubated overnight with primary antibodies in TBST containing 1% bovine serum albumin (BSA). The following primary antibodies were purchased from Cell Signaling Technology (CST, Danvers, MA, USA): cyclophilin B loading control (43603), Rb (4H1) (9309), p16INKa (E6N8P) (18769), β-actin (4967), and HSP70 (4872). The following primary polyclonal antibodies were purchased from Santa Cruz Biotechnology (SCBT, Dallas, TX, USA): HPV 16 E7 (sc-6981) and HPV 16/HPV 18 E6 (sc-460). The HPV 16 E6 primary polyclonal antibody (BS-0990R) was purchased from ThermoFisher. After washing, the membranes were incubated with HRP-conjugated anti-rabbit (7074, CST at 1:5000 dilution) or anti-mouse antibody (7076, CST, at 1:5000 dilution) for one hour at room temperature. Proteins were visualized using an electrochemical luminescence reagent (Clarity™ Western ECL Substrate) (1705060S, Bio-Rad,) on a ChemiDoc Touch Imaging System (Bio-Rad).

2.4 |. Proximity Ligation Assays

Duolink® PLA Reagents were purchased and protocols followed according to the manufacturer’s instructions (DUO92004–100RXN, DUO92002–100RXN, DUO92008–30RXN, Sigma-Aldrich). Cervical cancer cell lines were seeded (1 × 105) into chamber slides and treated with DMSO. The cells were then rinsed with phosphate-buffered saline (PBS) and fixed in ice-cold methanol (100%) for 10 min. Cells were washed with PBS (2x), permeabilized with 0.1% Triton X-100 in PBS (PBST) for 10 min and incubated in the PLA blocking reagent for one-hour at room temperature. The cells were then incubated with the primary antibody overnight. The primary antibodies E6 (sc-460, SCBT) and E7 (sc-65711, SCBT) were used for Caski and SiHa. The primary antibodies E6 (sc-365089, SCBT) and E7 (PA5–117384, ThermoFisher) were used for C4-II. The HSP70 antibody (4872, CST, at 1:1000 dilution) was used for all cell lines. The ligation assay was performed the following day as previously described.23

2.5 |. Cell Cycle Analysis

Cervical cancer cell lines were treated with 10 μM SHetA2 or DMSO. After 24 hours of incubation, single cell suspensions of the cultures were generated by treating with trypsin, washing with PBS. Then cells were strained through a 35-micron filter and incubated on ice in 100% ethanol for 20 minutes. For SiHa, the incubation was extended to 48 hours to observe cell cycle profile changes. After incubation, cells were stained with propidium iodide (PI) (0.5 μg/mL RNase A, 50 μg/mL PI and 1% Triton X-100) and flow cytometry was performed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA).

2.6 |. Animal Model

All animal investigations followed the guidelines that were required for the care and use of laboratory animals and were approved by the University of Oklahoma Health Sciences Center Institutional Animal Care and Use Committee (IACUC Protocol #19–009-CHI). Female athymic mice (Nude-Foxn1nu mice ENVIGO, Alice, TX, USA) were subcutaneously injected with 1 × 107 CaSki cells suspended in PBS). Tumor sizes were then measured using calipers, and the rate of tumor growth was calculated until a humane endpoint was determined at 55 days. Mice were randomized, with eight animals in each group. Animals were treated by oral gavage with SHetA2 or Kolliphor control every day for 55 days. Tumors, kidneys, liver, and spleen were collected and weighed during necropsy.

2.7 |. Immunofluorescent Analysis

Tumor tissues from xenograft tumor models were formalin-fixed and paraffin-embedded, and the resulting blocks were sectioned onto microscope slides. The sections were deparaffinized using xylene and a series of ethanol dilutions. Antigen retrieval was performed using VisUcyte antigen retrieval solution (VCTS023, R&D systems, Minneapolis, MN, USA). Non-specific binding was blocked using horse serum albumin and anti-mouse F(ab) (ab6668, Abcam, Cambridge, United Kingdom) to prevent cross reactivity between the primary antibodies and mouse tissue. Primary incubation was performed at 4°C overnight using either p16 (18769, CST), Rb (9309, CST), or E7 (sc-65711, SCBT). Washing was performed using PBST, and secondary incubation was performed at room temperature using anti-mouse Alexa 488 (ab150077, Abcam). Prolong Gold mounting media with DAPI was then added and allowed to cure for 24 hours. Imaging was performed using a Leica SP8 confocal imaging microscope.

2.8 |. Statistical analysis

All experiments, unless otherwise stated, were performed at least in triplicate, and repeated three independent times. Data are shown as mean ± SD, unless otherwise stated. One-way way ANOVA and Student’s t-test were used to compare the mean between three or more groups and two groups, respectively. Statistical significance was set at p < 0.05. Analyses were performed using Prism 8 software (RRID:SCR_002798, GraphPad, Boston, MA, USA,).

3 |. RESULTS

3.1 |. SHetA2 regulation E6 and E7 in cervical cancer cells

Effects of SHetA2 on expression the E6 and E7 mRNA and proteins were determined by rt-qPCR and western blot in the HPV 16 positive cervical cancer cell lines, Caski and SiHa. Treatment with 5 μM SHetA2 caused significant decreases in both E6 and E7 mRNA expression, but only caused a significant decrease in E7 protein levels, with no significant effect on E6 protein levels (Figure 1A–B). The effects were shown to be not limited to the HPV 16 type, as E7, and not E6, protein reduction was similarly exerted by SHetA2 in C4-II cells, which harbor the HPV 18 subtype (Figure 1B). A similar pattern of E7 reduction and E6 stability was observed in the ME180 cell line, which harbors the HPV68 subtype (Figure S1A–B). However, since there are no commercially available antibodies for HPV 68 E6 or E7 proteins, the HPV 18 E6 or E7 antibodies were used. It is important to note that even though this antibody used is not validated for being able to recognize HPV 68 E6 and E7 proteins, the downstream consequences of E7 reduction that were observed in the HPV 16, or 18 positive cell lines were also observed in ME180 (Figure S1C).

Figure 1. SHetA2 regulation of HR-HPV E6/E7 expression.

Figure 1.

Open in a new tab

A) qPCR analysis of HPV E6/E7 mRNA levels in CaSki and SiHa cell lines after treatment with 5 μM SHetA2 for 24 hours or the same volume of DMSO solvent. B) Western Blot analysis of HPV E6 or E7 protein levels in CaSki, C4-II and SiHa cell lines after treatment with 5 μM SHetA2 for 24 hours or the same volume of DMSO solvent. T-tests were used to determine significance between treatment groups.: ns = not significant, p value >0.05 and <0.01, * = p < 0.05, ** = p < 0.01.

3.2 |. SHetA2 disrupts HSP70/hsc70 interaction with HR-HPV E7 and causes HR-HPV E7 degradation.

Based on the selective reduction of E7, and not E6, protein observed in SHetA2-treated cervical cancer cells, we predicted that E7, and not E6, protein is protected by HSP70 chaperone interaction, and that SHetA2 disrupts the HSP70/E7 interaction. To test this prediction, we used a proximity ligation assay with an antibody that recognizes both Hsp70 (HSPA1) and hsc70 (Figure 2A–B). The HSP70 proteins were detected for association with either HPV E7 (Figure 2A) or HPV E6 (Figure 2B) in multiple cell lines. Due to the 85% homology of the Hsp70 and hsc70 proteins, an antibody that can differentiate between the two has not yet been developed. In this ligation assay, the detection of positive focal point signals in the control-treated cells indicates interaction of these HSP70 proteins to HR-HPV E7, while reduction of the focal point signals in SHetA2-treated cells indicates SHetA2 disruption of the HSP70/E7 complexes. Significant elevation of the focal point signals by treatment with the MG132 proteasomal inhibitor indicates that inhibition of E7 proteasomal degradation causes higher E7 levels, and the availability of HSP70 to bind them. SHetA2 was also able to disrupt HSP70/E7 complexes in the presence of MG132. The effects of SHetA2 on E6 protein, however, were different. There was either a non-significant change or slight increase of HSP70/E6 interactions during SHetA2 treatment (Figure 2B).

Figure 2. Degradation of E7 is partially induced by inhibiting the interaction ability of the HSP70 family and their client proteins.

Figure 2.

Open in a new tab

–Caski, C4-II, and SiHa cells were plated at a concentration of 1×105 cells on an eight-chambered microscope slide. A) A proximity ligation assay was performed to determine interaction between E7 and hsp70. Red spots indicate a site where protein-protein interaction occurs. All treatments were performed for 24 hours, and SHetA2 or DMSO concentrations were 5uM. B) The same ligation assay was performed to determine the interaction between E6 and hsp70. Quantification of imaging results: One-way ANOVA was used to determine significance between each of the groups: ns = not significant, p value >0.05 and <0.01, * = p < 0.05, ** = p < 0.01

3.3 |. SHetA2 molecular and cellular effects are consistent with consequences of E7 protein degradation.

Consistent with the known E7 upregulation of p1624, SHetA2 reduction of E7 protein levels was associated with reduction of p16 protein levels in HR-HPV positive cell lines and upregulation of p16 in the HPV-negative C33A cell line as demonstrated by western blot (Figure 3A) and immunofluorescence cell staining (Figure 3B).

Figure 3. The overexpression of p16 is modulated during SHetA2 treatment.

Figure 3.

Open in a new tab

– A) Caski, C33A, C4-II, and SiHa cells were treated with SHetA2. Protein was isolated and ran for Western blot analysis. Results are demonstrated in triplicate and quantified against GAPDH as a loading control. All treatments were performed for 24 hours, and SHetA2 or DMSO concentrations were 5uM. B) Four cervical cancer cell lines were treated with SHetA2 and tested for p16 using immunofluorescent confocal imaging. T-tests were used to determine significance between treatment groups.: ns = not significant, p value >0.05 and <0.01, * = p < 0.05.

SHetA2 has been demonstrated in multiple cancer types to inhibit metabolic cell viability and induce cell cycle arrest. This has been shown to be caused by cyclin D1 degradation during SHetA2 treatment in ovarian cancer cells.25 In this study, SHetA2 reduced the metabolic viability of cervical cancer cell lines with half-maximal inhibitory concentrations in the micromolar range, with ME180 being the most sensitive and SiHa being the most resistant (Figure 4A). SHetA2 significantly inhibited cell cycle progression causing G1-phase cell-cycle arrest in C33A and Caski cell lines, while having no effect on the cell cycle profile of SiHa at 24 hours but causing G2 arrest at 48 hours of treatment (Figure 4B). During cell cycle progression, cyclins play key roles in the transitions through each phase. The cyclin D1, cyclin dependent kinase (CDK)4, and CDK6 are involved in the G1/S transition.26 The cyclin A1, phosphorylated cell division control 2 (pCDC2), and CDK2 are associated with S/G2 transition.26 There are also CDK inhibitor proteins, such as p27, that function as a molecular break during these phase transitions.27 Furthermore, SHetA2 significantly reduced cyclins D1, A, B1, CDK2, CDK4, CDK6 and pCDC2, and increased p27 in all cell lines evaluated, except for SiHa (Figure 4C–D). Consistent with the lesser SHetA2-senstivity of SiHa in comparison to the other cell lines, cyclin D1 was undetectable by western blot, while SHetA2 increased CDK6 and p27 and did not affect cyclin A in SiHa.

Figure 4. SHetA2 leads to cell cycle arrest and modulation of cell cycle proteins in multiple cervical cancer cell lines.

Figure 4.

Open in a new tab

– A) C33A, Caski, and SiHa cells were treated with 10 μM SHetA2 for 24 hours for all cell lines, except for SiHa, which was treated for 48 hours, and cell cycle analysis using flow cytometry was performed. B) All cervical cancer cell lines were treated with 10 μM SHetA2 for 48 hours and probed for several cell cycle related proteins. C) Quantified results of western blot data in panel B. T-tests were used to determine significance between treatment groups.: ns = not significant, p value >0.05 and <0.01, * = p < 0.05, ** = p < 0.01, *** p < 0.001, **** p < 0.0001.

3.4 |. SHetA2 reduction of tumor growth is associated with reduction of HPV E7 protein.

SHetA2 has been demonstrated to significantly reduce growth of xenograft tumors established with the SiHa cell line at a dose of 60 mg/kg/day.21,22,28 In this study, we used the reduced dose of 30 mg/kg/day to ensure that a sufficient amount of tumor tissue would be available for mechanistic studies at the end of the experiment (Figure 5A). Treatment of mice harboring Caski xenograft tumors with 30 mg/kg SHetA2 significantly reduced tumor size (Figure 5B), with no effect on total body weight (Figure 5C), consistent with the SHetA2 efficacy and lack of toxicity observed in previous studies. Immunofluorescent staining of tissue from the xenograft tumors demonstrated the presence of E7 and p16 proteins in tumor isolated from the control group and no-to-barely detectable E7 and p16 proteins in tumors from the SHetA2 treated group (Figure 5D). Furthermore, tumors from the SHetA2-treated group exhibited rescued levels of Rb when compared to the control group (Figure 5D). Similar E7 reduction, pRb upregulation, but no effect on p16 levels were observed in SiHa xenograft tumors collected in an independent, previously-published model22, with a larger sample size (n=8) and a final tumor volume that was significantly decreased in the SHetA2 group compared to that in the untreated control group (Figure 5E).

Figure 5. In vivo model supports effectiveness of SHetA2 in Caski tumor.

Figure 5.

Open in a new tab

– A) Schematic of Caski animal model. Animals were injected with 1 × 106 Caski cells and two weeks were allowed for tumors to grow. Mice were treated with 30 mg/kg until end of study. Caski tumors were measured over the period of the study every 2–3 days. B) The final measurement of tumors demonstrates a decrease in the SHetA2 group. C) Body weights were not significantly different by end of study. D) Immunofluorescent confocal imaging was performed on Caski tissue and probed for E7, p16, and Rb. E) SiHa tumor protein was isolated and run through western blot analysis, a reduction in E7 protein is observed in the SHetA2 group. T-tests were used to determine significance between treatment groups.: ns = not significant, p value >0.05 and <0.01, * = p < 0.05, ** = p < 0.01, *** p < 0.001, **** p < 0.0001.

4 |. DISCUSSION

Our research uncovers a novel mechanism by which SHetA2 treatment inhibits cervical cancer progression, specifically targeting the cell cycle and metabolic viability by disrupting HSP70/E7 complexes. This study uniquely demonstrates that HSP70 specifically binds to and protects the HR-HPV E7, but not E6, oncoprotein shielding it from proteasomal degradation. Heat shock proteins bind to a vast array of client proteins to assure functional protein folding, reverse protein misfolding and provide higher levels of protein and protein complex stability.29 Multiple studies have demonstrated the importance of HSP70 family proteins during viral infection and replication.30–32 Given the critical role of heat shock proteins in stabilizing client proteins and preventing misfolding, our findings highlight the significance of HSP70 in viral infections and replication. Importantly, this is the first evidence of a direct interaction between any heat shock protein and the HR-HPV E7 protein. Based on the results presented herein, we propose that disrupting HSP70/E7 complexes can serve as an effective strategy to enhance E7 degradation, thereby reducing cervical cancer cell viability.

In contrast to the differential effects of SHetA2 on E6 and E7 proteins, this investigational new drug significantly reduced the mRNA expression levels of both E6 and E7, which are polycistronically transcribed from a single promoter. This reduction in mRNA expression alone cannot explain the loss of E7 protein in SHetA2-treated cells, as only E7 and not E6 protein expression was lost during its mRNA reduction, and E7, but not E6, was shown to interact with HSP70 and this complex was disrupted by SHetA2. Together, these results demonstrate that SHetA2 inhibits HR-HPV mRNA transcription, in addition to increasing proteasomal degradation of E7. The ability of SHetA2 to inhibit cervical cancer cells and tumors in this study and others, while reducing E7, and not E6, levels demonstrate that targeting E7 alone is a rational target for cervical cancer drug development.28

The protein p16 is highly upregulated during HPV infection and is an indirect consequence of E7 expression.33–36 Canonically, p16 is a CDK inhibitor; however, during HPV infection poorly understood mechanisms arise that create a dependency on p16 expression for cell survival. A reduction in p16 expression can lead to inhibition of cell cycle progression and viability of cervical cancer cells.24,37 In this study, the SHetA2 reduction of p16 in the HR-HPV positive cell lines represents a valid down-stream consequence of E7 protein reduction and demonstrates a rational mechanism for the SHetA2 inhibition of cervical cancer cells and tumors. Interestingly, an increase in p16 was observed in the HPV negative cell line C33A during SHetA2 treatment. A rescue of p16 in non-HPV associated cancers has been associated with cell cycle arrest and possible promotion of senescence.38 This observation supports that during HR-HPV carcinogenesis there is a change in p16 function associated with HPV viral protein expression, and that reduction of p16 protein levels is a candidate pharmacodynamic biomarker of SHetA2.

SHetA2 has been demonstrated to induce G1 cell cycle arrest in multiple other cancer types regardless of HR-HPV status.20,39 This is the first report to demonstrate SHetA2-induced cell cycle arrest in cervical cancer cells. Furthermore, the arrest was associated with altered levels of cell cycle regulatory proteins and rescue of pRb and p16 levels. After 24 hours of treatment with 10 μM SHetA2, 4 of the 5 cell lines evaluated exhibited arrest in the G1 phase of the cell cycle, however the SiHa cell line was not arrested after 24 hours and arrested in the G2 phase at 48 hours of treatment. Among the 5 cell lines evaluated, SiHa exhibited the lowest sensitivity to SHetA2 inhibition of metabolic viability and reduction of cell cycle regulatory proteins. This difference in SHetA2 sensitivity of the SiHa cell line is not likely due to the HPV 16 type in SiHa, because the HPV 16 type Caski cell line exhibited G1 cell cycle arrest in response to SHetA2 treatment. While the cell cycle progression regulatory proteins were increased and the cell cycle inhibition regulatory proteins were decreased in the 4 cell lines exhibiting G1 arrest, SiHa exhibited an SHetA2-induced increase in CDK6, which could have interfered with the G1 cell cycle arrest allowing the cells to progress to G2. Although SiHa was resistant to SHetA2 inhibition of cyclin A, which could have prevented G2 arrest, this was counteracted with SHetA2-inhibition of CDK2 and pCDC2, which are required for G2 cell cycle progression. Another factor contributing to SHetA2-induced cell cycle arrest in all 5 cell lines is the upregulation of p27, which is a known inhibitor of all phases of the cell cycle.33 It is possible that, in HR-HPV-positive cervical cancer cell lines, SHetA2-reduction of cell cycle regulatory proteins is a down-stream consequence of its diminution of E7 levels, as E7 has been demonstrated to increase expression of cyclins and the activity of cyclin dependent kinases.40,41 However, the reduction of each of the cell cycle proteins still occurs in the HPV-negative cell line C33A and in conjunction with the data shown for multiple other cancer types, it is more likely that the mechanism may also be independent of viral activity. In the case of the HR-HPV-positive cell lines, there must be a reduction of both cyclin D1 and HPV E7 to rescue Rb levels and prevent G1/S phase transition as they are both involved in the inhibition of Rb through independent mechanisms.42 43

The current model demonstrates that SHetA2 reduces HSP70/E7 complexes and E7 protein levels, resulting in E7 proteasomal degradation and recovery of cell cycle regulatory proteins, including total pRb and p16 levels in association with reduction of cell cycle progression and metabolic viability (Figure 6). The lack of E6 reduction in this mechanism suggests that targeting E7 alone is a rational mechanism for cervical cancer drug development.

Figure 6.

Figure 6.

Open in a new tab

Description of two alternative Rb pathways altered via treatment of SHetA2 in cervical cancer.

An ongoing phase I clinical trial to determine a safe dose of oral SHetA2 capsules (ClinicalTrials.gov ID NCT04928508) is collecting cervical cancer patient tumor biopsies before and after treatment. Measurement of HR-HPV and cell cycle regulatory protein expression in these tumors could provide clinical validation of the current model. The results of this study support development of SHetA2 as a preventative agent for the development of HR-HPV-induced cervical cancer or other HPV-induced cancers and diseases. In support of this SHetA2 application, inhibition of E6 and E7 viral proteins has been shown to disrupt HPV carcinogenesis.4 Oral bioavailability44–46, primary and secondary in vivo cancer prevention activity47,48, and lack of toxicity49–52 in extensive preclinical models evaluating SHetA2 makes this investigational new drug an ideal candidate for a chemoprevention agent.

In summary, our study confirms that SHetA2 effectively disrupts HSP70’s protective mechanism over the E7 oncoprotein, leading to its degradation. This interference results in significant changes in cell cycle regulation and suppresses both cell proliferation and metabolic viability. The observed reductions in E7 and related cell cycle markers, validated by independent animal studies, underscore the potential of targeting the HSP70/E7 interaction as a therapeutic strategy in cervical cancer. These findings support the development of SHetA2 as a promising candidate for both the prevention and treatment of cervical cancer.

Supplementary Material

Supinfo1

Figure S1. Results for an HPV68 positive cell line: ME180. A) Western blot analysis of HPV E6 or E7 protein levels in ME180 cells after 24 hours of SHetA2 treatment at 5 μM. B) A proximity ligation assay was performed to determine interaction between E7 and hsp70 in the ME180 cell line. C) Western blot analysis and immunofluorescent imaging of p16 in the ME180 cell line. For A) and C) T-tests were used to find significance between groups. For B) a one-way ANOVA was used to determine significance.

Supinfo2

ACKNOWLEDGEMENTS

Research reported in this publication was supported in part by the National Cancer Institute grant R01 CA196200126 awarded to D.M.B. and Cancer Center Support Grant P30CA225520 awarded to the University of Oklahoma Stephenson Cancer Center and used the Molecular Biology and Cytometry Research Shared Resource. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

Conflict of Interest: The authors declare no potential conflicts of interest.

REFERENCES

  • 1.Hoppe-Seyler K, Bossler F, Braun JA, Herrmann AL, Hoppe-Seyler F. The HPV E6/E7 Oncogenes: Key Factors for Viral Carcinogenesis and Therapeutic Targets. Trends in Microbiology. 2018;26(2):158–168. [DOI] [PubMed] [Google Scholar]
  • 2.Arbyn M, Weiderpass E, Bruni L, et al. Estimates of incidence and mortality of cervical cancer in 2018: a worldwide analysis. Lancet Glob Health. 2020;8(2):e191–e203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Walboomers JM, Jacobs MV, Manos MM, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999;189(1):12–19. [DOI] [PubMed] [Google Scholar]
  • 4.Pal A, Kundu R. Human Papillomavirus E6 and E7: The Cervical Cancer Hallmarks and Targets for Therapy. Front Microbiol. 2019;10:3116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Juneja T, Pandya MD, Shah S. Molecular Landscape and Computational Screening of the Natural inhibitors against HPV16 E6 Oncoprotein. Asian Pac J Cancer Prev. 2021;22(8):2461–2469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhao X, Zhang R, Song Z, et al. Curcumin suppressed the proliferation and apoptosis of HPV-positive cervical cancer cells by directly targeting the E6 protein. Phytother Res. 2023. [DOI] [PubMed] [Google Scholar]
  • 7.Ahmad A, Tiwari RK, Mishra P, et al. Antiproliferative and apoptotic potential of Glycyrrhizin against HPV16+ Caski cervical cancer cells: A plausible association with downreguation of HPV E6 and E7 oncogenes and Notch signaling pathway. Saudi J Biol Sci. 2022;29(5):3264–3275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Xie X, Hu L, Liu L, et al. Punicalagin promotes autophagic degradation of human papillomavirus E6 and E7 proteins in cervical cancer through the ROS-JNK-BCL2 pathway. Transl Oncol. 2022;19:101388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chitsike L, Duerksen-Hughes PJ. PPI Modulators of E6 as Potential Targeted Therapeutics for Cervical Cancer: Progress and Challenges in Targeting E6. Molecules. 2021;26(10). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Malecka KA, Fera D, Schultz DC, et al. Identification and characterization of small molecule human papillomavirus E6 inhibitors. ACS Chem Biol. 2014;9(7):1603–1612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bertagnin C, Messa L, Pavan M, et al. A small molecule targeting the interaction between human papillomavirus E7 oncoprotein and cellular phosphatase PTPN14 exerts antitumoral activity in cervical cancer cells. Cancer Letters. 2023;571:216331. [DOI] [PubMed] [Google Scholar]
  • 12.Celegato M, Messa L, Goracci L, et al. A novel small-molecule inhibitor of the human papillomavirus E6-p53 interaction that reactivates p53 function and blocks cancer cells growth. Cancer Letters. 2020;470:115–125. [DOI] [PubMed] [Google Scholar]
  • 13.Martinez-Zapien D, Ruiz FX, Poirson J, et al. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53. Nature. 2016;529(7587):541–545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Caldeira S, Dong W, Tommasino M. Analysis of E7/Rb associations. Methods Mol Med. 2005;119:363–379. [DOI] [PubMed] [Google Scholar]
  • 15.Reinstein E, Scheffner M, Oren M, Ciechanover A, Schwartz A. Degradation of the E7 human papillomavirus oncoprotein by the ubiquitin-proteasome system: targeting via ubiquitination of the N-terminal residue. Oncogene. 2000;19(51):5944–5950. [DOI] [PubMed] [Google Scholar]
  • 16.Li S, Hong X, Wei Z, et al. Ubiquitination of the HPV Oncoprotein E6 Is Critical for E6/E6AP-Mediated p53 Degradation. Front Microbiol. 2019;10:2483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rai R, Kennedy AL, Isingizwe ZR, Javadian P, Benbrook DM. Similarities and Differences of Hsp70, hsc70, Grp78 and Mortalin as Cancer Biomarkers and Drug Targets. Cells. 2021;10(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Benbrook DM. SHetA2 Attack on Mortalin and Colleagues in Cancer Therapy and Prevention. Front Cell Dev Biol. 2022;10:848682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Benbrook DM, Nammalwar B, Long A, et al. SHetA2 interference with mortalin binding to p66shc and p53 identified using drug-conjugated magnetic microspheres. Invest New Drugs. 2013(32):412–423. [Selected for inclusion into GLOBAL MEDICAL DISCOVERY [ISSN 1929–8536] [https://globalmedicaldiscovery.com]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Chandra V, Rai R, Benbrook DM. Utility and Mechanism of SHetA2 and Paclitaxel for Treatment of Endometrial Cancer. Cancers (Basel). 2021;13(10). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rai R, Lightfoot S, Benbrook DM. Manipulation of metabolic responses enhances SHetA2 efficacy without toxicity in cervical cancer cell lines and xenografts. Gynecol Oncol. 2023;180:44–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kennedy AL, Rai R, Isingizwe ZR, Zhao YD, Lightfoot SA, Benbrook DM. Complementary Targeting of Rb Phosphorylation and Growth in Cervical Cancer Cell Cultures and a Xenograft Mouse Model by SHetA2 and Palbociclib. Cancers (Basel). 2020;12(5). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hegazy M, Cohen-Barak E, Koetsier JL, et al. Proximity Ligation Assay for Detecting Protein-Protein Interactions and Protein Modifications in Cells and Tissues in Situ. Curr Protoc Cell Biol. 2020;89(1):e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.McLaughlin-Drubin ME, Park D, Munger K. Tumor suppressor p16INK4A is necessary for survival of cervical carcinoma cell lines. Proc Natl Acad Sci U S A. 2013;110(40):16175–16180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Masamha CP, Benbrook DM. Cyclin D1 degradation is sufficient to induce G1 cell cycle arrest despite constitutive expression of cyclin E2 in ovarian cancer cells. Cancer Research. 2009;69(16):6565–6572. [DOI] [PubMed] [Google Scholar]
  • 26.Matthews HK, Bertoli C, de Bruin RAM. Cell cycle control in cancer. Nat Rev Mol Cell Biol. 2022;23(1):74–88. [DOI] [PubMed] [Google Scholar]
  • 27.Abukhdeir AM, Park BH. P21 and p27: roles in carcinogenesis and drug resistance. Expert Rev Mol Med. 2008;10:e19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Rai R, Chandra V, Kennedy AL, Zuna RE, Benbrook DM. Distinct mechanism of cervical cancer cell death caused by the investigational new drug SHetA2. Front Oncol. 2022;12:958536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hu C, Yang J, Qi Z, et al. Heat shock proteins: Biological functions, pathological roles, and therapeutic opportunities. MedComm (2020). 2022;3(3):e161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Rezaei F, Namvar A, Akbari E, Heidarnejad F, Bolhassani A. Immunoinformatics studies of heat shock proteins 27 and 70: Development of potent therapeutic vaccine constructs against human papillomavirus-related cancers. Heliyon. 2023;9(8):e19261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Song H, Moseley PL, Lowe SL, Ozbun MA. Inducible heat shock protein 70 enhances HPV31 viral genome replication and virion production during the differentiation-dependent life cycle in human keratinocytes. Virus Res. 2010;147(1):113–122. [DOI] [PubMed] [Google Scholar]
  • 32.Zhang X, Yu W. Heat shock proteins and viral infection. Front Immunol. 2022;13:947789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.van de Putte G, Holm R, Lie AK, Trope CG, Kristensen GB. Expression of p27, p21, and p16 protein in early squamous cervical cancer and its relation to prognosis. Gynecol Oncol. 2003;89(1):140–147. [DOI] [PubMed] [Google Scholar]
  • 34.Li M, Yang J, Liu K, et al. p16 promotes proliferation in cervical carcinoma cells through CDK6-HuR-IL1A axis. J Cancer. 2020;11(6):1457–1467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhu Y, Ren C, Yang L, Zhang X, Liu L, Wang Z. Performance of p16/Ki67 immunostaining, HPV E6/E7 mRNA testing, and HPV DNA assay to detect high-grade cervical dysplasia in women with ASCUS. BMC Cancer. 2019;19(1):271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Izadi-Mood N, Asadi K, Shojaei H, et al. Potential diagnostic value of P16 expression in premalignant and malignant cervical lesions. J Res Med Sci. 2012;17(5):428–433. [PMC free article] [PubMed] [Google Scholar]
  • 37.Zhang CY, Bao W, Wang LH. Downregulation of p16(ink4a) inhibits cell proliferation and induces G1 cell cycle arrest in cervical cancer cells. Int J Mol Med. 2014;33(6):1577–1585. [DOI] [PubMed] [Google Scholar]
  • 38.Huang W, Hickson LJ, Eirin A, Kirkland JL, Lerman LO. Cellular senescence: the good, the bad and the unknown. Nat Rev Nephrol. 2022;18(10):611–627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Masamha CP, Benbrook DM. Cyclin D1 degradation is sufficient to induce G1 cell cycle arrest despite constitutive expression of cyclin E2 in ovarian cancer cells. Cancer Res. 2009;69(16):6565–6572. [DOI] [PubMed] [Google Scholar]
  • 40.Martin LG, Demers GW, Galloway DA. Disruption of the G1/S transition in human papillomavirus type 16 E7-expressing human cells is associated with altered regulation of cyclin E. J Virol. 1998;72(2):975–985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zerfass K, Schulze A, Spitkovsky D, Friedman V, Henglein B, Jansen-Durr P. Sequential activation of cyclin E and cyclin A gene expression by human papillomavirus type 16 E7 through sequences necessary for transformation. J Virol. 1995;69(10):6389–6399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Alao JP. The regulation of cyclin D1 degradation: roles in cancer development and the potential for therapeutic invention. Mol Cancer. 2007;6:24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Mir BA, Ahmad A, Farooq N, et al. Increased expression of HPV-E7 oncoprotein correlates with a reduced level of pRb proteins via high viral load in cervical cancer. Sci Rep. 2023;13(1):15075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sharma A, Benbrook DM, Woo S. Pharmacokinetics and interspecies scaling of a novel, orally-bioavailable anti-cancer drug, SHetA2. PLoS One. 2018;13(4):e0194046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sharma A, Li M, Thavathiru E, et al. Physiologically Based Pharmacokinetic Modeling and Tissue Distribution Characteristics of SHetA2 in Tumor-Bearing Mice. AAPS J. 2020;22(2):51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sharma A, Liu X, Chandra V, Rai R, Benbrook DM, Woo S. Pharmacodynamics of Cyclin D1 Degradation in Ovarian Cancer Xenografts with Repeated Oral SHetA2 Dosing. AAPS J. 2023;26(1):5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Benbrook DM, Guruswamy S, Wang Y, et al. Chemoprevention of colon and small intestinal tumorigenesis in APC(min/+) mice by SHetA2 (NSC721689) without toxicity. Cancer Prev Res (Phila). 2013;6(9):908–916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ramraj SK, Elayapillai SP, Pelikan RC, et al. Novel ovarian cancer maintenance therapy targeted at mortalin and mutant p53. Int J Cancer. 2020;147(4):1086–1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kabirov KK, Kapetanovic IM, Benbrook DM, et al. Oral toxicity and pharmacokinetic studies of SHetA2, a new chemopreventive agent, in rats and dogs. Drug Chem Toxicol. 2013;36(3):284–295. [DOI] [PubMed] [Google Scholar]
  • 50.Mic FA, Molotkov A, Benbrook DM, Duester G. Retinoid activation of retinoic acid receptor but not retinoid X receptor is sufficient to rescue lethal defect in retinoic acid synthesis. Proc Natl Acad Sci U S A. 2003;100(12):7135–7140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Benbrook DM, Kamelle SA, Guruswamy SB, et al. Flexible heteroarotinoids (Flex-Hets) exhibit improved therapeutic ratios as anti-cancer agents over retinoic acid receptor agonists. Invest New Drugs. 2005;23(5):417–428. [DOI] [PubMed] [Google Scholar]
  • 52.Doppalapudi RS, Riccio ES, Davis Z, et al. Genotoxicity of the cancer chemopreventive drug candidates CP-31398, SHetA2, and phospho-ibuprofen. Mutat Res. 2012;746(1):78–88. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supinfo1

Figure S1. Results for an HPV68 positive cell line: ME180. A) Western blot analysis of HPV E6 or E7 protein levels in ME180 cells after 24 hours of SHetA2 treatment at 5 μM. B) A proximity ligation assay was performed to determine interaction between E7 and hsp70 in the ME180 cell line. C) Western blot analysis and immunofluorescent imaging of p16 in the ME180 cell line. For A) and C) T-tests were used to find significance between groups. For B) a one-way ANOVA was used to determine significance.

NIHMS2036868-supplement-Supinfo1.tif (389.3KB, tif)
Supinfo2
NIHMS2036868-supplement-Supinfo2.tif (504.7KB, tif)

RESOURCES